Download handbook (simple version)

CNSA Handbook (simple version in English)

Register/Login

Please use the email or mobile number to register/login on the registration page and fill in the submitter’s information.

Enter the submission portal

Click “Submit” on the CNSA homepage or click “Submission portal” on the homepage navigation bar to enter the Submission portal page.

Submit project

1. Enter the submission process

Click “Project” on the Submission portal page to enter the submission process.

2. Submit project information

Select Data access manner -> fill in the basic information -> fill in the details -> overview -> submit

Notes:

1. The first step in project submission requires the choice of Data access manner. If you choose "Public" or "Controlled", the release date can refer to the date the article will be published, and the recommendation is later than the date the article will be published.
2. The information of the article also can be supplemented after the article is published.
3. After the project is submitted successfully, you can get the CNSA assigned project accession (prefixed with CNP) in “My submission-Project”.

Submit review materials

After the project is successfully submitted, you have completed the submission of the data submission application; if you need to supplement the relevant materials during the compliance review, the data administrator (datasubs@cngb.org) will prompt you to submit the relevant review materials, please pay attention to the email of datasubs@cngb.org. Please note that the material review time is generally 3 working days. After the material review is passed, the data administrator will conduct a project review.

Submit sample

1. Enter the submission process

Click “Sample” on the Submission portal page to enter the submission process.

2. Submit sample information

If you submit only one sample at a time, we recommend that you choose a single submission method. If you submit multiple samples at a time, we recommend that you choose the batch submission method.

（1）Single submission: Select "Submit a single sample" -> select sample type -> fill in sample attributes -> Fields pass check-> overview -> submit

（2）Batch submission: Select "Submit batch samples" -> Select sample type -> Download template -> Upload completed template -> Template pass check -> Submit

Notes:

1. Please select the sample type correctly and you can't modify it by yourself after submitting.
2. The sample name cannot be duplicated.
3. When filling out the batch template file, please view the related description and field comments first. If some required fields are missing, you can fill in 'not collected', 'not applicable' or 'missing'. If the taxonomy ID or scientific name of the organism is unclear, you can enter the single submission process to search and ensure that the information is correct.
4. Collection date supports 4 data formats, YYYY, YYYY-MM, YYYY-MM-DD, YYYY-YYYY.
5. The number of uploaded file lines cannot exceed 2000. If it exceeds 2000, please submit in multiple processes.
6. After the sample is submitted successfully, you can get the sample accession assigned by CNSA (prefixed by CNS) in “My submission-Sample”.

Submit experiment/run

1. Enter the submission process

Click “Experiment/run” on the Submission portal page to enter the submission process.

2. Submit data files and metadata

If you submit only one experiment/run at a time, we recommend that you choose a single submission method. If you submit multiple experiments/runs at a time, we recommend that you choose the batch submission method. 

（1）Single submission: Select submission type (Submit a single experiment/run) -> Fill in basic information -> Fill in metadata -> Metadata pass check -> Submit data files -> Data files pass check -> Overview ->Submit

（2）Batch submission: Select submission type (Submit batch experiments/runs) ->Upload data files->Download metadata template->Upload completed metadata template->Metadata pass check ->Data files pass check -> submit

Notes:

1. It is recommended to upload the data files first. All users can upload data via FTP or mail the hard drive.

   （1）You just finished uploading after the data is uploaded to the FTP personal directory.

   （2）FTP server, username and password can be viewed in the submission process or "My service". Each user has a unique FTP account.

2. When filling out the batch template file, please view the related instructions and field comments first. One line represents a run. If a sample is associated with multiple data files, please submit them in multiple lines to ensure that the experiment information is consistent and the library name is unique. The file name and MD5 value of each data file are unique.
3. The number of metadata file lines cannot exceed 2000. If it exceeds 2000, please submit in multiple processes.
4. After the experiment/run is submitted successfully, you can obtain the accession assigned by CNSA in “My submission- Experiment/run” (Experiment: prefixed with CNX; Run: prefixed with CNR)

Submit assembly

1. Enter the submission process

Click “Assembly” on the Submission portal page to enter the submission process.

2. Submit data files and metadata

If you submit only one assembly at a time, we recommend that you choose a single submission method. If you submit multiple assemblies at a time, we recommend that you choose the batch submission method. 

（1）Single submission: Select submission type (Submit a single assembly) -> Fill in basic information -> Fill in metadata -> Metadata pass check -> Submit data files -> Data files pass check -> Overview ->Submit

（2）Batch submission: Select submission type (Submit batch assemblies)->Upload data files->Download metadata template->Upload completed metadata template->Metadata pass check ->Data files pass check -> submit

Notes:

1. It is recommended to upload the data files first (currently only supports the FASTA format). All users can upload data via FTP or mail the hard disk.

   （1） You just finished uploading after the data is uploaded to the FTP personal directory.

   （2） FTP server, username and password can be viewed in the submission process or "My service". Each user has a unique FTP account.

2. When filling out the batch template file, please view the related instructions and field comments first. One line represents an assembly, ensuring that the assembly name of each assembly is unique, and the file name and MD5 value of each data file are unique.
3. The number of metadata file lines cannot exceed 2000. If it exceeds 2000, please submit in multiple processes.
4. After the assembly is submitted successfully, you can get the CNSA assigned assembly accession (prefixed with CNA) in “My submission-Assembly”.

Submit variation

1. Enter the submission process

Click “Variation” on the Submission portal page to enter the submission process.

2. Submit data files and metadata

（1）Submit SNP: Select variation type (SNP) -> Upload data files to ftp-> Download metadata template -> Upload completed metadata template -> Metadata pass check -> Data files pass check -> Submit

（2）Submit SV: Select variant type (SV) -> Upload data files to ftp (optional) -> Download template -> Upload completed template -> Pass check -> Data files pass check (if submitted) ->Submit

（3）Submit CAHV: Select variation type (CAHV)->Download template->Upload completed template-> Pass check->Submit

Notes:

1. If the selected variation type is SNP, you are advised to first upload the data files (currently only supports VCF format). All users can upload data via FTP or mail the hard disk.

   （1） You just finished uploading after the data is uploaded to the FTP personal directory.

   （2） FTP server, username and password can be viewed in the submission process or "My service". Each user has a unique FTP account.

2. When filling out the batch template file, please view the description and field comments first. If you need to upload VCF files, make sure that the file name and MD5 value of each data file are unique.
3. After the data has been reviewed, you can get the variation accessions (prefixed by varc) assigned by CNSA in “My submission-Variation”.

Submit metabolism

1. Enter the submission process

Click "Metabolism" on the Submission portal page to enter the submission process.

2. Submit data files and metadata

Upload data files-> Download “Descriptions” template -> Upload completed “Descriptions” template -> Add “Assay” ->Download the template of the created “Assay” -> upload the completed “Assay” template ->Metadata pass check -> Data files pass check -> Submit

Notes:

1. You are advised to first upload the data files. All users can upload data via FTP or mail the hard disk.

   （1） You just finished uploading after the data is uploaded to the FTP personal directory.

   （2） FTP server, username and password can be viewed in the submission process or "My service". Each user has a unique FTP account.

2. The "descriptions" information is required, and at least one assay needs to be created. A new assay can be added after the previous assay is uploaded.
3. The number of lines in each sheet of the metadata file cannot exceed 2000. If it exceeds 2000, please submit in multiple processes.
4. When filling out the template file, please view the description and field comments first, and make sure that the file name and MD5 value of each data file are unique.
5. After the data has been reviewed, you can get the metabolism accession (prefixed by METM) assigned by CNSA in “My submission- Metabolism”.

Submit single cell

1. Enter the submission process

Click “Single cell” on the Submission portal page to enter the submission process.

2. Select the associated project accession and fill in the number of cells.

3. Submit data files and metadata

Upload data files-> Download metadata template -> Upload completed metadata template -> Metadata pass check -> Data files pass check -> Submit

Notes:

1. You are advised to first upload the data files. All users can upload data via FTP or mail the hard disk.

   （1） You just finished uploading after the data is uploaded to the FTP personal directory.

   （2） FTP server, username and password can be viewed in the submission process or "My service". Each user has a unique FTP account.

2. The expression matrix file is required, and other file types are optional. If your gene expression files, metadata files, and cluster files need to be grouped, please add the group name to the file name.
3. The number of lines in each sheet of the metadata file cannot exceed 2000. If it exceeds 2000, please submit in multiple processes.
4. When filling out the template file, please view the description and field comments first, and make sure that the file name and MD5 value of each data file are unique.
5. After the data has been reviewed, you can get the metabolism accession (prefixed by CSE) assigned by CNSA in “My submission-Single cell”.

Submit virus sequence

1. Enter the submission process

Click "Virus sequence" on the Submission portal page to enter the submission process.

2. Select the release date of this submission.

3. Submit data files and metadata

Upload data files to ftp-> Download metadata template -> Upload completed metadata template -> Metadata pass check -> Data files pass check -> Submit

Notes:

1. You are advised to first upload the data files (currently only supports FASTA format). All users can upload data via FTP or mail the hard disk.

   （1） You just finished uploading after the data is uploaded to the FTP personal directory.

   （2） FTP server, username and password can be viewed in the submission process or "My service". Each user has a unique FTP account.

2. When filling out the template file, please view the description and field comments first, and make sure that the file name and MD5 value of each data file are unique.
3. After the data has been reviewed, you can get the virus sequence accessions (prefixed by N_) assigned by CNSA in “My submission-Virus sequence”.

Submit sequence

1. Enter the submission process

Click “Sequence” on the Submission portal page to enter the submission process.

2. Select the release date of this submission.

3. Submit data files and metadata

Upload data files-> Download file list template -> Upload completed file list template -> File list pass check -> Data files pass check -> Submit

Notes:

1. You are advised to first upload the data files (currently only supports GBFF format). All users can upload data via FTP or mail the hard disk.

   （1） You just finished uploading after the data is uploaded to the FTP personal directory.

   （2） FTP server, username and password can be viewed in the submission process or "My service". Each user has a unique FTP account.

2. When filling out the template file, please view the description and field comments first, and make sure that the file name and MD5 value of each data file are unique.
3. After the data has been reviewed, you can get the virus sequence accessions (prefixed by N_) assigned by CNSA in “My submission-Sequence”.

Memo

1. Data release

The release date can be set in the “Data Management” in the project submission process. Only the date today or within two years after today can be selected. The data will not be made public until the submitted data is reviewed by the reviewer and reaches the release date set by the user. If the data is about to reach the release date, the system will send a reminder email 15 days in advance.

2. Modify and delete

On the "My Submission" page, you can click the "pencil icon" in the status column to modify. If the status column does not have a "pencil icon" , please send an email to datasubs@cngb.org and indicate the submission ID or data accession and the reason for the modification.

3. Data association

The information of the sample will only be triggered after the experiment/run or assembly is submitted; only after the experiment/run or assembly is reviewed and the data is public, all the information associated with the project can be retrieved according to the project accession. Otherwise, the information of the project and sample can only be retrieved separately, and no association will occur.

4. MD5 check

Please fill in the file name and MD5 value of the uploaded data file, and then click "Check", there are maybe four statuses:

（1）Not uploaded: The data file is not uploaded or being uploaded. If you have uploaded the data file, it still shows "Not uploaded". Please click "Check" later.

（2）Calculating: The data file has been uploaded, but the MD5 value of the file has not been calculated or is being calculated. Please click "Check" later.

（3）MD5 mismatch: The MD5 value calculated by the system is inconsistent with the MD5 value you filled in. If the data file is only uploaded a part and in check, the MD5 value calculated by the system will be inconsistent with the one you filled in. Please click "Check" later. If you click "Check" after a long time (such as half an hour), the status still shows "MD5 mismatch", please recalculate and fill in the MD5 of the data file. If the status still shows "MD5 mismatch", please contact datasubs@cngb.org and indicate the file name in the email.

（4）Check finished: The data file has been uploaded and passed the check.

5. View accessions and submitted metadata

On “My submission” page, you can directly view the accession of a single submission, download the batch-submitted attribute files with accessions in the status column, or click on the completed submission ID to view the details.

6. Contact us

If you have any questions, please contact the administrator at datasubs@cngb.org or 0755-33945586.

Submitter

The submitter submits data on project, sample, experiment, run, assembly and variation to the CNSA. A submitter can submit multiple data types, update and modify data, set Data access manner, etc.

Project

The definition of a set of related data, a 'project' is very flexible and supports the need to define a project using different parameters. For example, Project records can be established for:

Project represents a submission, initiative, or group of data that is logically related in some manner, or is of interest to retrieve as a distinct dataset. A project may be identified in terms of distinctions in the type of data produced.

Data access manner

There are three Data access manner of CNSA: Public, Controlled and Private. The data submitter can choose a Data access manner when submitting a project.

General info

*Project title

Short descriptive name of the project such as a phrase or short sentence for public display.

Project name

A short name for the study.

*Public description

A description (a paragraph) of the study goals and relevance. Provide enough information (more than 100 characters) in the description for other users to interpret the data.

*Relevance

The primary general relevance of the project.

*Relevance description

Describe the relevance when the Other is selected.

*Functional annotation

You are asked if the project will contain functional annotation. If yes, then a unique locus tag prefix will be created.

*Locus tag prefix

The prefix of a locus tag. Locus_tags are identifiers that are systematically applied to every gene in a genome. All components of a project (such as multiple chromosomes or plasmids, etc) should use the same locus_tag prefix.

Format requirements:

（1）It can contain only alpha-numeric characters, and must be at least 3 characters long.

（2）All letters are capitalized，and it should start with a letter, but numerals can be in the 2nd position or later in the string. (eg. A1C).

（3）There should be no symbols, such as -_* in the prefix.

External links

The web sites that are related to this project.

Related projects

The projects that are related to this project.

Grants

The funding sources of this project.

Consortium

If project is carried out as part of a consortium, please provide the related consortium information.

Data providers

Indicate the data provider (data submitter) if it is someone other than the submitting organization or consortium.

Detailed information

Project type

*Project data type

A general label indicating the primary study goal. Select appropriate types.

* Project data type description

Describe the project data type when the Other is selected.

*Sample scope

The scope and purity of the biological sample used for the study.

1. Choose “Multiisolate” as the Scope when the goal of the research is to compare multiple individuals or strains of the same species, eg, in a Variation or Genome sequencing and assembly project.
2. Choose “Multispecies” when different species are being examined.
3. Choose “Monoisolate” if the goal is to make a single genome or transcriptome assembly, even if more than one individual was the source of the DNA or RNA.

* Target description

Describe the target description when the Other is selected.

Publications

Sample

Description of biological source material; each physically unique specimen should be registered as a single Sample with a unique set of attributes.

General information

Submission type

Sample type

In preparing your submission, please refer to this attributes list and Sample examples and fill in the relevant fields. Select the package that best describes your samples

Sample attributes

A major component of a Sample record is the sample attributes section. Attributes define the material under investigation and can include sample characteristics such as cell type, collection site and phenotypic information like disease state.

Sample attributes are captured as structured name: value pairs, for example, tissue: liver. The first targeted dictionaries implemented in the Sample submission are the MIxS minimum information checklists for standardizing descriptions of genomes, metagenomes and targeted locus sequences as developed by the Genomics Standards Consortium.

Experiment

A description of sample-specific sequencing library, instrument and sequencing methods. An Experiment references 1 Project and 1 Sample.

General information

Submission type

*Project accession

Select the project this experiment affiliates.

*Sample accession

Select the sample this experiment uses.

Metadata

Experiment reuse

Reuse information of experiment that has already been submitted. The existing experiment information will be automatically populated into cells so that users can quickly submit.

*Data files type

The format of sequencing data files.

General information

* Platform

The sequencing platform and instrument model.

* Title

Short text that can be used to call out experiment records in searches or in displays.

Library

* Library name

Provide a name for your library if you have any.

* Strategy

The library strategy specifies the sequencing technique intended for this library.

* Source

The library source specifies the type of source material that is being sequenced.

* Selection

The library selection specifies whether any method was used to select for or against, enrich, or screen the material being sequenced.

* Layout

The library layout specifies whether to expect single, paired of reads.

Design description

The goal and setup of the individual library.

Data files

*File name

The name of a sequence data file.

*MD5 value

MD5 checksum of a sequence data file.

Status

The status of file uploaded to FTP servers.

Assembly

An assembly is a collection of genomic sequences that are used to represent the genome of an organism.

General information

Submission type

*Project accession

Select the project this assembly affiliates.

*Sample accession

Select the sample this assembly uses.

Metadata

Assembly metadata

Assembly method

Data files

*File type

The assembly data file format.

*File name

The name of an assembly data file.

*MD5 value

MD5 checksum of an assembly data file.

Status

The status of file uploaded to FTP servers.

Variation

CNSA accepts genomic variations from any species, including single nucleotide polymorphisms, short insertions/deletions and genomic structural variations, etc., and provides long-term stable archive accessions and data. The variation data includes Analysis, Samplesets, Subject, Call, File and Region.

Submission template

There are three templates for submission of variations.

SNP_submission_template.v1.1.xlsx  is for the submission of simple and small-scale genomic variations <= 50 bp, such as single nucleotide polymorphisms (SNP), short insertions and deletions (INDEL), microsatellites, etc., which includes four parts: Analysis, Samplesets, Subject, File, and they are all required.

SV_submission_template.v1.1.xlsx is for the submission of complex and large-scale genomic structural variations (SV) >50bp, such as insertions, deletions, duplications, inversions, translocations, mobile elements, etc., which includes six parts: Analysis, Samplesets, Subject, Call, Region, File. The information of Analysis, Sampleset, Subject are required, at least one of Call and File is required. The Region is optional.

CAHV_Submission_template.v1.0.xlsx  is for the submission of Clinically Associated Human Variations (CAHV)，including genomic variations and related phenotypes and clinical significance, etc., which includes four parts: Analysis, Samplesets, Subject, Call, and they are all required.

Metabolism

Metabolomics data, including metadata such as protocols, assays, samples, and raw data files for metabolomics study.

Metabolic metadata includes descriptions and assays:

"Descriptions" is a description of the research designs, factors, factors and samples, etc.

"Assay" is a description of the research metabolites and instrument parameters, etc.

Submission template

The submission of metabolic metadata contains four templates:

Template_Metabolism_Descriptions_MS_NMR.xlsx is used to submit the description information for metabolism.

Template_Metabolism_Assay_GC-MS.xlsx is used to submit assay information using gas chromatography-mass spectrometry (GC_MS) technology.

Template_Metabolism_Assay_LC-MS.xlsx is used to submit assay information using liquid chromatography-mass spectrometry (LC-MS) technology.

Template_Metabolism_Assay_NMR.xlsx is used to submit assay information using nuclear magnetic resonance (NMR) technology.

Single cell

Analysis results of data generated using single cell technology.

Single cell metadata mainly includes description information of gene expression files, metadata files, cluster files and other files.

Submission template

Template_Single_Cell.xlsx

Virus sequence

Viral sequence data, including assembled or non-assembled virus sequences.

Virus sequence metadata mainly includes sequence information and related sample information, experiment information, submission lab, etc.

Submission template

Template_Virus_Sequence.xlsx

Sequence

Sequence data other than the genome assembly sequences of the species, including sequence data of ribosomal RNA (rRNA), rRNA-ITS, metazoan COX1, mRNA, genomic DNA, organelle, ncRNA, plasmids, phages, synthetic constructs, etc.

For specific field information of sequence metadata, please refer to CNSA_Sequence_Submission_Instructions.docx.

Submission template

Templete_Sequence_File_List.xlsx is used to submit a list of data files.

Template_sequence_v1.0.gb is used to submit metadata and sequences.

Run

CNSA receives six types of Data file format, including FASTQ, BAM, SFF, PacBio_HDF and CRAM.

FASTQ format

We recommend FASTQ format. Single and paired reads are accepted. Please note that all files must not be compressed into one file for upload. All file names in your account folder must be unique.

• Quality scores must be in Phred scale.
• Both ASCII and space delimitered decimal encoding of quality scores are supported. We will automatically detect the Phred quality offset of either 33 or 64.
• No technical reads (adapters, linkers, barcodes) are allowed.
• Single reads must be submitted using a single Fastq file and can be submitted with or without read names.
• Paired reads must split and submitted using two Fastq files. The read names must have a suffix identifying the first and second read from the pair, for example '/1' and '/2' (regular expression for the reads: "^@([a-zA-Z0-9_-]+:[0-9]+:[a-zA-Z0-9]+:[0-9]+:[0-9]+:[0-9-]+:[0-9-]+) ([12]):[YN]:[0-9]*[02468]:[ACGTN]+$").
• The first line for each read must start with '@'.
• The base calls and quality scores must be separated by a line starting with '+'.
• The Fastq files must be compressed using gzip or bzip2.
• The regular expression for bases is "^([ACGTNactgn.]*?)$"
• Example of FASTQ file containing single reads:
  @read_name
  GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
  +
  !''*((((***+))%++)(%).1***-+*''))**55CCF>>>>>>CCCCCCC65
  ...
• file containing paired reads:
  @read_name/1
  GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
  +
  !''*((((***+))%++)(%).1***-+*''))**55CCF>>>>>>CCCCCCC65
  @read_name/2
  GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
  +
  !''*((((***+))%++)(%).1***-+*''))**55CCF>>>>>>CCCCCCC65
  ...

BAM file

Submitted BAM files must be readable with Samtools.

BAM file names are required to end up with the .bam suffix.

All files must not be compressed into one file for upload.

All file names in your account folder must be unique.

SFF format

The SFF format is supported for the 454 and Ion Torrent platforms.

SFF file names are required to end up with the .sff suffix.

All files must not be compressed into one file for upload.

All file names in your account folder must be unique.

PacBio_HFD5 format

PacBio_HFD5 data submissions are supported in the platform specific native format.

One run consists of *.bax.h5, *.bas.h5 and xml. These files should be tarred and compressed.

PacBio_HFD5 data must be submitted as a single tar.gz or tar.bz file.

All files must not be compressed into one file for upload.

All file names in your account folder must be unique.

CRAM format

CRAM is a sequencing read file format that is highly space efficient by using reference-based compression of sequence data and offers both lossless and lossy modes of compression. Please refer to CRAMv3.0 for the specific format.

CRAM file names are required to end up with the .cram suffix.

All files must not be compressed into one file for upload.

All file names in your account folder must be unique.

Assembly

Genome assembly submissions include plasmids, organelles, complete virus genomes, viral segments/replicons, bacteriophages, prokaryotic and eukaryotic genomes. Chromosomes include organelles (e.g. mitochondrion and chloroplast), plasmids and viral segments.

Sequences should be submitted as a Fasta file. These sequences can be either contig, scaffold or chromosome sequences.

The submitted fasta file must be gz compressed and should specify the classification (contig, scaffold or chromosome) in the file name.

All file names in your account folder must be unique. All files must not be compressed into one file for upload.

Fasta format

format：

The sequence name is extracted from the header line starting with >.
For example, the following sequence has name contig1:

Variation

CNSA currently only accepts variation data in VCF format. Please note that your variation data needs to be converted to VCF file format. To ensure that the format of VCF file is correct, you are advised to refer to VCFv4.3.

VCF file

VCF is a text file format (most likely stored in a compressed manner). It contains meta-information lines (prefixed with “##”), a header line (prefixed with “#”), and data lines each containing information about a position in the genome and genotype information on samples for each position (text fields separated by tabs). Zero length fields are not allowed, a dot (“.”) must be used instead. In order to ensure interoperability across platforms, VCF compliant implementations must support both LF (\n) and CR+LF (\r\n) newline conventions.

For example:

Metabolism

CNSA accepts various metabolic data file formats, such as RAW, ZIP, JDX, CDF, WIFF, JCAMP, TXT, etc.

Single cell

The single cell data files accepted by CNSA include Gene expression file, Metadata file, Cluster file and Other files.

1. Gene expression file

Gene expression scores can be represented either as an "Expression matrix" or "MM coordinate matrix".

(1) Expression matrix

genecell_1cell_2cell_3...

Trp53000...

Apoe05.0980...

Tlr4000...

Lep000.123...

Il61.23400...

...

An Expression matrix file is a dense matrix file that has a header row containing the value "gene", and single cell names. The filename suffix can be .txt, .txt.gz, .tsv, .tsv.gz, .csv, csv.gz.

(2) MM coordinate matrix

%%MatrixMarketmatrixcoordinaterealgeneral

%

1234532456234567

1561

1122

...

An MM coordinate matrix file is a Matrix Market file that contains a sparse matrix in coordinate form. The filename suffix can be .mtx, .mtx.gz, .mm, .mm.gz, .txt, .txt.gz. Please note that MM coordinate matrix file must be sorted before upload, and you need to upload the Genes file and Barcodes file separately. The filename suffix can be .csv,.csv.gz, .tsv, .tsv.gz. A Genes file contains all annotated genes. Each gene is represented in each row. The first column is the gene id while the second column is the gene name. A Barcodes file contains the barcodes represented in the MM coordinate matrix file.

• The top three lines of MM coordinate matrix file are header lines.
• The third line contains the total number of rows in all the three files (Genes file, Barcodes file, MM coordinate matrix file).
• The next lines (line number 4 onwards) have three columns:

The first column refers to the "gene id" index. The "gene id" indices correspond to the entries in the Genes file.

The second column refers to "cell id" index. The "cell id" indices correspond to the entries in the Barcodes file.

The third column represents the total Unique Molecular Identifiers (UMI) count per cell and gene combination.

The index in the MM coordinate matrix file is 1-based.

2. Metadata file

nameclustersub_clusteraverage_intensitysample_nameexperiment_accession

typegroupgroupnumericsample_attributeexperiment_attribute

cell_1clst_Aclst_A_16.687sample1CNXxxxxxx

cell_2clst_Aclst_A_1-12.625sample1CNXxxxxxx

...

A Metadata file is a tab-delimited text file containing cell-level annotations. The filename suffix can be .txt or.txt.gz.

• A metadata file has at least 2 columns.
• A header row containing the value "name" and column names for cluster-level annotations.
• A second row with:

The header of "type" to declare metadata types (see below).

A value for each metadata column declaring its datatype

"group" (set membership) values are treated as literal strings.

"numeric" (continuous scores) values are treated as floating-point numbers.

"Sample_name" (sample name) is a sample name you submitted in CNSA, required.

"experiment_accession" (experiment accession) is an experiment accession you submitted in CNSA, optional.

3. Cluster file

nameXYZcategoryintensity

typenumericnumericnumericgroupnumeric

cell_134.47232.21160.035C0.719

cell_215.97510.04321.424B0.904

...

A Cluster file contains any cluster ordinations and optional cluster-specific metadata. The filename suffix can be .txt or.txt.gz.

（1）A cluster file has at least 3 columns.

（2）A header row containing the value "name", "X", "Y", optionally "Z", and columns containing cell-level annotations

（3）A second row with:

The header of "type" to declare metadata types (see below).

A value for each metadata column declaring its datatype

"group" (set membership) values are treated as literal strings.

"numeric" (continuous scores) values are treated as floating-point numbers.

The values for the "X", "Y", and "Z" columns must be set to "numeric".

4. Other files

Any documentation or other support filles you have.

Virus sequence

CNSA currently accepts virus data files in FASTA format.

The file extensions can be: .fa.gz, .fa.bz2, .fasta.gz, .fasta.bz2, .fasta, .fa.

Sequence

CNSA currently accepts sequence data in GenBank Flat File Format (GBFF). Please do not change the sequence file format at will, otherwise the format check will fail. For the specific format, please refer to the sequence template and sequence submission instructions.

If a sample has multiple sequences, please put all the sequences of the sample in a file, and a single file allows up to 10,000 sequences.

Notes

（1）Please read the "Data Submission Guide" carefully before submitting the data.

（2）CNSA currently accepts online submissions of projects, samples, experiments/runs, assemblies, and variations.

（3）Before submitting data, you need to register/login and fill in the submitter information.

（4）The project and sample must be submitted prior to submitting the experiment/run, assembly, and variation.

（5）The sample can be submitted independently, but the sample is only associated with the project after the relevant data has been submitted.

（6）In the data submission process, fields with * are required, and other are optional.

（7）If you need to submit data files, in order to complete the data submission process more quickly, it is recommended to submit the data files before submitting the metadata.

（8）After the data submission is completed, the system will automatically jump to the corresponding data type under “My submission” after 10 seconds.

Signup /Login

Users can enter the homepage of CNSA (Fig. 1) through the website (http://db.cngb.org/cnsa). Click the tab of “ Login/Signup” on the right side of the page to enter the Login/Signup page (Fig. 2). (Note: You need to register before you can login and submit the data.)

Fig. 1 CNSA homepage

Fig. 2 Login/Signup page

Submitter information

CNSA will obtain partial submitter information from the user's account information. The submitter's information filled out by the user is bound to the submitted project, sample, experiment/run, assembly, and variation data. When submitting the data, if the submitter information is not filled out, the system will jump to the CNSA homepage and ask the submitter to add the information; if the submitter information is completed, the system will automatically skip the page and enter the submission page. If the user needs to change the submitter information, click "My CNGBdb" in the home navigation to select "Submit" in the drop-down option, and go to the CNSA homepage (Figure 3) to modify. The modified submitter information will be bound to the data being submitted or submitted in the future.

Fig. 3 Submitter page

Submission portal

Projects, samples, experiments/runs, assemblies, and variations can be submitted through their respective submission portal. Please click "Submit" on the home page or "Submit portal" in the navigation bar to enter the Submission portal page (Fig. 4), and then click the submission portal for the corresponding data type to submit the data. You can also enter the corresponding submission process by clicking the "New submission" button under each data type in “My submission”.

Fig. 4 Submission portal page

Submit project

1. Project submission portal

   Click on "Project" (Fig. 5) on the Submission portal page to enter the submission process.

   

   Fig. 5 Project submission portal

2. Data management

   On the data management page (Fig. 6), you need to choose a Data access manner. If you choose “Public” or “Controlled”, you need to set a release date. Then click "Save and continue" to proceed to the next step.

   Note:

   （1）When selecting the Data access manner, you need to carefully read the prompt information under the option. After submitting, you cannot change it yourself. If you need to make changes, please send an email to datasubs@cngb.org with the project accession and the reason for the change. If you need to change the controlled data to public, please send an email to “cngb-ebb@cngb.org” to apply and prepare the corresponding review materials.

   （2）If you need to change the release date, click “My submission”, find the submission under the project, and click the "pencil icon" in the release date column to edit it.

   

   Fig. 6 Data management

3. General information

   On the general information page (Fig. 7), fill in the information of the Project title, Relevance, Public description, External links, Related projects, etc., and then click "Save and Continue" to proceed to the next step.

   

   Fig. 7 General information

4. Detailed information

   On the detailed information page (Fig. 8), select the project type (you can choose more than one) and sample scope. The literature information is optional. Then click "Save and Continue" to proceed to the next step. If your article has not been published yet, you can click on “My submission” in the navigation bar after the article is published, find the corresponding submission ID, click on the "pencil icon" in the status column to enter the modification process, and supplement the relevant information of the article.If the status column does not have a "pencil icon", please contact datasubs@cngb.org, and indicate the project accession in the email.

   

   Fig. 8 Detailed information

5. Overview

   The overview page (Fig.9) summarizes the information filled in the previous steps. If you find any errors, please click “Previous” to go to any of the previous pages to make the corresponding changes. If the check is correct, please click “Submit”. During the process of filling in the entire project information, the system will retain the last filling result.

   

   Fig. 9 Overview

6. My submission-Project

   After the project is submitted, the system will automatically assign a project accession (CNPXXXXXXX) and jump to "My submissions – Project" after 10 seconds, you can view the project accession on this page (Fig. 10).

   

   Fig. 10 My submission-Project

Submit sample

Sample submission portal

Click on "Sample" (Figure 11) on the Submission portal page to enter the submission process.

Fig. 11 Sample submission portal

Submission type

Select a submission type (Fig. 12). If you submit multiple samples at a time, we recommend that you choose the batch submission, which is more convenient and faster than a single submission. You will need to download the batch submission template for the samples first in the submission process, then fill it out and upload it. If you submit only one sample at a time, we recommend that you choose a single submission. You need to fill out the sample information online in the submission process.

Fig. 12 Submission type

1. Submit batch samples

   （1）Select a sample type (Fig. 13). First select a large class from the drop-down list in the left input box and select a small class in the drop-down list in the right input box. Please carefully select the sample type. Once the process is submitted, you cannot modify it yourself. If you need to modify it, please send an email to datasubs@cngb.org with the submission ID and the reason for the modification.

   （2）Download the batch submission template of samples, fill it out and upload it (Fig. 13). Each sample cannot be duplicated with other submitted samples. Please add or modify other field attributes other than the three fields "sample_name, sample_title, description" (optional field attributes can be added) to distinguish the samples you submitted.

   

   Fig. 13 Submit batch samples

   （3）If it fails the check, modify it according to the check rule and error line number prompted by the bullet box (Fig. 14), and then upload again.

   

   Fig. 14 Check result

   （4）After the check passed, click “Submit”, the system will automatically assign the sample accessions (CNSXXXXXXX) and jump to “My submission-Sample” after 10 seconds. The metadata file with accessions can be downloaded in the status column of this page (Fig. 15).

   

   Fig. 15 My submission-Sample

2. Submit a single sample

   （1）Sample type

   On the sample type page (Fig. 16), please carefully select the sample type, then click “Save and continue” to proceed to the next step. Once the process is submitted, you cannot modify it yourself. If you need to modify it, please send an email to datasubs@cngb.org with the submission ID and the reason for the modification.

   

   Fig. 16 Sample type

   （2）Sample attributes

   On the sample attributes page (Fig. 17), different sample types require different attributes, then click "Save and continue". If some fields do not pass the check, please modify it according to the prompt information, then click "Save and continue" to proceed to the next step.

   

   Fig. 17 Sample attributes

   （3）Overview

   This page (Fig. 18) summarizes the information filled in the previous steps. If you find any errors, please click “Previous” to go to any of the previous pages to make the corresponding changes. In the entire submission process, the system will retain the last saved result when you quit the system. If the check is correct, please click “Submit”.

   

   Fig. 18 Overview

   （4）My submission-Sample

   After the sample is submitted, the system will automatically assign a sample accession such as CNSXXXXXXX and jump to “My submission – Sample”. The sample accession can be viewed in in the status column of that page (Fig. 19).

   

   Fig. 19 My submission-Sample

Submit experiment/run

You need to submit the metadata and data files for the experiment/run. Before submitting the experiment/run data, please create the project and sample first.

Experiment/run submission portal

Click on " Experiment/run " (Figure 20) on the Submission portal page to enter the submission process.

Fig. 20 Experiment/run submission portal

Submission type

Select a submission type (Fig. 21). If you submit multiple experiments/runs at a time, we recommend that you choose the batch submission method, which is more convenient and faster than a single submission. You will need to download the batch submission template for the experiments/runs metadata first in the submission process, then fill it out and upload it. If you submit only one experiment/run(s) at a time, we recommend that you choose a single submission method. You need to fill out the experiment/run(s) metadata online in the submission process.

Fig. 21 Submission type

1. Submit batch experiments/runs

   （1）Upload data files according to the data upload method.

   （2）Download the batch submission template of experiments/runs, fill it out and upload it (Fig. 22). If it fails the check, modify it according to the check rule and error line number prompted by the bullet box, and then upload again. After the metadata pass the check, the system will check the MD5 values of data files. If there are files that have not passed the check, please handle it according to the prompt information of the bullet box (Fig. 23).

   

   Fig. 22 Submit batch experiments/runs

   

   Fig. 23 Check result

   （3） When the status of the data file is "Check finished", click “Submit”, the system will automatically assign the accessions of experiments/runs (CNXXXXXXXX/CNRXXXXXXX) and jump to “My submission- Experiment/run” after 10 seconds. The metadata file with accessions can be downloaded in the status column of this page (Fig. 24).

   

   Fig. 24 My submission- Experiment/run

2. Submit a single experiment/run(s)

   （1）General information

   One the general information page (Fig. 25), select the project accession and sample accession associated with the experiment/run(s) in the drop-down list, then click “Save and continue” to proceed to the next step. If you have not submitted the project and sample, create a new project and sample.

   

   Fig. 25 General information

   （2）Metadata

   On the metadata page (Figure 26), you can select a submitted experiment accession in the experiment reuse section, the system will automatically fill in the experiment information. The copied experiment information can be modified to help users to fill in quickly. If you do not reuse the experiment information, you need to fill in the experiment information, then click "Save and continue". If some fields do not pass the check, please modify it according to the prompt information, then click "Save and continue" to proceed to the next step.

   

   Fig. 26 Metadata

   （3）Data files

   On the data files page (Fig. 27), please upload the data file according to the data upload method, and fill in the file name and MD5 value of the data file in the input box of the “Data files” section, then click "Check". If the input box turns red, modify it according to the error message in the question mark, and then click "Check". If the status of the data file is “Not uploaded, Calculating or MD5 mismatch”, please handle it according to the prompt information in this part of the page. If the status of the data file is "Check finished ", click "Save and continue" to proceed to the next step.

   

   Fig. 27 Data files

   （4）Overview

   This overview page (Fig. 28) summarizes the information filled in the previous steps. If you find any errors, please click “Previous” to go to any of the previous pages to make the corresponding changes. In the entire submission process, the system will retain the last saved result when you quit the system. If the check is correct, please click “Submit”.

   

   Fig. 28 Overview

   （5） My submission- Experiment/run

   After the experiment/run is submitted, the system will automatically assign the accession of experiment/run (CNXXXXXXXX/CNRXXXXXXX) and jump to “My submission- Experiment/run” after 10 seconds. The experiment accession can be viewed in in the status column of that page (Fig. 29). The run accession can be viewed by clicking on the submission ID.

   

   Fig. 29 My submission- Experiment/run

Submit assembly

You need to submit the metadata and data files for the assembly. Before submitting the assembly data, please create the project and sample first.

Assembly submission portal

Click on " Assembly " (Figure 30) on the Submission portal page to enter the submission process.

Fig. 30 Assembly submission portal

Submission type

Select a submission type (Fig. 31). If you submit multiple assemblies at a time, we recommend that you choose the batch submission method, which is more convenient and faster than a single submission. You will need to download the batch submission template for the assemblies’ metadata first in the submission process, then fill it out and upload it. If you submit only one assembly at a time, we recommend that you choose a single submission method. You need to fill out the assembly metadata online in the submission process.

Fig. 31 Submission type

1. Submit batch assemblies

   （1）Upload data files according to the data upload method (Fig. 32).

   （2）Download the batch submission template of assemblies, fill it out and upload it (Fig. 32). If it fails the check, modify it according to the check rule and error line number prompted by the bullet box (Fig. 33), and then upload again. After the metadata pass the check, the system will check the MD5 values of data files. If there are files that have not passed the check, please handle it according to the prompt information of the bullet box.

   

   Fig. 32 Submit batch assemblies

   

   Fig. 33 Check result

   （3）When the status of the data file is "Check finished", click “Submit”, the system will automatically assign the accessions of assemblies (CNAXXXXXXX) and jump to “My submission-Assembly” after 10 seconds. The metadata file with accessions can be downloaded in the status column of this page (Fig. 34).

   

   Fig. 34 My submission-Assembly

2. Submit a single assembly

   （1）General information

   Select the project accession and sample accession associated with the assembly in the drop-down list (Fig. 35), then click “Save and continue” to proceed to the next step. If you have not submitted the project and sample, create a new project and sample.

   

   Fig. 35 General information

   （2）Metadata

   On the metadata page (Figure 36), you need to fill in the metadata of assembly, then click "Save and continue". If some fields do not pass the check, please modify it according to the prompt information, then click "Save and continue" to proceed to the next step.

   

   Fig. 36 Metadata

   （3）Data files

   On the data files page (Fig. 37), please upload the data file according to the data upload method, and fill in the file name and MD5 value of the data file in the input box of the “Data files” section, then click "Check". If there is a field that has not passed the check, please modify it according to the error prompt under the field, and then click "Check". If the status of the data file is “Not uploaded, Calculating or MD5 mismatch”, please handle it according to the prompt information in this part of the page. If the status of the data file is "Check finished ", click "Save and continue" to proceed to the next step.

   

   Fig. 37 Data files

   （4）Overview

   The overview page (Fig. 38) summarizes the information filled in the previous steps. If you find any errors, please click “Previous” to go to any of the previous pages to make the corresponding changes. In the entire submission process, the system will retain the last saved result when you quit the system. If the check is correct, please click “Submit”.

   

   Fig. 38 Overview

   （5）My submission-Assembly

   After the assembly is submitted, the system will automatically assign the assembly accession (CNAXXXXXXX) and jump to “My submission-Assembly” after 10 seconds. The assembly accession can be viewed in in the status column of that page (Fig. 39).

   

   Fig. 39 My submission-Assembly

Submit variation

Before submitting the variation data, please create the project and sample first, and the experiment/run data is optional.

Variation submission portal

Click on " Variation " (Figure 40) on the Submission portal page to enter the submission process.

Fig. 40 Variation submission portal

Submit variation data

1. Select a variant type (Fig. 41).

   

   Fig. 41 Variation type

2. Upload the VCF file of variations.

   （1）If you choose SNP, you need to upload the VCF file to FTP, then download the SNP submission template, fill it out and upload it (Fig. 42).

   

   Fig. 42 Submit SNP

   （2）If you choose SV, you need to download the SV submission template, fill it out and upload it. VCF files can be optionally submitted (Fig. 43).

   

   Fig. 43 Submit SV

   （3）If you choose CAHV, you only need to need to download the CAHV submission template and fill it out and upload it (Fig. 44).

   

   Fig. 44 Submit CAHV

3. After the template file is filled in and uploaded, the system will check each sheet in the template in turn. If the field fails to pass the check, modify it according to the check rules and the error line numbers in the bullet box (Fig. 45), then re-upload and click "check".

   

   Fig. 45 Check result

4. If the check is passed, click “Submit”, the system will jump to “My submission-Variation” after 10 seconds. After the data pass the review, the submitted file with accessions can be downloaded in the status column of this page (Fig. 46).

   

   Fig. 46 My submission-Variation

Submit metabolism

Before submitting the metabolic data, please create the project and sample first.

Metabolism submission portal

Click on "Metabolism" (Figure 47) on the Submission portal page to enter the submission process.

Fig. 47 Metabolism submission portal

Submit metabolic data files and metadata

1. Check the data file format requirements first, and then upload the data files (Figure 48).

   

   Fig. 48 Submit metabolic data files

2. Metabolic metadata includes descriptions and assays. The descriptions must be submitted, and the assay can be added after the descriptions is uploaded. A new assay can be added after the previous assay is uploaded. Please download the descriptions template first, fill it in and upload it (Figure 49).

   

   Fig. 49 Submit metabolic metadata

3. The system will check each sheet in the submitted file in turn. If the field check fails, please modify it according to the check rules and the error line number prompted by the pop-up box, and then upload it again (Figure 50).

   

   Fig. 50 Check results of descriptions

4. Click "Add assay" to create an assay (Figure 51). The system will provide the corresponding assay template according to your choice. Please download the template, fill in and upload it. If the field check fails, please modify it according to the check rules and error line number prompted by the pop-up box, and then upload again.

   

   Fig. 51 Add assay

5. After the metadata check is passed, the system will check the MD5 value of the data files. You can check the status of the data files in the “Data files status” module (Figure 52). If there is a file that has not passed the check, click "View" and deal with it according to the prompt information in the pop-up box.

   

   Fig. 52 Data files status

6. When the “Data files status” is "Check finished", please click "Submit", the system will automatically assign a metabolism accession (METMXXXXXXX), and after 10 seconds, it will jump to "My submission-Metabolism". You can view the metabolism accession and download the metadata file in the “Metadata status” column of this page (Figure 53).

   

   Fig. 53 My submission-Metabolism

Submit single cell

Before submitting the single cell data, please create the project and sample first.

Single cell submission portal

Click on "Single cell" (Figure 54) on the Submission portal page to enter the submission process.

Fig. 54 Single cell submission portal

Associated project

Fill in the project accession and cell number associated with the data (Figure 55).

Fig. 55 Associated project

Submit single cell data files and metadata

1. First upload the data files according to the data file format requirements and data upload options (Figure 56). Note: Gene expression files are required, other types of files are optional. If your gene expression files, metadata files, and cluster files need to be grouped, please add the group name to the file name.

   

   Fig. 56 Submit single cell data files

2. Download the single cell metadata submission template, fill it in and upload it (Figure 57).

   

   Fig. 57 Submit single cell metadata

3. The system will check each sheet in the submitted file in turn. If the field check fails, please modify it according to the check rules and the error line number prompted by the pop-up box (Figure 58), and then upload it again.

   

   Fig. 58 Check results of single cell metadata

4. After the metadata check is passed, the system will check the MD5 value of the data files. You can check the status of the data files in the “Data files status” module (Figure 59). If there is a file that has not passed the check, click "View" and deal with it according to the prompt information in the pop-up box.

   

   Fig. 59 Data files status

5. When the “Data files status” is "Check finished", please click "Submit", the system will automatically assign a single cell accession (CSEXXXXXXX), and after 10 seconds, it will jump to "My submission-Single cell". You can view the single cell accession and download the metadata file in the “Metadata status” column of this page (Figure 60).

   

   Fig. 60 My submission-single cell

Submit virus sequence

Before submitting the virus sequence data, please create the project, the sample is optional.

Virus sequence submission portal

Click on "Virus sequence" on the submission portal page (Figure 61), or click "Submit data" on the Virus Data Integration Platform (VirusDIP) (Figure 62) to enter the submission process.

Fig. 61 Submission portal-Virus sequence portal

Fig, 62 VirusDIP- Virus sequence portal

Select a release date

Please select the release date of the virus sequence data submitted this time (Figure 63). Note that the release date of this data must be later than the release date of the associated project. Otherwise, the release date is invalid, and the system will release this data on the project’s release date. If you need to release this data in advance, please adjust the release date of the project.

Fig. 63 Release date of virus data

Submit virus data files and metadata

1. Upload the sequence data file in FASTA format to FTP according to the data file format requirements and data upload method (Figure 64).

   

   Fig. 64 Submit virus data files

2. Download the virus metadata submission template, fill it in and upload it (Figure 65).

   

   Fig. 65 Submit virus metadata

3. The system will check the submitted file. If the field check fails, please modify it according to the check rules and the error line number prompted by the pop-up box (Figure 66), and then upload it again.

   

   Fig. 66 Check results of virus metadata

4. After the metadata check is passed, the system will check the MD5 value of the data files. You can check the status of the data files in the “Data files status” module (Figure 67). If there is a file that has not passed the check, click "View" and deal with it according to the prompt information in the pop-up box.

   

   Fig. 67 Data files status

5. When the “Data files status” is "Check finished", please click "Submit", the system will automatically assign an accession to each virus sequence (for example, N_AAADBH010000000), and after 10 seconds, it will jump to "My submission-Virus sequence". You can download the metadata file with accessions in the “Metadata status” column of this page (Figure 68).

   

   Fig. 68 My submission-Virus sequence

Submit sequence

Before submitting the sequence data, please create the project, the sample is optional. Note, please submit the genome data of the species through the "Assembly" portal, and the viral sequence data through the "Virus sequence" portal.

Sequence submission portal

Click on "Sequence" on the submission portal page (Figure 69) to enter the submission process.

Fig. 69 Sequence portal

Submit sequence data files and file list

1. Upload the sequence data files according to the data file format requirements and data upload method (Figure 70)

   

   Fig. 70 Submit sequence data files

2. Download the submission template of the sequence data file list, fill it in and upload it (Figure 71).

   

   Fig. 71 Submit sequence file list

3. The system will check the submitted file. If the field check fails, please modify it according to the check rules and the error line number prompted by the pop-up box (Figure 72), and then upload it again.

   

   Fig. 72 Check results of the file list

4. After the file list check is passed, the system will check the MD5 value of the data files. You can check the status of the data files in the “Data files status” module (Figure 72). If there is a file that has not passed the check, click "View" and deal with it according to the prompt information in the pop-up box.

   

   Fig. 73 Data file status-MD5 check

5. After the MD5 check is passed, the system will check the sequence format. Please make sure that the format of the sequence you submit is GenBank Flat File Format (GBFF). If there is a file that has not passed the format check, please click "View" and modify the sequence file with the wrong format as prompted by the pop-up box (Figure 74), then upload it again, and the system will check it again.

   

   Fig. 74 Data file status-Sequence format check

6. When the “Data files status” is "Check finished", please click "Submit", the system will automatically assign an accession to each sequence (for example, N_000001234), and after 10 seconds, it will jump to "My submission-Sequence". You can download the file list with accessions in the “Metadata status” column of this page (Figure 75). If the submission has just been completed and the "Download file list with accessions" does not appear in the "Status" column of the submission, it means that the system is assigning sequence accessions. Please refresh the page.

   

   Fig. 75 My submission-Sequence