International Journal of Systematic and Evolutionary Microbiology, 2015
Erigeron sp. plants showing symptoms of witches' broom and stunting were found near orchards ... more Erigeron sp. plants showing symptoms of witches' broom and stunting were found near orchards of passion fruit in São Paulo state, Brazil. These symptoms were indicative of infection by phytoplasmas. Thus, the aim of this study was to detect and identify possible phytoplasmas associated with diseased plants. Total DNA was extracted from symptomatic and asymptomatic plants and used in nested PCR conducted with the primer pairs P1/Tint and R16F2n/16R2. Amplification of genomic fragments of 1.2 kb from the 16S rRNA gene confirmed the presence of phytoplasma in all symptomatic samples. The sequence identity scores between the 16S rRNA gene of the phytoplasma strain identified in the current study and those of previously reported ‘Candidatus Phytoplasma fraxini’-related strains ranged from 98 % to 99 % indicating the phytoplasma to be a strain affiliated with ‘Candidatus Phytoplasma fraxini’. The results from a phylogenetic analysis and virtual RFLP analysis of the 16S rRNA gene seque...
Plants of Capsicum annuum cv. Magali R, resistant to Pepper yellow mosaic virus (PepYMV), which s... more Plants of Capsicum annuum cv. Magali R, resistant to Pepper yellow mosaic virus (PepYMV), which showed severe yellow mosaic, leaf malformation and stunting were observed during the 2003/04 growing season in Lins, São Paulo State, Brazil. Potyvirus-like particles observed in leaf sap from infected plants under the electron microscope reacted with an antiserum against PepYMV in PTA-ELISA. In addition to C. annuum cv. Magali R, this potyvirus also infected systemically the resistant C. annuum cv. Rubia R. The nucleotide sequence of part of the CP gene of this potyvirus shared 96-98% identity with that of other PepYMV isolates. The partial nucleotide sequence of the 3' NTR showed 94-96% identity with that of PepYMV. These data indicate that this potyvirus is a resistance-breaking isolate of PepYMV.
Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in ... more Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV ...
The accumulation of Tomato bushy stunt virus (TBSV) defective interfering RNAs (DIs) has been obs... more The accumulation of Tomato bushy stunt virus (TBSV) defective interfering RNAs (DIs) has been observed in several species of plants, but the involvement of host-specific processes and the functional role of DIs are still poorly understood. In this study, the accumulation of DIs was compared after several passages of TBSV through Nicotiana benthamiana and pepper (Capsicum annuum). As anticipated, passages of wild-type TBSV through N. benthamiana resulted in the accumulation of significant levels of TBSV DIs, which caused symptom attenuation and prevented the plants from lethal necrosis. On the contrary, TBSV infection of pepper plants caused severe local and systemic chlorosis, but continuous virus passages did not result in detectable levels of DIs accumulation. In addition, the inoculation of pepper plants with a mixture of helper virus and DI either from in vitro generated transcripts or from infected N. benthamiana did not yield DI in upper pepper leaves. Our cumulative results s...
Avaliou-se o comportamento de dezesseis introduções, consideradas resistentes à broca no Sul dos ... more Avaliou-se o comportamento de dezesseis introduções, consideradas resistentes à broca no Sul dos E.U.A., e quatro clones 'IAC' de cana-de-açúcar em relação ao ataque de Diatraea saccharalis (Fabr., 1794) (Lepidoptera:Pyralidae) em ensaio delineado em blocos ao acaso, com dez repetições, instalado na Estação Experimental de Ribeirão Preto, do Instituto Agronômico. As introduções utilizadas foram CP57-614, CP62-258, CP66-491, CP70-321, CP70-330, CP71-321, Tainan 2n = 96, US74-103, TJS76-9, US-76-14, US76-15, US76-20, US76-22, TJS76-25, US76-26 e US76-34 e, os clones, 'IAC50-134', 'IAC52-150', 'IAC71-1001' e 'IAC1006'. Decorrido um ano do plantio, efetuado em setembro de 1979, procedeu-se à avaliação. Vinte colmos por parcela foram cortados e, individualmente, mediu-se o diâmetro e contaram-se os internódios sadios e broqueados. A partir desses dados, calcularam-se a infestação e a sua intensidade. Os dois índices evidenciaram o mais baixo ataque...
International Journal of Systematic and Evolutionary Microbiology, 2015
Erigeron sp. plants showing symptoms of witches' broom and stunting were found near orchards ... more Erigeron sp. plants showing symptoms of witches' broom and stunting were found near orchards of passion fruit in São Paulo state, Brazil. These symptoms were indicative of infection by phytoplasmas. Thus, the aim of this study was to detect and identify possible phytoplasmas associated with diseased plants. Total DNA was extracted from symptomatic and asymptomatic plants and used in nested PCR conducted with the primer pairs P1/Tint and R16F2n/16R2. Amplification of genomic fragments of 1.2 kb from the 16S rRNA gene confirmed the presence of phytoplasma in all symptomatic samples. The sequence identity scores between the 16S rRNA gene of the phytoplasma strain identified in the current study and those of previously reported ‘Candidatus Phytoplasma fraxini’-related strains ranged from 98 % to 99 % indicating the phytoplasma to be a strain affiliated with ‘Candidatus Phytoplasma fraxini’. The results from a phylogenetic analysis and virtual RFLP analysis of the 16S rRNA gene seque...
Plants of Capsicum annuum cv. Magali R, resistant to Pepper yellow mosaic virus (PepYMV), which s... more Plants of Capsicum annuum cv. Magali R, resistant to Pepper yellow mosaic virus (PepYMV), which showed severe yellow mosaic, leaf malformation and stunting were observed during the 2003/04 growing season in Lins, São Paulo State, Brazil. Potyvirus-like particles observed in leaf sap from infected plants under the electron microscope reacted with an antiserum against PepYMV in PTA-ELISA. In addition to C. annuum cv. Magali R, this potyvirus also infected systemically the resistant C. annuum cv. Rubia R. The nucleotide sequence of part of the CP gene of this potyvirus shared 96-98% identity with that of other PepYMV isolates. The partial nucleotide sequence of the 3' NTR showed 94-96% identity with that of PepYMV. These data indicate that this potyvirus is a resistance-breaking isolate of PepYMV.
Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in ... more Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV ...
The accumulation of Tomato bushy stunt virus (TBSV) defective interfering RNAs (DIs) has been obs... more The accumulation of Tomato bushy stunt virus (TBSV) defective interfering RNAs (DIs) has been observed in several species of plants, but the involvement of host-specific processes and the functional role of DIs are still poorly understood. In this study, the accumulation of DIs was compared after several passages of TBSV through Nicotiana benthamiana and pepper (Capsicum annuum). As anticipated, passages of wild-type TBSV through N. benthamiana resulted in the accumulation of significant levels of TBSV DIs, which caused symptom attenuation and prevented the plants from lethal necrosis. On the contrary, TBSV infection of pepper plants caused severe local and systemic chlorosis, but continuous virus passages did not result in detectable levels of DIs accumulation. In addition, the inoculation of pepper plants with a mixture of helper virus and DI either from in vitro generated transcripts or from infected N. benthamiana did not yield DI in upper pepper leaves. Our cumulative results s...
Avaliou-se o comportamento de dezesseis introduções, consideradas resistentes à broca no Sul dos ... more Avaliou-se o comportamento de dezesseis introduções, consideradas resistentes à broca no Sul dos E.U.A., e quatro clones 'IAC' de cana-de-açúcar em relação ao ataque de Diatraea saccharalis (Fabr., 1794) (Lepidoptera:Pyralidae) em ensaio delineado em blocos ao acaso, com dez repetições, instalado na Estação Experimental de Ribeirão Preto, do Instituto Agronômico. As introduções utilizadas foram CP57-614, CP62-258, CP66-491, CP70-321, CP70-330, CP71-321, Tainan 2n = 96, US74-103, TJS76-9, US-76-14, US76-15, US76-20, US76-22, TJS76-25, US76-26 e US76-34 e, os clones, 'IAC50-134', 'IAC52-150', 'IAC71-1001' e 'IAC1006'. Decorrido um ano do plantio, efetuado em setembro de 1979, procedeu-se à avaliação. Vinte colmos por parcela foram cortados e, individualmente, mediu-se o diâmetro e contaram-se os internódios sadios e broqueados. A partir desses dados, calcularam-se a infestação e a sua intensidade. Os dois índices evidenciaram o mais baixo ataque...
Uploads