Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients

JNI-475720; No of Pages 10 Journal of Neuroimmunology xxx (2013) xxx–xxx Contents lists available at SciVerse ScienceDirect Journal of Neuroimmunology journal homepage: www.elsevier.com/locate/jneuroim Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients Judith Fraussen a, Kathleen Vrolix b, Nele Claes a, Pilar Martinez-Martinez b, Mario Losen b, Raymond Hupperts b,c, Bart Van Wijmeersch a,d,e, Mercedes Espiño f, Luisa M. Villar f, Marc H. De Baets a,b, Piet Stinissen a, Veerle Somers a,⁎,1 a Hasselt University, Biomedical Research Institute and Transnationale Universiteit Limburg, School of Life Sciences, Diepenbeek, Belgium Department of Neuroscience, School of Mental Health and Neuroscience, Maastricht University, Maastricht, The Netherlands c Department of Neurology, Orbis Medical Center, Sittard, The Netherlands d REVAL Rehabilitation Research Center, Department of Healthcare, PHL University College, Diepenbeek, Belgium e Revalidatie & MS-Centrum, Overpelt, Belgium f Department of Immunology, Ramón y Cajal Hospital, Madrid, Spain b a r t i c l e i n f o Article history: Received 5 March 2013 Received in revised form 8 May 2013 Accepted 9 May 2013 Available online xxxx Keywords: Multiple sclerosis Clinically isolated syndrome B cell immortalization Complementarity determining region 3 Clonal B cell expansion Autoreactivity a b s t r a c t We studied Ig heavy chain (VDJ) sequences and antigen reactivity of 412 immortalized B cell lines from the peripheral blood of 10 multiple sclerosis (MS) patients, 4 clinically isolated syndrome (CIS) patients and 6 healthy controls (HCs). 78/238 (32.8%) MS and CIS B cell lines were part of 9 clonally expanded B cell populations, of which 5 were present in multiple patients. Increased VH1 gene family usage was evidenced for MS B cells, with 29.2% expressing VH1–69. Affinity maturation in MS and CIS was indicated by increased Ig VDJ mutations. Autoantibody producing B cells reactive to intracellular antigens were significantly higher in MS (25%) and CIS (28%) patients than in HCs (5%), including 3/9 expanded B cell clones. Specificity for phosphatidylcholine was observed for 1/9 B cell clones. These findings indicate clonally expanded autoreactive B cells with affinity maturation in the peripheral blood in MS and CIS. © 2013 Elsevier B.V. All rights reserved. 1. Introduction B cells and antibodies are clearly implicated in the immune pathogenesis of multiple sclerosis (MS) (Fraussen et al., 2009) and its first clinical manifestation, clinically isolated syndrome (CIS) (Miller et al., 2005; Bennett et al., 2008; Lee-Chang et al., 2011), that progresses into clinically definite MS in 63% of cases (Miller et al., 2005; Fisniku et al., 2008). The most important evidence for the involvement of B cells comes from the finding of oligoclonal immunoglobulin G (IgG) bands (OCBs) in the cerebrospinal fluid (CSF) of more than 90% of MS patients (Kabat et al., 1948; Cole et al., 1998). Further, the presence of B cells, plasma cells, complement, myelin-specific antibodies and B cell cytokines was reported in chronic MS lesions (Esiri, 1977; Gerritse et al., 1994; Genain et al., 1999; Archelos et al., 2000; Cross et al., 2001; Krumbholz et al., 2005; Ziemssen and Ziemssen, 2005). The most frequent (approximately 58%) lesion type in MS ⁎ Corresponding author at: Hasselt University, Biomedical Research Institute and Transnationale Universiteit Limburg, School of Life Sciences, Agoralaan, Building C, 3590 Diepenbeek, Belgium. Tel.: + 32 11269202; fax: + 32 11269299. E-mail address: veerle.somers@uhasselt.be (V. Somers). 1 Postal address: Hasselt University, Martelarenlaan 42, Hasselt, Belgium. patients is the pattern II demyelinating lesion, characterized by immunoglobulin (Ig) deposits and involvement of the complement system (Lucchinetti et al., 2000). In addition, B cell follicle-like structures were characterized in the meninges of MS patients (Serafini et al., 2004), while positive results have recently been achieved using the B cell depleting anti-CD20 antibody rituximab in clinical trials (Bar-Or et al., 2008; Hauser et al., 2008; Stuve et al., 2009; Naismith et al., 2010). In the last decade, a lot of studies have been performed to analyze Ig heavy (H) chain variable (V) sequences (VH) of B cells from MS patients, usually following single-cell sorting or laser-capture microdissection. B cells from the CSF and brain of MS patients were characterized by a chronic antigen-driven B cell response, as evidenced by the restricted usage of Ig VH gene segments (Owens et al., 1998; Qin et al., 1998; Baranzini et al., 1999; Colombo et al., 2000, 2003; Owens et al., 2003; Qin et al., 2003). Intraclonal diversification of these clonally expanded B cells was shown in multiple studies (Colombo et al., 2000, 2003; Ritchie et al., 2004; Monson et al., 2005). Furthermore, skewed Ig VH gene family usage with an overrepresentation of VH1, VH3 and VH4 family members has been pointed out (Owens et al., 1998; Baranzini et al., 1999; Colombo et al., 2000, 2003; Owens et al., 2003; Qin et al., 2003; Monson et al., 2005). 0165-5728/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jneuroim.2013.05.002 Please cite this article as: Fraussen, J., et al., Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients, J. Neuroimmunol. (2013), http://dx.doi.org/10.1016/j.jneuroim.2013.05.002 J. Fraussen et al. / Journal of Neuroimmunology xxx (2013) xxx–xxx 2 McDonald criteria (McDonald et al., 2001; Polman et al., 2011). The MS group was characterized by an average age of 42.8 ± 9.9 years and included 206 peripheral Ig VH sequences. Further, 32 Ig VH sequences were examined from the CIS group, with an average age of 36.3 ± 14.5 years. As a control, 174 immortalized B cell lines from the peripheral blood of 6 HCs were included, with an average age of 37.3 ± 15.3 years. Informed consent was obtained from the subjects included in the study. The study was approved by the institutional ethics committee. Clinical characteristics of MS and CIS patients are shown in Table 1. Increased Ig gene mutation numbers in B cells from CSF and plaques of MS patients were demonstrated, suggesting ongoing affinity maturation (Smith-Jensen et al., 2000; Owens et al., 2003; Monson et al., 2005; Harp et al., 2007). Similar features were reported in the CSF of CIS patients (Qin et al., 2003; Bennett et al., 2008) but also in other autoimmune diseases, such as myasthenia gravis (MG) (Graus et al., 1995; Graus et al., 1997; Vrolix et al., 2010). Indications for intact receptor editing were additionally found in MS CSF B cells (Owens et al., 2003; Monson et al., 2005; Harp et al., 2007). B cells appeared to be selected in the context of a germinal center (GC) through mutation targeting to RGYW motifs in the complementarity determining region (CDR) (Qin et al., 2003; Harp et al., 2007), although this was challenged by others (Monson et al., 2005). The role of peripheral B cell responses in MS and CIS has remained unclear up to now. Some studies that examined Ig VH sequences of peripheral B cells could not detect clonal B cell populations in peripheral blood and were unable to discriminate between peripheral B cell responses in healthy controls (HCs) and MS or CIS patients (Colombo et al., 2000; Owens et al., 2007; Bennett et al., 2008). Recently, however, bidirectional exchange of clonally related B cells across the blood–brain barrier (BBB) was indicated (von Budingen et al., 2012). In this study, a molecular analysis of the B cell receptor (BCR) VH region was performed using 10 IgM+ and 402 IgG+ immortalized B cell lines that were generated from peripheral blood B cells of MS patients, CIS patients and HCs. The aim was to characterize the peripheral B cell repertoire of MS and CIS patients in more detail in terms of diversity, clonal expansion and antigen reactivity. The latter was done by detecting antibody binding to different cell types, including a human oligodendroglioma (HOG) and an astrocytoma (U251) cell line. Reactivity to myelin lipid was investigated by detecting binding of the antibodies to phosphatidylcholine (PC). Molecular characterization of peripheral B cells in MS and CIS patients could provide more insight into B cell responses in both the early phase and in established disease. 2.2. B cell immortalization B cell immortalization was performed using simultaneous or sequential B cell stimulation and infection with Epstein–Barr virus (EBV), as described before (Fraussen et al., 2010). Immortalizations were done with total PBMC for MS-1, MS-2, MS-3 and CIS-1, resulting in the generation of both IgM+ and IgG+ immortalized B cell lines. In order to select for IgG+ memory B cells, purified IgG+ B cells were used for immortalizations of all other MS and CIS patients and also for the HCs. Immortalized B cells were cultured in RPMI 1640 medium supplemented with L-glutamine, 10 mM HEPES buffer, 1 mM sodium pyruvate, 50 U/ml penicillin, 50 μg/ml streptomycin (all obtained from Invitrogen Life Technologies, Merelbeke, Belgium) and 10% heat-inactivated fetal bovine serum (FBS, HyClone Europe, Erembodegem, Belgium). 2.3. Sequencing analysis of Ig VH region For each immortalized B cell line, genomic DNA (gDNA) was first isolated out of 0.5–1 × 106 immortalized B cells. Cells were lysed overnight at 37 °C in lysis buffer (10 mM Tris–Cl, 0.4 M NaCl, 2.4 mM EDTA), 0.5% sodium dodecyl sulphate (SDS) and 0.2% proteinase K solution in 35 mM SDS, 2.4 mM EDTA. The gDNA was then purified using a chloroform based extraction process, precipitated by ethanol and resuspended in sterilized water. The Ig VH region was amplified from 100 ng gDNA using a reverse consensus primer directed against the conserved joining (J) region in combination with a mixture of forward primers targeting the different VH families of framework region 1 (FR1). Reaction mixtures consisted of 1 × PCR buffer, 0.25 mM dNTPs, 1 U Taq polymerase 2. Materials and methods 2.1. Study population Peripheral blood was obtained from 10 MS patients, 4 CIS patients and 6 HCs. MS and CIS patients were diagnosed according to the Table 1 Clinical features of MS and CIS patients. Age MS typea Disease durationb Treatmentc EDSSd OCBe Analyzed sequences PBMC or IgG+ B cellsf IgG+ IgM+ MS patients MS-1 F MS-2 M MS-3 F MS-4 F MS-5 F MS-6 F MS-7 F MS-8 F MS-9 F MS-10 F 27 27 42 49 47 60 43 46 40 47 RR RR RR PP RR SP RR RR RR RR 2 3 17 2 0.5 23 18 4 6 0.5 Untreated Untreated Untreated Untreated Untreated Untreated Untreated IFN-β IFN-β Untreated 6.0 2.0 3.0 2.0 1.5 3.0 3.0 3.5 1.5 2.0 10 (2) 18 (2) 8 (0) 0 (NA) 8 (0) NA NA NA NA 15(0) 7 2 7 9 11 4 18 18 65 65 PBMC PBMC PBMC IgG+ B cells IgG+ B cells IgG+ B cells IgG+ B cells IgG+ B cells IgG+ B cells IgG+ B cells 1g 0g 3 9 11 4 18 18 65 65 3g 1g 4 0 0 0 0 0 0 0 CIS patients CIS-1 F CIS-2 F CIS-3 F CIS-4 M 40 36 52 17 / / / / 1 12 3 0.5 Untreated IFN-β Untreated Untreated 2.0 0.0 0.0 2.0 0 (NA) 0 (NA) 0 (NA) 0 (NA) 3 3 6 20 PBMC IgG+ B cells IgG+ B cells IgG+ B cells 1 3 6 20 2 0 0 0 Subject a b c d e f g Sex RR: relapsing–remitting MS, PP: primary progressive MS, SP: secondary progressive MS. In years. IFN-β: interferon-beta. EDSS: Expanded Disability Status Scale. OCB in CSF, (): OCB in serum, NA: not available. Immortalization started with total PBMC or purified IgG+ B cells. Antibody concentrations of some B cell lines were too low to determine the isotype. Please cite this article as: Fraussen, J., et al., Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients, J. Neuroimmunol. (2013), http://dx.doi.org/10.1016/j.jneuroim.2013.05.002 J. Fraussen et al. / Journal of Neuroimmunology xxx (2013) xxx–xxx (Roche Diagnostics, Brussels, Belgium) and 10 pmol of all primers (Eurogentec, Seraing, Belgium). PCR conditions were 7 min at 95 °C, 35 cycles at 95 °C for 45 s, 60 °C for 45 s and 72 °C for 90 s and 10 min at 72 °C. Primer sequences were designed and tested during the BIOMED-2 Concerted Action as described by van Dongen et al. (2003) and are shown in Table 2. The reverse sequence of the purified PCR products (ExoSAP-IT, Affymetrix, Ohio, USA) was determined using the reverse J primer and Big Dye TMT Terminator Cycle Sequence Ready Reaction Kit II (Applied Biosystems, Warrington, United Kingdom) on ABI Prism 310 Genetic Analyzer (Applied Biosystems). The Ig VH region was subsequently sequenced in the forward direction by means of a VH family specific forward primer using the same procedure. Alignment of the Ig VH sequences to germline V gene segments, mutation analysis and CDR3 analysis were performed using JOINSOLVER software (Souto-Carneiro et al., 2004). CDR3 amino acid (aa) charge and composition were determined using DNAMAN software version 4.15. Sequences are submitted in GenBank under the accession numbers JF764087–JF764370 and JX945171–JX945323 (http://www.ncbi. nlm.nih.gov/genbank/). 2.4. Flow cytometry Culture supernatant of immortalized B cells was used to detect antibody binding to a human oligodendroglioma (HOG) cell line, peripheral blood mononuclear cells (PBMCs) and a human adenocarcinomic alveolar epithelial (A549) cell line. The latter was included as a negative control. Incubations were done at 4 °C for PBMC and on ice for HOG and A549. Extracellular antibody binding was measured by incubation of 1 × 105 cells (HOG/A549/PBMC) with 100 μl culture supernatant (IgG concentrations from 0.5 to 50 μg/ml) for 1 h. Next, the cells were incubated for 30 min with a FITC-conjugated goat anti-human IgG (1:100, 10 μg/ml, AbD Serotec, Düsseldorf, Germany). Human IgG1 and IgG4 antibodies, both directed against the acetylcholine receptor (AChR, mAb637) were used as isotype controls (van der Neut et al., 2007; Luo et al., 2009). 7-AAD was used to gate on living cells. Intracellular antibody binding was measured similarly, using the BD Cytofix/Cytoperm™ Kit (BD Biosciences, Erembodegem, Belgium). The cells were analyzed on a FACSCalibur flow cytometer using CellQuest software (BD Biosciences). Mean fluorescence intensity (MFI) analysis was done by gating on living cells, followed by correction for background staining. Mean + 3 SD of the HC B cell lines was used as a cut-off for a Table 2 Primer sequences for Ig VH region sequence analysis. Target region FR1 FR2 FR3 J Gene family VH1 VH2 VH3 VH4 VH5 VH6 VH1 VH2 VH3 VH4 VH5 VH6 VH7 VH1 VH2 VH3 VH4 VH5 VH6 VH7 / Primer sequence 5′ GGCCTCAGTGAAGGTCTCCTGCAAG 3′ 5′ GTCTGGTCCTACGCTGGTGAAACCC 3′ 5′ CTGGGGGGTCCCTGAGACTCTCCTG 3′ 5′ CTTCGGAGACCCTGTCCCTCACCTG 3′ 5′ CGGGGAGTCTCTGAAGATCTCCTGT 3′ 5′ TCGCAGACCCTCTCACTCACCTGTG 3′ 5′ CTGGGTGCGACAGGCCCCTGGACAA 3′ 5′ TGGATCCGTCAGCCCCCAGGGAAGG 3′ 5′ GGTCCGCCAGGCTCCAGGAA 3′ 5′ TGGATCCGCCAGCCCCCAGGGAAGG 3′ 5′ GGGTGCGCCAGATGCCCGGGAAAGG 3′ 5′ TGGATCAGGCAGTCCCCATCGAGAG 3′ 5′ TTGGGTGCGACAGGCCCCTGGACAA 3′ 5′ TGGAGCTGAGCAGCCTGAGATCTGA 3′ 5′ CAATGACCAACATGGACCCTGTGGA 3′ 5′ TCTGCAAATGAACAGCCTGAGAGCC 3′ 5′ GAGCTCTGTGACCGCCGCGGACACG 3′ 5′ CAGCACCGCCTACCTGCAGTGGAGC 3′ 5′ GTTCTCCCTGCAGCTGAACTCTGTG 3′ 5′ CAGCACGGCATATCTGCAGATCAG 3′ 5′ CTTACCTGAGGAGACGGTGACC 3′ 3 positive signal. Samples that gave positive signals were tested repeatedly to confirm specific binding. 2.5. Immunocytochemistry HOG or astrocytoma (U251) cells were cultured on glass slides and fixed in 4% paraformaldehyde. After washing in PBS, the cells were permeabilised using 0.2% (v/v) PBS/Triton X-100 for 30 min. Culture supernatant of immortalized B cells or an anti-AChR isotype antibody was added for 1 h at 4 °C. Next, the cells were incubated with a FITC-labeled goat anti-human IgG (1:100, AbD Serotec) for 30 min at 4 °C. Following nuclear staining with DAPI, glass slides were coverslipped with fluorescence mounting medium (Dako, Heverlee, Belgium). 2.6. Lipid antibody reactivity analysis Antibodies from B cell lines that were part of the 9 clonally expanded B cell populations were separated by isoelectric focusing (IEF) and blotted on a nitrocellulose membrane precoated with phosphatidylcholine (PC). IEF, blotting and detection of antibodies bound to the membrane were performed as previously described (Villar et al., 2001, 2005). 2.7. Statistics All statistical analyses were performed using Prism software version 4.00 (GraphPad). Usage of particular V, J and diversity (D) families, as well as CDR3 length and charge, was compared between patient groups using Fisher's exact test. For all other analyses, Mann–Whitney t-test or Student's t-test was performed. A p value b 0.05 was considered statistically significant. 3. Results 3.1. B cell immortalization and sequencing analysis of Ig VH region In total, 412/470 immortalized B cell lines (87.7%) expressed productive rearrangements, including 206 B cell lines of 10 MS patients, 32 of 4 CIS patients and 174 of 6 HCs. Unproductive rearrangements, due to amplification of the unproductively rearranged allele, were manifested for 58 Ig VH sequences by an out-of-frame J region or occasionally a stop codon in the VH region. We confined further VDJ region analysis to sequences with productive rearrangements since these give rise to functional antibodies. For the majority of these immortalized B cell lines (97.57%), a selection for IgG+ B cells was done prior to immortalization. Ten IgM+ B cell lines (2.43%), resulting from the immortalization of total PBMC, were included as well. 3.2. Immortalized B cell lines reflect the in vivo B cell repertoire When using cloning techniques, including B cell immortalization, one always has to keep in mind that a certain bias can be introduced in the outgrowth of cells. To address this question, the Ig VH repertoire of peripheral memory B cells from 3 MS patients and 2 CIS patients was compared before and after immortalization (Supplementary Fig. 1). Although identical fragment sizes do not always correspond with identical Ig VH sequences, all fragment sizes of immortalized B cell lines could be recovered from the collection of fragment sizes of total PBMC (before immortalization). When a lower number of immortalized B cell lines were available, their fragment sizes corresponded to the most frequent PBMC fragment sizes. This reflects the higher probability of frequent B cell clones to become immortalized when compared to rare B cell clones. Further, we compared the Ig VH gene family usage patterns between 4 individual HCs included in our study, the total HC population, Please cite this article as: Fraussen, J., et al., Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients, J. Neuroimmunol. (2013), http://dx.doi.org/10.1016/j.jneuroim.2013.05.002 J. Fraussen et al. / Journal of Neuroimmunology xxx (2013) xxx–xxx 4 the germline distribution (VBase Centre for Protein Engineering) (Cook and Tomlinson, 1995) and peripheral memory IgG+CD27+ B cells from a HC derived from the study of Owens et al. (2007). Ig VH gene family usage was similar when analyzing these groups of HC B cells, showing no significant differences in the percentages of VH1–7 family members (Table 3). Although a limited number of immortalized B cell lines were analyzed in this study, these results indicate that the B cell immortalization process does not induce significant bias in the resulting collection of immortalized B cell lines. 3.3. Skewed VH gene family usage in peripheral B cells of MS patients We next studied Ig VH gene family usage in the MS and CIS population. VH3 gene family usage was significantly decreased in MS patients when compared to HCs (p = 0.02) (Fig. 1A). This skewed VH3 family usage coincided with an overrepresentation of VH1 family members in B cells from the peripheral blood of MS patients when compared to HCs (p = 0.003). Ig VH gene usage in peripheral B cells of CIS patients was not significantly different from peripheral B cells of HCs. In order to analyze the skewed VH gene family usage in MS patients in more detail, we identified the specific gene segments used by peripheral B cells of MS patients and HCs. Overall, we identified 36 different VH gene family segments in both MS patients and HCs (Fig. 1B). The most important finding was an increased usage of the VH1–69 gene segment by peripheral B cells in MS. VH1–69 was expressed by 29.2% of the immortalized B cell lines originating from MS peripheral blood, compared to 5.9% of the HC B cell lines (p b 0.0001) (Fig. 1C). In addition, DH and JH gene family segment usage was analyzed. In all patient groups, JH4, DH3 and DH5 were the most frequently used DH and JH gene segments (data not shown), similar to germline expression and previous reports (Yamada et al., 1991; Brezinschek et al., 1995; Baranzini et al., 1999). In the MS and CIS group, expression of DH5 gene segments was significantly higher than in the HC population (p b 0.0001 and p = 0.005, respectively) (Supplementary Fig. 2). 3.4. Peripheral B cells of MS and CIS patients are clonally expanded CSF B cells of MS and CIS patients were repeatedly shown to be clonally expanded (Owens et al., 1998; Qin et al., 1998; Baranzini et al., 1999; Colombo et al., 2000, 2003; Owens et al., 2003; Qin et al., 2003; Bennett et al., 2008). Here, we found multiple immortalized B cell lines from the peripheral blood expressing identical Ig VH CDR3 aa sequences, indicating clonally related B cells that most likely recognize the same antigenic target (Table 4, Supplementary Table 1). A total of 9 different populations of clonally expanded B cells were identified, which consisted of 71/206 (34.5%) MS and 7/32 (21.9%) CIS B cell lines that originated from the peripheral blood of 5/10 MS and 3/4 CIS patients. Peripheral B cells of HCs showed a diverse repertoire that lacked identical or closely related clones. Several clonally expanded B cell populations (Nos. 1, 2, 3, 5 and 8) were present in the peripheral blood of multiple patients, emphasizing their possible relevance in the disease process. The largest clonally expanded B cell population comprised 49 related B cells, 1 of 1 CIS patient and 48 of 2 MS patients (clone 1). Clone 1 expressed VH1–69, contributing to the overrepresentation of VH1 gene family members, and more specifically VH1–69, in the MS population (Fig. 1). Furthermore, expanded B cell clones 5 and 7 were retrieved exclusively from CIS patients and could therefore be related to early pathogenesis. Interestingly, 2 expanded IgM+ B cell clones were isolated from 1 MS and 2 CIS patients, which points towards the involvement of IgM+ B cells in the underlying disease process, at least in some patients. Members of expanded B cell clones were characterized by high deviation from germline sequences, indicating high mutation frequencies (Supplementary Table 1). Moreover, differences in homology to the closest germline V, D and J segments pointed towards differences in frequency of Ig VH mutations between different members of the same clonal population. High mutation frequencies that differ between members of the same clonal population are indications of intraclonal diversification and affinity maturation. 3.5. Peripheral B cells of MS and CIS patients display high Ig VH mutation frequencies After demonstrating intraclonal diversification in peripheral clonally expanded B cells of MS and CIS patients, we looked further into the Ig VH mutation frequencies. Immortalized B cell lines from the peripheral blood of MS patients displayed significantly higher mutation numbers (Fig. 2A) and mutation frequencies (Fig. 2B) when compared to CIS patients (p = 0.02 and p = 0.04, respectively) and HCs (p b 0.0001 for both parameters). Further, Ig VH sequences of peripheral B cells from CIS patients displayed significantly higher mutation frequencies than those from HCs (p = 0.04). Average Ig VH mutation frequency of peripheral B cells was 12.5 ± 9.3 for MS patients, 8.7 ± 7.1 for CIS patients and 5.5 ± 3.2 for HCs. Increased Ig VH mutations in peripheral B cells were also observed at patient level in MS and CIS patients (data not shown). These results again demonstrate a B cell response caused by chronic antigen stimulation, possibly with affinity maturation and receptor editing attempts, in the peripheral blood of MS and CIS patients. During somatic hypermutation, mutation hotspots such as the RGYW region are preferentially targeted. In our panel of peripheral immortalized B cells, an increased targeting of mutations to the RGYW region was observed for the MS population when compared to CIS patients (p = 0.0004) and HCs (p = 0.002) (Fig. 2C). This points towards selection in the context of a GC. Moreover, peripheral B cells of MS patients and HCs were characterized by a higher ratio of replacement to silent mutations (R/S ratio) in the CDR regions Table 3 Ig VH gene usage in HC memory B cells. VH family HC-1 n = 27 HC-2 n = 39 HC-3 n = 41 HC-4 n = 27 HC total n = 174 Expecteda n = 51 Owens et al. (2007)b n = 32 VH1 VH2 VH3 VH4 VH5 VH6 VH7 14.81% 3.70% 48.15% 25.93% 7.41% 0% 0% 20.51% 2.56% 53.85% 23.08% 0% 0% 0% 26.83% 2.44% 43.90% 21.95% 4.88% 0% 0% 25.93% 3.70% 59.26% 11.11% 0% 0% 0% 21.26% 2.87% 51.15% 21.26% 3.45% 0% 0% 21.57% 5.88% 43.14% 21.57% 3.92% 1.96% 1.96% 12.5% 0% 68.8% 12.5% 6.3% / 0% a b Expected values indicate the number of functional germline genes, derived from VBase. IgG+CD27+ peripheral blood B cells of a HC derived from the study of Owens GP, Winges KM et al. J Immunol, 2007. Please cite this article as: Fraussen, J., et al., Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients, J. Neuroimmunol. (2013), http://dx.doi.org/10.1016/j.jneuroim.2013.05.002 J. Fraussen et al. / Journal of Neuroimmunology xxx (2013) xxx–xxx 5 Fig. 1. H chain V gene usage in 206 peripheral blood immortalized B cell lines of MS patients, 32 B cell lines of CIS patients and 174 B cell lines of HCs. (A) Distribution of VH families in immortalized B cells. Expected values indicate the number of functional germline genes. Comparison between patient groups was done using Fisher's exact test. (B) Fractional usage of individual VH gene segments in immortalized B cells from MS and HC. Central oval “n” indicates the number of productive sequences examined. (C) The percentage of immortalized B cell lines expressing the VH1–69 germline segment is depicted for MS patients, CIS patients and HCs. Statistical analysis was performed using Mann–Whitney t-test. ⁎p b 0.05; ⁎⁎0.001 b p b 0.01; ⁎⁎⁎p b 0.001. Table 4 Overview of clonally expanded B cell populations. Clone 1 2 3 4 5 6 7 8 9 a b Frequency Isotype 49× 8× 5× 4× 3× 2× 2× 2× 2× IgG IgG IgG IgM IgM IgG IgG IgG IgG Patients CDR3 aa sequence VH gene DH genea JH gene Antibody staining HOGb Antibody staining ≥1 cell lineb 2 MS (32×; 16×); 1 CIS (1×) 1 MS (7×); 1 CIS (1×) 2 MS (4×; 1×) 1 MS 2 CIS (2×; 1×) 1 MS 1 CIS 2 MS (1×; 1×) 1 MS AGLFAYSYGPLDY ARDFFGSGSYHHPGGMDV GRAQLSLGAIDY AREFPSGSYYGLGY TSDHILDTAK AKDIGPYYYDSSGYPDS ARVILDGYNNDDGFDV ARLRGYAETRWFDI AKDIGVTSLYFFYGLDV V1–69*01 V3–13*01 V3–33*01 V3–7*01 V3–15*01 V3–9*01 V1–69*02 V4–39*04 V3–30*18 D5–5*01 D3–10*01 D3–10*02 D1–26*01 D5–5*01 D3–22*01 D5–24*01 D3–16*01 NA J4*02 J6*02 J4*02 J4*02 J4*02 J4*02 J3*01 J5*02 J6*02 Neg Neg Neg Neg Neg Neg Neg Neg Neg Neg Pos (3/8) Pos (4/5) Neg Neg Neg Neg Neg Pos (1/2) NA: not available. Neg: negative, Pos: positive. Please cite this article as: Fraussen, J., et al., Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients, J. Neuroimmunol. (2013), http://dx.doi.org/10.1016/j.jneuroim.2013.05.002 6 J. Fraussen et al. / Journal of Neuroimmunology xxx (2013) xxx–xxx Table 5 Antibody binding to HOG, PBMC and A549 cells using flow cytometry. Patient group Antibody staining HOG Antibody staining PBMC Antibody staining >1 cell line Antibody staining ≥1 cell line = TOTAL MS CIS HC 3/302 (0.99) 1/39 (2.56) 0/133 (0) 0/302 (0) 0/39 (0) 1/133 (0.75) 59/302 (19.54) 6/39 (15.38) 4/133 (3.01) 62/302 (20.53) 7/39 (17.95) 5/133 (3.76%) () shows the percentage of immortalized B cell lines that is positive for antibody binding; numbers in bold are statistically significant with p b 0.05 using Fisher's exact test. Fig. 2. Mutation analysis of Ig VH region from peripheral B cells in MS, CIS and HC. The number (A) and percentage (B) of Ig VH mutations were determined together with the percentage of mutated RGYW motifs (C) for all immortalized B cell lines from the peripheral blood of MS patients, CIS patients and HCs. Mann–Whitney or Student's t-test was used for statistics. ⁎p b 0.05; ⁎⁎0.001 b p b 0.01; ⁎⁎⁎p b 0.001. than in the FR regions (data not shown). This indicates antigendriven selection of peripheral B cells both in the diseased and normal conditions. 3.6. A subpopulation of peripheral B cells of MS and CIS patients is autoreactive Finally, in order to learn if the clonally expanded and heavily mutated peripheral B cells were linked to MS pathology, it became of interest to study the antigen reactivity of peripheral B cells from MS and CIS patients. Therefore, we analyzed antibody binding to different cell types, including HOG (human oligodendroglioma) cells, PBMCs and U251 (astrocytoma) cells. Alveolar A549 cells were included as a negative control cell line. IgG-containing supernatant of 302 MS B cell lines, 39 CIS B cell lines and 133 HC B cell lines was tested. Membrane binding of antibodies produced by the immortalized B cell lines to the different cell types was not observed (data not shown). Antibodies derived from 3 MS B cell lines and 1 CIS B cell line showed specific binding to an intracellular target of HOG cells, both by flow cytometry (Table 5) and immunocytochemistry (Fig. 3A–B). The number of B cell lines showing antibody binding to more than 1 of the tested cell types was significantly higher in MS (59/302, 19.54%, p b 0.0001) and CIS (6/39, 15.38%, p = 0.0098) patients than in HCs (4/133, 3.01%). This intracellular antibody binding to multiple cell types suggests reactivity to a common intracellular target (Table 5, Fig. 3C–D; F–G). Moreover, total numbers of autoantibody-producing B cell lines were significantly higher in MS (76/302, 25.17%, p b 0.0001) and CIS (11/39, 28.21%, p = 0.0061) patients when compared to HCs (7/133, 5.26%). Of the 9 identified clonally expanded peripheral B cell populations (Table 4), reactivity against a common intracellular target was demonstrated for antibodies from several members of clones 2, 3 and 9 (Fig. 3C,F). Antibodies produced by the 9 identified clonally expanded B cell populations did not react with the common myelin antigens myelin oligodendrocyte glycoprotein (MOG) and myelin basic protein (MBP) (data not shown). To investigate whether the antibodies recognized myelin lipid, we tested their reactivity to PC as it was previously shown that oligoclonal IgM from the CSF of MS patients mainly recognized this phospholipid (Villar et al., 2005). Antibody binding to PC was demonstrated for an IgM+ B cell line that was part of clone 5 (B17.26, Fig. 4), showing the importance of this peripheral B cell clonal expansion in MS pathogenesis. These results show that a subpopulation of autoreactive B cells is present in the peripheral blood. Moreover, this autoreactive B cell population is more prominent in MS and CIS patients than in HCs. Antibody reactivity to an intracellular autoantigen could be determined for 3 of the clonally expanded peripheral B cell populations. The specific target of 1 of the B cell clones could be identified, namely PC. This indicates the likely involvement of these B cell clones in MS pathogenesis. 4. Discussion We recently developed an improved method for B cell immortalization in which 87% of the resulting immortalized B cell lines appeared to be monoclonal (Fraussen et al., 2010). Here, we show that the immortalized B cells generated using this technology can be used for molecular analysis of representative BCR VH regions. The collection of Ig VH fragment sizes of peripheral B cells was comparable before and after immortalization. We showed that the most frequent B cells were most likely to become immortalized so that in vivo clonal expansions should readily be recovered in the immortalized B cell lines. However, PBMC fragment sizes usually represent multiple B cell clones with VH fragment sizes in the same range. Therefore, we further compared Ig VH gene family usage of HC B cell lines to theoretically expected values or previous data, which revealed a similar distribution. These data imply that the B cell immortalization process does not introduce significant bias in the outgrowth of immortalized B cells. Thus, our panel of immortalized B cell lines is most likely Please cite this article as: Fraussen, J., et al., Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients, J. Neuroimmunol. (2013), http://dx.doi.org/10.1016/j.jneuroim.2013.05.002 J. Fraussen et al. / Journal of Neuroimmunology xxx (2013) xxx–xxx 7 Fig. 3. Antibody binding of immortalized B cell lines to HOG and U251 cells. Representative images are shown for 2 MS B cell lines that showed FACS staining of more than 1 tested cell type, B26.2 (A; E) and B27.33 (B; F). Two representative HOG-specific immortalized B cell lines, B27.53 (C) and B29.9 (D), are depicted as well. An isotype antibody in the same concentration was included as a negative control (G, H). Images are 400× magnified. taken at random from the whole in vivo B cell population. Due to high technological difficulty and restrictions in immortalization efficiency, we were only able to analyze limited numbers of immortalized B cells. In order to obtain a broader representation of the in vivo B cell population, a higher number of immortalized B cell lines should be analyzed. A restricted intrathecal B cell response has previously been shown in MS and CIS patients (Owens et al., 1998; Qin et al., 1998; Baranzini et al., 1999; Colombo et al., 2000, 2003; Owens et al., 2003; Qin et al., 2003; Bennett et al., 2008). However, the absence of clonally related peripheral B cells was described by multiple studies using molecular Ig VH analysis (Colombo et al., 2000; Owens et al., 2007; Bennett et al., 2008). Colombo et al. did not identify shared clones between the CSF and peripheral blood (Colombo et al., 2000), while Monson et al. only detected a single CSF B cell clone that was also present in the blood of 1 MS patient (Monson et al., 2005). The lack of peripheral B cell clonal expansions in these studies can be explained by the analysis of naïve B cells, since clonally related B cells are unlikely to be found in the heterogeneous naïve B cell pool. In our study, the analyzed peripheral B cells were mainly IgG+ memory B cells for all patient groups. We thereby excluded the observation of differences that are inherent to different B cell subsets and focused on B cells with high relevance in pathogenesis. Next to the molecular Ig VH analysis of peripheral B cells, we focused on the antibody reactivity profile of (clonally expanded) peripheral B cells in MS, CIS and HC. A significantly increased usage of the VH1–69 gene segment was evidenced in peripheral B cells of MS patients. The largest identified B cell clone (clone 1) also expressed this VH1 family member. VH1– 69 expressing B cell clones were previously identified in the CSF of MS patients (Monson et al., 2005). Moreover, VH1 and VH4 families showed obvious signs of clonal expansion in MS brain (Baranzini et al., 1999; Monson et al., 2005). Thus, VH1–69 expressing B cells could be involved in disease pathogenesis. Furthermore, evidence of affinity maturation was obtained by increased Ig VH mutation frequencies in peripheral B cells of MS and CIS patients. Increased Ig VH mutations are also indicative of a specific antigen-stimulated immune response. Since the Ig VH mutation frequency of memory B cells in MS and CIS is increased when compared to HC, repeated/chronic antigen stimulation must be taking place. This mostly coincides with receptor editing, which can however only be evidenced when including Ig light chain sequencing. In addition, hypermutation machinery typical of a GC reaction seemed to be intact, as mutations were preferentially targeted to RGYW regions. Peripheral clonally expanded B cells have thus been selected by the classical GC pathway and not via alternative mechanisms. Although the chance of detecting a B cell with an identical Ig VH segment in multiple subjects is theoretically very small, we identified some shared CDR3 sequences by peripheral B cells of different patients. These data are unlikely to result from cross-contamination of PCR reactions, since all Ig VH sequences were isolated twice from the same sample (forward + reverse sequencing reaction). Further, evidence from both murine and human systems suggests that Ig recombination processes might not occur randomly (Yancopoulos et al., 1984; Malynn et al., 1990; Adderson et al., 1993). As an example, Adderson et al. reported identical VDJ joints that were shared by 2 or more Haemophilus influenzae type b hybridomas, even from unrelated subjects (Adderson et al., 1993). Several other studies showed identical CDR3 sequences among B cells from multiple patients with chronic lymphocytic leukemia (CLL) or hepatitis C virus infection (HCV) (Widhopf et al., 2004; Charles et al., 2008). In MS, regulation of the Ig VH gene usage could be disrupted, leading to the disturbed expression of autoreactive B cell clones in response to chronic antigen stimulation. Whether this leads to a pathological autoreactivity or low affinity polyreactivity remains unclear from the results in this study. Another possible explanation for the finding of shared Ig VH segments is a general humoral immune response Fig. 4. Antibody binding of B17.26, member of clone 5, to phosphatidylcholine (PC). Antibodies of B17.26 were separated by IEF, followed by transfer onto a nitrocellulose membrane precoated with PC. Total IgM was first detected (A), followed by anti-PC reactivity (B). As a negative control, antibody binding to a non-coated membrane is shown (C). Please cite this article as: Fraussen, J., et al., Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients, J. Neuroimmunol. (2013), http://dx.doi.org/10.1016/j.jneuroim.2013.05.002 8 J. Fraussen et al. / Journal of Neuroimmunology xxx (2013) xxx–xxx against intracellular antigens in a large proportion of MS patients, not as a pathogenic effect but as a consequence of the pathologic brain damage. Analysis of the antigen reactivity of the immortalized B cell lines revealed an increased subpopulation of peripheral B cells from MS and CIS patients that displayed autoreactivity to intracellular target antigens. Four B cell lines even showed specific binding to precursor oligodendrocytes (HOG), although these were not part of the 9 identified clonal populations. Nonetheless, antibodies from several B cell lines of clones 2, 3 and 9 stained more than 1 of the tested cell types. To our knowledge, this is the first report of peripheral clonally expanded B cells that display autoreactivity. This indicates that not only CSF-derived antibodies but also clonal expansions of B cells producing autoantibodies are present in the peripheral blood of patients with MS and CIS. Antibody binding to multiple cell types could suggest specificity for a common intracellular target, for example an antigen that is involved in cell cycle regulation, DNA replication or other cellular processes. Interestingly, an IgM+ clonally expanded B cell population was identified in the peripheral blood of a CIS patient. This B cell clone appeared to be specific for the myelin lipid PC. CSF IgM OCBs were previously shown to predict early conversion of CIS to clinically definite MS (Ferraro et al., 2013). Moreover, IgM OCBs specific for myelin lipids in the CSF have been associated with brain atrophy, lesion load and prediction of a more adverse long-term outcome in MS and CIS patients (Thangarajh et al., 2008; Magraner et al., 2012). We have now also identified a population of clonally expanded IgM+ B cells directed against the myelin lipid PC in the peripheral blood of a CIS patient. Further follow-up of this patient could unravel whether this is also related with conversion to MS or a more aggressive disease course. B cells originating from paired CSF and blood could be investigated to obtain more information on B cell trafficking in MS. The finding of clonally expanded, heavily mutated and autoreactive B cell populations in the peripheral blood of MS and CIS patients clearly shows their role in the disease process, which can be both primary pathologic and secondary to chronic inflammation. It is not yet known whether initial antigen recognition in MS occurs in the CNS or in the periphery. Clonally expanded peripheral B cells could represent a population of autoreactive B cells that are initially triggered in the peripheral blood and then travel to the CNS and become reactivated. Serafini et al. suggested that a dysregulated EBV infection is involved in B cell pathology in MS (Serafini et al., 2007), which could also cause peripheral expansion of EBV-infected autoreactive B cells that later migrate into the CNS. However, this observation could not be confirmed in other studies (Willis et al., 2009; Peferoen et al., 2010; Sargsyan et al., 2010). On the other hand, peripheral clonally expanded autoreactive B cells could represent the intrathecal immune response by migration of B cells from the CNS into the peripheral circulation through the blood–brain barrier (BBB) (Broman, 1964; Ebers et al., 1984; Marchi et al., 2004). Autoreactive B cells could be reactivated in the periphery by brain antigens that have leaked into the circulation following tissue damage. Increasing evidence shows that BBB impairment and leakage in MS is not only restricted to acute disease but starts already at an early stage (Kermode et al., 1990), which could explain the finding of clonally related B cells in the peripheral blood of CIS patients. Furthermore, indications for BBB disturbance have now been collected in normal appearing white matter (NAWM) and inflammatory silent inactive lesions (Kwon and Prineas, 1994; Filippi et al., 1998; Soon et al., 2007). Autoreactive memory B cells could possibly recirculate in the peripheral blood to recruit more inflammatory cells into the CNS by functioning as antigen-presenting cells (Rock et al., 1984; Lanzavecchia, 1990). Another possibility is clonal expansion of peripheral B cells as the result of a secondary immune response that could be initiated by epitope spreading or leakage of brain antigens into the peripheral blood (Hemmer et al., 2002; Hafler, 2004). Expansion of autoreactive B cells could occur in the periphery due to decreased suppressive functions of regulatory T cells (Venken et al., 2008) and could be sustained by repeated antigen exposure as a consequence of BBB leakage. Antigen reactivity could not be further clarified for 5/9 clonally expanded B cell populations. However, VH1–69 gene segment usage by 2 of these clonally expanded B cell populations could point towards their involvement in MS pathogenesis. It is still possible that these other B cell clonal expansions are part of an anti-viral or other immune response. One of the limitations of this study is the relatively low number of analyzed B cell Ig VH sequences and the lack of paired peripheral blood and CSF samples. A higher number of immortalized B cell lines from a larger population of MS patients, CIS patients and HCs could be included in future analysis to obtain a broader representation of both the peripheral and intrathecal B cell repertoire. Moreover, Ig light chain sequencing could give more information on receptor editing of clonally expanded B cells. PC was identified as the target of a clonally expanded IgM+ B cell population from the peripheral blood of a CIS patient. The antigenic targets of the remaining clonally expanded B cell populations should be identified in future experiments in order to increase our understanding of B cell involvement in MS pathology. In conclusion, we identified clonally expanded B cell populations in the peripheral blood of MS and CIS patients with mutation characteristics of ongoing diversification and affinity maturation. A subpopulation of these peripheral B cells of MS and CIS patients displayed autoreactivity to intracellular target antigens, emphasizing their involvement in disease pathology. An expanded IgM+ B cell clone isolated from the peripheral blood of a CIS patient demonstrated specificity for myelin lipid. Further analysis of antibody specificity can unravel the true nature and involvement of these subpopulations of peripheral B cells in the disease process. Ultimately, this could increase our understanding of the immune pathogenesis of MS and lead to novel targets for therapy, diagnosis and prognosis that are easily available due to their presence in the peripheral blood. Funding This study was supported by a grant from the Transnationale Universiteit Limburg, Hasselt University and Charcot Foundation Belgium. J. Fraussen is a postdoctoral fellow of the Fund for Scientific Research (FWO), Flanders. M. Losen was supported by a Veni fellowship of The Netherlands Organization for Scientific Research and a fellowship of the Brain Foundation of the Netherlands. Conflict of interest statement The authors have no commercial or other conflicts of interest. Acknowledgements We thank Igna Rutten for technical assistance and Dr. R. Medaer, Dr. A. Van Diepen and T. Broekmans for collection of some patient samples. We greatly acknowledge Bertine Timmermans, Ingrid Mevissen-Smeets and Riny Wieërs for their help with the patient data. Appendix A. Supplementary data Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.jneuroim.2013.05.002. Please cite this article as: Fraussen, J., et al., Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients, J. Neuroimmunol. (2013), http://dx.doi.org/10.1016/j.jneuroim.2013.05.002 J. Fraussen et al. / Journal of Neuroimmunology xxx (2013) xxx–xxx References Adderson, E.E., Shackelford, P.G., Quinn, A., Wilson, P.M., Cunningham, M.W., Insel, R.A., Carroll, W.L., 1993. Restricted immunoglobulin VH usage and VDJ combinations in the human response to Haemophilus influenzae type b capsular polysaccharide. Nucleotide sequences of monospecific anti-Haemophilus antibodies and polyspecific antibodies cross-reacting with self antigens. J. Clin. Invest. 91 (6), 2734–2743. Archelos, J.J., Storch, M.K., Hartung, H.P., 2000. The role of B cells and autoantibodies in multiple sclerosis. Ann. Neurol. 47 (6), 694–706. Baranzini, S.E., Jeong, M.C., Butunoi, C., Murray, R.S., Bernard, C.C., Oksenberg, J.R., 1999. B cell repertoire diversity and clonal expansion in multiple sclerosis brain lesions. J. Immunol. 163 (9), 5133–5144. Bar-Or, A., Calabresi, P.A., Arnold, D., Markowitz, C., Shafer, S., Kasper, L.H., Waubant, E., Gazda, S., Fox, R.J., Panzara, M., Sarkar, N., Agarwal, S., Smith, C.H., 2008. Rituximab in relapsing–remitting multiple sclerosis: a 72-week, open-label, phase I trial. Ann. Neurol. 63 (3), 395–400. Bennett, J.L., Haubold, K., Ritchie, A.M., Edwards, S.J., Burgoon, M., Shearer, A.J., Gilden, D.H., Owens, G.P., 2008. CSF IgG heavy-chain bias in patients at the time of a clinically isolated syndrome. J. Neuroimmunol. 199 (1–2), 126–132. Brezinschek, H.P., Brezinschek, R.I., Lipsky, P.E., 1995. Analysis of the heavy chain repertoire of human peripheral B cells using single-cell polymerase chain reaction. J. Immunol. 155 (1), 190–202. Broman, T., 1964. Blood–brain barrier damage in multiple sclerosis supravital testobservations. Acta Neurol. Scand. (Suppl. 40) (Suppl.-4). Charles, E.D., Green, R.M., Marukian, S., Talal, A.H., Lake-Bakaar, G.V., Jacobson, I.M., Rice, C.M., Dustin, L.B., 2008. Clonal expansion of immunoglobulin M + CD27+ B cells in HCV-associated mixed cryoglobulinemia. Blood 111 (3), 1344–1356. Cole, S.R., Beck, R.W., Moke, P.S., Kaufman, D.I., Tourtellotte, W.W., 1998. The predictive value of CSF oligoclonal banding for MS 5 years after optic neuritis. Optic Neuritis Study Group. Neurology 51 (3), 885–887. Colombo, M., Dono, M., Gazzola, P., Roncella, S., Valetto, A., Chiorazzi, N., Mancardi, G.L., Ferrarini, M., 2000. Accumulation of clonally related B lymphocytes in the cerebrospinal fluid of multiple sclerosis patients. J. Immunol. 164 (5), 2782–2789. Colombo, M., Dono, M., Gazzola, P., Chiorazzi, N., Mancardi, G., Ferrarini, M., 2003. Maintenance of B lymphocyte-related clones in the cerebrospinal fluid of multiple sclerosis patients. Eur. J. Immunol. 33 (12), 3433–3438. Cook, G.P., Tomlinson, I.M., 1995. The human immunoglobulin VH repertoire. Immunol. Today 16 (5), 237–242. Cross, A.H., Trotter, J.L., Lyons, J., 2001. B cells and antibodies in CNS demyelinating disease. J. Neuroimmunol. 112 (1–2), 1–14. Ebers, G.C., Vinuela, F.V., Feasby, T., Bass, B., 1984. Multifocal CT enhancement in MS. Neurology 34 (3), 341–346. Esiri, M.M., 1977. Immunoglobulin-containing cells in multiple-sclerosis plaques. Lancet 2 (8036), 478. Ferraro, D., Simone, A.M., Bedin, R., Galli, V., Vitetta, F., Federzoni, L., D'Amico, R., Merelli, E., Nichelli, P.F., Sola, P., 2013. Cerebrospinal fluid oligoclonal IgM bands predict early conversion to clinically definite multiple sclerosis in patients with Clinically Isolated Syndrome. J. Neuroimmunol. 257 (1–2), 76–81. Filippi, M., Rocca, M.A., Martino, G., Horsfield, M.A., Comi, G., 1998. Magnetization transfer changes in the normal appearing white matter precede the appearance of enhancing lesions in patients with multiple sclerosis. Ann. Neurol. 43 (6), 809–814. Fisniku, L.K., Brex, P.A., Altmann, D.R., Miszkiel, K.A., Benton, C.E., Lanyon, R., Thompson, A.J., Miller, D.H., 2008. Disability and T2 MRI lesions: a 20-year follow-up of patients with relapse onset of multiple sclerosis. Brain 131 (Pt. 3), 808–817. Fraussen, J., Vrolix, K., Martinez-Martinez, P., Losen, M., De Baets, M.H., Stinissen, P., Somers, V., 2009. B cell characterization and reactivity analysis in multiple sclerosis. Autoimmun. Rev. 8 (8), 654–658. Fraussen, J., Vrolix, K., Martinez-Martinez, P., Losen, M., Meulemans, E., De Baets, M.H., Stinissen, P., Somers, V., 2010. A novel method for making human monoclonal antibodies. J. Autoimmun. 35 (2), 130–134. Genain, C.P., Cannella, B., Hauser, S.L., Raine, C.S., 1999. Identification of autoantibodies associated with myelin damage in multiple sclerosis. Nat. Med. 5 (2), 170–175. Gerritse, K., Deen, C., Fasbender, M., Ravid, R., Boersma, W., Claassen, E., 1994. The involvement of specific anti myelin basic protein antibody-forming cells in multiple sclerosis immunopathology. J. Neuroimmunol. 49 (1–2), 153–159. Graus, Y., Meng, F., Vincent, A., van B., V., De Baets, M., 1995. Sequence analysis of antiAChR antibodies in experimental autoimmune myasthenia gravis. J. Immunol. 154 (12), 6382–6396. Graus, Y.F., De Baets, M.H., Parren, P.W., Berrih-Aknin, S., Wokke, J., Breda Vriesman, P.J., Burton, D.R., 1997. Human anti-nicotinic acetylcholine receptor recombinant Fab fragments isolated from thymus-derived phage display libraries from myasthenia gravis patients reflect predominant specificities in serum and block the action of pathogenic serum antibodies. J. Immunol. 158 (4), 1919–1929. Hafler, D.A., 2004. Multiple sclerosis. J. Clin. Invest. 113 (6), 788–794. Harp, C., Lee, J., Lambracht-Washington, D., Cameron, E., Olsen, G., Frohman, E., Racke, M., Monson, N., 2007. Cerebrospinal fluid B cells from multiple sclerosis patients are subject to normal germinal center selection. J. Neuroimmunol. 183 (1–2), 189–199. Hauser, S.L., Waubant, E., Arnold, D.L., Vollmer, T., Antel, J., Fox, R.J., Bar-Or, A., Panzara, M., Sarkar, N., Agarwal, S., Langer-Gould, A., Smith, C.H., 2008. B-cell depletion with rituximab in relapsing–remitting multiple sclerosis. N. Engl. J. Med. 358 (7), 676–688. Hemmer, B., Archelos, J.J., Hartung, H.P., 2002. New concepts in the immunopathogenesis of multiple sclerosis. Nat. Rev. Neurosci. 3 (4), 291–301. Kabat, E.A., Glusman, M., Knaub, V., 1948. Quantitative estimation of the albumin and gamma-globulin in normal and pathological cerebrospinal fluid by immunochemical methods. Am. J. Med. 4, 653–662. 9 Kermode, A.G., Thompson, A.J., Tofts, P., MacManus, D.G., Kendall, B.E., Kingsley, D.P., Moseley, I.F., Rudge, P., McDonald, W.I., 1990. Breakdown of the blood–brain barrier precedes symptoms and other MRI signs of new lesions in multiple sclerosis. Pathogenetic and clinical implications. Brain 113 (Pt. 5), 1477–1489. Krumbholz, M., Theil, D., Derfuss, T., Rosenwald, A., Schrader, F., Monoranu, C.M., Kalled, S.L., Hess, D.M., Serafini, B., Aloisi, F., Wekerle, H., Hohlfeld, R., Meinl, E., 2005. BAFF is produced by astrocytes and up-regulated in multiple sclerosis lesions and primary central nervous system lymphoma. J. Exp. Med. 201 (2), 195–200. Kwon, E.E., Prineas, J.W., 1994. Blood–brain barrier abnormalities in longstanding multiple sclerosis lesions. An immunohistochemical study. J. Neuropathol. Exp. Neurol. 53 (6), 625–636. Lanzavecchia, A., 1990. Receptor-mediated antigen uptake and its effect on antigen presentation to class II-restricted T lymphocytes. Annu. Rev. Immunol. 8, 773–793. Lee-Chang, C., Zephir, H., Top, I., Dubucquoi, S., Trauet, J., Prin, L., Vermersch, P., 2011. B-cell subsets up-regulate alpha4 integrin and accumulate in the cerebrospinal fluid in clinically isolated syndrome suggestive of multiple sclerosis onset. Neurosci. Lett. 487 (3), 273–277. Lucchinetti, C., Bruck, W., Parisi, J., Scheithauer, B., Rodriguez, M., Lassmann, H., 2000. Heterogeneity of multiple sclerosis lesions: implications for the pathogenesis of demyelination. Ann. Neurol. 47 (6), 707–717. Luo, J., Taylor, P., Losen, M., De Baets, M.H., Shelton, G.D., Lindstrom, J., 2009. Main immunogenic region structure promotes binding of conformation-dependent myasthenia gravis autoantibodies, nicotinic acetylcholine receptor conformation maturation, and agonist sensitivity. J. Neurosci. 29 (44), 13898–13908. Magraner, M.J., Bosca, I., Simo-Castello, M., Garcia-Marti, G., Alberich-Bayarri, A., Coret, F., Alvarez-Cermeno, J.C., Marti-Bonmati, L., Villar, L.M., Casanova, B., 2012. Brain atrophy and lesion load are related to CSF lipid-specific IgM oligoclonal bands in clinically isolated syndromes. Neuroradiology 54 (1), 5–12. Malynn, B.A., Yancopoulos, G.D., Barth, J.E., Bona, C.A., Alt, F.W., 1990. Biased expression of JH-proximal VH genes occurs in the newly generated repertoire of neonatal and adult mice. J. Exp. Med. 171 (3), 843–859. Marchi, N., Cavaglia, M., Fazio, V., Bhudia, S., Hallene, K., Janigro, D., 2004. Peripheral markers of blood–brain barrier damage. Clin. Chim. Acta 342 (1–2), 1–12. McDonald, W.I., Compston, A., Edan, G., Goodkin, D., Hartung, H.P., Lublin, F.D., McFarland, H.F., Paty, D.W., Polman, C.H., Reingold, S.C., Sandberg-Wollheim, M., Sibley, W., Thompson, A., van den, N.S., Weinshenker, B.Y., Wolinsky, J.S., 2001. Recommended diagnostic criteria for multiple sclerosis: guidelines from the International Panel on the diagnosis of multiple sclerosis. Ann. Neurol. 50 (1), 121–127. Miller, D., Barkhof, F., Montalban, X., Thompson, A., Filippi, M., 2005. Clinically isolated syndromes suggestive of multiple sclerosis, part I: natural history, pathogenesis, diagnosis, and prognosis. Lancet Neurol. 4 (5), 281–288. Monson, N.L., Brezinschek, H.P., Brezinschek, R.I., Mobley, A., Vaughan, G.K., Frohman, E.M., Racke, M.K., Lipsky, P.E., 2005. Receptor revision and atypical mutational characteristics in clonally expanded B cells from the cerebrospinal fluid of recently diagnosed multiple sclerosis patients. J. Neuroimmunol. 158 (1–2), 170–181. Naismith, R.T., Piccio, L., Lyons, J.A., Lauber, J., Tutlam, N.T., Parks, B.J., Trinkaus, K., Song, S.K., Cross, A.H., 2010. Rituximab add-on therapy for breakthrough relapsing multiple sclerosis: a 52-week phase II trial. Neurology 74 (23), 1860–1867. Owens, G.P., Kraus, H., Burgoon, M.P., Smith-Jensen, T., Devlin, M.E., Gilden, D.H., 1998. Restricted use of VH4 germline segments in an acute multiple sclerosis brain. Ann. Neurol. 43 (2), 236–243. Owens, G.P., Ritchie, A.M., Burgoon, M.P., Williamson, R.A., Corboy, J.R., Gilden, D.H., 2003. Single-cell repertoire analysis demonstrates that clonal expansion is a prominent feature of the B cell response in multiple sclerosis cerebrospinal fluid. J. Immunol. 171 (5), 2725–2733. Owens, G.P., Winges, K.M., Ritchie, A.M., Edwards, S., Burgoon, M.P., Lehnhoff, L., Nielsen, K., Corboy, J., Gilden, D.H., Bennett, J.L., 2007. VH4 gene segments dominate the intrathecal humoral immune response in multiple sclerosis. J. Immunol. 179 (9), 6343–6351. Peferoen, L.A., Lamers, F., Lodder, L.N., Gerritsen, W.H., Huitinga, I., Melief, J., Giovannoni, G., Meier, U., Hintzen, R.Q., Verjans, G.M., van Nierop, G.P., Vos, W., Peferoen-Baert, R.M., Middeldorp, J.M., van der Valk, P., Amor, S., 2010. Epstein Barr virus is not a characteristic feature in the central nervous system in established multiple sclerosis. Brain 133 (Pt. 5), e137. Polman, C.H., Reingold, S.C., Banwell, B., Clanet, M., Cohen, J.A., Filippi, M., Fujihara, K., Havrdova, E., Hutchinson, M., Kappos, L., Lublin, F.D., Montalban, X., O'Connor, P., Sandberg-Wollheim, M., Thompson, A.J., Waubant, E., Weinshenker, B., Wolinsky, J.S., 2011. Diagnostic criteria for multiple sclerosis: 2010 revisions to the McDonald criteria. Ann. Neurol. 69 (2), 292–302. Qin, Y., Duquette, P., Zhang, Y., Talbot, P., Poole, R., Antel, J., 1998. Clonal expansion and somatic hypermutation of V(H) genes of B cells from cerebrospinal fluid in multiple sclerosis. J. Clin. Invest. 102 (5), 1045–1050. Qin, Y., Duquette, P., Zhang, Y., Olek, M., Da, R.R., Richardson, J., Antel, J.P., Talbot, P., Cashman, N.R., Tourtellotte, W.W., Wekerle, H., van den, N.S., 2003. Intrathecal B-cell clonal expansion, an early sign of humoral immunity, in the cerebrospinal fluid of patients with clinically isolated syndrome suggestive of multiple sclerosis. Lab. Invest. 83 (7), 1081–1088. Ritchie, A.M., Gilden, D.H., Williamson, R.A., Burgoon, M.P., Yu, X., Helm, K., Corboy, J.R., Owens, G.P., 2004. Comparative analysis of the CD19+ and CD138+ cell antibody repertoires in the cerebrospinal fluid of patients with multiple sclerosis. J. Immunol. 173 (1), 649–656. Rock, K.L., Benacerraf, B., Abbas, A.K., 1984. Antigen presentation by hapten-specific B lymphocytes. I. Role of surface immunoglobulin receptors. J. Exp. Med. 160 (4), 1102–1113. Sargsyan, S.A., Shearer, A.J., Ritchie, A.M., Burgoon, M.P., Anderson, S., Hemmer, B., Stadelmann, C., Gattenlohner, S., Owens, G.P., Gilden, D., Bennett, J.L., 2010. Please cite this article as: Fraussen, J., et al., Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients, J. Neuroimmunol. (2013), http://dx.doi.org/10.1016/j.jneuroim.2013.05.002 10 J. Fraussen et al. / Journal of Neuroimmunology xxx (2013) xxx–xxx Absence of Epstein–Barr virus in the brain and CSF of patients with multiple sclerosis. Neurology 74 (14), 1127–1135. Serafini, B., Rosicarelli, B., Magliozzi, R., Stigliano, E., Aloisi, F., 2004. Detection of ectopic B-cell follicles with germinal centers in the meninges of patients with secondary progressive multiple sclerosis. Brain Pathol. 14 (2), 164–174. Serafini, B., Rosicarelli, B., Franciotta, D., Magliozzi, R., Reynolds, R., Cinque, P., Andreoni, L., Trivedi, P., Salvetti, M., Faggioni, A., Aloisi, F., 2007. Dysregulated Epstein–Barr virus infection in the multiple sclerosis brain. J. Exp. Med. 204 (12), 2899–2912. Smith-Jensen, T., Burgoon, M.P., Anthony, J., Kraus, H., Gilden, D.H., Owens, G.P., 2000. Comparison of immunoglobulin G heavy-chain sequences in MS and SSPE brains reveals an antigen-driven response. Neurology 54 (6), 1227–1232. Soon, D., Tozer, D.J., Altmann, D.R., Tofts, P.S., Miller, D.H., 2007. Quantification of subtle blood–brain barrier disruption in non-enhancing lesions in multiple sclerosis: a study of disease and lesion subtypes. Mult. Scler. 13 (7), 884–894. Souto-Carneiro, M.M., Longo, N.S., Russ, D.E., Sun, H.W., Lipsky, P.E., 2004. Characterization of the human Ig heavy chain antigen binding complementarity determining region 3 using a newly developed software algorithm, JOINSOLVER. J. Immunol. 172 (11), 6790–6802. Stuve, O., Leussink, V.I., Frohlich, R., Hemmer, B., Hartung, H.P., Menge, T., Kieseier, B.C., 2009. Long-term B-lymphocyte depletion with rituximab in patients with relapsing–remitting multiple sclerosis. Arch. Neurol. 66 (2), 259–261. Thangarajh, M., Gomez-Rial, J., Hedstrom, A.K., Hillert, J., Alvarez-Cermeno, J.C., Masterman, T., Villar, L.M., 2008. Lipid-specific immunoglobulin M in CSF predicts adverse long-term outcome in multiple sclerosis. Mult. Scler. 14 (9), 1208–1213. van der Neut, K.M., Schuurman, J., Losen, M., Bleeker, W.K., Martinez-Martinez, P., Vermeulen, E., den Bleker, T.H., Wiegman, L., Vink, T., Aarden, L.A., De Baets, M.H., van de Winkel, J.G., Aalberse, R.C., Parren, P.W., 2007. Anti-inflammatory activity of human IgG4 antibodies by dynamic Fab arm exchange. Science 317 (5844), 1554–1557. van Dongen, J.J., Langerak, A.W., Bruggemann, M., Evans, P.A., Hummel, M., Lavender, F.L., Delabesse, E., Davi, F., Schuuring, E., Garcia-Sanz, R., van Krieken, J.H., Droese, J., Gonzalez, D., Bastard, C., White, H.E., Spaargaren, M., Gonzalez, M., Parreira, A., Smith, J.L., Morgan, G.J., Kneba, M., Macintyre, E.A., 2003. Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 Concerted Action BMH4-CT98-3936. Leukemia 17 (12), 2257–2317. Venken, K., Hellings, N., Thewissen, M., Somers, V., Hensen, K., Rummens, J.L., Medaer, R., Hupperts, R., Stinissen, P., 2008. Compromised CD4+ CD25 (high) regulatory T-cell function in patients with relapsing–remitting multiple sclerosis is correlated with a reduced frequency of FOXP3-positive cells and reduced FOXP3 expression at the single-cell level. Immunology 123 (1), 79–89. Villar, L.M., Gonzalez-Porque, P., Masjuan, J., Alvarez-Cermeno, J.C., Bootello, A., Keir, G., 2001. A sensitive and reproducible method for the detection of oligoclonal IgM bands. J. Immunol. Methods 258 (1–2), 151–155. Villar, L.M., Sadaba, M.C., Roldan, E., Masjuan, J., Gonzalez-Porque, P., Villarrubia, N., Espino, M., Garcia-Trujillo, J.A., Bootello, A., Alvarez-Cermeno, J.C., 2005. Intrathecal synthesis of oligoclonal IgM against myelin lipids predicts an aggressive disease course in MS. J. Clin. Invest. 115 (1), 187–194. von Budingen, H.C., Kuo, T.C., Sirota, M., van Belle, C.J., Apeltsin, L., Glanville, J., Cree, B.A., Gourraud, P.A., Schwartzburg, A., Huerta, G., Telman, D., Sundar, P.D., Casey, T., Cox, D.R., Hauser, S.L., 2012. B cell exchange across the blood–brain barrier in multiple sclerosis. J. Clin. Invest. 122 (12), 4533–4543. Vrolix, K., Fraussen, J., Molenaar, P.C., Losen, M., Somers, V., Stinissen, P., De Baets, M.H., Martinez-Martinez, P., 2010. The auto-antigen repertoire in myasthenia gravis. Autoimmunity 43 (5–6), 380–400. Widhopf, G.F., Rassenti, L.Z., Toy, T.L., Gribben, J.G., Wierda, W.G., Kipps, T.J., 2004. Chronic lymphocytic leukemia B cells of more than 1% of patients express virtually identical immunoglobulins. Blood 104 (8), 2499–2504. Willis, S.N., Stadelmann, C., Rodig, S.J., Caron, T., Gattenloehner, S., Mallozzi, S.S., Roughan, J.E., Almendinger, S.E., Blewett, M.M., Bruck, W., Hafler, D.A., O'Connor, K.C., 2009. Epstein–Barr virus infection is not a characteristic feature of multiple sclerosis brain. Brain 132 (Pt. 12), 3318–3328. Yamada, M., Wasserman, R., Reichard, B.A., Shane, S., Caton, A.J., Rovera, G., 1991. Preferential utilization of specific immunoglobulin heavy chain diversity and joining segments in adult human peripheral blood B lymphocytes. J. Exp. Med. 173 (2), 395–407. Yancopoulos, G.D., Desiderio, S.V., Paskind, M., Kearney, J.F., Baltimore, D., Alt, F.W., 1984. Preferential utilization of the most JH-proximal VH gene segments in preB-cell lines. Nature 311 (5988), 727–733. Ziemssen, T., Ziemssen, F., 2005. The role of the humoral immune system in multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). Autoimmun. Rev. 4 (7), 460–467. Please cite this article as: Fraussen, J., et al., Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients, J. Neuroimmunol. (2013), http://dx.doi.org/10.1016/j.jneuroim.2013.05.002