Oncogene (1997) 15, 2833 ± 2839
1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00
Induction of a b-catenin-LEF-1 complex by wnt-1 and transforming
mutants of b-catenin
Emilio Por®ri1, Bonnee Rubinfeld1, Iris Albert1, Karine Hovanes2, Marian Waterman2
and Paul Polakis1
1
ONYX Pharmaceuticals, 3031 Research Drive, Richmond, California 94806, USA; and 2Microbiology and Molecular Genetics
Departments, University of California Irvine, Irvine, California 92697, USA
Signal transduction by b-catenin involves its posttranslational stabilization and import to the nucleus
where it interacts with transcription factors. Recent
implications for b-catenin signaling in cancer prompted
us to examine colon cancer cell lines for the expression
of LEF-1, a transcription factor that binds to b-catenin.
The analysis of several cell lines revealed the expression
of LEF1 mRNA and a constitutive association of the
LEF-1 protein with b-catenin. In contrast to the colon
cells, PC12 and 293 cells did not contain a b-cateninLEF-1 complex, even though both proteins were detected
in cell lysates. In these cells, the association of
endogenous LEF1 and b-catenin was induced by
stimulation with the wnt-1 proto-oncogene. The complex
formed following transient stimulation with wnt-1 and
also persisted in cells stably expressing wnt-1. Ectopic
overexpression of b-catenin in 293 cells also induced the
assembly of the b-catenin-LEF-1 complex and activated
gene transcription from a LEF-1-dependent promotor.
Expression of mutant oncogenic forms of b-catenin
identi®ed in cancer cells resulted in higher levels of
transcriptional activity. The results suggest that a cancer
pathway driven by wnt-1, or mutant forms of b-catenin,
may involve the formation of a persistent transcriptionally active complex of b-catenin and LEF1.
Keywords: b-catenin; LEF1; wnt-1; cancer
Introduction
Signal transduction mediated by b-catenin, or its
homolog armadillo, drives cell fate determinations in
embryonic development of Xenopus and Drosophila
(Gumbiner, 1995; Peifer, 1995). In mammalian cells,
several lines of evidence link b-catenin signaling to
cancer progression. The wnt-1 proto-oncogene, which
stabilizes b-catenin in cell culture (Bradley et al., 1993;
Hinck et al., 1994), promotes tumor formation when
expressed in mouse mammary tissue (Tsukamoto et al.,
1988). In colon cancer, hyperactive b-catenin signaling
may result from inactivation of the APC tumor
suppressor gene, the product of which downregulates
b-catenin in cultured cells (Munemitsu et al., 1995). In
tissue sections, b-catenin is grossly overexpressed in
adenomatous epithelium relative to neighboring
normal epithelial cells (Inomata et al., 1996). b-catenin
Correspondence: P Polakis
Received 23 May 1997; revised 28 July 1997; accepted 28 July 1997
has also been identi®ed by random expression cloning
of cDNAs capable of transforming NIH3T3 cells
(Whitehead et al., 1995). Finally, missense mutations
identi®ed in the b-catenin gene in cancer cells promote
the stabilization of the protein and prevent its
downregulation by the APC tumor suppressor
(Rubinfeld et al., 1997; Morin et al., 1997). Similar
mutations activate b-catenin or armadillo in wnt/wg
signalling (Yost et al., 1996; Pai et al., 1997). Although
these observations make a strong case for b-catenin as
an oncogene, it is not clear how transformation is
achieved by the stabilization of the protein. The
identi®cation of LEF/TCF transcription factors as
downstream targets for b-catenin signaling in embryonic development (Behrens et al., 1996; Huber et al.,
1996; Molenaar et al., 1996), suggests that transcription
of speci®c target genes may constitute an endpoint in
this cancer pathway.
The LEF-1 transcription factor was originally
identi®ed as a T cell-speci®c high mobility group
DNA binding protein that binds to a speci®c motif
in the minimal TCRa enhancer region and is required
for its activity (Travis et al., 1991; Waterman et al.,
1991). More recently, the LEF1 cDNA and a Xenopus
homolog XTcf-3 were found to interact with b-catenin
at a site localized to the extreme amino-terminal region
of LEF-1/XTcf-3 proteins (Behrens et al., 1996;
Molenaar et al., 1996). Both of the gene products
functionally interacted with b-catenin when tested for
axis duplication of Xenopus embryos. A Drosophila
homolog of the LEF/TCF gene has also been identi®ed
and shown to act downstream of the b-catenin
homolog armadillo in the wingless signaling pathway
(van de Wetering et al., 1997; Brunner et al., 1997).
These observations suggest that in cancer, deregulation
of b-catenin may result in its hyperactive interaction
with a LEF/TCF transcription factor and thereby
activate transcription of genes involved in cell growth
control. A constitutive complex of b-catenin and LEF1 has been detected in melanoma cell lines expressing
either mutant b-catenin or mutant APC (Rubinfeld et
al., 1997). Also, an additional LEF/TCF family
member, TCF-4, was identi®ed in colon cancer cells
and shown to activate transcription from a reporter
plasmid in response to b-catenin expression (Korinek et
al., 1997; Morin et al., 1997). Here we demonstrate
that LEF1 mRNA and protein are also expressed in
colon cancer cell lines and that b-catenin is constitutively associated with it. We have also investigated the
eects of the wnt-1 proto-oncogene on LEF1 complex
formation and demonstrate that wnt-1 induces the
association of b-catenin with LEF-1.
wnt-1 activation of b-catenin
E Porfiri et al
2834
Results
Based on the evidence implicating b-catenin in cancer
we sought to determine if the b-catenin binding protein
LEF-1 was present in colon cancer cell lines. Five of
the six cell lines examined contained polypeptides,
ranging in molecular weight from *50 000 ± 60 000,
that were reactive with antibody to LEF-1 (Figure 1a).
It was surprising to ®nd LEF-1 in colon cancer cells, as
its expression was thought to be con®ned mostly to
lymphocytes and lymphoid organs in adults (Travis et
al., 1991; Waterman et al., 1991), and we were unable
to detect it in RNA from normal adult colon or
intestine (Figure 1b). To con®rm its expression,
Northern analysis was performed on total RNA
puri®ed from the colon cancer cell lines. A LEF-1
cDNA probe recognized LEF-1 mRNA in total RNA
puri®ed from SW480, CMT93, colo320, DLD1 and
colo205 cells (Figure 1c). A 3.4 kb mRNA, previously
detected in Jurkat cells (Waterman et al., 1991), was
identi®ed in the colon cancer cells along with a novel
2.7 kb mRNA not seen in the Jurkat cells. We also
isolated LEF-1 cDNAs derived from reverse transcription of mRNA puri®ed from SW480 and DLD-1 cells.
An entire open reading frame was sequenced and the
predicted transcript matched a LEF-1 mRNA isoform
containing an 84 bp in-frame deletion (data not shown)
previously identi®ed in Jurkat cells (Waterman et al.,
1991).
To look for an interaction between b-catenin and
LEF-1 proteins, b-catenin immunoprecipitates were
β-cat. —
CM T93
Colo320
Colo205
DLD-1
SW480
Jurkat
Hela
colo205
DLD-1
SW948
colo320
CM T 93
c
SW480
a
analysed for LEF-1 by immunoblotting. A b-cateninLEF-1 complex was detected in the lysates from the
SW480, colo320, DLD-1 and colo205 cell lines (Figure
2a). The coimmunoprecipitation of LEF-1 with bcatenin was also con®rmed by southwestern analysis.
Beta-catenin immunoprecipitates resolved on SDSpolyacrylamide gels were transferred to ®lter membranes that were sequentially probed with a radiolabeled oligonucleotide containing a LEF-1 binding site
and then with a LEF-1 antibody. The 32P-labeled
oligonucleotide bound to a protein of the same
mobility as that recognized by the LEF-1 antibody
(Figure 2b).
The association of b-catenin with LEF-1 in cancer
cells may be conditional and dependent upon protein
modi®cations or subcellular location. Some cell lines,
such as the Jurkat T lymphocyte, contained ample
amounts of both LEF-1 and b-catenin, but no complex
was identi®ed (Figure 2c). This was not due to an
inability of the LEF-1 from Jurkat cells to bind bcatenin, as LEF-1 was anity precipitated from lysates
by puri®ed Glu-Glu epitope-tagged b-catenin (Figure
2c). LEF-1 was also recovered from SW480 lysates by
anity precipitation, however the majority of the LEF1 in these lysates was pre-complexed with endogenous
b-catenin as determined by its coimmunoprecipitation
with b-catenin antibodies. The lack of an endogenous
b-catenin-LEF-1 complex in the Jurkat cell suggested
b-catenin may not have access to LEF-1.
We have previously noted that the cytosolic
distribution and stability of b-catenin correlated with
28S —
LEF1
LEF1
18S —
PBL
GAPDH
colon
intestine
ovary
testis
prostate
thym us
spleen
b
7.5 —
4.4 —
2.4 —
Figure 1 Expression of LEF-1 in colon cancer cells. (a) Protein-equivalent amounts of total lysates from the indicated cell lines
were subjected to SDS ± PAGE and immunoblotting. The blot was cut horizontally and the sections incubated separately with
antibody speci®c to b-catenin (top) and LEF-1 (bottom). (b) Northern blot analysis for LEF1 in RNA from the indicated adult
human tissues. The blot was purchased from Clonetech and hybridized to a LEF-1-speci®c cDNA probe. (c) Northern blot of total
RNA hybridized to a LEF-1-speci®c cDNA probe (top). To control for RNA levels, the same blot was probed for GAPDH
expression (bottom). Migration of ribosomal RNA 18S and 28S is indicated at left of panel
wnt-1 activation of b-catenin
E Porfiri et al
α-β-cat.
cont.
α-β-cat.
cont.
cont.
αβ-cat.
cont.
αβ-cat.
b
cont.
αβ-cat.
cont.
αβ-cat.
cont.
αβ-cat.
αβ-cat.
a
cont.
2835
β-cat. —
LEF1 —
LEF1
32P-oligo
CM T93
SW480
colo320
SW948
colo205
DLD-1
158K
670K
cont.
β-cat. A.P.
αβ-cat
cont.
Total
Lysate
β-cat. A.P.
d
αβ-cat
c
α-LEF1
15
17
19
21
23
44K
25
LEF1
Jurkat
SW480
Jurkat
SW480
Jurkat
SW480
size fractionation
(β-catenin)
Figure 2 Association of LEF-1 with b-catenin. (a) Immunoprecipitates of b-catenin (ab-cat.) from the indicated colon cancer cell
lines were analysed for b-catenin and LEF-1 by SDS ± PAGE and immunoblotting. A Glu-Glu antibody was used as a control
(cont.). (b) The b-catenin (ab-cat) immunoprecipitates were resolved by SDS ± PAGE, transferred to a PVDF membrane and probed
with a radiolabeled oligonucleotide containing the LEF-1 binding site (32P-oligo.). Following autoradiography, membranes were
developed using an antibody to LEF-1 and visualized by enhanced chemiluminescence (a-LEF1). Glu-Glu antibody was used as a
control (cont.). (c) Lysates from Jurkat and SW480 cells were analyzed directly for LEF-1 by immunoblotting (total lysate) or ®rst
subjected to immunoprecipitation with antibody to b-catenin (ab-cat.), or anity precipitation using puri®ed Glu-Glu tagged bcatenin (b-cat. AP) or Glu-Glu tagged C3G protein as a control (Cont.). The puri®ed proteins were recovered on anti-Glu-Glu
beads and analysed for associated LEF-1. (d) Jurkat and SW480 cell lysates were subjected to size exclusion chromatography and
the fractions were analysed for b-catenin by SDS ± PAGE followed by immunoblotting. Column fraction numbers are shown at the
top, arrows indicate the elution position of protein standards
a monomeric pool observed on size fractionation
chromatography (Munemitsu et al., 1995; Papko et
al., 1996). This monomeric pool of b-catenin, which is
present in colon cancer cells, can be induced by the
wnt-1 proto-oncogene in nontransformed cells and is
opposed by the APC tumor suppressor. Therefore, this
pool of b-catenin may be indicative of a translocation
event that allows the interaction of b-catenin with
additional protein targets. Accordingly, we were unable
to detect a free pool of b-catenin by size exclusion
chromatography of Jurkat cell lysates (Figure 2d). By
contrast, high levels of free b-catenin were detected in
the SW480 cells as previously reported (Munemitsu et
al., 1995). The inability to detect this form of b-catenin
in Jurkat cells suggested that its subcellular distribution
may prevent its interaction with LEF-1.
That both b-catenin and LEF-1 are present in some
cell lines, but not associated, suggests that special
circumstances are required to aect their interaction.
As wnt-1 is known to stabilize b-catenin and promote
its distribution to cadherin-independent pools (Bradley
et al., 1993; Hinck et al., 1994; Papko et al., 1996), we
tested the ability of wnt-1 to promote the assembly of
the b-catenin-LEF-1 complex. The embryonal kidney
cell line 293 was chosen as we have noted that their
transient transfection with wnt-1 stabilizes b-catenin
and induces a free pool as determined by size exclusion
chromatography (P Polakis, B Rubinfeld; unpublished
data). No association of b-catenin with LEF-1 was
detected in cells transfected with empty vector,
although LEF-1 was anity precipitated from the cell
lysates by the addition and recovery of puri®ed bcatenin (Figure 3a). By contrast, when 293 cells were
transiently transfected with wnt-1, b-catenin formed a
complex with LEF-1 as determined by their coimmunoprecipitation (Figure 3a). It was possible that wnt-1
induced the complex through a mechanism not
involving the stabilization or distribution of b-catenin
to new subcellular compartments. To test this, we
transfected 293 cells with D89b-catenin, an N-terminal
deletion mutant which is highly stable and localizes to
free pools in the cell (Munemitsu et al., 1996). The
D89b-catenin formed a complex with LEF-1 when
expressed in the 293 cell (Figure 3a). This suggests that
wnt-1 likely enables the association of endogenous bcatenin with LEF-1 by promoting b-catenin subcellular
redistribution. It was also possible that wnt-1 induced
the LEF-1-b-catenin complex by elevating the levels of
LEF-1 expression. However, this was unlikely as the
association of ectopically overexpressed LEF-1 with bcatenin was still dependent upon wnt-1 stimulation
(Figure 3b).
wnt-1 activation of b-catenin
E Porfiri et al
M yc-LEF1
+Wnt-1
vector
cont.
β-cat .A.P.
αβ-cat.
cont.
β-cat .A.P.
αβ-cat.
cont.
β-cat .A.P.
M yc-LEF1
IP: anti-myc
b
αβ-cat.
w nt-1
vector
a
∆N89β-cat.
2836
β-cat. —
LEF1
w nt-1
Vector
Total lysate
∆N89β-cat.
(+) w nt-1
cont.
β-cat .A.P.
αβ-cat.
vector
cont.
αE-cad
αAPC
αβ-cat.
αE-cad
αAPC
αβ-cat.
d
αβ-cat.
c
β-cat .A.P.
M yc-LEF1 —
LEF1—
Vector
w nt-1
(–) w nt
–1
Total
lysate
(+) w nt
–1
Total
lysate
Figure 3 Induction of LEF-b-catenin complex by wnt-1. (a) Transient transfections with empty vector or plasmids encoding wnt-1
or DN89b-catenin were performed on 293 cells and the lysates were analysed for total LEF-1 (total lysate) or subjected to
immunoprecipitation (ab-cat.) or anity precipitation (b-cat. AP or cont.) as described in Figure 2. (b) Lysates from 293 cells
transfected with vector only (vector) or cotransfected with mycLEF-1 and either wnt-1 or empty vector were subjected to
immunoprecipitation using antibody to the myc epitope. Immunoprecipitates were analysed for LEF-1 and b-catenin by
immunoblotting. (c) Lysates from PC12 cells carrying empty vector or stably expressing wnt-1 were analysed directly for LEF-1
(total lysate) or ®rst subjected to immunoprecipitation with antibodies to b-catenin, APC and E-cadherin. (d) Lysates from wild type
PC12 cells grown on extracellular matrix derived from either wnt-1 expressing PC12 cells (+ wnt-1) or from control (7 wnt-1) cells
were subjected to immunoprecipitation with antibody to b-catenin (ab-cat.), or anity precipitation with Glu-Glu b-catenin (b-cat.
AP). The precipitates or total lysates were analysed for LEF-1 by immunoblotting
b
S45Yβ-cat.
Vector
S45Yβ-cat.
S37Aβ-cat.
w tβ-cat.
Vector
S37Aβ-cat.
anti-m yc IP
Total lysate
w tβ-cat.
a
116 —
— b-cat. —
80 —
anti-β-catenin
anti-m yc tag
LEF1
50 —
anti-LEF1
Figure 4 Activation of LEF-1-dependent transcription by wild type and mutant b-catenins. (a) A plasmid expressing a LEF-1responsive reporter was cotransfected into 293 cells with either empty vector (vector) or plasmid expressing wild type (wt b-cat.) or
mutant (S37Ab-cat., S45Yb-cat.) b-catenins. Reporter activation resulted in luciferase expression that was assayed in aliquots of
lysate normalized for protein. The data represent the mean+s.d. of eight independent determinations. (b) Myc immunoblot of total
lysates from 293 cells transfected with vector alone or myc tagged wild-type b-catenin or with the indicated mutant b-catenins (left).
Protein-equivalent aliquots of the same lysates were subjected to immunoprecipitation with myc antibody and immunoprecipitates
were analysed by immunoblotting for b-catenin and LEF-1 (right)
wnt-1 activation of b-catenin
E Porfiri et al
2837
To further demonstrate the induction of the bcatenin-LEF-1 complex by wnt-1, we employed the
PC12 cell line in which b-catenin, and its homolog
plakoglobin (Bradley et al., 1993), localize to new
subcellular compartments in response to wnt-1. The bcatenin-LEF-1 complex was readily detected in PC12
cells stably expressing wnt-1, but not in those carrying
empty vector (Figure 3c). Immunoprecipitates of two
additional b-catenin binding proteins E-cadherin and
APC did not contain LEF-1, demonstrating that they
are not in the b-catenin-LEF-1 complex. The induction
of the b-catenin-LEF-1 complex also occurred, albeit
to a lesser degree, in parental PC12 cells when plated
on an extracellular matrix derived from the wnt-1
expressing cells (Figure 3d). In the absence or presence
of wnt-1, LEF-1 was anity precipitated by puri®ed bcatenin, but the endogenous proteins were only
associated in cells stimulated with wnt-1.
The above results suggest that the stabilization and
redistribution of b-catenin may be required for its
association with LEF-1. Recently, we have identi®ed
missense mutants of b-catenin in melanoma cell lines
that contain the substitutions ser37phe and ser45tyr
(Rubinfeld et al., 1997). These b-catenins are highly
stable, accumulate to high steady-state levels and are
distributed throughout the cytoplasm and nucleus. To
determine whether these mutants form a transcriptionally active complex with LEF-1, we tested their ability
to activate a luciferase reporter plasmid containing the
minimal T-cell receptor a enhancer placed upstream of
the herpes virus thymidine kinase promoter. This
enhancer contains an LEF1 binding site ¯anked on
opposite sides by CRE and Ets-1 binding sites. In 293
cells, expression of luciferase activity was greatly
enhanced by cotransfection of b-catenins with the
reporter construct, and the mutant b-catenins were
more eective than wildtype (Figure 4a). This was
consistent with the higher steady-state levels of mutant
b-catenin and the higher levels of LEF-1 that
coimmunoprecipitated with the mutants relative to
wildtype b-catenin (Figure 4b). Thus, the mutant bcatenins identi®ed in cancer cells can activate LEF-1dependent transactivation and, due to their increased
stability, are stronger activators than wildtype bcatenin.
Discussion
There is considerable evidence now to implicate bcatenin as a contributing factor in cancer progression.
Its stability is aected in opposing manners by the
APC tumor suppressor and the wnt-1 oncogene
(Munemitsu et al., 1995; Papko et al., 1996), and
missense mutations that stabilize b-catenin have been
identi®ed in cancer cells (Morin et al., 1997; Rubinfeld
et al., 1997). Although these observations are
compelling, how b-catenin alters cell growth remains
to be determined. This could come about through its
interaction with any of the known b-catenin binding
proteins including cadherins (McCrea et al., 1991),
fascin (Tao et al., 1996), the EGF receptor
(Hoschuetzky et al., 1994), APC (Rubinfeld et al.,
1993; Su et al., 1993) or the LEF/TCF transcription
factors (Behrens et al., 1996; Huber et al., 1996;
Molenaar et al., 1996). Finding b-catenin in the
nucleus, functionally coupled to a transcription
factor, makes the activation of growth controlling
genes an attractive model for a b-catenin cancer
mechanism. However, it is unclear which of the LEF/
TCF transcription factors represent the appropriate
partner for b-catenin in this pathway. LEF-1, TCF-1,
and TCF-4 all contain b-catenin binding sites in their
amino-terminal regions (Behrens et al., 1996; Korinek
et al., 1997). Based on its expression in colonic
epithelium, and its interaction with b-catenin, TCF-4
has been proposed as a target for b-catenin in colon
cancer (Korinek et al., 1997). Here we have shown that
LEF-1 mRNA is expressed in colon cancer cell lines
and that the protein is constitutively associated with bcatenin. Thus, LEF-1 also needs to be considered as a
potential target for b-catenin signaling in cancer.
We were unable to detect LEF-1 mRNA in normal
colonic mucosa consistent with previous reports that
LEF-1 expression is largely con®ned to lymphoid
organs (Waterman et al., 1991). It is unclear how
LEF-1 expression becomes reactivated in colon
cancer, but this event may represent another
component of tumor progression. The cDNA that
we identi®ed in the colon cancer cells was identical to
a naturally occurring splice variant previously
identi®ed in Jurkat cells (Waterman et al., 1991).
This alternatively spliced mRNA codes for an LEF-1
lacking amino acids 214-241. The signi®cance of this
deletion has not been determined, but this sequence
lies within a modular transactivation domain previously de®ned in LEF-1, and deletion of these amino
acids impairs the activity of this domain (Carlsson et
al., 1993). It is possible that the products of the LEF1 mRNA splice variants respond dierentially to their
interaction with b-catenin. Indeed, alternatively
spliced forms of the TCF-1 mRNA result in proteins
that either contain or lack the amino-terminal binding
site for b-catenin (Van de Wetering et al., 1996). The
identi®cation of the speci®c LEF/TCF forms responsible for oncogenic signaling through b-catenin will
require a careful analysis of many candidates.
Additionally, it is not clear in what context the
LEF-1 DNA binding site must occur to receive the
relevant b-catenin-dependent signal. Transactivation
by LEF-1 does not occur in test systems employing
only multimerized copies of the LEF-1 binding site,
but requires adjacent binding sites for additional
enhancer proteins (Carlsson et al., 1993; Giese and
Grosschedl, 1993). Our results show that expression
of b-catenin can promote transcription from the T-cell
receptor a enhancer, however, the context of the bcatenin-LEF-1 binding site in colon cancer cells is
unknown. Moreover, TCF-4 can activate transcription
in a b-catenin-dependent manner without requiring
¯anking binding sites for additional transcription
factors (Korinek et al., 1997).
In the present study, the association of b-catenin
with LEF-1 appeared to be dependent on the status of
b-catenin in the cell. We have previously reported that
the subcellular distribution and the oligomeric composition of b-catenin are in¯uenced by the APC tumor
suppressor, the wnt-1 oncogene, and mutations in bcatenin itself (Munemitsu et al., 1995, 1996; Papko et
al., 1996; Rubinfeld et al., 1997). The colon cancer cells
containing constitutive LEF-1-b-catenin complexes all
exhibited a free pool of b-catenin indicative of its
wnt-1 activation of b-catenin
E Porfiri et al
2838
distribution to noncytoskeletal compartments. In cells
containing wildtype APC, the b-catenin can be induced
to undergo a similar redistribution when stimulated by
wnt-1 (Papko et al., 1996). Accordingly, wnt-1 also
promoted the association of LEF-1 with b-catenin.
Finally, in cells containing wildtype APC, speci®c point
mutations or deletions in b-catenin will also promote
its distribution into cytosolic and nuclear compartments (Munemitsu et al., 1996; Rubinfeld et al., 1997).
Ectopic expression of these mutant b-catenins resulted
in their association with LEF-1 and strongly promoted
the transactivation of a reporter plasmid containing
LEF-1 binding sites. Together the results indicate that
the induction of b-catenin by a variety of mechanisms,
all result in its interaction with the LEF-1 transcription
factor. This interaction is also likely to occur in vivo as
excessive staining of b-catenin in both the cytoplasm
and nucleus of adenomatous colonic tissue has been
observed (Inomata et al., 1996). Hence, the identification of target genes activated by b-catenin-LEF/TCF
complexes should greatly extend our understanding of
this cancer mechanism.
Materials and methods
Transfections, immunoprecipitations and immunoblotting
All cell lines were from the American Type Culture
Collection (ATCC). Human LEF-1 (Waterman et al.,
1991) and murine wnt-1 (Fung et al., 1985) cDNAs were
subcloned into the pCDNA3 (Invitrogen) expression vector
containing the Myc epitope tag. The b-catenin ser45tyr
mutant was generated by fragment switching between wild
type b-catenin cDNA and b-catenin cDNA isolated from a
melanoma cell line containing the ser45tyr mutant
(Rubinfeld et al., 1997). Transient transfection of 293
cells was carried out using a modi®cation of the calcium
phosphate precipitation method (Munemitsu et al., 1994).
For the derivation of stable PC12 cell lines, cells were
transfected by electroporation at 500 mF and 230 mV, and
grown for 3 days in complete medium before selection in
G418 (Loeb and Greene, 1993). Wnt-1-conditioned
extracellular matrix was generated by growing PC12 cells
stably expressing wnt-1 on collagen type IV coated dishes
for 2 ± 3 days. Cells were scraped and the dishes used to
culture wild type PC12 cells. Under these conditions, bcatenin was stabilized and distributed to the cytoplasm in
the cells grown on the wnt-1 conditioned extracellular
matrix (E Por®ri, P Polakis, unpublished data). For
immunoprecipitation and immunoblotting, the cells were
lysed in Triton X-100 buer as described (Rubinfeld et al.,
1996). Approximately 1 mg of total cell protein was used
for each immunoprecipitation or for anity precipitations
using 2 mg of Glu-Glu tagged puri®ed b-catenin or GluGlu tagged C3G protein as control. The polyclonal
antibodies to LEF-1 (Waterman et al., 1991) and b-
catenin (Rubinfeld et al., 1996) used for immunoblotting
(0.2 mg/ml) have been described. The monoclonal antibodies used to immunoprecipitate b-catenin and cadherin
were purchased from Transduction Laboratories, those to
the Myc and Glu-Glu epitope tag have been described
(Evan et al., 1985; Grussenmyer et al., 1985).
Northern and Southwestern analysis
Northern analysis was carried out as described (Waterman
et al., 1991). RNA was puri®ed from the indicated cell
lines using the RNeasy kit (Qiagen). Ten mg of total RNA
were fractionated on a 1.2% agarose formaldehyde gel
and transferred to a Hybond N membrane (Amersham).
Blots were probed with a radiolabeled DNA probe
representing most of the LEF-1 ORF (bp 821 ± 1824 of
LEF-1 cDNA). Southwestern analysis was performed
essentially as described (Waterman and Jones, 1990). bcatenin immunoprecipitates were resolved by SDS ± PAGE
(Novex) and transferred to a PVDF membrane. Membranes were equilibrated in binding buer (20 m M
HEPES, pH 7.9, 60 mM KCl, 1 mM DTT, 10% glycerol,
0.01% NP-40) for 10 min and blocked for a further
10 min in 5% non-fat milk in binding buer containing
4 mg/ml salmon testes DNA. Blots were rinsed and
incubated for 16 h at 48C with 107 c.p.m. of a 32P-labeled
double stranded oligonucleotide containing a LEF-1
binding site (GATCTAGGGCACCCTTTGAAGCTCT)10
in 3 ml of binding buer containing 4 mg/ml salmon
testes DNA. Polynucleotide kinase and 32P-g-ATP was
used to label the probe. Following hybridization, blots
were washed and autoradiographed. After autoradiography blots were incubated with anti-LEF-1 antibody and
developed using enhanced chemiluminescence. For isolation of LEF-1 cDNAs, a cDNA pool was ®rst obtained by
reverse transcription of total mRNA (RNeasy kit, Qiagen)
using random primers. PCR was then performed on the
cDNA pool using a primer set corresponding to bp 1 ± 18
and 1178 ± 1200 of LEF-1 open reading frame, and the
PCR products were cloned into pCR2.1 (Invitrogen) and
propagated in E. coli.
Luciferase assay
For luciferase assays, the reporter construct a2tk (1 mg),
which contained two copies of the TCRa enhancer
upstream of the TATA box of the HSV-1 tymidine kinase
promoter and luciferase gene (Waterman and Jones, 1990)
was cotransfected with the indicated plasmid (1 mg) into
293 cells. Cells were lysed and luciferase activity was
measured in a luminometer using the Luciferase Assay
System kit (Promega) and normalized to the protein
concentration.
Acknowledgements
We thank David Lowe for production of recombinant Sf9
cells and Jackie Papko for the plasmid expressing wnt-1.
References
Behrens J, von Kries JP, Kuhl M, Bruhn L, Wedlich D,
Grosschedl R and Birchmeier W. (1996). Nature, 382,
638 ± 642.
Bradley RS, Cowin P and Brown AMC. (1993). J. Cell. Biol.,
123, 1857 ± 1865.
Brunner E, Peter O, Schweizer L and Basler K. (1997).
Nature, 385, 829 ± 833.
Carlsson P, Waterman ML and Jones KA. (1993). Genes
Dev., 7, 2418 ± 2430.
Evan G, Lewis G, Ramsey G and Bishop J. (1985). Mol. Cell.
Biol., 5, 3610.
Fung YK, Shackleford GM, Brown AM, Sanders GS and
Varmus HE. (1985). Mol. Cel. Biol., 5, 3337 ± 3344.
Giese K and Grosschedl R. (1993). EMBO J., 12, 4667 ±
4676.
Grussenmyer T, Scheidtmann KH, Hutchinson MA and
Walter G. (1985). Proc. Natl. Acad. Sci. USA, 82, 7952 ±
7954.
wnt-1 activation of b-catenin
E Porfiri et al
2839
Gumbiner BM. (1995). Curr. Opin. Cell Biol., 7, 634 ± 640.
Hinck L, Nelson WJ and Papko J. (1994). J. Cell Biol., 124,
729 ± 741.
Hoschuetzky H, Aberle H and Kemler R. (1994). J. Cell.
Biol., 127, 1375 ± 1380.
Huber O, Korn R, McLaughlin J, Ohsugi M, Herrmann BG
and Kemler R. (1996). Mech. Dev., 59, 3 ± 10.
Inomata M, Ochiai A, Akimoto S, Kitano S and Hirohashi S.
(1996). Cancer Res., 56, 2213 ± 2217.
Korinek V, Barker N, Morin PJ, van Wichen D, de Weger R,
Kinzler KW, Vogelstein B and Clevers H. (1997). Science,
275, 1784 ± 1787.
Loeb DM and Greene LA. (1993). J. Neurosci., 13, 2919 ±
2929.
McCrea PD, Turck CW and Gumbiner B. (1991). Science,
254, 1359 ± 1361.
Molenaar M, van de Wetering M, Oosterwegel M, PatersonMaduro J, Godsave S, Korinek V, Roose J, Destree O and
Clevers H. (1996). Cell, 86, 391 ± 399.
Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H,
Vogelstein B and Kinzler KW. (1997). Science, 275, 1787 ±
1790.
Munemitsu S, Albert I, Rubinfeld B and Polakis P. (1996).
Mol. Cell. Biol., 16, 4088 ± 4094.
Munemitsu S, Albert I, Souza B, Rubinfeld B and Polakis P.
(1995). Proc. Natl. Acad. Sci. USA, 92, 3046 ± 3050.
Munemitsu S, Souza B, Muller O, Albert I, Rubinfeld B and
Polakis P. (1994). Cancer Res., 54, 3676 ± 3681.
Papko J, Rubinfeld B, Schryver B and Polakis P. (1996).
Mol. Cell. Biol., 16, 2128 ± 2134.
Pai LM, Orsulic S, Bejsovec A and Peifer M. (1997).
Development, 124, 2255 ± 2266.
Peifer M. (1995). Trends Cell. Biol., 5, 224 ± 229.
Rubinfeld B, Albert I, Por®ri E, Fiol C, Munemitsu S and
Polakis P. (1996). Science, 272, 1023 ± 1026.
Rubinfeld B, Robbins, P, El-Gamil M, Albert I, Por®ri P and
Polakis P. (1997). Science, 275, 1790 ± 1792.
Rubinfeld B, Souza B, Albert I, Muller O, Chamberlain SC,
Masiarz F, Munemitsu S and Polakis P. (1993). Science,
262, 1731 ± 1734.
Su L-K, Vogelstein B and Kinzler KW. (1993). Science, 262,
1734 ± 1737.
Tao YS, Edwards RA, Tubb B, Wang S, Bryan J and
McCrea PD. (1996). J. Cell. Biol., 134, 1271 ± 1281.
Travis A, Amsterdam A, Belanger C and Grosschedl R.
(1991). Genes Dev., 5, 880 ± 894.
Tsukamoto AS, Grosschedl R, Guzman RC, Parslow T and
Varmus HE. (1988). Cell, 55, 619 ± 625.
Van de Wetering M, Castrop J, Korinek V and Clevers H.
(1996). Mol. Cell. Biol., 16, 745 ± 752.
van de Wetering M, Cavallo R, Dooijes D, van Beest M, van
Es J, Loureiro J, Ypma A, Hursh D, Jones T, Bejsovec A,
Peifer M, Mortin M and Clevers H. (1997). Cell, 88, 789 ±
799.
Waterman ML, Fischer WH and Jones KA. (1991). Genes
Dev., 5, 656 ± 669.
Waterman ML and Jones KA. (1990). New Biol., 2, 621 ±
636.
Whitehead I, Kirk H and Kay R. (1995). Mol. Cell. Biol., 15,
704 ± 710.
Yost C, Torres M, Miller JR, Huang E, Kimelman D and
Moon RT. (1996) Genes & Dev, 10, 1443 ± 1454.