Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/o... more Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucia...
Ecdysteroid and sequiterpenoids juvenile hormones play a gonadotrophic role in the insect adult f... more Ecdysteroid and sequiterpenoids juvenile hormones play a gonadotrophic role in the insect adult female vitellogenesis. The molecular basis of hormone action has been analyzed in great detail in flies and moths, but rarely in primitive insect orders. The primitive hemimetabolous insect Periplaneta americana was used, as a model, to isolate and characterize, for the first time, two cDNAs of RXR/USP, a component of the heterodimeric ecdysone receptor. These two cDNAs correspond to two isoforms, named PamRXR-S (short form) and PamRXR-L (long form). Both are identical except for 25 amino acids deletion/insertion located in the loop between helices H1 and H3 of the ligand-binding domain. The two isoforms are differentially expressed in different tissues as revealed by RT-PCR and northern blot analysis. In fat body, brain, ovary, and muscle tissues, the predominant form was PamRXR-S, whereas PamRXR-L was abundant in ovaries. The PamRXR transcript was detected during all stages of vitellogenesis in the fat body with different levels. It was little low during the early vitellogenic period (days 2, 3), then a peak of increase was detected during days 4-6 (day 5) which was followed by another peak of increase at the end of vitellogenesis, day 9. We assumed that PamRXR might play a dual role of induction of vitellogenin through JH at early vitellogenesis and suppression through 20E during late vitellogenesis. The present work will pave the way for several other investigations to understand both the ecdysteroid-dependent genetic hierarchy and JH mechanism controlling vitellogenesis in the American cockroach, P. americana.
Purpose Educational policy is crucial to society. Its process is related to political, economic a... more Purpose Educational policy is crucial to society. Its process is related to political, economic and cultural variables. Nevertheless, there is a paucity of research in the field of applied social sciences, about how educational policies help to achieve societal objectives and welfare. This study aims to assess the concept and features of school education in Egypt during 1990-2017. Design/methodology/approach Secondary data were collected using governmental reports and educational institutional reports and assessed through specialized focus groups. Findings Results showed that, despite the multiplicity of strategies to reform the educational system, achievements and outcomes of educational processes are modest, and the developmental status of Egypt is lower than that of other countries. Studying educational outcomes indicated that school-education suffered from the predominance of quantity over quality and a serious inability to meet requirements of new knowledge era. Originality/val...
Although the regulation of vitellogenesis in insects has been mainly discussed in terms of ‘class... more Although the regulation of vitellogenesis in insects has been mainly discussed in terms of ‘classical’ lipid hormones, juvenile hormone (JH), and 20-hydroxyecdysone (20E), recent data support the notion that this process must be adjusted in harmony with a nutritional input/reservoir and involvement of certain indoleamines and neuropeptides in regulation of such process. This study focuses on crosstalks among these axes, lipid hormones, monoamines, and neuropeptides in regulation of vitellogenesis in the American cockroach Periplaneta americana with novel aspects in the roles of arylalkylamine N-acetyltransferase (aaNAT), a key enzyme in indoleamine metabolism, and the enteroendocrine peptides; crustacean cardioactive peptide (CCAP) and short neuropeptide F (sNPF). Double-stranded RNA against aaNAT (dsRNAaaNAT) was injected into designated-aged females and the effects were monitored including the expressions of aaNAT itself, vitellogenin 1 and 2 (Vg1 and Vg2) and the vitellogenin rec...
The present work aims to study the biochemical changes of Culex pipiens females infected with Pla... more The present work aims to study the biochemical changes of Culex pipiens females infected with Plasmodium cathemerium. For achievement this research, females of Culex pipiens were infected with Plasmodium cathemerium to study the effect of Plasmodium on Culex pipiens females protein profile quantitative and qualitative at 12h, 1d, 4d, 5d and 6d post infection for mid-gut samples, while salivary glands collected after 3d, 4d, 5d, 6d and 7d post infection. The results showed a significant gradual decreases in total protein concentration within the infected samples at all tested times. In case of mid-gut-samples, the total protein concentration of the infected samples decreased on comparing with control samples with exception after 5 d.p.i. the total protein concentration increases, while, in case of salivary glands –samples total protein concentration of the infected samples decreased on comparing with control samples. Protein of Cx. pipiens (control and infected) were separated using ...
Avian malaria is a mosquito-borne disease caused by Plasmodium spp. protozoa. Although these para... more Avian malaria is a mosquito-borne disease caused by Plasmodium spp. protozoa. Although these parasites have been extensively studied in North America and Eurasia, knowledge on the diversity of Plasmodium, its vectors and avian hosts in Africa is scarce. In this study, we report on natural malarial infections in free-ranging sparrows (Passer domesticus) sampled at Giza Governorate, Egypt. Parasites were morphologically characterized as Plasmodium cathemerium based on the examination of thin blood smears from the avian host. Sequencing a fragment of the mitochondrial cytochrome b gene showed that the parasite corresponded to lineage PADOM02. Phylogenetic analysis showed that this parasite is closely related to the lineages SERAU01 and PADOM09, both of which are attributed to P. cathemerium. Experimental infection of Culex pipiens complex was successful, with ookinetes first detected at 1-day post infection (dpi), oocysts at 4 dpi and sporozoites at 6 dpi. The massive infection of the ...
Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/o... more Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucia...
Ecdysteroid and sequiterpenoids juvenile hormones play a gonadotrophic role in the insect adult f... more Ecdysteroid and sequiterpenoids juvenile hormones play a gonadotrophic role in the insect adult female vitellogenesis. The molecular basis of hormone action has been analyzed in great detail in flies and moths, but rarely in primitive insect orders. The primitive hemimetabolous insect Periplaneta americana was used, as a model, to isolate and characterize, for the first time, two cDNAs of RXR/USP, a component of the heterodimeric ecdysone receptor. These two cDNAs correspond to two isoforms, named PamRXR-S (short form) and PamRXR-L (long form). Both are identical except for 25 amino acids deletion/insertion located in the loop between helices H1 and H3 of the ligand-binding domain. The two isoforms are differentially expressed in different tissues as revealed by RT-PCR and northern blot analysis. In fat body, brain, ovary, and muscle tissues, the predominant form was PamRXR-S, whereas PamRXR-L was abundant in ovaries. The PamRXR transcript was detected during all stages of vitellogenesis in the fat body with different levels. It was little low during the early vitellogenic period (days 2, 3), then a peak of increase was detected during days 4-6 (day 5) which was followed by another peak of increase at the end of vitellogenesis, day 9. We assumed that PamRXR might play a dual role of induction of vitellogenin through JH at early vitellogenesis and suppression through 20E during late vitellogenesis. The present work will pave the way for several other investigations to understand both the ecdysteroid-dependent genetic hierarchy and JH mechanism controlling vitellogenesis in the American cockroach, P. americana.
Purpose Educational policy is crucial to society. Its process is related to political, economic a... more Purpose Educational policy is crucial to society. Its process is related to political, economic and cultural variables. Nevertheless, there is a paucity of research in the field of applied social sciences, about how educational policies help to achieve societal objectives and welfare. This study aims to assess the concept and features of school education in Egypt during 1990-2017. Design/methodology/approach Secondary data were collected using governmental reports and educational institutional reports and assessed through specialized focus groups. Findings Results showed that, despite the multiplicity of strategies to reform the educational system, achievements and outcomes of educational processes are modest, and the developmental status of Egypt is lower than that of other countries. Studying educational outcomes indicated that school-education suffered from the predominance of quantity over quality and a serious inability to meet requirements of new knowledge era. Originality/val...
Although the regulation of vitellogenesis in insects has been mainly discussed in terms of ‘class... more Although the regulation of vitellogenesis in insects has been mainly discussed in terms of ‘classical’ lipid hormones, juvenile hormone (JH), and 20-hydroxyecdysone (20E), recent data support the notion that this process must be adjusted in harmony with a nutritional input/reservoir and involvement of certain indoleamines and neuropeptides in regulation of such process. This study focuses on crosstalks among these axes, lipid hormones, monoamines, and neuropeptides in regulation of vitellogenesis in the American cockroach Periplaneta americana with novel aspects in the roles of arylalkylamine N-acetyltransferase (aaNAT), a key enzyme in indoleamine metabolism, and the enteroendocrine peptides; crustacean cardioactive peptide (CCAP) and short neuropeptide F (sNPF). Double-stranded RNA against aaNAT (dsRNAaaNAT) was injected into designated-aged females and the effects were monitored including the expressions of aaNAT itself, vitellogenin 1 and 2 (Vg1 and Vg2) and the vitellogenin rec...
The present work aims to study the biochemical changes of Culex pipiens females infected with Pla... more The present work aims to study the biochemical changes of Culex pipiens females infected with Plasmodium cathemerium. For achievement this research, females of Culex pipiens were infected with Plasmodium cathemerium to study the effect of Plasmodium on Culex pipiens females protein profile quantitative and qualitative at 12h, 1d, 4d, 5d and 6d post infection for mid-gut samples, while salivary glands collected after 3d, 4d, 5d, 6d and 7d post infection. The results showed a significant gradual decreases in total protein concentration within the infected samples at all tested times. In case of mid-gut-samples, the total protein concentration of the infected samples decreased on comparing with control samples with exception after 5 d.p.i. the total protein concentration increases, while, in case of salivary glands –samples total protein concentration of the infected samples decreased on comparing with control samples. Protein of Cx. pipiens (control and infected) were separated using ...
Avian malaria is a mosquito-borne disease caused by Plasmodium spp. protozoa. Although these para... more Avian malaria is a mosquito-borne disease caused by Plasmodium spp. protozoa. Although these parasites have been extensively studied in North America and Eurasia, knowledge on the diversity of Plasmodium, its vectors and avian hosts in Africa is scarce. In this study, we report on natural malarial infections in free-ranging sparrows (Passer domesticus) sampled at Giza Governorate, Egypt. Parasites were morphologically characterized as Plasmodium cathemerium based on the examination of thin blood smears from the avian host. Sequencing a fragment of the mitochondrial cytochrome b gene showed that the parasite corresponded to lineage PADOM02. Phylogenetic analysis showed that this parasite is closely related to the lineages SERAU01 and PADOM09, both of which are attributed to P. cathemerium. Experimental infection of Culex pipiens complex was successful, with ookinetes first detected at 1-day post infection (dpi), oocysts at 4 dpi and sporozoites at 6 dpi. The massive infection of the ...
Uploads
Papers by Azza El-Gendy