Original Article | J Adv Med Biomed Res. 2023; 31(144): 86-92
Journal of Advances in Medical and Biomedical Research | ISSN:2676-6264
Effect of Memantine on Expression of NAT-Rad18, Rad18 and Sorl1 Genes in
Rat Model of Alzheimer's Disease
Parisa Azadfar1
, Zahra Noormohammadi1*
1
Akram Eidi
1.
2.
3.
4.
, Maryam Noroozian2,3
,
4
, Pejman Mortazavi
Dept. of Biology, Science and Research Branch, Islamic Azad University, Tehran, Iran
Dept. of Memory and Behavioral Neurology (MBND), Roozbeh Hospital, Tehran, Iran
Dept. of Neuroscience, School of Advanced Technologies in Medicine, Tehran University of Medical Sciences, Tehran,
Iran
Dept. of Pathobiology, Science and Research Branch, Islamic Azad University, Tehran, Iran
Article Info
ABSTRACT
10.30699/jambs.31.144.86
Received: 2021/10/27;
Accepted: 2022/08/02;
Published Online: 12 Dec 2022;
Use your device to scan and read the
article online
Background & Objective: Dysregulation of long-term expression of non-coding
RNAs (lncRNAs) has a potential role in progressive brain disorders such as
Alzheimer's disease (AD). This study aimed to analyze the apoptosis and expression
of 51A and NAT-Rad18 lncRNAs and their target genes in brain tissue and
peripheral blood mononuclear cells (PBMCs) of the rat model of AD, before and
after memantine treatment.
Materials & Methods: Twenty-eight male Wistar rats were divided into four groups:
1. Normal control (n = 4), 2. Sham-operated (n = 4), 3. Alzheimer's control (n = 10),
and 4. The experimental group (n = 10) was treated with memantine. The qPCR and
TUNEL tests were used to detect the lncRNAs expression and apoptosis.
Results: Sorl1 gene was reduced in brain tissue of Alzheimer’s control (p = 0.016)
and PBMCs of Alzheimer's control and experimental groups (p = 0.002 and p = 0.001
respectively). The expression of NAT-Rad18 and Rad18 genes increased in brain
tissue of Alzheimer's control group (p = 0.002 and p = 0.04 respectively) while
reduced in PBMCs of Alzheimer's control and experimental groups (p = 0.005 and p
= 0.045 for NAT-Rad18, p = 0.01 and p = 0.006 for Rad18).
Corresponding Information:
Zahra Noormohammadi,
Dept. of Biology, Science and Research
Branch, Islamic Azad University,
Tehran, Iran
Conclusion: ROC curve analysis showed 100% sensitivity and 85.7% specificity
for the Sorl1 gene with 0.911 under the curve area and 100% sensitivity and 100%
specificity for NAT-Rad18 and Rad18, separately with one under the curve area.
Decreased expression in Sorl1, NAT-Rad18, and Rad18 genes can be used as blood
biomarkers for diagnosis independently. However, studies on Alzheimer's patients
are needed.
Keywords: Alzheimer’s disease, Rat, Biomarker, lncRNA, Memantine
E-Mail: z-nouri@srbiau.ac.ir,
marjannm@yahoo.com
Copyright © 2023, This is an original open-access article distributed under the terms of the Creative Commons Attribution-noncommercial 4.0 International License which permits
copy and redistribution of the material just in noncommercial usages with proper citation.
Introduction
Alzheimer's disease (AD) is mild progressive memory
loss with three features, extraneuronal amyloid beta (Aβ),
intraneuronal neurofibrillary tangles (NFTs), and synaptic
dysfunction due to Aβ accumulation. Amyloid plaques
and NFTs change synaptic plasticity, leading to
widespread synaptic loss neurodegeneration (1). Recent
studies showed that dysregulation of long-term expression
of non-coding RNAs (lncRNAs) plays a potential role in
progressive brain disorders (2).
The 51A is located in an antisense configuration on
intron 1 of the neuronal sortilin-related receptor gene
(SORL1) (3, 4) and up-regulated in both in-vitro and AD
brain models (3). In AD, over-expression of 51A causes
down-regulation of SORL1 variant A via alternative
Volume 31, January-February 2023
splicing and subsequently increases Aβ formation in the
brain (3, 4). The SORL1 is expressed in the central
nervous system and has been predicted to be involved in
AD pathogenesis (5). This gene localized to intracellular
compartments in the cell soma of neurons, suggesting a
role for this receptor in vesicular protein transport (6). The
SORL1, as a sorting receptor for APP holoprotein,
mediated APP localization and processing by 'trapping'
APP in the Golgi and/or by directing APP into the
endosome-to-Golgi retrieval pathway (3, 7). Absence or
abundant expression of SORL1 in the neurons leads to
modification APP from the retromer recycling pathway to
the β-secretase cleavage pathway because more APP
enters to late-endosome, where the enzymes BACE1 and
Journal of Advances in Medical and Biomedical Research
Parisa Azadfar et al. 87
PS1 cleave neurotoxic Aβ (3, 8). The progression of AD
disrupts SORL1 expression and its regulatory function
(9).
Natural antisense transcripts versus Rad18 (NATRad18) exerts a post-transcriptional control on Rad18
(10). There is an equilibrium relationship between NATRad18 and its target gene, Rad18, in both mRNA and
protein levels, with Rad18 showing a low expression
level. Rad18 is an ubiquitin ligase involved in postreplication repair processes (11). Mammalian cells need
the E3 ubiquitin ligase Rad18 for perpetuation after
various types of DNA damage (12). Controlling the
expression of DNA repair protein of Rad18, due to upregulation of NAT-Rad18 in brain tissue of AD following
exposure to Aβ, can make the neuron more sensitive to
apoptosis (13). This document suggests NAT-Rad18 is
probably involved in AD via its effects on the DNA repair
system (2).
N-methyl-D-aspartate receptor (NMDAR) is a ligand of
glutamate and the fast excitatory neurotransmitter in the
human central nervous system, especially in the cortex
and hippocampus (14). NMDAR activation plays a vital
role in synaptic plasticity, learning, and memory (15).
Inordinate NMDAR activity causes excitotoxicity and
rising cell death which is associated with
neurodegenerative disorders such as AD (16).
Memantine, a non-competitive NMDAR antagonist (17),
improves cognitive function and inhibits disease
progression in the cortex and hippocampus by targeting
NMDARs and APP protein translation (18).
The aims of the present study were: 1. The analysis of
51A and NAT-Rad18 lncRNAs and their target genes
expression, Sorl1 and Rad18, before and after memantine
treatment in brain tissue and peripheral blood
mononuclear cells (PBMCs) in rats model of Alzheimer's
disease 2. Detection of apoptosis with TUNEL test 3. The
relationship between the expression of mentioned genes
and the level of Aβ protein, measured in our previous
study, will be discussed.
Materials and Methods
Twenty-eight male Wistar rats aged six weeks (mean
weight 250-290gr) were purchased from the Animal
Laboratory of Pasteur Institute, Tehran, Iran. The Ethics
Committee principles and the Guide for the Care and Use
of Laboratory Animals by the National Institute of Health
(No. 85-23, revised in 1996) were followed in all the
experiments. Ethics Committees approved this study with
the ethical code of IR.IAU.SRB.REC.1397.170. In our
previous study, surgical procedure, experimental design,
histopathological examination, and RNA extraction were
explained in detail (19).
ICV injection of STZ
According to the stereotaxic atlas, rats were kept in
individual home cages for seven days after stereotaxic
surgery
(20).
Rats
received
two
bilateral
intracerebroventricular injections (ICV) of STZ (Sigma,
Volume 31, January-February 2023
St. Louis, MO, USA) diluted in physiological saline at 3
mg/kg (1.5mg/kg on each side), on days 7 and 9 (21-23).
Experimental design
Rats were randomly divided into four groups: Normal
control (n = 4), Sham-operated rats that underwent
surgery (n = 4), Alzheimer's control rats that received STZ
in a dose of 3 mg/kg (1.5mg/kg on each side) ICV-STZ
bilaterally two times in day 7, and 9 (n = 10) and
Experimental group that treated with memantine in a dose
of 30 mg/kg/day using an intragastric tube for 28 days,
starting with the first administration of the STZ (n = 10)
(19).
Sampling
Three weeks after the first STZ or saline ICV injection
at the doses of 3 mg/kg (24) (25), on the 28th day, all rats
were anesthetized and sacrificed. 2 ml of blood was
collected in Ethylene Diamine Tetra Acetic Acid-coated
(EDTA) vials. Based on the test protocol, the left
hemisphere was prepared for hematoxylin, eosin (H&E),
and Bielschowsky staining (26). The right hemisphere
was used for molecular detections. A Pilot Study of gene
expression in the cortex and hippocampus, which are
destroyed in Alzheimer's disease, showed no difference in
gene expression, so whole brain tissue was used for the
study.
RNA extraction and Gene expression
Ficoll (Cat No: GE17144003) was used to separate
peripheral blood mononuclear cells (PBMCs). RNA was
isolated by Trizol (cat no: YT 9066), and the Parstous
cDNA Synthesis kit (cat no. A101161) was provided for
reverse transcription. The Sorl1 gene primers were
designed by the Gene Runner program and primer 3. The
primers used for gene expression are 51A forward 5′TGGGAGAGTCAGCATCTTGAAG-3′ and reverse 5′TGTACAGTCAGACAAGAGGTGTGTGTAT-3′(27),
Sorl1
gene
forward,
5′TGAGAAGCCTGTGTTTGTGTATG-3′ and reverse 5′TCCTTGTTAGAGCCGAAGATGG-3′, NAT-Rad18
forward, 5′- CAGGCCACCAGCAGTTACT-3′ and
reverse, 5′-TCAGAGGAAGGTGACTGTGC-3′ (10)
and
Rad18
forward,
5′GCAGTAACAGAGCCAGACCT-3′ and reverse, 5′GAGGTGGAAGACACAGGAGA-3′ (10) and Gapdh
gene
(as
reference
gene)
forward,
5′GAAGCTGGTCATCAACGGGA-3′ and reverse, 5′GAAGGGGCGGAGATGATGAC
-3′
(19).
Amplification conditions were 95°C for 20 sec, 40 cycles
of denaturation at 95°C for 5 sec, and annealing at 57°C
for 20 sec.
TUNEL assay
In Situ Cell Death Detection Kit, fluorescein-dUTP, AP
by Roche Applied Science (Cat no: 11684817910) was
used to detect and quantify apoptosis cell death at the
single cell level (TUNEL test). Image J software (Media
version: 6.00) was used to analyze positive reactions
(green stained pixels/total pixels) in 20-megapixel photos
from cross-sections. The samples were assayed with a
Nikon fluorescence microscope (Japan). Then, each
Journal of Advances in Medical and Biomedical Research
88 Effect of Memantine on NAT-Rad18, Rad18 and Sorl1
section's mean ± SD of pixel-based intensities was
evaluated and compared among Alzheimer's control and
experimental groups.
Statistical analysis
The gene expressions were measured by a relative
quantification based on the relative expression of target
genes against a reference gene (Gapdh). Statistical
analyses were performed on the normalized data
evaluated by ANOVA, Tukey, independent T-test, and
ROC tests. The SPSS version 26 software package was
used to analyze all statistical tests. The significance level
was set at P-Value < 0.05.
Results
Gene Expressions
The expression of Sorl1 was significantly decreased in
the brain tissue of Alzheimer's controls compared with
normal control (p = 0.016). Although the expression of
Sorl1 in the brain tissue increased in the experimental
group in comparison with Alzheimer's control group (p
= 0.000), the changes were not significant compared
with normal control (p = 0.146) (Figure1.a).
Furthermore, the expression of the Sorl1 gene in the
PBMCs of Alzheimer's control and experimental groups
was decreased compared to normal control (p = 0.002
and p = 0.001, respectively) (Fig1.b). The ROC curve
analysis showed 87.5% sensitivity and 100% specificity
for the Sorl1 gene in blood, with a 0.938 area under the
curve (Figure 2).
Figure 1. Expression of lncRNAs and their targets in brain tissue and PBMCs of normal control, sham-operated, Alzheimer’s
control and experimental groups. A value of P < 0.05 was considered significant. It is noted that * in the graphs indicates the
significance of the Alzheimer’s control and experimental groups compared to the normal control group. * , ** and *** show
P<0.05 , P< 0.01 and P<0.001, respectively. In brain tissue, the gene expression of Sorl1 significantly was down regulated in
Alzheimer’s control group. Expression of NAT-Rad18 and Rad18 genes, showed significant increases in brain tissue of
Alzheimer’s control group. In PBMCs, level of Sorl1, NAT-Rad18 and Rad18 genes expression indicated significant reduction
in Alzheimer’s control and experimental groups.
group were significant compared to Alzheimer's control
group (p = 0.006, Figure 1.a). On the other hand, the
NAT-Rad18 expression level in PBMCs was reduced in
the Alzheimer's control and the experimental groups
compared to the normal control group (p = 0.005 and p
= 0.045, respectively, Fig 1. b), while the changes in both
the Alzheimer's control and experimental groups were
not significant (p = 0.119).
Figure 2. ROC curve analysis. Analysis showed 87.5%
sensitivity and 100% specificity for Sorl1gene, with 0.938
area under curve and also, showed 100% sensitivity and
100% specificity for NAT-Rad18 and Rad18 genes in
PBMC, separately, with 1 area under curve.
We couldn't find the sequence of the 51A gene in
intron 1 of the Sorl1 gene in the rat genome. However,
we used 51A primers based on the human genome. Our
attempts failed to detect it.
The expression of NAT-Rad18 was significantly
boosted in the brain tissue of the Alzheimer's control
group compared with the normal control group (p =
0.002). Decreases in the brain tissue of the experimental
Volume 31, January-February 2023
The qPCR analyses indicated a significant increase in
Rad18 expression in the brain tissue of the Alzheimer's
control group compared to the normal control group (p =
0.04). The reduction of Rad18 in the experimental group
was significant compared to Alzheimer's control group
(p = 0.044, Figure 1.a). The expression of Rad18
significantly reduced in PBMCs of the Alzheimer's
control and experimental groups compared with the
control group (p = 0.01 and p = 0.006, respectively). In
contrast, Alzheimer's control and experimental groups'
changes were insignificant (p = 0.991, Figure 1.b).
The ROC curve analysis showed 100% sensitivity and
100% specificity for NAT-Rad18 and Rad18 genes in
blood, with one area under the curve (Figure. 2).
Journal of Advances in Medical and Biomedical Research
Parisa Azadfar et al. 89
TUNEL test
The cortex section in Alzheimer's control (a) and
experimental (b) groups showed that the numbers of
apoptotic neurons (green color, Figure. 3) in the
Alzheimer's control were more than the experimental
group in mean value, but the changes were not
significant (p = 0.39).
Figure 3. TUNEL assay in the cortex section in (a) Alzheimer’s control and (b) experimental groups: Apoptotic neurons were
shown with green color (arrow) (Immunofluorescent antibody staining, 40X).
Discussion
In this study, the gene expression of Sorl1 was
significantly down-regulated in the brain tissue of the
Alzheimer's control group and significantly increased
in the experimental group compared to the Alzheimer's
control group. Expression of NAT-Rad18 and Rad18
genes showed significant increases in brain tissue of
the Alzheimer's control group and a significant
reduction in the experimental group compared to the
Alzheimer's control group. In PBMCs, levels of the
Sorl1, NAT-Rad18, and Rad18 genes expression
indicated a significant reduction in the Alzheimer's
control and the experimental groups. Aβ protein level,
according to our previous study (19), and apoptotic
neurons in brain tissue of the Alzheimer's control group
showed insignificant increases compared with the
experimental group.
The SORL1 gene is mainly expressed in neurons,
and the loss of APP binding to SORL1 leads to AD
(28). The expression of the Sorl1 gene was decreased
in the brain tissue of the Alzheimer's control group,
while it was significantly boosted in experimental
groups compared to the Alzheimer's control group. In
the mice model of AD, a reduction of Sorl1 (29) and
decreases in Aβ production via up-regulation of Sorl1
gene expression was reported. Conversely, the knockout of the Sorl1 gene in cell lines and mouse models
demonstrated the increases in Aβ generation (30). Our
finding explained that memantine probably reduced
AD progression by increasing the expression of the
Sorl1 gene in the brain without affecting the Aβ protein
level. The level of Aβ protein showed decreases in
mean value, which were insignificant. Perhaps
significant changes in Aβ protein levels could be
observed by extending the length of the study, more
than 28 days.
Volume 31, January-February 2023
The 51A gene expression increases Aβ formation by
reducing the SORL1 variant A via alternative splicing
(3, 4). We were unable to detect the 51A expression
because of the lack of 51A sequence in Wistar rats.
However, due to the opposite relationship between 51A
and Sorl1 genes expression, and based on the Sorl1
gene expression, we expected to see up-regulation of
51A expression in the brain tissue of Alzheimer's
control group, and a reduction of 51A expression in the
experimental group compared to Alzheimer's control
group. Therefore, it seems that the expression of 51A
is changed in response to memantine treatment. This is
why Ciarlo et al. reported significant individual
variations in their AD brain (0.049). Their samples
were chosen from different stages of AD, without
mention of memantine treatment or not. Maybe
patients in severe and moderate stages have been
treated with memantine (3). We think that 51A
expression due to AD progression should be increased
in the brain tissue with high significance and show
decreases after memantine treatment.
NAT-Rad18 is differentially boosted in brain tissues,
especially in cortical neurons, following exposure to
Aβ (10, 31). Expression of both NAT-Rad18 and
Rad18 genes significantly elevated in brain tissue,
while significantly decreased followed memantine
treatment compared to Alzheimer's control group.
Similarly, Parenti et al. found that at the cellular level,
the expression of NAT-Rad18 and Rad18 was
counterbalanced using in-situ hybridization and
immunohistochemistry (10). Based on the experiments,
they suggested the existence of a NAT- Rad18 that
exerts post-transcriptional control on Rad18. A
prevalent discordant regulation was proposed due to
counterbalanced expressions of NAT-Rad18 and
Rad18, both at mRNA and protein levels. However, it
was impossible for NAT-Rad18 to act at the level of
Journal of Advances in Medical and Biomedical Research
90 Effect of Memantine on NAT-Rad18, Rad18 and Sorl1
Rad18 translation, possibly due to antisense interaction
with upstream sequences of Rad18 mRNA. This may
mainly affect the stability of Rad18 mRNA (10).
According to our TUNEL assay, we think that
increased in Rad18 protein levels followed by
increases in NAT-Rad18 and Rad18 in the AD brain
decreases the activity of Rad18 protein. Accumulating
Rad18 protein in brain tissue can probably lead to the
unavailability of the active site or limitation in physical
interactions. It seems that memantine increases the
activity of the Rad18 protein by decreasing NATRad18, Rad18, and Rad18 protein in brain tissue.
Therefore, the translation of the Rad18 protein was
reduced via the reduction of Rad18 mRNA. Although
insignificant, the reduction of the mean value of
apoptotic neurons in the experimental group
emphasizes the validity of this claim. It seems that by
increasing the duration of memantine treatment to
more than 28 days, the results of the TUNEL assay can
be significant.
Different studies tried to measure lncRNAs
expression and their targets in CSF and AD subjects'
blood contents as a biomarker (27) (4, 32). In PBMCs,
we are unable to detect 51A expression, while Sorl1,
NAT-Rad18, and Rad18 genes expression was
significantly reduced in both Alzheimer's control and
experimental groups. In the plasma of AD patients,
Deng reported stable and significant increases in the
expression of 51A (27); in contrast, Feng found no
significant changes (32). These conflicting reports
could be a reflection of the type of treatments, such as
memantine, while they didn't mention the patient's
medications. According to our results in blood, the
ROC curve analysis showed 100% sensitivity and
85.7% specificity for the Sorl1 gene with 0.911 under
the curve area and 100% sensitivity and 100%
specificity for NAT-Rad18 and Rad18, separately with
one under the curve area. So, the low expression of
Sorl1, NAT-Rad18, and Rad18 genes can probably be
used as non-invasive and effective blood biomarkers
for prognostic or diagnostic of AD. However, human
studies are needed to achieve certainty.
Acknowledgments
None.
Conflict of Interest
The authors declare that they have no competing
interests.
References
1.
Babri S, Mohaddes G, Feizi I, et al. Effect of
troxerutin on synaptic plasticity of hippocampal
dentate gyrus neurons in a β-amyloid model of
Alzheimer ׳s disease: an electrophysiological
study. Eur. J. Pharmacol. 2014;732:19-25.
[DOI:10.1016/j.ejphar.2014.03.018] [PMID]
2.
Luo Q, Chen Y. Long noncoding RNAs and
Alzheimer's disease. Clin interv aging.
2016;11:867. [DOI:10.2147/CIA.S107037]
[PMID] [PMCID]
3.
Ciarlo E, Massone S, Penna I, et al. An intronic
ncRNA-dependent
regulation
of
SORL1
expression affecting Aβ formation is upregulated
in post-mortem Alzheimer's disease brain samples.
Dis models mech. 2013;6(2):424-33.
[DOI:10.1242/dmm.009761] [PMID] [PMCID]
4.
Ma QL, Galasko DR, Ringman JM, et al.
Reduction of SorLA/LR11, a sorting protein
limiting β-amyloid production, in alzheimer
disease cerebrospinal fluid. Arch neurol. 2009;
66(4):448-57. [DOI:10.1001/archneurol.2009.22]
[PMCID]
5.
Lee JH, Barral S, Reitz C. The neuronal sortilinrelated receptor gene SORL1 and late-onset
Alzheimer's disease. Curr neurol Neurosci Rep.
2008;8(5):384. [DOI:10.1007/s11910-008-00608] [PMID] [PMCID]
6.
Andersen OM, Rudolph IM, Willnow TE. Risk
factor SORL1: from genetic association to
functional validation in Alzheimer's disease. Acta
Neuropathol. 2016;132(5):653-65. [PMCID]
[DOI:10.1007/s00401-016-1615-4] [PMID]
7.
Mehmedbasic A, Christensen SK, Nilsson J, et al.
SorLA complement-type repeat domains protect
the amyloid precursor protein against processing.
J Biol Chem. 2015;290(6):3359-76. [PMCID]
[DOI:10.1074/jbc.M114.619940] [PMID]
8.
Khvotchev M, Südhof TC. Proteolytic processing
of amyloid-β precursor protein by secretases does
not require cell surface transport. J Biol Chem.
2004;279(45):47101-8.
[DOI:10.1074/jbc.M408474200] [PMID]
9.
Andersen OM, Reiche J, Schmidt V, et al.
Neuronal sorting protein-related receptor
sorLA/LR11 regulates processing of the amyloid
Conclusion
For the first time, the effect of memantine on the
expression of Sorl1, NAT-Rad18, and Rad18 genes
was investigated in both brain tissue and blood in the
rat model of AD. Western blot experiments, in addition
to gene expression studies, are suggested. It seems that
the Sorl1, NAT-Rad18, and Rad18 expressions can be
used as a non-invasive and effective blood biomarker
for prognostic or diagnostic approaches. Also, Sorl1
and Rad18 expression can probably be used for
monitoring AD progression. However, further studies
on patients with mild cognitive impairment (MCI) and
patients in different stages of Alzheimer's are needed.
Volume 31, January-February 2023
Journal of Advances in Medical and Biomedical Research
Parisa Azadfar et al. 91
precursor protein. Proc Natl Acad Sci. 2005;
102(38):13461-6. [PMCID]
[DOI:10.1073/pnas.0503689102] [PMID]
20. Pxinos G, Watson C. The rat brain in stereotaxic
coordinates. Har-court Brace Jovanovich, San
Diego. 1986.
10. Parenti R, Paratore S, Torrisi A, Cavallaro S. A
natural antisense transcript against Rad18,
specifically expressed in neurons and upregulated
during β‐amyloid‐induced apoptosis. Eur. J.
Neurosci. 2007;26(9):2444-57. [PMID]
[DOI:10.1111/j.1460-9568.2007.05864.x]
21. Grieb P. Intracerebroventricular streptozotocin
injections as a model of Alzheimer's disease: in
search of a relevant mechanism. Mol. Neurobiol.
2016;53(3):1741-52. [DOI:10.1007/s12035-0159132-3] [PMID] [PMCID]
11. Inagaki A, Sleddens-Linkels E, van Cappellen
WA, et al. Human RAD18 interacts with
ubiquitylated
chromatin
components and
facilitates RAD9 recruitment to DNA double
strand breaks. PloS One. 2011;6(8). [PMCID]
[DOI:10.1371/journal.pone.0023155] [PMID]
12. Huang J, Huen MS, Kim H, et al. RAD18
transmits DNA damage signalling to elicit
homologous recombination repair. Nat Cell Biol.
2009;11(5):592-603. [DOI:10.1038/ncb1865]
[PMID] [PMCID]
13. Iacoangeli A, Bianchi R, Tiedge H. Regulatory
RNAs in brain function and disorders. Brain res J.
2010;1338:36-47. [PMCID]
[DOI:10.1016/j.brainres.2010.03.042] [PMID]
14. Francis PT. Glutamatergic systems in Alzheimer's
disease. Int J Geriatr Psychiatry. 2003;18(S1):S15S21. [DOI:10.1002/gps.934] [PMID]
15. Brigman JL, Wright T, Talani G, et al. Loss of
GluN2B-containing NMDA receptors in CA1
hippocampus and cortex impairs long-term
depression, reduces dendritic spine density, and
disrupts learning. J Neuroscie. 2010;30(13):4590600. [DOI:10.1523/JNEUROSCI.0640-10.2010]
[PMID] [PMCID]
16. Kodis EJ, Choi S, Swanson E, Ferreira G, Bloom
GS. N-methyl-D-aspartate receptor-mediated
calcium influx connects amyloid-β oligomers to
ectopic neuronal cell cycle reentry in Alzheimer's
disease. Alzheimers Dement. 2018;14(10):130212. [DOI:10.1016/j.jalz.2018.05.017] [PMID]
[PMCID]
17. Song X, Jensen MØ, Jogini V, et al. Mechanism of
NMDA receptor channel block by MK-801 and
memantine.
Nature.
2018;556(7702):515-9.
[DOI:10.1038/s41586-018-0039-9] [PMID]
[PMCID]
18. Dominguez E, Chin TY, Chen CP, Wu TY.
Management of moderate to severe Alzheimer's
disease: Focus on memantine. Taiwan J Obstet
Gynecol. 2011;50(4):415-23.
[DOI:10.1016/j.tjog.2011.10.004] [PMID]
19. Azadfar P, Noormohammadi Z, Noroozian M,
Eidi A, Mortazavi P. Effect of memantine on
expression of Bace1-as and Bace1 genes in STZinduced Alzheimeric rats. Mol Biol Rep. 2020:19. [DOI:10.1007/s11033-020-05629-7] [PMID]
Volume 31, January-February 2023
22. Khalili M, Kiasalari Z, Rahmati B, Narenjkar J.
Behavioral and histological analysis of Crocus
sativus
effect
in
intracerebroventricular
streptozotocin model of Alzheimer disease in rats.
Iran J Pathol. 2010;5(1):27-33.
23. Jayant S, Sharma BM, Bansal R, Sharma B.
Pharmacological benefits of selective modulation
of cannabinoid receptor type 2 (CB2) in
experimental Alzheimer's disease. Pharmacol.
Biochem. Behav. 2016;140:39-50.
[DOI:10.1016/j.pbb.2015.11.006] [PMID]
24. Lester-Coll N, Rivera EJ, Soscia SJ, Doiron K,
Wands JR, de la Monte SM. Intracerebral
streptozotocin model of type 3 diabetes: relevance
to sporadic Alzheimer's disease. J Alzheimer's Dis.
2006;9(1):13-33. [DOI:10.3233/JAD-2006-9102]
[PMID]
25. Chen S, Liu AR, An FM, Yao WB, Gao XD.
Amelioration of neurodegenerative changes in
cellular and rat models of diabetes-related
Alzheimer's disease by exendin-4. Age. 2012;
34(5):1211-24. [DOI:10.1007/s11357-011-93038] [PMID] [PMCID]
26. Suenaga T, Hirano A, Llena J, Yen SH, Dickson
DW. Modified Bielschowsky stain and
immunohistochemical studies on striatal plaques
in Alzheimer's disease. Acta Neuropathol. 1990;
80(3):280-6. [DOI:10.1007/BF00294646] [PMID]
27. Deng Y, Xiao L, Li W, et al. Plasma long
noncoding RNA 51A as a stable biomarker of
Alzheimer's disease. Int J Clin Exp Pathol. 2017;
10:4694-9.
28. La Rosa LR, Perrone L, Nielsen MS, Calissano P,
Andersen OM, Matrone C. Y682G mutation of
amyloid precursor protein promotes endolysosomal dysfunction by disrupting APP-SorLA
interaction. Front Cell Neurosci. 2015;9:109.
[DOI:10.3389/fncel.2015.00109] [PMID]
[PMCID]
29. Ma QL, Teter B, Ubeda OJ, et al. Omega-3 fatty
acid
docosahexaenoic
acid
increases
SorLA/LR11, a sorting protein with reduced
expression in sporadic Alzheimer's disease (AD):
relevance to AD prevention. J Neurosci. 2007;27
(52):14299-307. [PMID] [PMCID]
[DOI:10.1523/JNEUROSCI.3593-07.2007]
30. Willnow TE, Andersen OM. Sorting receptor
SORLA-a trafficking path to avoid Alzheimer
Journal of Advances in Medical and Biomedical Research
92 Effect of Memantine on NAT-Rad18, Rad18 and Sorl1
disease. J Cell Sci. 2013;126(13):2751-60.
[DOI:10.1242/jcs.125393] [PMID]
31. Folch J, Busquets O, Ettcheto M, et al. Memantine
for the treatment of dementia: a review on its
current and future applications. J Alzheimers Dis.
2018;62(3):1223-40. [DOI:10.3233/JAD-170672]
[PMID] [PMCID]
32. Feng L, Liao YT, He JC, et al. Plasma long noncoding RNA BACE1 as a novel biomarker for
diagnosis of Alzheimer disease. BMC Neurol.
2018;18(1):4. [DOI:10.1186/s12883-017-1008-x]
[PMID] [PMCID]
How to Cite This Article:
Azadfar P, Noormohammadi Z, Noroozian M, Eidi A, Mortazavi P. Effect of Memantine on Expression of NATRad18, Rad18 and Sorl1 Genes in Rat Model of Alzheimer's Disease. J Adv Med Biomed Res. 2023; 31(144):
86-92.
Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:
Mendeley
Zotero
Volume 31, January-February 2023
RefWorks
Journal of Advances in Medical and Biomedical Research