Molecular Microbiology (2011) 䊏
doi:10.1111/j.1365-2958.2011.07676.x
The N-terminal part of Als1 protein from Candida albicans
specifically binds fucose-containing glycans
mmi_7676 1..13
Dagmara S. Donohue, Francesco S. Ielasi,
Katty V. Y. Goossens and Ronnie G. Willaert*
Laboratory of Structural Biology, Vrije Universiteit
Brussel, Pleinlaan 2, 1050 Brussels, Belgium.
Summary
The opportunistic pathogen Candida albicans
expresses on its surface Als (Agglutinin like
sequence) proteins, which play an important role in the
adhesion to host cells and in the development of
candidiasis. The binding specificity of these proteins
is broad, as they can bind to various mammalian proteins, such as extracellular matrix proteins, and N- and
E-cadherins. The N-terminal part of Als proteins constitutes the substrate-specific binding domain and is
responsible for attachment to epithelial and endothelial cells. We have used glycan array screening to
identify possible glycan receptors for the binding
domain of Als1p-N. Under those conditions, Als1p-N
binds specifically to fucose-containing glycans, which
adds a lectin function to the functional diversity of the
Als1 protein. The binding between Als1p-N and BSAfucose glycoconjugate was quantitatively characterized using surface plasmon resonance, which demonstrated a weak millimolar affinity between Als1p-N
and fucose. Furthermore, we have also quantified the
affinity of Als1p-N to the extracellular matrix proteins
proteins fibronectin and laminin, which is situated in
the micromolar range. Surface plasmon resonance
characterization of Als1p-N–Als1p-N interaction was
in the micromolar affinity range.
Introduction
Candida albicans occurs naturally as a part of the human
gastrointestinal flora. In a healthy body, with wellmaintained homeostasis, this commensal interaction
remains unnoticed. However, when the balance between
the immune system and C. albicans is disturbed, commensalism may turn into fungal infection (candidiasis)
(Mavor et al., 2005; Rupp, 2007). Adherence is an essenAccepted 19 April, 2011. *For correspondence. E-mail ronnie.
willaert@vub.ac.be; Tel. (+32) 2629 1846; Fax (+32) 2629 1963.
© 2011 Blackwell Publishing Ltd
tial determinant of pathogenesis, as it allows C. albicans
to attach to host cells and to form biofilms that protect the
yeast cells from unfavourable conditions.
Candida albicans has developed multiple ways to colonize and infect host cells and tissues. One such mechanism is the specific ligand–receptor interaction through a
whole range of adhesins displayed on the yeast cell wall
(Chaffin et al., 1998; Sundstrom, 2002; Filler, 2006). These
cell wall proteins are capable of recognizing protein ligands
(reviewed in Chaffin et al., 1998), glycolipids (Ghannoum
et al., 1986, Jimenez-Lucho et al., 1990; Yu et al., 1994;
Cameron and Douglas, 1996) and carbohydrates on mammalian cells (Sandin et al., 1982; Critchley and Douglas,
1987a; Macura and Tondyra, 1989; Brassart et al., 1991).
The ALS gene family of C. albicans encodes eight
known large cell surface glycoproteins that are involved in
adhesion to mammalian cells (Fu et al., 1998; Sheppard
et al., 2004; Hoyer et al., 2008; Zhu and Filler, 2010).
Each Als protein possesses an N-terminal region with the
secretory signal peptide, followed by a threonine-rich
region, then a highly glycosylated central domain rich in
tandem repeats and a C-terminus with a glycosylphosphatidylinositol anchor (Hoyer, 2001; Frank et al., 2010).
Homology modelling and experimental studies indicate
that the N-terminal part of the Als proteins contain
domains that belong to the immunoglobulin superfamily
(Sheppard et al., 2004). Each Ig-like domain consists of
two sheets of seven stranded anti-parallel b-strands.
Microorganisms commonly use this type of structure for
cell–cell recognition and signalling functions (Holmgren
et al., 1992; Barclay, 2003).
The Als1 protein has been shown to be abundantly
expressed in various candidiasis models, where it was
able to bind to epithelial and endothelial cells (Fu et al.,
2002; Kamai et al., 2002; Green et al., 2004; 2006;
Sheppard et al., 2004; Cheng et al., 2005). Experimental
data on Als1p show that the substrate-specific binding
domain is located within the N-terminus (Loza et al.,
2004; Sheppard et al., 2004; Phan et al., 2007). It was
demonstrated that different Als proteins can bind to
extracellular matrix proteins (ECM), epithelial and endothelial cells (Sheppard et al., 2004). It has been shown
using C. albicans and Saccharomyces cerevisiae
expressing Als proteins that both Als1p and Als5p recognize peptides containing the structural motif tj+ (a
2 D. S. Donohue, F. S. Ielasi, K. V. Y. Goossens and R. G. Willaert 䊏
Fig. 1. A. SDS-PAGE gel of the purified N-terminal part of Als1p. Lanes 1–2: MW markers, lane 3: Als1-N after gel filtration. Molecular
weights are indicated for the marker in lane 1.
B. Glycan staining of Als1p-N using the Glycoprotein Gel Stain Kit. Lane 1: MW marker, lane 2: stained glycosylated Als1p-N.
C. SDS-PAGE of the magnetic bead assay. Lane 1: MW marker, lane 2: the presence of Als1p-N at the expected molecular height
(approximately 60 kDa) after boiling of the beads indicates that the protein was bound to fibronectin-coupled beads.
turn-like residue, a bulky hydrophobic residue, and Lys
or Arg), which can be found in many proteins (Klotz
et al., 2004). However, Als1p does not recognize some
peptides recognized by Als5p. This suggests that different Als proteins have preference towards different
sequences within the ligands. It has also been shown
that the N-terminal part of Als3 and Als1 proteins bind to
epithelial cell E-cadherin and endothelial cell N-cadherin
and this induces endocytosis by host cells (Phan et al.,
2007).
Host–pathogen interactions depend very often on
carbohydrate–lectin interactions. The presence of a
lectin-like adhesin with specifity for L-fucose or Nacetylglucosamine (GlcNAc) has been previously
described for C. albicans adhesion, but this lectin activity
was not attributed to any specific protein found on the cell
wall of C. albicans (Critchley and Douglas, 1987b; Tosh
and Douglas, 1992; Vardar-Ünlü et al., 1998).
The goal of this study was to determine if the
N-terminal, substrate-specific part of Als1p possesses an
affinity to carbohydrates and thus has lectin activity.
Therefore, the N-terminal part of Als1p (Als1p-N) was
overexpressed in S. cerevisiae, purified, and used in a
glycan microarray screening. This experiment revealed
the specificity of Als1p-N towards glycans containing
fucose. Surface plasmon resonance (SPR) experiments
confirmed the specific interaction between Als1p-N and
fucose, which bound to each other with millimolar affinity.
Additionally, the Als1p-N interactions with fibronectin and
laminin as well as Als1p-N–Als1p-N interactions were
quantitatively investigated using SPR.
Results
Als1p-N binds to fibronectin and laminin with
micromolar affinity
The N-terminal part of the Als1 protein (18–432 aa) was
produced in S. cerevisiae by secretion to the medium.
Mass spectrometry analysis and N-terminal sequencing
(data not shown) confirmed the presence of the Als1p-N
protein after purification. The protein has a predicted
molecular weight (MW) of 45 kDa, but runs on SDS-PAGE
gel as an approximately 60 kDa protein (Fig. 1A). The
higher MW is probably due to glycosylation of the protein.
Glycan staining experimentally confirmed the presence of
glycans using Pro-Q Emerald 300 Glycoprotein Gel and a
Blot Stain Kit (Invitrogen) (Fig. 1B). The analysis of the
Als1p-N sequence indicated that only O-glycosylation
should be present. The Als1p-N (18–432 aa) contains 40
serines and 76 threonines, many of which are located in
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
Als1p-N from Candida albicans binds to fucose glycans 3
A
B
C
Fig. 2. A. Topographic AFM image of Als1p-N adsorbed to mica. Inset: zoomed-in AFM picture, where the arrows indicate monomers (M),
dimers (D) or trimers (T) of Als1p-N.
B. The representation of the Als1p-N volume distribution obtained through image analysis. The majority of Als1p-N deposited on mica is
present in the monomeric form.
C. Dynamic light scattering. Representation of the Als1p-N particles in buffer solution used for the Biacore experiments: the monomeric form of
Als1p-N with a radius of 3.11 nm corresponds to the first peak; and the second peak represents the aggregated form of Als1p-N with a radius
of 115.62 nm.
the T-rich region and can be highly O-glycosylated. The
treatment of Als1p-N with EndoH enzyme, which removes
N-glycans from the protein, did not result in a reduced
molecular weight (data not shown). High-resolution
atomic force microscopy (AFM) imaging showed protein
edges that are blurry, which is an indication of the presence of glycans (Fig. 2A). A cross-sectional analysis of
the protein (3D AFM height) image showed the presence
of the glycans as well (data not shown). Evaluation of the
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
binding of Als1p-N to fibronectin-coupled Dynabeads
(Fig. 1C) confirmed the activity of the protein. The presence of Als1p-N in the supernatant after boiling the beads
visualized by SDS-PAGE gel indicated that Als1p-N binds
to fibronectin.
Surface plasmon resonance analysis was performed to
quantify the affinity between Als1p-N and both fibronectin
and laminin (Fig. 3A–D). After fibronectin and laminin
were coupled to the CM5 chip, Als1p-N was used as the
4 D. S. Donohue, F. S. Ielasi, K. V. Y. Goossens and R. G. Willaert 䊏
A
B
C
D
Fig. 3. A. SPR sensorgram of the interaction between fibronectin and Als1p-N (concentration range of 0.02–100 mM).
B. Fitting of the data points at equilibrium for the Als1p-N–fibronectin interaction to the steady-state 1:1 model.
C. SPR sensorgram of the interaction between laminin and Als1p-N (concentration range of 0.12–62.5 mM).
D. Fitting of the data points at equilibrium for the Als1p-N–laminin interaction to the steady-state 1:1 model.
analyte to flow over the chip. The dissociation constant at
equilibrium state (KD) was estimated at 1.6 ⫾ 0.6 ¥ 10-6 M
for the Als1p-N–fibronectin interaction and 1.3 ⫾ 0.2 ¥
10-5 M for the Als1p-N–laminin interaction using the 1:1
binding model.
Als1p-N recognizes specifically
fucose-containing glycans
The purified Als1p-N was subjected to a high-throughput
screening allowing the binding to a total of 406 different
synthetic glycan structures covalently attached to a
microarray glass slide through molecular spacers of different lengths. The Als1p-N bound selectively to multiple
groups of ligands with terminal fucose as well as to fucose
alone (Fig. 4A). Most glycans that gave the highest fluorescence signals contained the structure Fuca1-2Galb1GlcNAc (Fig. 4B). Additionally, Als1p-N selectively bound
to fucose linked to N-acetylglucosamine (GlcNAc) via a1–3
and a1–4 linkages. The specificity for a particular stereochemistry was high, as no significant binding to other
monosaccharides, such as mannose, galactose, rhamnose, glucose and N-acetylglucosamine was observed.
To find out if the interaction between Als1p-N and the
ECM proteins laminin and fibronectin is based on a specific interaction with fucose, SPR inhibition experiments
by adding fucose to the Als1p-N solution were performed;
glucose and galactose were chosen as negative controls
(based on the glycan array results). The results (Table S1)
show that fucose exerts a significant – but modest –
inhibitory effect on the binding of Als1p-N to both laminin
and fibronectin. Glucose and galactose do not have a
significant inhibitory effect on the binding of Als1p-N to
laminin. Unexpectedly glucose and galactose also
reduced binding of Als1p-N to fibronectin by almost half,
relative to binding without added monosaccharide. These
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
Als1p-N from Candida albicans binds to fucose glycans 5
A
Fig. 4. Interaction of Als1p-N with glycans
on the glycan microarray chip.
A. Als1p-N glycan array spectrum.
Fucose-containing glycans (No 10–11, 55–86,
262–279) bind specifically to the N-terminal
part of Als1 protein.
B. Consolidated glycan array data. Most
fucose-containing glycans recognized by
Als1p-N contained the
Fuca1-2Galb1-4GlcNAc structure (first group
of glycans), which is a constituent of type-2 H
antigen. The second group of glycans
(Fuca1-3GlcNAcb) represents structures
present in Lewisx and Lewisy and the third
group (Fuca1-4GlcNAcb) contains glycans
present in Lewisa and Lewisb antigens. The
binding response of Als1p-N to fucose alone
is shown in the forth group. Glycans with a
fluorescence response lower than 40 RFU
were not included. Error bars are based on
the standard error of the mean for six
replicates.
B
results suggest strongly that inhibition of the fucose–lectin
interaction is insufficient to disrupt Als1p-N binding to
laminin or fibronectin.
Als1p-N binds to BSA-fucose with millimolar affinity and
to Als1p-N with micromolar affinity
The binding of the N-terminal part of Als1p to fucose was
further studied by injecting increasing concentrations of
Als1p-N in a BIAcore flow cell over the CM5 chip coated
with BSA-fucose neoglycoconjugate. A wide concentration
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
range of Als1p-N (11–355 mM) was used to maximize the
signal-to-noise ratio and to facilitate the evaluation of the
results. Figure 5A shows a typical sensorgram obtained for
the interaction of Als1p-N with BSA-fucose. The equilibrium dissociation constant was obtained by fitting the data
to the 1:1 binding model and the estimated affinity was in
millimolar range with a KD value of 2.1 ⫾ 0.3 ¥ 10-4 M
(Fig. 5B). Similarly, the N-terminal part of the Als1 protein
was immobilized on a CM5 chip and increasing concentrations of Als1p-N (0.82–210 mM) were injected in the flow
cell (Fig. 5C). Fitting of the data using the 1:1 binding
6 D. S. Donohue, F. S. Ielasi, K. V. Y. Goossens and R. G. Willaert 䊏
A
B
C
D
Fig. 5. A. SPR sensorgram of the BSA-fucose and Als1p-N (concentration range of 11–355 mM) interaction.
B. Fitting of the data points at equilibrium for the Als1p-N–BSA-fucose interaction to the steady-state 1:1 model.
C. SPR sensorgram of the Alsp1-N and Als1p-N (concentration range of 0.82–210 mM) interaction.
D. Fitting of the data points at equilibrium for the Als1p-N–Als1p-N interaction to the steady-state 1:1 model.
model, resulted in an estimated affinity KD for Als1p-N –
Als1p-N binding of 2 ⫾ 0.1 ¥ 10-5 M (Fig. 5D).
Als1p-N in solution exists predominantly
in monomeric form
To find out, if the Als1p-N can form aggregates in buffer
used for SPR experiments, the Als1p-N protein (667
protein particles/mm2) was adsorbed to mica and visualized
using tapping mode AFM (Fig. 2A). Figure 2A shows that
most proteins are monomeric, but also small aggregates
can be observed (some aggregates are pointed with
arrows on the inset picture). A rough estimate of the volume
distribution was performed using the method of Ratcliff and
Erie (2001) (Fig. 2B). The majority of the particles are in a
monomeric form (smaller than 25 nm3). The analysis of
Als1p-N by dynamic light scattering confirmed the presence of a very large protein fraction in monomeric form
(Fig. 2C). One population corresponded to the monomeric
state of Als1p-N with a radius of 3.11 nm and was responsible for 93% of the change in light intensity. The second
population of Als1p-N was in the aggregated form with a
radius of 115.62 nm and was responsible for only 7% of the
change in light intensity. Additionally, during gel filtration of
the Als1p-N into HBS buffer there was no indication of the
formation of aggregates, as protein came out of the column
as one peak at 280 nm corresponding to the molecular
weight protein of approximately 60 kDa. These results
suggest that the predominant form of Als1p-N in buffer
used for Biacore analysis was in the monomeric, nonaggregated form and justifies the one-to-one binding
model used to obtain the affinity constants (KD).
Discussion
In this study, we have used the Als1 protein encompassing the N-terminal, substrate-specific domain (Ig region of
about 310 aa) together with the threonine-rich region
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
Als1p-N from Candida albicans binds to fucose glycans 7
(T region of about 105 aa), which has been shown previously to be necessary for proper protein folding and
secretion to the medium (Rauceo et al., 2006). The
binding activity resides in the N-terminal part of Als
protein, although tandem repeats have been shown to
enhance the binding of the Als1p N-terminal part and alter
the functional characteristics of Als proteins (Loza et al.,
2004; Sheppard et al., 2004; Oh et al., 2005; Rauceo
et al., 2006). Therefore, we aimed to measure the binding
affinity that is related to the Ig-T region (18–432 aa).
The interactions between Als1p-N and fibronectin (440–
500 kDa) and laminin (900 kDa), which are found in the
extracellular matrix surrounding endothelial and epithelial
cells (Ruoslahti, 1984; Beck et al., 1990), were quantified
using SPR. It was demonstrated that Als1p-N binds to
fibronectin with an apparent KD of 1.6 ⫾ 0.6 ¥ 10-6 M and
to laminin with a KD of 1.3 ⫾ 0.2 ¥ 10-5 M (Fig. 3A–D). The
full-length Als1p was previously shown to be able to bind
to fibronectin and laminin (Sheppard et al., 2004; Zhao
et al., 2004). Additionally, the truncated forms of the Als5
protein Als5p1-431 and Als5p1-664 were shown, through
single antibody ELISA, to bind to fibronectin with an
apparent dissociation constant in the nanomolar range
(Rauceo et al., 2006; Frank et al., 2010). About 10-fold
more Als5p1-664 bound to fibronectin in comparison with
Als5p1-431. This indicates that tandem repeats did not alter
the affinity but affected maximal binding as a result of
self-aggregation.
Using SPR, we have observed binding between
Als1p-N proteins and estimated the affinity of this interaction (KD of 2.0 ⫾ 0.1 ¥ 10-5 M) (Fig. 5C and D). AFM visualization of Als1p-N showed some self-interaction of
Als1p-N (Fig. 2A and B). Nevertheless, the image analysis of the protein volume shows that most proteins are
present in the non-aggregated form. To obtain KD values,
we have used the one-to-one model, which assumes
binding of one molecule of analyte to one molecule of
ligand. Taking into account the capability of Als1p-N to
form aggregates, this model can only be an estimation of
the calculated affinity.
In order to gain more information about possible molecular ligands for Als proteins, we have performed glycan array
screening, for which Als1p-N was used. The results show
that Als1p-N can recognize fucose-containing glycans
(Fig. 4A). The fluorescent signal from the fluorescently
labelled antibodies obtained in the experiment was rather
low and suggests a low affinity of Als1p-N for fucose. This
is typical for lectin–carbohydrate interaction, as in vivo
those interactions seem to be highly dependent on properties such as multivalency, which results in an increased
avidity (Monsigny et al., 2000; Loris, 2009).
Fucosyl-specific lectins are found in plants, including
the Lotus tetragonolobus (Pereira and Kabat, 1974) and
Ulex europaeus (Matsumoto and Osawa, 1969) lectins,
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
eel (Anguilla) (Watkins and Morgan, 1952), and in the
fungus Rhizopus stalonifer (Oda et al., 2003). Fucosebinding lectins have recently been designated as F-type
lectins (or F-lections) and they constitute a newly identified family of fucosyl-binding lectins (Bianchet et al., 2002;
Odom and Vasta, 2006), with members also described in
the Japanese horseshoe crab (Saito et al., 1997) and
‘fucolectins’ in fish (Honda et al., 2000; Cammarata et al.,
2001; Cammarata et al., 2007).
Fucose is present in the L-configuration of many cell
surface-expressed glycan structures found on mammalian
cells (Becker and Lowe, 2003; Orczyk-Pawiłowicz, 2007).
This carbohydrate is present as a terminal modification of
blood group ABH and Lewis antigens. Such localization
predisposes fucose to play an important role in host–
microbe interactions (Moran, 2008). Blood group antigens
have been pointed before to act as epithelial cell receptors
for C. albicans (Cameron and Douglas, 1996). It was
reported that the minimum structure required to inhibit C.
albicans attachment to buccal cells was the Fuca1-2Galb
determinant of the H blood group antigen (Brassart et al.,
1991). In another study, fucose was also the major inhibitor
of C. albicans adhesion to buccal and vaginal epithelial
cells (Critchley and Douglas, 1987b). The extracellular
polymeric material from C. albicans was used to isolate
a lectin-like mannoprotein that recognized fucosecontaining receptors; however, the protein was not identified (Tosh and Douglas, 1992). The analysis of Als1p-N
binding to glycans coupled to the microarray chip revealed
that Als1p-N bound preferentially to Fuca1-2Galb14GlcNAc structures, also when sulphated, followed
by fucose linked via a1–3 and a1–4 linkages to
N-acetylglucosamine (GlcNAc) (Fig. 4B). Additionally,
a-linked fucose coupled via eight- or nine-atoms spacer to
the glycan array chip also gave a significant response.
Fuca1-2Galb1-4GlcNAc is a characteristic of the blood
group H type-2 determinant, which can be found on red
cells, in vascular endothelium, in epithelium of gastrointestinal and respiratory tract as well as in the epithelium of the
outer layer of the skin (epidermis) (Ravn and Dabelsteen,
2000; Varki et al., 2009). By comparison, the response to
the Fuc a1-2Galb1–3 structure, which is a constituent of
the H antigen type 1, 3 and 4, was much lower. Fuca1–3
and a1–4 linked to GlcNAc are typical for Lewis blood
group antigens (Varki et al., 2009). The Als1p-N bound to
structures represented by all Lewis antigens, which are
present in human secretions and fluids, and can be
adsorbed to a variety of tissues (Bässler, 1986; Ravn and
Dabelsteen, 2000). Blood group antigens are commonly
used by pathogens as binding receptors. For example,
some Campylobacter jejuni strains and rabbit-specific
virus (RHDV) were shown to recognize and attach to H
type 2 epitopes (Newburg, 2000; Ruvoën-Clouet et al.,
2000). In another example, the bacterium Helicobacter
8 D. S. Donohue, F. S. Ielasi, K. V. Y. Goossens and R. G. Willaert 䊏
Fig. 6. Hypothetical interactions mediated by the Als1 protein. The N-terminal part of Als1p (indicated in light blue) binds to the extracellular
matrix proteins (laminin and fibronectin), N- and E-cadherins as well as to blood group antigens found on epithelial and endothelial cells.
Additionally, Als1p-N binds to Als1p-N expressed on another C. albicans cell. Tandem repeats of Als1p (shown as a zigzag pattern) can form
amyloid-like structures by aggregating with tandem repeats of the neighbouring Als1p. Binding of Als1p to gelatin, which is the product of the
partial hydrolysis of collagen has not been indicated (Sheppard et al., 2004).
pylori is able to attach to Lewisb antigens displayed on
human gastric epithelial cells (Moran, 2008). Different
carbohydrates are also recognized by microorganisms as
tools to attach to host cells. For example, Epa1 protein from
Candida glabrata has been shown to bind to host-cell
asialo-lactosyl-containing carbohydrates, which can be
found on epithelial cells (Cormack et al., 1999). Additionally, the glycan specifity of Epa proteins from C. glabrata
using glycan array and adhesion assays has been
described (Zupancic et al., 2008). It was shown that the
N-terminal parts of Epa1, Epa6 and Epa7 bound to glycans
containing a terminal galactose. This binding was inhibited
when more complex glycans (e.g. with terminal fucose)
were used and blocked the access of Epa proteins to
galactose residue. The range of specificity towards
galactose-containing glycans was different between all
three Epa proteins.
The affinity of the Als1p-N for fucose was determined
quantitatively by SPR (KD of 2.1 ⫾ 0.3 ¥ 10-4 M) (Fig. 5A
and B). An affinity in the millimolar range is typically
observed for lectin–monosaccharides interactions (Loris,
2009). However, it has been shown that some fucose
binding lectins can have an affinity in the micromolar
range (Wimmerova et al., 2003; Kostlánová et al., 2005;
Matsumura et al., 2007; Olausson et al., 2008; Okuyama
et al., 2009).
Some fungal lectins, such as Epa proteins from C.
glabrata and flocculins from S. cerevisiae are calciumdependent for carbohydrate binding (Miki et al., 1982;
Cormack et al., 1999). Although, it has been recently
shown that the N-terminal part of Flo5p contains two
binding sites, where only the high affinity site contained a
Ca2+ ion (Veelders et al., 2010). Therefore, we have also
tested the influence of calcium on binding (using SPR)
between Als1p-N and BSA-fucose, Als1p-N and fibronectin and laminin as well as on self-binding of Als1p-N and
found no enhancement of binding (data not shown).
Another fungal lectin, the Rhizopus stolonifer lectin, does
also not require Ca2+ ions for binding (Oda et al., 2003).
Als proteins use different strategies to bind to mammalian cells (Fig. 6). In this study, we showed that the
N-terminal part of Als1p can bind to fucose-containing
glycans, interact with ECM proteins, and self-interact.
Because the ECM proteins laminin and fibronectin are
glycosylated with fucose containing glycans (Mosesson
and Amrani, 1980; Jin et al., 1995), the binding of Als1p-N
to these proteins might in theory depend on interaction
with these glycans. However, SPR inhibition experiments
with fucose, glucose and galactose showed that fucose
inhibited binding of Als1 to laminin only marginally. Moreover, a slight inhibition of Als1 binding to fibronectin by
fucose was apparently non-specific as glucose or galactose inhibited equally well. We interpret this to mean that
binding of Als1 to laminin or fibronectin is not mediated
entirely by a lectin–glycan interaction, and that additional
contacts between Als1 and these ECM components must
underlie the interaction. While our data show that the
fucose–lectin interaction is not necessary for binding
these ECM components, we have not ruled out that it
might contribute under physiological conditions to the
Als1p interaction with glycosylated proteins, including
laminin and fibronectin. Als1p-N has also been indicated
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
Als1p-N from Candida albicans binds to fucose glycans 9
to induce endocytosis of C. albicans by binding to
N-cadherin on endothelial cells and E-cadherin on oral
epithelial cells (Phan et al., 2007).
The used construct in this study contains the substratespecific binding domain and the T region. The substratespecific binding domain contains Ig-like domains that
belong to the immunoglobulin superfamily (Sheppard
et al., 2004). Because the protein was expressed in S.
cerevisiae, the T region contains two serine residues
(position 303 and 379) instead of two leucine residues as
a result of the differently translated CUG codon in C.
albicans (Santos and Tuite, 1995; Gomes et al., 2007).
However, because the mistranslated codons are not
present in the N-terminal binding domain, they will have
no significant impact on the investigated substratespecific binding function. The expression of Als1p-N
in S. cerevisiae results also in a slightly different
O-glycosylation glycan structure (the two end-standing
mannose residues are connected via a1–3 in S. cerevisiae instead of a1–2 in C. albicans) (Varki et al., 2009).
Because these expression differences result in minor
structural changes, they will not have a significant effect
on the binding characterization results.
Aggregation of Als proteins have also been attributed to
amyloid-forming sequences found in the threonine-rich
and tandem repeats region (Rauceo et al., 2006; Otoo
et al., 2008; Ramsook et al., 2010). The T region is the
most conserved sequence in Als proteins. T region
domains can bind strongly (unbinding force is larger than
250 pN) to other T region domains as T–T interaction was
necessary to unfold the TR regions of Als5p in an AFM
force spectroscopy experiment (Alsteens et al., 2009).
The observed Als1p-N–Als1p-N interaction probably
occurs through interacting T-domains.
Variation within tandem repeats may alter the functional
characteristics of Als proteins (Hoyer et al., 2008; Nather
and Munro, 2008). An expanded tandem repeat region
enhances the exposure of the N-terminal functional
domain in the extracellular space and can explain the
enhanced binding. Each tandem repeat sequence folds
compactly to give an independent b-sheet-rich domain
with conserved hydrophobic core and consistent surface
features (Frank et al., 2010). The domain surface promotes interactions with a large variety of hydrophobic
surfaces, including other tandem repeat domains.
The expression of the full-length Als1p and Als5p on the
surface of C. albicans and S. cerevisiae demonstrated
adherence to immobilized peptides and proteins (Klotz
et al., 2004). Adherence was sequence specific because
all recognized peptides contain the structural motif tj+. To
investigate the binding of the full-length Als1p to fucose,
we performed a binding assay based on a microfluidic
flow cell (Bioflux, Fuxion) with a C. albicans Als1p overexpressing and an Als1p null mutant (Fu et al., 2002)
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
(data not shown). Binding of the strains to a BSA-fucoseand BSA-coated channel was compared using an
increasing shear stress (up to 10 dyne/cm2) to remove
loosely bound cells. Als1p overexpressing cells as well as
Als1p null mutant cells could bind to the coated flow cell
wall. However, there was no significant difference
between binding to BSA-fucose and BSA. This result indicates that binding to fucose is weak compared with other
binding events between the cell wall and the coated
channel wall. The weak binding to fucose-containing
glycans and BSA-fucose of the purified Als1p-N was in
this study also experimentally observed using glycan
array screening and SPR respectively.
To sum up, we have shown that the N-terminal binding
domain of Als1p binds to ECM proteins (fibronectin and
laminin) with micromolar affinity calculated for one-toone interaction of ligand and analyte. The Als1p-N also
recognizes fucose-containing glycans, of which structures are typically found in blood group antigens. The
predominant structure recognized by Als1p-N was the
blood group antigen H type 2 and also Lewis antigens.
The interaction between Als1p-N and fucose was determined to be in the millimolar range. We have confirmed
that Als1p-N can bind to another Als1p-N and we have
characterized this interaction quantitatively. Despite the
capability of self-binding of Als1p-N, the AFM and DLS
analysis of Als1p-N sample showed that most protein
particles are present in non-aggregated form. The multiple interactions mediated by the N-terminal part of
Als1p-N from C. albicans are likely to enhance the
chance of efficient colonization of mammalian cells by
this fungus. Although predictions of the Als proteins
structures were made (Sheppard et al., 2004; Phan
et al., 2007), resolving the crystal structure would
answer a number of questions regarding the exact position of binding site(s) for fucose and ECM proteins.
Experimental procedures
Cloning and purification of Als1p-N (17–432 aa)
The N-terminal part of the ALS1 gene was inserted into a
pYEX-S1 vector using the In-Fusion method (Clontech,
Mountain View, CA, USA), which is based on the recombination between homologous sequences of the vector and the
amplified gene (Zhu et al., 2007). For this purpose two oligonucleotides 5′-TCCTTAGTCAAAAGGAAGACAATCACTGG
TGTTTTTGATAGTTTTAATTCAT-3′ and 5′-GGAGATCGGAA
TTCGTCAGTGATGGTGATGGTGATGTGGAACTTGTACCA
CCACTGTGT-3′ were designed to amplify the N-terminal part
of ALS1 gene with a C-terminal His-tag. The plasmid
pYEX-S1 is a yeast-Escherichia coli shuttle vector, regulated
by a strong constitutive PGK promoter with mutated leu-2,
URA3 and AmpR as selectable markers (Castelli et al., 1994).
The secretion sequence for Als1p (1–17 aa) has not been
included during cloning, as the pYEX-S1 vector contains the
10 D. S. Donohue, F. S. Ielasi, K. V. Y. Goossens and R. G. Willaert 䊏
full-length leader sequence from Kluyveromyces lactis to
direct proteins through the secretory pathway. The S288Cderived BY4147 S. cerevisiae yeast strain has been used to
transform plasmids carrying the ALS1 gene. Cells were cultivated in rich YPD medium at 30°C with shaking at 150 r.p.m.
After 2 days of cultivation, the supernatants were collected by
centrifuging at 4°C, 4000 r.p.m., for 30 min and subsequently
filtered to remove residual cells. The pH of the final supernatant was adjusted to 7.0–7.5 with 1 M Tris base, incubated
with nickel-nitrilotriacetic acid (Ni-NTA) Sepharose beads for
1 h at 4°C, and next applied onto a column containing more
Ni-NTA Sepharose beads. To minimize unspecific binding,
the beads with bound protein were washed with buffer containing 500 mM NaCl, 10 mM imidazol and 20 mM Tris pH
7.5. The proteins were eluted with 1 M imidazol in phosphate
buffer saline (PBS), pH 7.4. The eluted protein was collected
and the purity was visualized using sodium dodecyl sulphate
polyacrylamide gel electrophoresis (SDS-PAGE). Fractions
have been pooled together and concentrated using 30 kDa
molecular weight cut off (MWCO) membrane concentrators
(Amicon Ultra, Millipore). To further purify the proteins and
exchange the buffer for future experiments, gel filtration was
applied. For this purpose, the Superdex 75 HR 10/30 column
was used with a buffer containing 150 mM NaCl, 20 mM Tris
pH 7.5 buffer. One millilitre fractions were collected and visualized on SDS-PAGE gel. Pure fractions were pooled
together, concentrated and used immediately for the next
experiments. The maximum protein yield obtained during
purification was about 7 mg per litre of culture.
Detection of glycoproteins
To visualize the glycans present on the proteins, the Pro-Q
Emerald 300 Glycoprotein Gel and Blot Stain Kit (Invitrogen)
was used according to manufacturer’s instructions.
Magnetic bead activity assay
To test the binding capacity of the purified Als1p-N, a bead
adhesion assay was performed as described previously
(Gaur et al., 1999). Tosyl-activated M-280 Dynabeads (Dynal,
Invitrogen) were coated with fibronectin (BD Biosciences)
following the manufacturer’s instructions. Als1p-N (20 mg per
mg of Dynabeads) was added to the beads at a concentration
of 3.3 ¥ 108 beads ml-1 and incubated for 2 h at 37°C with
vigorous shaking. To remove unbound proteins, the beads
were washed with PBS. To release the bound proteins, the
beads were boiled and the supernatant was subjected to
SDS-PAGE to visualize the released proteins.
SPR
The binding measurements of Als1p-N were performed using
SPR, BIAcore 3000 system (GE Healthcare). Fibronectin (BD
Biosciences), laminin (Sigma-Aldrich), BSA-fucose (Dextra
Laboratories) and Als1p-N were covalently immobilized on a
CM5 sensor chip via amine coupling using an amine coupling
kit (BIAcore, GE Healthcare). Increasing concentrations of
the analyte (Als1p-N) were allowed to flow across both the
reference and ligand-coated flow cell in running buffer containing 3 mM EDTA, 150 mM NaCl, 0.05% (v/v) Tween 20,
20 mM HEPES pH 7.4 (HBS) or in buffer used for glycan
array screening (2 mM CaCl2, 150 mM NaCl, 20 mM Tris pH
7.4). The injection was performed at 25°C using a flow rate of
20 ml min-1 for 1.5 min (10 min for Als1p-N over fibronectin).
The dissociation was then monitored for 9 min. For the Als1pN–fibronectin interaction, the surface was regenerated with
0.1% (w/v) SDS. No surface regeneration was needed for the
interaction between Als1p-N and laminin, fucose and
Als1p-N. Binding was determined by measuring the increase
in resonance units after subtraction of the background
response obtained from the reference flow cell and the
sample containing only the buffer. The dissociation constant
at equilibrium state (KD) was estimated using following
steady-state affinity model with a 1:1 ligand-analyte ratio:
Req = Rmax (KACA)/(KACA + 1) where Req is the response at
equilibrium state, KA is the association constant at equilibrium
state, CA is the analyte concentration and Rmax is the
maximum binding capacity (Chaiken et al., 1992). The standard deviation was calculated from the average of the
dissociation constants (KD) obtained for two independent
experiments.
For the binding inhibition experiments, Als1p-N–
fibronectin and Als1p-N–laminin interactions were analysed
– as described before in this section – for 5 mM Als1p-N
samples containing 100 mM of the monosaccharide
L-fucose (Sigma-Aldrich), as potential inhibitor molecule,
and 100 mM of the monosaccharides D-glucose or
D-galactose (Sigma-Aldrich), as negative controls. For each
experiment, Req values were retrieved from Als1p-N-only
and Als1p-N-monosaccharide curves. Averages and standard deviations, based on three independent repetitions,
were calculated for these values. Subsequently, in order to
evaluate the relative carbohydrate effects on the equilibrium
response, every mean Req was divided by the one obtained
for Als1p-N-only condition. The statistical significance was
calculated with the Student’s t-test. All the results were
analysed with BIAevaluation software version 4.1 (GE
Healthcare).
AFM
Glycan array
The N-terminal part of Als1p was screened for binding to
glycans printed on a glass slide microarray (version 3.2)
developed by the Consortium for Functional Glycomics (Blixt
et al., 2004). The immunodetection was performed using fluorescently labelled anti-His antibodies. The average relative
fluorescent units were obtained for six replicates for each
glycan. Error bars in Fig. 4 are based on the standard error of
the mean for these replicates.
Topographic images were recorded with a Multimode Nanoscope IIIa AFM instrument (Veeco, Santa Barbara, CA, USA)
using tapping mode in air. RTESP cantilevers (Veeco)
were used with a nominal spring constant of 20–80 N m-1.
The AFM sample was prepared by depositing 10 ml of
0.05 mg ml-1 of Als1p-N for 15 min at room temperature onto
freshly cleaved mica. Unbound proteins were removed by
washing with ultrapure water and dried under a gentle stream
of nitrogen gas. The image was obtained at a scan rate of
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
Als1p-N from Candida albicans binds to fucose glycans 11
1 Hz. Images were processed by first order flattening to
remove the background slope. The calculation of the protein
volume distribution was performed as described previously
(Ratcliff and Erie, 2001).
Dynamic light scattering
The Als1p-N sample (0.35 mg ml-1) was prepared in the
buffer that was used for the SPR measurements (HBS). The
light intensity was measured using the DynaPro DLS Plate
Reader (Wyatt Technology). The mean radius was calculated
based on 10 acquisitions for a globular protein shape.
Acknowledgements
We wish to acknowledge the Consortium for Functional Glycomics (http://www.functionalglycomics.org) for the glycan
analysis. We thank Prof J.E. Edwards (Medicine Dept., Division of Infectious Diseases, Harbor-UCLA, CA, USA) for providing us with the sequence encoding the N-terminal part of
Als1p on pYEX-S1 vector. We acknowledge Prof A.P. Mitchell
(Dept. Biological Sciences, Carnegie Mellon University, Pittsburgh, PA, USA) for the gift of the C. albicans Als1 overexpression strain and the Als1 null mutant strain. We also
acknowledge Catherine Stassen and Prof Bart Devreese
(L-Probe, Ghent University, Ghent, Belgium) for mass spectrometry analysis. The Belgian Federal Science Policy Office
and European Space Agency (ESA) PRODEX program, the
Institute for the Promotion of Innovation by Science and Technology in Flanders (IWT) and the Research Council of the
VUB, all supported this work.
References
Alsteens, D., Dupres, V., Klotz, S.A., Gaur, N.K., Lipke, P.N.,
and Dufrêne, Y.F. (2009) Unfolding individual Als5p adhesion proteins on live cells. ACS Nano 3: 1677–1682.
Barclay,
A.N.
(2003)
Membrane
proteins
with
immunoglobulin-like domains – a master superfamily of
interaction molecules. Semin Immunol 15: 215–223.
Bässler, G. (1986) Determination of the Lewis blood group
substances in stains of forensically relevant body fluids.
Forensic Sci Int 30: 29–35.
Beck, K., Hunter, I., and Engel, J. (1990) Structure and function of laminin: anatomy of a multidomain glycoprotein.
FASEB J 4: 148–160.
Becker, D.J., and Lowe, J.B. (2003) Fucose: biosynthesis
and biological function in mammals. Glycobiology 13:
41R–53R.
Bianchet, M.A., Odom, E.W., Vasta, G.R., and Amzel, L.M.
(2002) A novel fucose recognition fold involved in innate
immunity. Nat Struct Biol 9: 628–634.
Blixt, O., Head, S., Mondala, T., Scanlan, C., Huflejt, M.E.,
Alvarez, R., et al. (2004) Printed covalent glycan array for
ligand profiling of diverse glycan binding proteins. Proc Natl
Acad Sci USA 101: 17033–17038.
Brassart, D., Woltz, A., Golliard, M., and Neeser, J.R. (1991)
In vitro inhibition of adhesion of Candida albicans clinical
isolates to human buccal epithelial cells by Fuc alpha
1-2Gal beta-bearing complex carbohydrates. Infect Immun
59: 1605–1613.
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
Cameron, B.J., and Douglas, L.J. (1996) Blood group glycolipids as epithelial cell receptors for Candida albicans.
Infect Immun 64: 891–896.
Cammarata, M., Vazzana, M., Chinnici, C., and Parrinello, N.
(2001) A serum fucolectin isolated and characterized from
sea bass Dicentrarchus labrax. Biochim Biophys Acta
1528: 196–202.
Cammarata, M., Benenati, G., Odom, E.W., Salerno, G.,
Vizzini, A., Vasta, G.R., and Parrinello, N. (2007) Isolation
and characterization of a fish F-type lectin from gilt head
bream (Sparus aurata) serum. Biochim Biophys Acta 1770:
150–155.
Castelli, L.A., Mardon, C.J., Strike, P.M., Azad, A.A., and
Macreadie, I.G. (1994) High-level secretion of correctly
processed beta-lactamase from Saccharomyces cerevisiae using a high-copy-number secretion vector. Gene
142: 113–117.
Chaffin, W.L., López-Ribot, J.L., Casanova, M., Gozalbo, D.,
and Martínez, J.P. (1998) Cell wall and secreted proteins of
Candida albicans: identification, function, and expression.
Microbiol Mol Biol Rev 62: 130–180.
Chaiken, I., Rosé, S., and Karlsson, R. (1992) Analysis of
macromolecular interactions using immobilized ligands.
Anal Biochem 201: 197–210.
Cheng, G., Wozniak, K., Wallig, M.A., Fidel, P.L., Jr, Trupin,
S.R., and Hoyer, L.L. (2005) Comparison between
Candida albicans agglutinin-like sequence gene expression patterns in human clinical specimens and models of
vaginal candidiasis. Infect Immun 73: 1656–1663.
Cormack, B.P., Ghori, N., and Falkow, S. (1999) An adhesin
of the yeast pathogen Candida glabrata mediating adherence to human epithelial cells. Science 285: 578–582.
Critchley, I.A., and Douglas, L.J. (1987a) Role of glycosides
as epithelial cell receptors for Candida albicans. J Gen
Microbiol 133: 637–643.
Critchley, I.A., and Douglas, L.J. (1987b) Isolation and partial
characterization of an adhesin from Candida albicans.
J Gen Microbiol 133: 629–636.
Filler, S.G. (2006) Candida–host cell receptor–ligand
interactions. Curr Opin Microbiol 9: 333–339.
Frank, A.T., Ramsook, C.B., Otoo, H.N., Tan, C., Soybelman,
G., Rauceo, J.M., et al. (2010) Structure and Function of
Glycosylated Tandem Repeats from Candida albicans ALS
Adhesins. Eukaryot Cell 9: 405–414.
Fu, Y., Rieg, G., Fonzi, W.A., Belanger, P.H., Edwards, J.E.,
Jr, and Filler, S.G. (1998) Expression of the Candida albicans gene ALS1 in Saccharomyces cerevisiae induces
adherence to endothelial and epithelial cells. Infect Immun
66: 1783–1786.
Fu, Y., Ibrahim, A.S., Sheppard, D.C., Chen, Y.C., French,
S.W., Cutler, J.E., et al. (2002) Candida albicans Als1p: an
adhesin that is a downstream effector of the EFG1 filamentation pathway. Mol Microbiol 44: 61–72.
Gaur, N.K., Klotz, S.A., and Henderson, R.L. (1999) Overexpression of the Candida albicans ALA1 gene in Saccharomyces cerevisiae results in aggregation following
attachment of yeast cells to extracellular matrix proteins,
adherence properties similar to those of Candida albicans.
Infect Immun 67: 6040–6047.
Ghannoum, M.A., Burns, G.R., Elteen, K.A., and Radwan,
S.S. (1986) Experimental evidence for the role of lipids in
12 D. S. Donohue, F. S. Ielasi, K. V. Y. Goossens and R. G. Willaert 䊏
adherence of Candida spp. to human buccal epithelial
cells. Infect Immun 54: 189–193.
Gomes, A.C., Miranda, I., Silva, R.M., Moura, G.R., Thomas,
B., Akoulitchev, A., and Santos, M.A. (2007) A genetic
code alteration generates a proteome of high diversity in
the human pathogen Candida albicans. Genome Biol 8:
R206.
Green, C.B., Cheng, G., Chandra, J., Mukherjee, P., Ghannoum, M.A., and Hoyer, L.L. (2004) RT-PCR detection of
Candida albicans ALS gene expression in the reconstituted
human epithelium (RHE) model of oral candidiasis and in
model biofilms. Microbiology 150: 267–275.
Green, C.B., Marretta, S.M., Cheng, G., Faddoul, F.F.,
Ehrhart, E.J., and Hoyer, L.L. (2006) RT-PCR analysis of
Candida albicans ALS gene expression in a hyposalivatory
rat model of oral candidiasis and in HIV-positive human
patients. Med Mycol 44: 103–111.
Holmgren, A., Kuehn, M.J., Brändén, C.I., and Hultgren, S.J.
(1992) Conserved immunoglobulin-like features in a family
of periplasmic pilus chaperones in bacteria. EMBO J 11:
1617–1622.
Honda, S., Kashiwagi, M., Miyamoto, K., Takei, Y., and
Hirose, S. (2000) Multiplicity, structures, and endocrine and
exocrine natures of eel fucose-binding lectins. J Biol Chem
275: 33151–33157.
Hoyer, L.L. (2001) The ALS gene family of Candida albicans.
Trends Microbiol 9: 176–180.
Hoyer, L.L., Green, C.B., Oh, S.H., and Zhao, X. (2008)
Discovering the secrets of the Candida albicans agglutininlike sequence (ALS) gene family-a sticky pursuit. Med
Mycol 46: 1–15.
Jimenez-Lucho, V., Ginsburg, V., and Krivan, H.C. (1990)
Cryptococcus neoformans, Candida albicans, and other
fungi bind specifically to the glycosphingolipid lactosylceramide (Gal beta 1-4Glc beta 1-1Cer), a possible adhesion
receptor for yeasts. Infect Immun 58: 2085–2090.
Jin, F., Chammas, R., Engel, J., and Reinhold, V. (1995)
Structure and function of laminin 1 glycans; glycan
profiling. Glycobiology 5: 157–158.
Kamai, Y., Kubota, M., Kamai, Y., Hosokawa, T., Fukoka, T.,
and Filler, S.G. (2002) Contribution of Candida albicans
ALS1 to the pathogenesis of experimental oropharyngeal
candidiasis. Infect Immun 70: 5256–5258.
Klotz, S.A., Gaur, N.K., Lake, D.F., Chan, V., Rauceo, J., and
Lipke, P.N. (2004) Degenerate peptide recognition by
Candida albicans adhesins Als5p and Als1p. Infect Immun
72: 2029–2034.
Kostlánová, N., Mitchell, E.P., Lortat-Jacob, H., Oscarson, S.,
Lahmann, M., Gilboa-Garber, N., et al. (2005) The fucosebinding lectin from Ralstonia solanacearum. A new type of
beta-propeller architecture formed by oligomerization
and interacting with fucoside, fucosyllactose, and plant
xyloglucan. J Biol Chem 29: 27839–27849.
Loris, R. (2009) Structural features of lectins and their binding
sites. In Bioinformatics for Glycobiology and Glycomics: An
Introduction. Von der Lieth, C.W., Lütteke, T., and Frank, M.
(eds). Chichester: Wiley-Blackwell, pp. 415–431.
Loza, L., Fu, Y., Ibrahim, A.S., Sheppard, D.C., Filler, S.G.,
and Edwards, J.E., Jr (2004) Functional analysis of the
Candida albicans ALS1 gene product. Yeast 21: 473–482.
Macura, A.B., and Tondyra, E. (1989) Influence of some
carbohydrates and concanavalin A on the adherence of
Candida albicans in vitro to buccal epithelial cells. Zentralbl
Bakteriol 272: 196–201.
Matsumoto, I., and Osawa, T. (1969) Purification and characterization of an anti-H(O) phytohemagglutinin of Ulex
europeus. Biochim Biophys Acta 194: 180–189.
Matsumura, K., Higashida, K., Ishida, H., Hata, Y., Yamamoto, K., Shigeta, M., et al. (2007) Carbohydrate binding
specificity of a fucose-specific lectin from Aspergillus
oryzae: a novel probe for core fucose. J Biol Chem 282:
15700–15708.
Mavor, A.L., Thewes, S., and Hube, B. (2005) Systemic
fungal infections caused by Candida species: epidemiology, infection process and virulence attributes. Curr Drug
Targets 6: 863–874.
Miki, B.L., Poon, N.H., James, A.P., and Seligy, V.L. (1982)
Possible mechanism for flocculation interactions governed
by gene FLO1 in Saccharomyces cerevisiae. J Bacteriol
150: 878–889.
Monsigny, M., Mayer, R., and Roche, A.C. (2000) Sugarlectin interactions: sugar clusters, lectin multivalency and
avidity. Carbohydr Lett 4: 35–52.
Moran, A.P. (2008) Relevance of fucosylation and Lewis
antigen expression in the bacterial gastroduodenal pathogen Helicobacter pylori. Carbohydr Res 343: 1952–1965.
Mosesson, M.W., and Amrani, D.L. (1980) The structure and
biologic activities of plasma fibronectin. Blood 56: 145–
158.
Nather, K., and Munro, C.A. (2008) Generating cell surface
diversity in Candida albicans and other fungal pathogens.
FEMS Microbiol Lett 285: 137–145.
Newburg, D.S. (2000) Oligosaccharides in human milk and
bacterial colonization. J Pediatr Gastroenterol Nutr 30:
S8–S17.
Oda, Y., Senaha, T., Matsuno, Y., Nakajima, K., Naka, R.,
Kinoshita, M., et al. (2003) A new fungal lectin recognizing
alpha(1-6)-linked fucose in the N-glycan. J Biol Chem 278:
32439–32447.
Odom, E.W., and Vasta, G.R. (2006) Characterization of a
binary tandem domain F-type lectin from striped bass
(Morone saxatilis). J Biol Chem 281: 1698–1713.
Oh, S.H., Cheng, G., Nuessen, J.A., Jajko, R., Yeater, K.M.,
Zhao, X., et al. (2005) Functional specificity of Candida
albicans Als3p proteins and clade specificity of ALS3
alleles discriminated by the number of copies of the
tandem repeat sequence in the central domain. Microbiology 151: 673–681.
Okuyama, S., Nakamura-Tsuruta, S., Tateno, H., Hirabayashi, J., Matsubara, K., and Hori, K. (2009) Strict binding
specificity of small-sized lectins from the Red Alga Hypnea
japonica for core (a1-6) fucosylated N-glycans. Biosci Biotechnol Biochem 73: 912–920.
Olausson, J., Tibell, L., Jonsson, B.H., and Påhlsson, P.
(2008) Detection of a high affinity binding site in recombinant Aleuria aurantia lectin. Glycoconj J 25: 753–762.
Orczyk-Pawiłowicz, M. (2007) The role of fucosylation of
glycoconjugates in health and disease. Postepy Hig Med
Dosw 61: 240–252.
Otoo, H.N., Lee, K.G., Qiu, W., and Lipke, P.N. (2008)
Candida albicans Als adhesins have conserved amyloidforming sequences. Eukaryot Cell 7: 776–782.
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
Als1p-N from Candida albicans binds to fucose glycans 13
Pereira, M.E., and Kabat, E.A. (1974) Specificity of
purified hemagglutinin (lectin) from Lotus tetragonolobus.
Biochemistry 13: 3184–3192.
Phan, Q.T., Myers, C.L., Fu, Y., Sheppard, D.C., Yeaman,
M.R., Welch, W.H., et al. (2007) Als3 is a Candida albicans
invasin that binds to cadherins and induces endocytosis by
host cells. PLoS Biol 5: e64.
Ramsook, C.B., Tan, C., Garcia, M.C., Fung, R., Soybelman,
G., Henry, R., et al. (2010) Yeast cell adhesion molecules
have functional amyloid-forming sequences. Eukaryot Cell
9: 393–404.
Ratcliff, G.C., and Erie, D.A. (2001) A novel single-molecule
study to determine protein–protein association constants.
J Am Chem Soc 123: 5632–5635.
Rauceo, J.M., De Armond, R., Otoo, H., Kahn, P.C., Klotz,
S.A., Gaur, N.K., et al. (2006) Threonine-rich repeats
increase fibronectin binding in the Candida albicans
adhesin Als5p. Eukaryot Cell 5: 1664–1673.
Ravn, V., and Dabelsteen, E. (2000) Tissue distribution of
histo-blood group antigens. APMIS 108: 1–28.
Ruoslahti, E. (1984) Fibronectin in cell adhesion and
invasion. Cancer Metastasis Rev 3: 43–51.
Rupp, S. (2007) Interactions of the fungal pathogen Candida
albicans with the host. Future Microbiol 2: 141–151.
Ruvoën-Clouet, N., Ganiére, J.P., André-Fontaine, G., Blanchard, D., and Le Pendu, J. (2000) Binding of rabbit hemorrhagic disease virus to antigens of the ABH histo-blood
group family. J Virol 74: 11950–11954.
Saito, T., Hatada, M., Iwanaga, S., and Kawabata, S. (1997)
A newly identified horseshoe crab lectin with binding specificity to O-antigen of bacterial lipopolysaccharides. J Biol
Chem 272: 30703–30708.
Sandin, R.L., Rogers, A.L., Patterson, R.J., and Beneke, E.S.
(1982) Evidence for mannose-mediated adherence of
Candida albicans to human buccal cells in vitro. Infect
Immun 35: 79–85.
Santos, M.A., and Tuite, M.F. (1995) The CUG codon is
decoded in vivo as serine and not leucine in Candida
albicans. Nucleic Acids Res 23: 1481–1486.
Sheppard, D.C., Yeaman, M.R., Welch, W.H., Phan, Q.T., Fu,
Y., Ibrahim, A.S., et al. (2004) Functional and structural
diversity in the Als protein family of Candida albicans. J Biol
Chem 279: 30480–30489.
Sundstrom, P. (2002) Adhesion in Candida spp. Cell Microbiol 4: 461–469.
Tosh, F.D., and Douglas, L.J. (1992) Characterization of a
fucoside-binding adhesin of Candida albicans. Infect
Immun 60: 4734–4739.
© 2011 Blackwell Publishing Ltd, Molecular Microbiology
Vardar-Ünlü, G., MsSharry, C., and Douglas, J.L. (1998)
Fucose-specific adhesins on germ tubes of Candida
albicans. FEMS Immunol Med Microbiol 20: 55–67.
Varki, A., Cummings, R.D., Esko, J.D., Freeze, H.H., Stanley,
P., Bertozzi, C.R., et al. (2009) Essentials of Glycobiology,
2nd edn. New York: Cold Spring Harbor Laboratory Press.
Veelders, M., Brückner, S., Ott, D., Unverzagt, C., Mösch,
H.U., and Essen, L.O. (2010) Structural basis of flocculinmediated social behavior in yeast. Proc Natl Acad Sci USA
107: 22511–22516.
Watkins, W.M., and Morgan, W.T. (1952) Neutralization of the
anti-H agglutinin in eel serum by simple sugars. Nature
169: 825–826.
Wimmerova, M., Mitchell, E., Sanchez, J.F., Gautier, C., and
Imberty, A. (2003) Crystal structure of fungal lectin: sixbladed beta-propeller fold and novel fucose recognition
mode for Aleuria aurantia lectin. J Biol Chem 278: 27059–
27067.
Yu, L., Lee, K.K., Sheth, H.B., Lane-Bell, P., Srivastava, G.,
Hindsgaul, O., et al. (1994) Fimbria-mediated adherence of
Candida albicans to glycosphingolipid receptors on human
buccal epithelial cells. Infect Immun 62: 2843–2848.
Zhao, X., Oh, S.H., Cheng, G., Green, C.B., Nuessen, J.A.,
Yeater, K., et al. (2004) ALS3 and ALS8 represent a single
locus that encodes a Candida albicans adhesin; functional
comparisons between Als3p and Als1p. Microbiology 150:
2415–2428.
Zhu, B., Cai, G., Hall, E.O., and Freeman, G.J. (2007)
In-fusion assembly: seamless engineering of multidomain
fusion proteins, modular vectors, and mutations. Biotechniques 43: 354–359.
Zhu, W., and Filler, S.G. (2010) Interactions of Candida albicans with epithelial cells. Cell Microbiol 12: 273–282.
Zupancic, M.L., Frieman, M., Smith, D., Alvarez, R.A., Cummings, R.D., and Cormack, B.P. (2008) Glycan microarray
analysis of Candida glabrata adhesin ligand specificity. Mol
Microbiol 68: 547–549.
Supporting information
Additional supporting information may be found in the online
version of this article.
Please note: Wiley-Blackwell are not responsible for the
content or functionality of any supporting materials supplied
by the authors. Any queries (other than missing material)
should be directed to the corresponding author for the
article.