Advances in Experimental Medicine and Biology, 2011
Page 70. Chapter 14 46, XY Disorders of Sex Development (46, XY DSD) due to Androgen Receptor Def... more Page 70. Chapter 14 46, XY Disorders of Sex Development (46, XY DSD) due to Androgen Receptor Defects: Androgen Insensitivity Syndrome Ivo JP Arnhold, Karla Melo, Elaine MF Costa, Debora Danilovic, Marlene Inacio ...
Male-to-female transsexual persons use oestrogens + antiandrogens to adapt their physical bodies ... more Male-to-female transsexual persons use oestrogens + antiandrogens to adapt their physical bodies to the female sex. Doses are usually somewhat higher than those used by hypogonadal women receiving oestrogen replacement. Particularly in cases of self-adminstration of cross-sex hormones, doses may be very high. Oestrogens are powerful stimulators of synthesis and release of prolactin and serum prolactin levels are usually somewhat increased following oestrogen treatment. Prolactinomas have been reported in male-to-female transsexual persons, both after use of high and conventional doses of oestrogens but remain rare events. We report two new cases of prolactinomas in male-to-female transsexual persons, one in a 41-year-old subject who had used nonsupervised high-dose oestrogen treatment since the age of 23 years and another one in a 42 year old who had initiated oestrogen treatment at the age of 17 years. Their serum prolactin levels were strongly increased, and the diagnosis of a pituitary tumour was confirmed by imaging techniques. Both cases responded well to treatment with cabergoline treatment whereupon serum prolactin normalised. Our two cases are added to the three cases of prolactinomas in the literature in persons who had used supraphysiological doses of oestrogens.
Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congen... more Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congenital adrenal hyperplasia and androgen insensitivity syndrome. Molecular biology has provided the opportunity to analyze genes that identify the presence of Y chromosome through easier and faster methodology than conventional cytogenetics techniques. We used DNA extracted from 8 chorionic villus biopsies, performed at 10-12 weeks of gestation to amplify a 778 bp fragment that corresponds to the coding sequence of the SRY gene to determine fetal sex (primers XES10, XES11). As a internal control of the PCR we also amplified in the same reaction a 650 bp fragment from the exon 6-8 of 21-hydroxylase active gene-CYP21 (primers 5'GAGGGATCACATCGTCGTGGAGATG3' and 5'TTCGTGGTCTAGCTCCTCCTG3'). The PCR protocol was: 94 degrees C-2 min followed by 32 cycles of 94 degrees C-1 min; 63 degrees C-1 min; 72 degrees C-2 min and a extension cycle of 72 degrees C-10 min. The karyotype was perf...
Bilateral adrenalectomy followed by immediate transplantation of adrenal slices into muscular tis... more Bilateral adrenalectomy followed by immediate transplantation of adrenal slices into muscular tissue was performed in 7 patients with Cushing's disease and 1 with bilateral pheochromocytoma. Patients were followed for 1 to 7 years and only 1 had evidence of a functional graft (serum cortisol level at the lower limit of normality). Low levels of dehydroepiandrosterone sulfate, aldosterone and cortisol were found in the remaining patients. Acute stimulation with adrenocorticotropichormone did not increase either cortisol or aldosterone levels in any patient. We conclude that prospective studies are needed to elucidate factors that could improve the success of adrenal implantation, since the literature shows examples of functional grafts, while the majority of the cases are unsuccessful.
Advances in Experimental Medicine and Biology, 2011
Page 70. Chapter 14 46, XY Disorders of Sex Development (46, XY DSD) due to Androgen Receptor Def... more Page 70. Chapter 14 46, XY Disorders of Sex Development (46, XY DSD) due to Androgen Receptor Defects: Androgen Insensitivity Syndrome Ivo JP Arnhold, Karla Melo, Elaine MF Costa, Debora Danilovic, Marlene Inacio ...
Male-to-female transsexual persons use oestrogens + antiandrogens to adapt their physical bodies ... more Male-to-female transsexual persons use oestrogens + antiandrogens to adapt their physical bodies to the female sex. Doses are usually somewhat higher than those used by hypogonadal women receiving oestrogen replacement. Particularly in cases of self-adminstration of cross-sex hormones, doses may be very high. Oestrogens are powerful stimulators of synthesis and release of prolactin and serum prolactin levels are usually somewhat increased following oestrogen treatment. Prolactinomas have been reported in male-to-female transsexual persons, both after use of high and conventional doses of oestrogens but remain rare events. We report two new cases of prolactinomas in male-to-female transsexual persons, one in a 41-year-old subject who had used nonsupervised high-dose oestrogen treatment since the age of 23 years and another one in a 42 year old who had initiated oestrogen treatment at the age of 17 years. Their serum prolactin levels were strongly increased, and the diagnosis of a pituitary tumour was confirmed by imaging techniques. Both cases responded well to treatment with cabergoline treatment whereupon serum prolactin normalised. Our two cases are added to the three cases of prolactinomas in the literature in persons who had used supraphysiological doses of oestrogens.
Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congen... more Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congenital adrenal hyperplasia and androgen insensitivity syndrome. Molecular biology has provided the opportunity to analyze genes that identify the presence of Y chromosome through easier and faster methodology than conventional cytogenetics techniques. We used DNA extracted from 8 chorionic villus biopsies, performed at 10-12 weeks of gestation to amplify a 778 bp fragment that corresponds to the coding sequence of the SRY gene to determine fetal sex (primers XES10, XES11). As a internal control of the PCR we also amplified in the same reaction a 650 bp fragment from the exon 6-8 of 21-hydroxylase active gene-CYP21 (primers 5'GAGGGATCACATCGTCGTGGAGATG3' and 5'TTCGTGGTCTAGCTCCTCCTG3'). The PCR protocol was: 94 degrees C-2 min followed by 32 cycles of 94 degrees C-1 min; 63 degrees C-1 min; 72 degrees C-2 min and a extension cycle of 72 degrees C-10 min. The karyotype was perf...
Bilateral adrenalectomy followed by immediate transplantation of adrenal slices into muscular tis... more Bilateral adrenalectomy followed by immediate transplantation of adrenal slices into muscular tissue was performed in 7 patients with Cushing's disease and 1 with bilateral pheochromocytoma. Patients were followed for 1 to 7 years and only 1 had evidence of a functional graft (serum cortisol level at the lower limit of normality). Low levels of dehydroepiandrosterone sulfate, aldosterone and cortisol were found in the remaining patients. Acute stimulation with adrenocorticotropichormone did not increase either cortisol or aldosterone levels in any patient. We conclude that prospective studies are needed to elucidate factors that could improve the success of adrenal implantation, since the literature shows examples of functional grafts, while the majority of the cases are unsuccessful.
Uploads