Acta Oto-Laryngologica
ISSN: 0001-6489 (Print) 1651-2251 (Online) Journal homepage: http://www.tandfonline.com/loi/ioto20
Transplantation of mouse-induced pluripotent
stem cells into the cochlea for the treatment of
sensorineural hearing loss
Jing Chen, Lina Guan, Hengtao Zhu, Shan Xiong, Liang Zeng & Hongqun Jiang
To cite this article: Jing Chen, Lina Guan, Hengtao Zhu, Shan Xiong, Liang Zeng &
Hongqun Jiang (2017): Transplantation of mouse-induced pluripotent stem cells into the
cochlea for the treatment of sensorineural hearing loss, Acta Oto-Laryngologica, DOI:
10.1080/00016489.2017.1342045
To link to this article: http://dx.doi.org/10.1080/00016489.2017.1342045
Published online: 23 Jun 2017.
Submit your article to this journal
Article views: 2
View related articles
View Crossmark data
Full Terms & Conditions of access and use can be found at
http://www.tandfonline.com/action/journalInformation?journalCode=ioto20
Download by: [Cornell University Library]
Date: 25 June 2017, At: 00:58
ACTA OTO-LARYNGOLOGICA, 2017
https://doi.org/10.1080/00016489.2017.1342045
RESEARCH ARTICLE
Transplantation of mouse-induced pluripotent stem cells into the cochlea for
the treatment of sensorineural hearing loss
Jing Chen, Lina Guan, Hengtao Zhu, Shan Xiong, Liang Zeng and Hongqun Jiang
Department of Otorhinolaryngology Head and Neck Surgery, the First Affiliated Hospital of Nanchang University, Nanchang, China
ABSTRACT
ARTICLE HISTORY
Conclusion: Mouse-induced pluripotent stem cells (iPSCs) could differentiate into hair cell-like cells
and spiral ganglion-like cells after transplantation into mouse cochleae, but it cannot improve the
auditory brain response (ABR) thresholds in short term.
Objective: To evaluate the potential of iPSCs for use as a source of transplants for the treatment of
sensorineural hearing loss (SNHL).
Methods: Establishing SNHL mice model, then injecting the iPSCs or equal volume DMEM basic
medium into the cochleae, respectively. Immunofluorescence staining and reverse transcriptionpolymerase chain reaction (RT-PCR) were used to assess the survival, migration, differentiation of the
transplanted iPSCs in cochleae and then recorded the ABR threshold in different time.
Hematoxylin–eosin (HE) staining was used to observe the teratoma formation.
Results: Four weeks after transplantation, CM-Di1-labeled iPSCs could be found in the modiolus and
Rosenthal’s canal (RC), and some of them could expressed auditory hair cell markers or spiral ganglion
neuron makers in group A, but not found in group B and C. As to the ABR threshold, no significance
differences were found between pre- with postoperative in group A or B. In our study, no teratoma
was observed in the cochleae.
Received 26 April 2017
Revised 1 June 2017
Accepted 5 June 2017
Introduction
Hearing is a primary perception and social communication
for individuals. Hearing impairment seriously affect the
quality of life, especially in childhood, which also can led to
speech and language delay or disorder. A report in 2005
from the WHO showed that approximately 278 million people worldwide were living with disabling hearing impairment. One quarter of hearing impairment began during
childhood, and 80% of all deaf and hearing impaired people
live in low- and middle-income countries. There are many
factors include noise, ototoxic drug, genetic disorder, age
and so on, which may cause hearing impairment. We
observed that most of the patients with hearing disorder are
sensorineural hearing loss. The main pathological changes
are degeneration or lack of cochlear hair cells and/or spiral
ganglion neurons. The mammalian cochlea hair cells and
spiral ganglion neurons cannot regenerate and repair after
damaged. Thus, how to repair the damaged hair cells and
spiral ganglion neurons and restore its function has become
the hot topics of otology research. Scientists from all over
the world are researching on etiology of treatment methods
to restore the morphology and function of damaged hair
cells and spiral ganglion neurons, in which cell transplantation is one choice of the treatment methods. With stem cell
KEYWORDS
Induced pluripotent stem
cells; inner ear
transplantation; auditory
hair cells; spiral ganglion;
cell differentiation; cell
therapy
technology rapid development, the methods in animal models have made gratifying progress [1–3].
In this study, we established the SNHL model of mice.
Then, the iPSCs were transplanted into the cochleae of
SNHL mice and identified the iPSCs could differentiated
into hair cell-like cells and spiral ganglion-like cells by the
methods of immunofluorescence staining and RT-PCR;
Comparing the hearing changes pre- and postoperatively
and identifying the tumorigenicity of iPSCs in vivo.
Accordingly, it provided a preliminary scientific basis for
the treatment of sensorineral hearing loss by transplanting
the iPSCs into the cochleae.
Materials and methods
Animals and group setting
The normal ICR mice (SCXK201-0001) were bought from
Vital River Laboratory Animal Technology Company
Limited as the experimental animal. The Animal Research
Committee of the Nanchang University Graduate School of
Medicine approved all experimental protocols, which were
performed in accordance with the National Institutes of
Health Guidelines for the Care and Use of Laboratory
Animals.
CONTACT Hongqun Jiang
jianghongqun@sohu.com
Department of Otorhinolaryngology Head and Neck Surgery, the First Affiliated Hospital of Nanchang
University, No. 17, YongWaiZheng Road, Nanchang 330006, PR China
These authors contributed equally to the study.
ß 2017 Acta Oto-Laryngologica AB (Ltd)
2
J. CHEN ET AL.
We established the SNHL mice model by intraperitoneally
injected of the neomycin solution (40 mg/mL in physiological
saline; Sigma, St Louis, MO) into the 14-day-old normal ICR
mice for 12 days. This kind of administration of to the mice
caused loss of almost all the auditory hair cells, resulting in
severe sensorineural hearing loss. Two weeks later, the
thresholds of ABR were recorded to monitor the mice’s hearing level. The thresholds of ABR were more than 70dBnHL
would be selected as SNHL mice. Then, we proceeded the
experiment groups. Group A: 20 SNHL mice, which were
transplanted of the mouse iPSCs into the cochleae; Group B:
20 SNHL mice which were injected of equal volume DMEM
basic medium into the cochleae; Group C: 20 normal mice.
The thresholds of ABR of the mice were recorded in different
periods after transplantation.
window niche (Figure 1), then injected the iPS cells suspension (1 106 cells in 5 lL) by using a Hamilton syringe and
infusion pump at the speed of 1 lL per min. The needle was
left in place for an additional 2 min and then removed
slowly. The hole in the cochlea and acoustic capsule was
sealed with muscle and sutured the incision. To prevent
bacterial infection of the inner ear, cefazolin was injected
intraperitoneally at a dose of 500 mg/kg/day for 3 days.
Tissue preparation and immunohistochemistry
Transplantation procedure
The mice were fed in the cage, under normal condition for
4 weeks after transplantation. The cochleae were dissected
and fixed in 4% paraformaldehyde solution for 24 h and
then decalcified in 10% EDTA/PBS for 4–5 days at 4 C.
After that, the samples were dehydrated in sucrose solution
of 15–30% and embedded in OCT. Frozen sections, 6 lm
thick, were prepared with freezing microtome (Leica,
Germany). The sections were used for immunofluorescence
staining. The primary antibodies used were as follows: antiMyosin 7a rabbit polyclonal antibody (1:250; Abcam,
England), anti-Math1 rabbit polyclonal antibody (1:100;
Abcam, England), anti-Calretinin rabbit monoclonal antibody (1:50; Abcam, England), anti-Nestin rat monoclonal
antibody (1:250; Abcam, England), anti-Neurofliment-M
rabbit polyclonal antibody (1:400; Abcam, England), antitubulinb-III rabbit polyclonal antibody (1:1000; Abcam,
England). The secondary antibodies used were DyLight 488
anti-rabbit or rat antibody (1:100; Earthox, USA). Specimens
were observed under a laser confocal microscope (Zeiss LSM
700, Germany).
Several sections random selection were used for HE
staining to identify whether teratoma formation after iPSCs
transplantation.
To transplant the CM-Di1-labeled iPSCs into the SNHL
mice cochleae, we used general anesthesia with 4% chloral
hydrate and local anesthesia with 0.5% lidocaine. The left
otic bulla of each animal was opened to expose the round
RT-PCR
Four weeks postoperation, total RNA was extracted from the
left cochleae of each group and then detected the expression
Cells and characterization
Mouse iPSCs were bought from SiDanSai Biotechnology
Co., Ltd which were cultured as described previously [4].
Before transplantation, we identified the pluripotency of
iPSCs by using the method of RT-PCR. The polymerase
chain reaction was performed with following primer pairs
(gene, forward, reverse, cDNA product length): Nanog,
CCTCCAGCAGATGCAAGAACT, AGTCCTCCCCGAAGT
TATGGA, 398bp; Oct4, GTTTCTGAAGTGCCCGAAGC,
CAGAGCAGTAACGGGAACA, 313bp; Sox2, TAGAGCTA
GACTCCGGGCGATGA, TTGCCTTAAACAAGACCACGA
AA, 297bp; Gapdh, ACCACAGTCCATGCCATCAC, TCC
ACCACCCTGTTGCTGTA, 452bp. Mouse iPSCs were
labeled with fluorescent dye CM-Di1.
Figure 1. (a). The exposed otic bulla and facial nerve; (b) The site of round window niche and stapedial artery.
ACTA OTO-LARYNGOLOGICA
of hair cell and nerve cell-related genes through the method
of RT-PCR. We used the following primer pairs (protein,
forward, reverse, and cDNA product length): Myosin7a,
GCTGTATTATCAGCGGGGAG, CAGGTGATGCAGTTAC
CCATG, 409bp; Math1, GAAGGGTGGGGTTGTAGTGG,
CTCCGACAGAGCGTTGATGT, 247bp; Nestin, AGCAGG
TGAACAAGACTCCG, AGAGGCCCAAGGGAGTAGAG-3,
668bp; Neurofliment Medium, GCTTACGACCAGGAGAT
CCG, ATGGCCTCCTTGTTCTGCTC, 485bp; Tubulinb-III,
GCCTTTTCGTCTCTAGCCGC, CTGACCAGGGAATCGA
AGGG, 766bp.
Results
Identification of mice iPSCs
Before transplantation, we identified the pluripotency of
Mouse iPSCs by RT-PCR. We demonstrated that the iPSCs
could express the pluripotent genes Nanog, Oct4, Sox2. By
contrast, the mouse embryonic fibrolasts (MEF) could not
express those markers (Figure 2). This indicated that iPSCs
were in undifferentiated state, and could differentiate into
any cell types of three embryonic germ layers.
Analysis of ABR test in different periods
To observe the functional effect of cochleae after iPSCs transplantation, we recorded the ABR threshold of the mice at special time. The result showed, the ABR threshold of group C
were in a stable scope from 15dBnHL to 25dBnHL, the SNHL
model mice were from 70dBnHL to 80dBnHL, the group A
mice were from 55dBnHL to 80dBnHL at different periods.
After 12 weeks, the threshold of ABR began to have the
improved tendency in group A. But in group B, the threshold
of ABR were more than 70dBnHL at different period. At last,
3
we compared the ABR threshold of group A and group B at
12 and 16 weeks after transplantation, difference was statistically significant (p < .05) (Table 1 and Figure 3).
Mouse iPSCs in cochleae differentiate toward auditory
hair cells
After transplantation of iPSCs into the cochleae of SNHL
mice 4 weeks, we observed that partial surviving iPSCs
labeled with fluorescent dye CM-Di1 were predominantly
located in the RC of the basal portion of the cochlea, which
partially express auditory hair cell markers Myosin7A,
Math1 and Calretinin (Figure 4(a–c)), indicating that iPSCs
could be successfully induced to differentiate into auditory
hair cell-like cells.
Mouse iPSCs in cochleae differentiate toward spiral
ganglion neuron
After the transplantation of iPSCs into the cochleae of SNHL
mice 4 weeks, we observed that partial surviving iPSCs labeled
with fluorescent dye CM-Di1 were predominantly located in
the RC of the basal portion of the cochlea. A few transplanted
cells were found in the cochlear modiolus, which partially
express neuron markers nestin, neurofilament medium
and tubulinb-III, which contacted with neurofilament
(Figure 5(a–c)), indicating that iPSCs could be successfully
induced to differentiate into spiral ganglion-like cells.
Expression of auditory hair cell and spiral ganglionrelated genes
To detect the expression of auditory hair cell and spiral
ganglion-related genes, we extracted total RNA from the left
Figure 2. RT-PCR analysis of pluripotent genes Nanog, Oct4, Sox2 expression in Mouse iPSCs, but not in MEF.
Table 1. ABR threshold of each group at different time points(dBnHL).
Group
N
Pre
4 weeks post
8 weeks post
12 weeks post
16 weeks post
A
B
C
F value
p value
10
10
10
75.50 ± 3.69
76.00 ± 3.94
20.50 ± 2.69a
713.630
.000
77.50 ± 2.64
77.50 ± 2.64
20.50 ± 2.69a
1181.455
.000
75.00 ± 3.33
76.50 ± 3.38
19.50 ± 4.38a
759.780
.000
71.50 ± 5.30
75.50 ± 2.84a
20.00 ± 4.71a
492.729
.000
69.00 ± 7.38
76.00 ± 3.94a
20.00 ± 4.08a
322.269
.000
a
comparing the ABR threshold of group B or group C with group A at the same period, difference was statistically significant (p < .01).
4
J. CHEN ET AL.
cochleae of each group mice at 4 weeks after transplantation
and then detect genes expression of hair cells (Myosin7a,
Math1) and spiral ganglion (nestin, neurofilament medium,
tubulinb-III) by RT-PCR. In our result, there were significant difference between each group (Figure 6), similarly to
result of immunofluorescence staining.
Figure 3. The change trend of each group ABR threshold at different period
during this study (preoperation, 4 weeks postoperation, 8 weeks postoperation,
12 weeks postoperation, 16 weeks postoperation).
Teratoma formation after transplantation
In our study, we found no teratoma formation after mouse
iPSCs transplantation at 4 weeks.
Discussion
As we know, embryonic stem cells (ESCs) have a very high
value in regenerative medicine, tissue engineering and many
other fields. Scientists have tried to get ESCs or ESC-like
cells from humans and other species in various ways. These
ways include: obtaining direct from the blastocyst separation
in vitro culture; somatic-cell nuclear transfer; obtaining
reprogramming cells after fusion of the somatic cells and
pluripotent cells; obtaining by putting the differentiated
somatic cell into the oocyte or pluripotent stem cell extracts
incubate in order to achieve reprogramming of somatic cells.
Although we can use these methods to obtain ECSs or ESCs
like cells, we still have a lot of limitations, such as technology, cell source, ethical issues, immune rejection and so on.
Unlike the ESCs, the iPSCs can avoid these problems, and
the preparation technology is mature [5,6], which provides a
theoretical basis for its wide application.
In 2006, Takahashi and Yamanaka [4] first announced
the successful derivation of iPSCs from adult mouse
Figure 4. (a). Transplanted iPSCs labeled with CM-Di1 in RC expressed hair cells marker Myosin 7A. (A) showed the overall organization of cochlea section,
transplanted cells were mainly found in RC in the basal portion of the cochlea (w in A). Blue fluorescence shows nuclear labeling with 40 ,6-diamino-2-phenylindole(DAPI). Scale bar ¼ 400 lm (A), 50 lm (B–E). ST, scale tympani; SM, scale media; SV, scale vestibule; MO, modiolus. (b). Transplanted iPSCs labeled
with CM-Di1 in RC expressed hair cells marker Math1. (A) showed the overall organization of cochlea section, transplanted cells were mainly found in RC in the
basal portion of the cochlea (w in A). Blue fluorescence shows nuclear labeling with 40 ,6-diamino-2-phenyl-indole (DAPI). Scale bar ¼ 400 lm(A), 100 lm (B–E). (c).
Transplanted iPSCs labeled with CM-Di1 in RC expressed hair cells marker calretinin. (A) showed the overall organization of cochlea section, transplanted cells were
mainly found in RC in the basal portion of the cochlea (w in A). Blue fluorescence shows nuclear labeling with 40 ,6-diamino-2-phenyl-indole(DAPI). Scale
bar ¼ 400 lm (A), 100 lm (B–E).
ACTA OTO-LARYNGOLOGICA
5
Figure 5. (a) Transplanted iPSCs labeled with CM-Di1 in RC expressed neuron markers nestin. (A) showed the overall organization of cochlea section, transplanted
cells were mainly found in RC in the basal portion of the cochlea (w in A). Blue fluorescence shows nuclear labeling with 40 ,6-diamino-2-phenyl-indole(DAPI). Scale
bar ¼ 400 lm (A), 100 lm (B–E). (b). Transplanted iPSCs labeled with CM-Di1 in RC expressed neuron markers neurofilament medium. (A) showed the overall organization of cochlea section, transplanted cells were mainly found in RC in the basal portion of the cochlea (w in A). Blue fluorescence shows nuclear labeling with
40 ,6-diamino-2-phenyl-indole (DAPI). Scale bar ¼ 400 lm (A), 100 lm (B–E). (c). Transplanted iPSCs labeled with CM-Di1 in RC expressed neuron markers tubulinb-III.
(A) showed the overall organization of cochlea section, transplanted cells were mainly found in cochlear modiolus and RC in the basal portion of the cochlea (w in
A). Blue fluorescence shows nuclear labeling with 40 ,6-diamino-2-phenyl-indole(DAPI). Scale bar ¼ 400 lm(A), 100 lm (B–E).
Figure 6. Expression of related genes at 4 weeks postoperation in each group.
fibroblasts through the ectopic coexpression of only four
genes: Oct3/4, Sox2, c-Myc, Klf4. Under the condition of ES
cell culture, these researchers found the four genes that were
sufficient to reprogram adult fibroblasts into iPSCs, iPSCs
are similar with ESCs in morphology and growth characteristics. After subcutaneous injection in nude mice, it can
induce the tumor of three germ layers. These indicate that
iPSCs maintain the key features of ESCs, including the ability to propagate in culture indefinitely and the capacity to
generate cells from each of the three embryonic germ layers;
in addition, iPSCs gene expression and surface antigen is
also the same as ESCs and can produce teratoma. It is
important that iPSCs can produce electrical activity under
neural induction [7]. Because iPSCs can be reprogrammed
from patients somatic cells, induced directional differentiation into needed cells for patients transplantation in vivo,
thus avoiding the immune rejection of their own; without
destroying the embryo in the process of preparation, so
there is no ethical issues.
However, viral vectors and cancer genes (c-Myc) are used
to reprogrammed the iPSCs, it has the potential risk of
tumorigenesis. Nishimura et al [3] evaluated the tumorigenesis risk of iPSCs and found that after transplanting the
iPSCs derived from different somatic cell into mice, the
iPSCs derived from adult mouse tail-tip fibroblasts had a
higher risk of tumorigenesis than iPS cells from mouse
embryonic fibroblasts. Avallone et al [8] demonstrated that
no tumors were observed in mice derived from iPSCs generated by using only three reprogramming factors (Oct3/4,
Klf4 and Sox2), eliminating c-Myc. In our study, HE staining was performed 4 weeks after transplantation and no
tumor formation was found in the frozen section of the
mouse cochlea. In summary, the iPSCs's tumor formation is
related to the origin of somatic cells and induction procedure, the local microenvironment may also affect the differentiation of transplanted cells [9].
Cell transplantation to repair the damaged auditory hair
cells and spiral ganglion neurons is a focus of research now,
which through the etiology to improve hearing so as to
6
J. CHEN ET AL.
cure SNHL. Previous research had studied various types of
cells used in the inner ear transplantation, for example,
embryonic stem cells [10], neural stem cells [9,11], dorsal
root ganglion [12], mesenchymal stem cells [13], or adult
stem cells [14], etc. Hildebrand et al [10] delivered undifferentiated and partially differentiated mouse embryonic stem
cells were delivered into the scala media through round window, found transplanted cells survived in the scala media
for a postoperative period of at least nine weeks and the
transplanted cells were discovered near the spiral ligament
and stria vascularis or spiral ligament. Tateya et al [11] demonstrated that fetal neural stem cells were transplanted into
the mouse inner ear after drug-induced injury, 30% of
which were found to be located in the spiral ganglion after
25 days. Although these cells could survive and differentiate
into hair cells and/or spiral neurons, they are difficult to
obtain and they have immune rejection and ethical issues,
which limit the clinical application. However, iPSCs can be
derived from autologous cells, thus avoiding donor restrictions, related immunological rejection and ethical issues. It
has been confirmed that iPSCs can differentiate into the
mechanosensitive hair cell-like cells in vitro through induced
by cytokines and coculture [15]. In vivo experiments,
Nishimura et al [16] found 50% of iPSCs induced by SDIA
could differentiate into the neural lineage which projected
neurites toward cochlear hair cells and the settlement of iPS
cell-derived neurons was observed 1 week after transplantation into the cochlea; Besides, Some transplants expressed
vesicular glutamate transporter 1, which is a marker for glutamatergic neurons, suggesting that iPSCs has the potential
to differentiate into auditory neurons in vivo and in vitro.
In our research, aminoglycoside antibiotic neomycin was
used to damage the cochlear hair cells, causing delayed death
of neurons, thus setting up SNHL model; then, we transplanted iPSCs to Rosenthal's canal through the round window niche.4 weeks after transplantation, we found that the
injected iPSCs expressed auditory hair cell markers
(Myosin7A, Math1, Calretinin) and spiral ganglion neuron
markers (nestin, neurofilament medium, tubulinb-III), which
indicated that iPSCs can be successfully induced to differentiate into hair cell-like cells and spiral ganglion neuron-like
cells. Myosin 7A now is considered as high specificity marker
of the mammalian inner ear hair cells. It belongs to the member of the family of myoglobulin, which plays an important
role in the survival and function of hair cells, which is now
widely used to identify hair cells. Math1 is essential for the
generation of mouse inner ear hair cells, which are expressed
from early stage of hair cell formation to maturation; calretinin is an early specific molecular marker of vestibular hair
cells. In this study, we can see the transplanted cells expressed
Myosin 7A, Math1, Calretinin, possible mechanisms may be
the related cytokines in the cochlea lymph or the beneficial
substances secreted by auditory cortex induce stem cells to
differentiate to hair cells. Nestin is expressed high in neural
precursor cells and can trace the differentiation of neural
stem cells into neurons, when fully differentiated into neurons, it can be replaced by neurofilament medium, but in the
middle of the process, both can exist at the same time
[17,18]. Neurofilament medium and tubulinb-III are
important structural protein of neurons, which can be used
to identify whether neural stem cells have differentiated into
neurons [19,20]. Therefore, the expression of the three
markers demonstrated that the transplanted iPSCs have differentiated into neural precursor cells not fully differentiated
into neuron and maintain the characteristics of stem cells. It
can be seen from the cell morphology of immunofluorescence
that only a small amount of cell-expressed red fluorescence
has nerve fiber structure, most of which were still in round or
oval cell morphology. To sum up, These results show that
iPSCs transplanted to the cochlea can survive, migrate locally
and differentiate into hair cell-like cells and spiral ganglionlike cells, which indicate that iPSCs have potential to repair
the damaged cochlear hair cells and spiral ganglion neurons;
however, we failed to continue to observe the survival time
and final differentiation of the stem cells in the cochlea,
which need further study.
According to the ABR recording, There are significant
differences between group A and group B in 12 weeks and
16 weeks after transplantation, which suggests that ABR
threshold of mice in group A is slightly better than in group
B, but it still belongs to the category of severe hearing loss
and unable to improve auditory threshold in deaf mice
effectively. The reason may be that transplanted cells differentiating into new auditory hair cells and spiral ganglion
neurons can secrete some cytokines that support the growth
of the remaining neurons and strengthen the formation of
synaptic connections with host neurons, which is beneficial
to self-repair of peripheral auditory system; however, this
kind of repair is limited, which may be due to the limitation
of the number and the degree of differentiation of the transplanted cells make it difficult to reach the normal level.
In other words, this experiment showed that the transplanted iPSCs in the cochlea can make ABR threshold slightly
lower in SNHL mice, but when compared with the normal
level, there is still a large gap. Furthermore, due to restriction
of iPSCs in vivo tracer (fluorescence quenching after a long
time), we failed to observe the structural changes and cell
differentiation in the cochlea when the ABR threshold was
lower, this step needs to be improved. Our results suggest
that cell transplantation in the treatment of SNHL is still a
long and promising research process, There will be a lot of
work to do until it is applied to the clinic.
Acknowledgments
This study was supported by the National Natural Science Grants of
China (No.81160126). We thank Hong Tu for his advise of statistical
analysis, and Yanhong Chen for her advise of anatomy of cochlea.
Disclosures statement
The authors report no conflicts of interest. The authors alone are
responsible for the content and writing of the paper.
Funding
This study was supported by the National Natural Science Grants of
China (No.81160126).
ACTA OTO-LARYNGOLOGICA
References
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
Zhao L, Li L, Wu N, et al. Migration and differentiation of
mouse embryonic stem cells transplanted into mature cochlea
of rats with aminoglycoside-induced hearing loss. Acta OtoLaryngologica. 2013;133:136–143.
Corrales CE, Pan LY, Li HW, et al. Engraftment and differentiation of embryonic stem cell-derived neural progenitor cells in
the cochlear nerve trunk: growth of processes into the organ of
corti. J Neurobiol. 2006;66:1489–1500.
Nishimura K, Nakagawa T, Sakamoto T, et al. Fates of murine
pluripotent stem cell-derived neural progenitors following
transplantation into mouse cochleae. Cell transplant.
2012;21:763–771.
Takahashi K, Yamanaka S. Induction of pluripotent stem cells
from mouse embryonic and adult fibroblast cultures by defined
factors. Cell. 2006;126:663–676.
Yoshida Y, Takahashi K, Okita K, et al. Hypoxia enhances the
generation of induced pluripotent stem cells. Cell Stem Cell.
2009;5:237–241.
Kim K, Doi A, Wen B, et al. Epigenetic memory in induced
pluripotent stem cells. Nature. 2010;467:285–290.
Jiang P, Rushing SN, Kong CW, et al. Electrophysiological
properties of human induced pluripotent stem cells. Am J
Physiol Cell Physiol. 2010;298:486–495.
Hamanaka S, Yamaguchi T, Kobayashi T, et al. Generation of
germline-competent rat induced pluripotent stem cells. PLoS
One. 2011;6:e22008.
Parker MA, Corliss DA, Gray B, et al. Neural stem cells
injected into the sound-damaged cochlea migrate throughout the cochlea and express markers of hair cells, supporting cells, and spiral ganglion cells. Hear Res. 2007;232:
29–43.
Hildebrand MS, Dahl HM, Hardman J, et al. Survival of
partially differentiated mouse embryonic stem cells in the
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
7
Scala Media of the Guinea pig cochlea. JARO. 2005;
6:341–354.
Tateya I, Nakagawa T, Iguchi F, et al. Fate of neural stem cells
grafted into injured inner ears of mice. Neuroreport.
2003;14:1677–1681.
Olivius P, Alexandrov L, Miller J, et al. Allografted fetal dorsal
root ganglion neuronal survival in the guinea pig cochlea. Brain
Res. 2003;979:1–6.
Matsuoka AJ, Kondo T, Miyamoto RT, et al. Enhanced survival
of bone-marrow-derived pluripotent stem cells in an animal
model of auditory neuropathy. Laryngoscope. 2007;117:
1629–1635.
Senn P, Heller S. Stem-cell-based approaches for treating inner
ear diseases. HNO. 2008;56:21–26.
Oshima K, Shin K, Diensthuber M, et al. Mechanosensitive hair
cell-like cells from embryonic and induced pluripotent stem
cells. Cell. 2010;141:704–716.
Nishimura K, Nakagawa T, Ono K, et al. Transplantation of
mouse induced pluripotent stem cells into the cochlea.
NeuroReport. 2009;20:1250–1254.
Chou YH, Khuon S, Herrmann H, et al. Nestin promotes the
phosphorylation-dependent disassembly of vimentin intermediate filaments during mitosis. Mol Biol Cell. 2003;14:1468–1478.
Messam CA, Hou J, Major EO. Coexpression of nestin in
neural and glial cells in the developing human CNS defined by
a human-specific anti-nestin antibody. Exp Neurol.
2000;161:585–596.
Jeong SW, Chu K, Jung KH, et al. Human neural stem cell
transplantation promotes functional recovery in rats with
experimental
intracerebral
hemorrhage.
Stroke.
2003;34:2258–2263.
Yang M, Stull ND, Berk MA, et al. Neural stem cells spontaneously express dopaminergic traits after transplantation into the
intact or 6-hydroxydopamine-lesioned rat. Exp Neurol.
2002;177:50–60.