Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 RESEARCH JOURNAL OF ANIMAL SCIENCE AND BIOTECHNOLOGY Open Access Morphological and microsatellite DNA diversity of Nigerian indigenous sheep Brilliant O Agaviezor1,3,6, Sunday O Peters1,6,7, Mufliat A Adefenwa2,6, Abdulmojeed Yakubu4,6, Olufunmilayo A Adebambo1, Michael O Ozoje1, Christian ON Ikeobi1, Matthew Wheto1, Oyeyemi O Ajayi1, Samuel A Amusan1, Oludotun J Ekundayo1, Timothy M Sanni1, Moses Okpeku5, Gbolabo O Onasanya1, Marcos De Donato6, Babatunde M Ilori1, Kadir Kizilkaya8 and Ikhide G Imumorin6* Abstract Background: Sheep is important in the socio-economic lives of people around the world. It is estimated that more than half of our once common livestock breeds are now endangered. Since genetic characterization of Nigerian sheep is still lacking, we analyzed ten morphological traits on 402 animals and 15 microsatellite DNA markers in 384 animals of the 4 Nigerian sheep breeds to better understand genetic diversity for breeding management and germplasm conservation. Results: Morphological traits of Uda and Balami were significantly (P < 0.05) higher than Yankasa, which were both higher than West African Dwarf (WAD) sheep. Stepwise discriminant analysis showed tail length, rump height, chest girth, ear length and chest depth as the most discriminating variables for classification. Mahalanobis distances show the least differentiation between Uda and Balami and the largest between WAD and Balami sheep. While 93.3% of WAD sheep were correctly assigned to their source genetic group, 63.9% of Yankasa, 61.2% of Balami and 45.2% of Uda were classified correctly by nearest neighbour discriminant analysis. The overall high Polymorphism Information Content (PIC) of all microsatellite markers ranged from 0.751 to 0.927 supporting their use in genetic characterization. Expected heterozygosity was high for all loci (0.783 to 0.93). Mean heterozygote deficiency across all populations (0.171 to 0.534) possibly indicate significant inbreeding (P < 0.05). Mean values for FST, FIT and FIS statistics across all loci were 0.088, 0.394 and 0.336 respectively. Yankasa and Balami are the most closely related breeds (DA = 0.184) while WAD and Balami are the farthest apart breeds (DA = 0.665), which is coincident with distance based on morphological analysis and population structure assessed by STRUCTURE. Conclusions: These results suggest that within-breed genetic variation in Nigerian sheep is higher than between-breeds and may be a valuable tool for genetic improvement and conservation. The higher genetic variability in Yankasa suggests the presence of unique ancestral alleles reflecting the presence of certain functional genes which may result in better adaptability in more agro-ecological zones of Nigeria. These genetic characteristics are potentially useful in planning improvement and conservation strategies in Nigerian indigenous sheep. Keywords: Discriminant analysis, Genetic distance, Microsatellite DNA, Morphological traits, Nigerian sheep * Correspondence: igi2@cornell.edu 6 Dept of Animal Science, Cornell University, Ithaca, NY 14853, USA Full list of author information is available at the end of the article © 2012 Agaviezor et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 Background The population of sheep in Nigeria is currently estimated at 33.9 million making up 3.1% of the world’s total [1]. Sheep is an important livestock species in the socio-economic lives of people around the world including Nigerians [2]. Increased loss of genetic diversity has been observed for all agriculturally used species, and it is estimated that more than half of our once common livestock breeds are now endangered [1]. According to FAO [3], it is estimated that the world loses two breeds of its valuable domestic animal diversity every week. Already, 740 breeds are recorded as extinct, with 1,335 (32% of the estimated total) being classified at high risk of loss or under threat of extinction. If the erosion of animal genetic diversity continues without adequate action, more than 2,000 domestic animal breeds could be lost within the next two decades [3]. The first step toward an efficient conservation strategy for cattle, sheep, and goat genetic resources is the proper characterization of the conservation value of the different breeds and their wild relatives [4]. Sheep biodiversity have been described using morphological measurements [5,6] or characterized using molecular data [7-13]. The phenotypic variation in a population arises due to genotypic and environmental effects, and the magnitude of phenotypic variability differs under different environmental conditions. Morphometric characters are continuous characters describing aspects of body shape [14,15]. Morphometric variation between populations can provide a basis for understanding flock structure, and may be more applicable for studying short-term, environmentally induced variation and thus more applicable to livestock management. According to Gizaw et al. [5], morphological description is an essential component of breed characterization that can be used to physically identify, describe, and recognize a breed, and also to classify livestock breeds into broad categories. Dossa et al. [16] reported that morphological measurements such as heart girth, height at withers and body length can be used for rapid selection of large size individuals in the field to enable the establishment of elite flocks. In addition, microsatellites have been used successfully over the years to characterize the genetic diversity of sheep populations in China [12], Ethiopia [5], Europe and Middle East [7-9,17], India [10,11,18] and Brazil [13]. The Nigerian sheep is still genetically unimproved, and the pressure of modern genetic improvement has increased the need to better understand natural genetic variation in Nigerian sheep breeds, as well as formulate germplasm conservation policies. The only genetic diversity study of genetic variation among Nigerian sheep breeds using microsatellite markers covered a limited geographical area [19]. Therefore, a more detailed study Page 2 of 16 using a larger sample size from across the entire country is still required to better understand the genetic structure of Nigerian sheep population. In this study, morphological data on 402 sheep and molecular data on 15 microsatellite DNA markers in 384 sheep sampled across the entire country were used to evaluate the morphological and genetic diversity of the four major extant sheep breeds in Nigeria. This study complements our recent molecular characterization of the mitochondrial Dloop region in Nigerian sheep [20]. The information obtained will be useful for designing appropriate breeding and selection schemes for indigenous sheep improvement and sustainable conservation. Results Morphological characterization The basic descriptive statistics of the morphological traits of WAD, Yankasa, Uda and Balami sheep are presented in Table 1. The biometric traits of Uda and Balami sheep were significantly (p < 0.05) higher than those of WAD and Yankasa, although the latter had superior mean values than the former for all morphometric traits with the exception of EL. The effects of sex and system of management on the body parameters of the four sheep breeds are presented in Tables 2 and 3. Male animals had significantly higher body parameters than their female counterparts and higher values are observed in Balami and Uda compared with other breeds. The sexual dimorphism observed could be attributed to differences in the genetic architecture of the sheep populations. Animals reared intensively also had superior means than those semi-intensively managed for all morphological traits. While all the sheep breeds are reared semi intensively, only WAD and Yankasa are reared extensively. However, WAD is not reared intensively. The effect of age on morphological parameters was significant with slight increases with age (Table 4). Table 5 shows the spread of the four Nigerian sheep breeds across the country. WAD is only found in the southern part of the country. Variation was observed in the various morphological parameters studied according to breed in the different sampling location. The stepwise discriminant procedure showed that TL, RH, CG, EL and CD were the most discriminating variables to separate WAD, Yankasa, Uda and Balami sheep based on their significance and partial R2 values ≥0.01 (Tables 6 and 7, respectively). The canonical variate analysis (Table 7) clearly showed distinctive differences in the morphological traits of the four sheep breeds. Table 8 shows the percentage of individual sheep classified into genetic groups. The highest value is between WAD and WAD (93.33) and the lowest is between Uda and Uda (45.16). Error level is lowest in Yankasa (0.361). Results for kinship coefficient (Dkf ) and proportion of shared Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 Table 1 Descriptive statistics of the morphological traits of Nigerian sheep breeds Trait WAD sheep Yankasa sheep Uda sheep Balami sheep LSM ± SEM LSM ± SEM LSM ± SEM LSM ± SEM BW 20.12 ± 1.23d 30.87 ± 1.05c 37.86 ± 1.20a 39.00 ± 0.94a WH 52.35 ± 1.07d 68.52 ± 0.6c 74.53 ± 0.87a 74.31 ± 0.59a a 73.64 ± 0.57a a 101.77 ± 1.21a a RH BL d 52.12 ± 0.87 d 76.87 ± 1.53 67.44 ± 0.63 c 93.56 ± 0.91 99.40 ± 0.99 13.03 ± 0.39 13.19 ± 0.28 15.63 ± 0.54 14.54 ± 0.28b FCL 13.45 ± 0.21d 14.85 ± 0.22c 16.53 ± 0.31a 15.60 ± 0.19b d c a 39.67 ± 0.50a a 19.42 ± 0.63 d c 73.78 ± 0.82 EL TL c c 35.28 ± 0.54 44.13 ± 0.73 CG 65.04 ± 1.60 75.83 ± 0.90 81.30 ± 1.12 82.87 ± 1.19a CD 25.73 ± 0.78d 33.38 ± 0.45c 35.22 ± 0.58a 33.82 ± 0.32a RW d c a 15.32 ± 0.22a 11.84 ± 0.29 c 13.77 ± 0.22 15.35 ± 0.30 a,b,c – means with different superscript are significantly (p < 0.05) different. BW body weight, WH withers height, RH rump height, BL body length, EL ear length, FCL fore cannon bone length, TL tail length, CG chest girth, CD chest depth, RW rump width WAD West African Dwarf sheep, LSM least square means, SEM standard error of mean. alleles are presented in Table 9. The highest kinship coefficient and number of shared alleles is between WAD and Balami. Molecular genetic diversity between populations Polymorphism Information Content (PIC) and F statistics (FIS, FIT, FST) according to Weir and Cockerham (1984), GST and Shannon index values for all 15 microsatellite markers analyzed in Nigerian sheep breeds are shown in Table 10. The l5 microsatellite loci demonstrated high polymorphism in this population with PIC values ranging from 0.751 to 0.927 (Table 10) lending strong support to the use of this panel of markers for assessing genetic diversity in Nigerian sheep. Differences in the values of global FST, FIT and FIS over all loci (Table 10) considered in this study shows the Page 3 of 16 suitability of some microsatellite markers over the others in the study of genetic diversity in Nigerian sheep breeds. The mean value of FST is 0.088 while that of FIT and FIS are 0.394 and 0.335 respectively. The highest value of FST (0.146) was observed for BM8125 while the lowest value of 0.022 was seen in DYMS1. Inbreeding values within and across breeds can also be attributed to selection. FST and GST are indices of population subdivision. Global FST, GST and GST’ over all loci were all significantly different (p < 0.001). The population differences examined by global analysis of FST (coefficient of multilocus genetic differentiation fixation index) for each of 15 microsatellite loci across the four sheep breeds revealed that most of the total genetic variation corresponds to differences among individuals within breeds (91.2%) and 8.8% result from differences among breeds. Values of GST ranged from 0.033 for OarFCB304 to 0.211 for OarHH47 with a mean of 0.120 (Table 10). The results of GST in this study reveal that gene variation among the breeds is still low. This differentiation formed the basis for describing how genetic variation is partitioned within Nigerian sheep breeds. Among the loci considered in this study, OarFCB304 had the highest Shannon information index value of 2.51 and the least index value of 1.391 was observed for OarHH47. Number of effective alleles, allelic richness, expected heterozygosity and observed heterozygosity are presented in Table 11. Effective number of alleles ranged from 17.330 in Yankasa to 7.200 in WAD. This trend was also observed for allelic richness with Yankasa having a value of 10.51 and WAD, 6.59. Yankasa had the highest expected heterozygosity (0.849) while WAD had the least (0.684). Mean values for observed heterozygosity across the breeds ranged from 0.405 in Uda to 0.563 in Yankasa (Table 11). The analysis of molecular variance (AMOVA) results revealed that the greatest variation (60.716%) is within individuals, 30.545% among individuals within populations Table 2 Effects of sex on the morphological traits of Nigerian sheep breeds Male Female Balami Uda WAD Yankasa Balami Uda WAD Yankasa 40.23 ± 1.69 44.28 ± 1.86 27.01 ± 3.46 37.12 ± 1.83 37.49 ± 1.08 33.89 ± 1.53 17.37 ± 2.63 27.99 ± 1.25 BL 91.34 ± 3.92 102.06 ± 4.32 79.63 ± 8.02 89.67 ± 4.26 82.65 ± 2.51 96.01 ± 3.55 75.26 ± 6.10 91.34 ± 2.90 TL 45.00 ± 1.09 46.37 ± 1.20 21.27 ± 2.23 35.39 ± 1.18 44.01 ± 0.69 42.64 ± 0.98 18.34 ± 1.69 34.74 ± 0.80 BW WH 73.89 ± 1.36 76.66 ± 1.50 53.09 ± 2.78 67.02 ± 1.48 71.16 ± 0.87 70.98 ± 1.23 47.07 ± 2.12 67.01 ± 1.00 RW 74.72 ± 1.07 77.73 ± 1.17 54.95 ± 2.19 68.00 ± 1.16 73.34 ± 0.68 71.68 ± 0.97 50.47 ± 1.66 66.45 ± 0.79 CG 78.39 ± 1.44 83.79 ± 1.59 63.59 ± 2.95 74.64 ± 1.57 78.25 ± 0.92 77.85 ± 1.31 60.21 ± 2.24 73.05 ± 1.07 CD 27.95 ± 1.85 35.70 ± 2.03 25.68 ± 3.78 32.05 ± 2.01 29.58 ± 1.18 30.96 ± 1.67 23.07 ± 2.88 30.35 ± 1.37 RH 14.44 ± 0.35 15.38 ± 0.39 11.36 ± 0.74 12.84 ± 0.39 14.91 ± 0.23 14.45 ± 0.32 11.52 ± 0.55 13.86 ± 0.26 FCL 14.70 ± 0.55 17.73 ± 0.60 14.05 ± 1.12 16.05 ± 0.59 12.78 ± 0.35 14.40 ± 0.49 13.10 ± 0.85 14.59 ± 0.41 EL 16.91 ± 0.52 18.84 ± 0.58 14.63 ± 1.07 15.42 ± 0.57 13.65 ± 0.33 13.93 ± 0.47 12.10 ± 0.82 12.51 ± 0.39 Semi intensive WAD Extensive Yankasa Balami Uda WAD Intensive Balami Uda Yankasa Balami Uda WAD Yankasa BW 34.18 ± 1.14 35.76 ± 1.20 21.54.19.44 30.65 ± 1.03 - - 19.44 ± 3.77 26.00 ± 11.32 BL 69.86 ± 2.39 95.43 ± 2.68 76.81 ± 5.14 90.23 ± 2.15 - - 77.00 ± 7.85 110.00 ± 23.56 44.81 ± 1.45 48.58 ± 2.74 - 47.00 ± 8.00 109.54 ± 3.01 112.17 ± 5.71 - 116.00 ± 16.66 TL 41.94 ± 0.72 43.13 ± 0.80 20.11 ± 1.54 34.71 ± 0.64 - - 17.77 ± 2.36 38.00 ± 7.09 48.05 ± 0.90 48.76 ± 0.90 - 47.50 ± 5.02 WH 71.10 ± 0.95 73.03 ± 1.07 49.00 ± 2.05 66.99 ± 0.85 - - 49.94 ± 3.13 RW 73.08 ± 0.74 73.03 ± 0.84 52.33 ± 1.61 66.84 ± 0.67 - - 51.61 ± 2.45 65.00 ± 9.39 73.31 ± 1.20 74.41 ± 2.27 - 69.5 ± 6.64 69.00 ± 7.37 74.80 ± 0.94 78.23 ± 1.78 - 72.00 ± 5.21 CG 76.70 ± 0.98 78.86 ± 1.10 60.79 ± 2.12 73.44 ± 0.88 - - 63.00 ± 3.24 74.00 ± 9.73 80.82 ± 1.24 86.58 ± 2.36 - 80.00 ± 6.88 CD 25.54 ± 1.24 32.06 ± 1.40 24.02 ± 2.68 30.82 ± 1.12 - - 24.05 ± 4.09 32.00 ± 12.28 34.78 ± 1.57 36.58 ± 2.97 - 34.50 ± 8.68 RH 14.23 ± 0.23 14.26 ± 0.26 11.26 ± 0.513 13.50 ± 0.21 - - 11.94 ± 0.78 15.00 ± 2.35 15.13 ± 0.48 17.41 ± 0.57 - 15.00 ± 1.66 FCL 12.21 ± 0.38 15.65 ± 0.43 13.52 ± 0.82 15.06 ± 0.34 - - 13.27 ± 1.25 15.00 ± 3.77 15.13 ± 0.48 16.17 ± 0.91 - 14.50 ± 2.67 EL 15.03 ± 0.40 16.09 ± 0.45 13.04 ± 0.86 13.47 ± 0.36 - - 13.00 ± 1.31 12.00 ± 3.94 13.91 ± 0.50 15.14 ± 0.95 - 11.50 ± 2.78 Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 Table 3 Effect of management systems on the morphological traits of Nigerian sheep breeds Page 4 of 16 < 1 year 1 -2 years Yankasa Balami Uda 2 – 3 years Balami Uda WAD WAD Yankasa Balami BW 33.66 ± 2.27 42.33 ± 4.64 13.50 ± 8.04 29.14 ± 4.29 30.86 ± 2.27 33.92 ± 2.68 15.54 ± 3.42 27.46 ± 2.14 37.53 ± 1.52 BL 77.68 ± 4.94 88.45 ± 10.09 74.00 ± 17.47 76.10 ± 9.34 67.12 ± 4.94 89.25 ± 5.82 70.45 ± 7.45 83.06 ± 4.67 77.11 ± 3.30 TL 43.47 ± 1.41 38.45 ± 2.89 19.75 ± 5.00 28.71 ± 2.67 42.48 ± 1.41 41.85 ± 1.66 18.09 ± 2.13 35.93 ± 1.33 42.05 ± 0.94 WH 68.08 ± 1.80 66.13 ± 3.68 46.00 ± 6.38 58.14 ± 3.41 67.05 ± 1.80 70.62 ± 2.12 47.50 ± 2.72 66.21 ± 1.70 72.25 ± 1.20 RW 70.45 ± 1.43 71.25 ± 2.92 50.00 ± 5.05 61.28 ± 2.70 70.02 ± 1.43 72.31 ± 1.68 49.04 ± 2.15 65.11 ± 1.35 74.50 ± 0.95 CG 74.16 ± 1.86 77.63 ± 3.79 56.80 ± 6.58 67.21 ± 3.51 71.53 ± 1.86 75.45 ± 2.19 58.22 ± 2.80 72.34 ± 1.75 79.19 ± 1.24 CD 31.69 ± 2.51 35.06 ± 5.12 22.25 ± 8.88 34.77 ± 4.74 22.84 ± 2.51 30.25 ± 2.96 22.36 ± 3.78 28.29 ± 2.37 28.29 ± 1.67 RH 14.04 ± 0.45 12.42 ± 0.92 9.50 ± 1.59 11.31 ± 0.85 13.15 ± 0.45 13.53 ± 0.53 11.00 ± 0.68 12.66 ± 0.42 14.62 ± 0.30 FCL 13.01 ± 0.76 14.76 ± 1.56 13.25 ± 2.71 15.18 ± 1.45 11.16 ± 0.76 14.49 ± 0.90 12.86 ± 1.15 14.60 ± 0.72 13.30 ± 0.51 EL 13.28 ± 0.79 15.61 ± 1.61 12.50 ± 2.80 12.14 ± 1.49 15.04 ± 0.79 14.55 ± 0.93 12.31 ± 1.19 13.53 ± 0.74 15.22 ± 0.52 Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 Table 4 Effects of age on the morphological traits of Nigerian sheep breeds Page 5 of 16 2 – 3 years 3 – 4 years Uda WAD Yankasa BW 36.27 ± 1.87 25.92 ± 3.03 32.62 ± 1.59 BL 99.23 ± 4.06 81.07 ± 6.60 92.58 ± 3.46 TL 43.85 ± 1.16 20.67 ± 1.89 35.50 ± 0.99 WH 73.69 ± 1.48 50.89 ± 2.41 67.39 ± 1.26 RW 73.84 ± 1.17 54.50 ± 1.91 CG 79.51 ± 1.53 63.07 ± 2.48 CD 33.36 ± 2.06 RH FCL EL Balami 5 – 6 years Uda WAD Yankasa Balami Uda 44.89 ± 1.75 40.51 ± 2.04 22.16 ± 6.56 103.44 ± 4.43 103.23 ± 4.43 82.66 ± 14.27 31.79 ± 2.01 48.11 ± 3.79 58.75 ± 8.04 96.13 ± 4.36 121.00 ± 8.23 47.07 ± 1.09 45.72 ± 1.27 18.16 ± 4.08 34.47 ± 1.25 51.11 ± 2.36 75.32 ± 1.39 75.16 ± 1.62 50.50 ± 5.20 68.33 ± 1.59 880.33 ± 3.00 67.75 ± 1.00 76.62 ± 1.10 75.41 ± 1.28 53.66 ± 4.13 68.24 ± 1.26 73.07 ± 1.30 83.10 ± 1.67 83.10 ± 1.67 68.83 ± 5.37 76.12 ± 1.64 25.64 ± 3.35 31.44 ± 1.75 30.92 ± 1.93 32.85 ± 2.25 23.83 ± 7.25 30.96 ± 2.22 14.70 ± 0.37 11.78 ± 0.60 13.92 ± 0.31 16.36 ± 0.34 15.90 ± 0.40 13.00 ± 1.30 16.38 ± 0.63 13.85 ± 1.02 15.35 ± 0.53 14.56 ± 0.59 15.99 ± 0.69 13.83 ± 2.21 16.33 ± 0.65 13.85 ± 1.05 14.01 ± 0.55 14.38 ± 0.61 16.23 ± 0.71 12.16 ± 2.28 WAD Yankasa - 28.80 ± 5.08 - 102.68 ± 11.05 63.00 ± 5.00 - 35.50 ± 3.16 82.00 ± 6.38 - 71.64 ± 4.03 76.88 ± 2.38 84.50 ± 5.05 - 68.54 ± 3.19 101.00 ± 6.58 101.00 ± 6.58 - 77.72 ± 4.16 36.66 ± 4.18 41.50 ± 8.81 - 32.54 ± 5.61 14.16 ± 0.39 15.33 ± 0.75 19.50 ± 1.59 - 13.64 ± 1.01 14.67 ± 0.67 14.66 ± 1.28 14.50 ± 2.71 - 16.88 ± 1.71 12.61 ± 0.70 14.38 ± 1.32 16.50 ± 2.80 - 14.04 ± 1.77 123 ± 17.47 Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 Table 4 Effects of age on the morphological traits of Nigerian sheep breeds (Continued) Page 6 of 16 South Middle belt Yankasa Balami Uda North East Balami Uda WAD WAD Yankasa Balami BW 45.66 ± 6.37 43.00 ± 3.67 20.91 ± 2.01 44.26 ± 2.53 47.22 ± 3.67 46.99 ± 3.32 - 28.47 ± 1.74 32.79 ± 1.61 BL 102.66 ± 11.77 98.11 ± 6.79 76.86 ± 3.72 92.000 ± 4.67 110.09 ± 6.79 108.89 ± 6.14 - 98.94 ± 3.22 59.74 ± 2.95 TL 44.00 ± 4.03 41.74 ± 2.32 19.41 ± 1.27 36.36 ± 1.60 43.78 ± 2.32 44.50 ± 2.10 - 31.47 ± 1.10 44.06 ± 1.01 WH 74.66 ± 5.19 77.88 ± 3.00 49.28 ± 1.64 65.23 ± 2.06 79.29 ± 3.0 82.01 ± 2.71 - 68.95 ± 1.42 67.62 ± 1.31 RW 77.00 ± 4.17 78.33 ± 2.40 52.11 ± 1.31 68.39 ± 1.65 77.57 ± 2.40 79.60 ± 2.17 - 67.69 ± 1.14 73.25 ± 1.05 CG 76.50 ± 5.58 78.92 ± 3.22 61.45 ± 1.76 72.26 ± 2.21 82.05 ± 3.22 86.60 ± 2.91 - 75.60 ± 1.52 75.57 ± 1.41 CD 33.66 ± 6.71 33.33 ± 3.87 24.03 ± 2.12 30.15 ± 2.66 36.56 ± 3.87 41.26 ± 3.50 - 32.72 ± 1.83 25.31 ± 1.69 RH 15.16 ± 1.35 14.61 ± 0.78 11.46 ± 0.42 12.86 ± 0.53 15.51 ± 0.78 15.65 ± 0.70 - 14.08 ± 0.37 13.84 ± 0.34 FCL 20.00 ± 1.75 20.88 ± 1.01 13.45 ± 0.55 17.21 ± 0.69 18.95 ± 1.01 20.37 ± 0.91 - 16.48 ± 0.48 11.41 ± 0.44 EL 19.83 ± 2.06 20.33 ± 1.19 13.03 ± 0.65 16.26 ± 0.82 18.83 ± 1.19 21.46 ± 1.07 - 13.12 ± 0.56 14.77 ± 0.52 Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 Table 5 Effects of sampling location on the morphological traits of Nigerian sheep breeds Page 7 of 16 North East North West North Central Uda WAD Yankasa Balami Uda WAD Yankasa Balami Uda WAD Yankasa BW 32.10 ± 2.08 - 23.00 ± 7.80 42.32 ± 1.32 40.15 ± 1.89 - 27.08 ± 2.67 34.18 ± 2.01 34.38 ± 3.18 - 29.15 ± 1.64 BL 102.47 ± 3.85 - 70.55 ± 14.42 108.43 ± 2.45 106.11 ± 3.49 - 99.76 ± 4.94 58.09 ± 5.88 58.09 ± 5.88 - 80.60 ± 3.04 TL 43.71 ± 1.32 - 44.50 ± 4.93 47.51 ± 0.84 45.85 ± 1.19 - 37.47 ± 1.69 37.47 ± 1.27 41.84 ± 2.01 - 36.05 ± 1.04 WH 70.92 ± 1.70 - 55.50 ± 6.36 73.56 ± 1.08 72.67 ± 1.54 - 69.52 ± 2.18 72.59 ± 1.64 69.05 ± 2.59 - 65.60 ± 1.34 RW 71.65 ± 1.36 - 62.75 ± 5.11 74.88 ± 0.87 74.20 ± 1.23 - 69.58 ± 1.75 70.42 ± 1.31 71.53 ± 2.08 - 64.85 ± 1.07 CG 78.87 ± 1.82 - 71.00 ± 6.83 80.32 ± 1.16 81.79 ± 1.65 - 78.05 ± 2.34 76.94 ± 1.76 74.31 ± 2.79 - 70.70 ± 1.44 CD 32.65 ± 2.19 - 48.00 ± 8.22 34.37 ± 1.40 35.58 ± 1.99 - 33.94 ± 2.82 20.24 ± 2.12 17.72 ± 3.35 - 27.67 ± 1.73 RH 14.42 ± 0.44 - 12.05 ± 1.65 15.39 ± 0.28 16.02 ± 0.40 - 13.35 ± 0.56 14.55 ± 0.42 11.80 ± 0.67 - 13.47 ± 0.35 FCL 16.62 ± 0.57 - 15.60 ± 2.15 14.78 ± 0.36 14.55 ± 0.52 - 13.94 ± 0.73 10.68 ± 0.55 8.98 ± 0.87 - 13.28 ± 0.45 EL 15.75 ± 0.67 - 12.00 ± 2.52 13.62 ± 0.43 13.89 ± 0.61 - 11.52 ± 0.86 14.48 ± 0.65 13.64 ± 1.03 - 13.30 ± 0.53 Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 Table 5 Effects of sampling location on the morphological traits of Nigerian sheep breeds (Continued) Page 8 of 16 Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 Page 9 of 16 Table 6 Stepwise selection of traits Traits entered Partial R2 F value Pr > F Wilk’s lambda Pr < lambda ASCC Pr > ASCC Tail length 0.4913 128.12 <0.0001 0.508710 <0.0001 0.164 <0.0001 Rump height 0.1056 15.63 <0.0001 0.454978 <0.0001 0.183 <0.0001 Chest girth 0.1055 15.49 <0.0001 0.356692 <0.0001 0.246 <0.0001 Ear length 0.0650 9.18 <0.0001 0.425392 <0.0001 0.201 <0.0001 Chest depth 0.0626 8.79 <0.0001 0.398760 <0.0001 0.212 <0.0001 ASCC Average squared canonical correlation. and 8.739 among populations which are consistent with the FST results (Table 12). Figure 1 presents the genetic distances (DA) between Nigerian sheep breeds. Population structure assessed by STRUCTURE software and barplots generated by DISTRUCT are presented in Figure 2. Classifications with the highest probability under the model that assumes independent allele frequencies and inbreeding coefficients among assumed clusters revealed the presence of ancestral populations (K) which is consistent with the morphological and diversity analyses reported earlier in this study. At K = 2, two clusters were constituted from breeds descended from Balami and Yankasa, both of which are from Northern Nigeria. At K = 3 and K = 4, one more cluster emerged and further analyses did not reveal any additional strong high level substructure, so separating the entire dataset into 3 major clusters was chosen as the final configuration. There are however, several cases of admixtures in the genome of some of the individuals that constitute the cluster. Yankasa and Balami breeds had more cases of admixtures followed by Uda while the WAD breed had the least cases of admixtures. Discussion Morphological diversity Phenotypic characterization has been shown to be an accessible and easy-to-use tool in conservation and breeding programs [6]. This could be explained in part by the high heritability of measures of size across ontogeny [21]. Marked differences were observed in the morphological traits of the sheep breeds in this study. The present values of BW and linear body measurements of Yankasa, Uda and Balami sheep are higher than the range of values reported for Ganjam sheep in India by Arora et al. [10]. Most researchers consider an organism’s phenotype as a multivariate set of variables and the covariation of traits an important analytical consideration [22]. Discriminant analysis of morphometric traits is a mathematical approach that has been widely used in determining the relationships between different breeds of livestock [6,23-25]. The most discriminating variables obtained in this study are similar to previous reports by Dossa et al. [16] and Vargas et al. [26]. The present results indicate that there is significant morphological differentiation among Nigerian sheep populations. This morphological diversity pattern could be as a result of inherent genetic potential of each breed, alongside geographical isolation, ecological variation and community isolation [5,27]. This is noticeable in the remarkable morphological differences between WAD (more adaptable to the wet, dense forest and derived savannah zones of southern Nigeria) and Yankasa, Uda and Balami sheep (more suited to the dry climatic conditions of Northern Nigeria). The larger values reported for the conformation traits of males are in consonance with earlier reports on sheep [28], goats [26] and cattle [29]. However, Bacchi et al. [30] found no sexual dimorphism in the morphometric characters considered in Lama guanicoe guanicoe in Argentina. The higher values recorded for intensively managed animals might be as a result of better nutrition and management practices as they tend to gain more attention than those reared semi-intensively. Riva et al. [14] reported that husbandry system was a source of variation in the body measurements of Bergamasca sheep; theirs was a case between transhumance and sedentary systems, where the former was taller, longer and showed a wider hock while the latter was wider at the chest and rump. Table 8 Percentage of individual sheep classified into genetic group Table 7 Total canonical structure of the discriminant analysis of the four sheep breeds Breed WAD Yankasa Uda Traits CAN1 CAN2 CAN3 WAD 93.33 6.67 0.00 Balami 0.00 Rump height 0.839 0.098 0.038 Yankasa 1.64 63.93 15.57 18.85 Chest girth 0.493 −0.112 −0.159 Uda 0.00 17.20 45.16 37.63 Chest depth 0.485 0.261 −0.012 Balami 0.00 17.83 21.02 61.15 Tail length 0.922 −0.107 0.098 Error level 0.067 0.361 0.548 0.389 Ear length 0.239 −0.242 0.791 Priors 0.250 0.250 0.250 0.250 Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 Table 9 Kinship coefficient (Dkf) below the diagonal and proportion of shared alleles above the diagonal between the Nigerian sheep breeds Balami Uda WAD Yankasa Balami 0.000 0.757 0.800 0.366 Uda 0.941 0.000 0.481 0.643 WAD 0.946 0.789 0.000 Yankasa 0.861 0.906 0.915 Page 10 of 16 Table 11 Effective number of alleles (Na), Allelic Richness, Expected Heterozygosity (He) and Observed Heterozygosity (Ho) in Nigerian sheep breeds Breed Effective No. of alleles (Na) Allelic richness Expected Heterozygosity Observed heterozygosity 0.693 Balami 13.730 9.240 0.823 0.558 0.000 Uda 9.000 8.200 0.754 0.405 WAD 7.200 6.590 0.684 0.448 Yankasa 17.330 10.510 0.849 0.563 Mean 11.815 8.635 0.778 0.494 The three canonical functions (linear combinations of the continuous variables that summarize variation between the four sheep breeds) obtained could be used as criterion for establishing phenotypic standards for Nigerian sheep. The closeness between Uda and Balami sheep compared to their WAD and Yankasa counterparts might be as a result of near biometric convergence, which may function as a guide to genetic and evolutionary relationships between the two breeds. The longer distance between WAD and other breeds, especially Balami and Uda revealed that phenotypic differences are maintained in part by the reduction of gene flow among populations separated by large distances as well as physical-ecological barriers. The WAD sheep predominate in the trypano-endemic humid zones of Southern Nigeria. The intermediate morphology of Yankasa sheep might be maintained by natural selection on body size of individuals inhabiting intermediate or a range of different environments (this breed of sheep, which occupies a central geographical position, is more widely distributed Table 10 Polymorphism Information Content (PIC), F statistics (FIS, FIT, FST) according to Weir and Cockerham (1984) GST and shannon index values for 15 microsatellite markers analyzed in Nigerian sheep breeds Locus PIC FIS FIT FST GST DYMS1 0.927 0.442 0.454 0.022 0.125 Shannon index 2.964 OarCP34 0.751 0.373 0.436 0.099 0.106 2.203 OarFCB193 0.845 0.220 0.329 0.140 0.163 2.321 BM8125 0.808 0.316 0.416 0.146 0.130 2.082 OarJMP29 0.904 0.287 0.352 0.092 0.084 2.854 OarJMP58 0.899 0.318 0.361 0.063 0.079 2.325 OarFCB128 0.782 0.534 0.593 0.126 0.187 2.212 OarFCB304 0.901 0.319 0.339 0.029 0.033 2.882 SRCRSP1 0.787 0.251 0.301 0.066 0.046 2.263 OarAE129 0.792 0.325 0.365 0.059 0.130 1.653 OarVH72 0.853 0.171 0.278 0.129 0.142 2.375 SRCRSP5 0.896 0.406 0.472 0.111 0.175 2.914 MCM 140 0.872 0.428 0.459 0.055 0.069 2.332 OarHH 47 0.825 0.387 0.436 0.079 0.211 SRCRSP9 0.857 0.245 0.320 0.099 Mean 0.846 0.335 0.394 0.088 in the country than the other three sheep breeds). Selective advantage might therefore favor Yankasa sheep from the biogeographical context, although more heterotic gains might be attained from crosses involving WAD and Uda or Balami. This is because populations are dynamic units which adapt physiologically and genetically to their environments and sensitive to, and within limits, responsive to any change in their environmental conditions. An appreciable percentage of animals were classified into their distinct breeds. However, some level of intermingling was observed between Uda and Balami, which could partly be attributed to indiscriminate crossbreeding due to geographical proximity. Molecular genetic diversity between populations The high number of alleles observed in Yankasa must have contributed to its adaptability to more agroecological zones in Nigeria compared to other sheep breeds that may confer selective advantages [19]. Genetic variation is necessary to allow organisms to adapt to ever-changing environments with some of this variation stemming from introduction of new alleles by the random and natural process of mutation, since the frequency of occurrence of an allele changes regularly as a result of mutation, genetic drift, and selection [31]. The number of alleles identified in this study is slightly higher than those reported by Adebambo et al. [19] with observed number of alleles in Yankasa, Balami, Uda and WAD being 11.5, 3.9, 5.85 and 5.05, respectively, based on relatively small sample sizes. Higher numbers of alleles may also be reflective of larger sample sizes used in this study. However, the values fall within the range Table 12 AMOVA design and results (average over 15 loci) Source of variation Sum of squares Variance components Percentage variation Among populations 172.808 0.585 8.739 Among individuals within populations 1432.042 2.04 30.545 2.172 0.122 2.268 Within individuals 759.500 4.063 60.716 0.120 2.388 Total 2364.350 6.692 Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 1.300 0.975 0.650 0.325 0.000 Uda WAD Balami Yankasa Figure 1 Dendogram showing diversity and similarity among Nigerian breeds of sheep. reported for other sheep breeds. Arora et al. [10] reported values for observed number of alleles in the range of 7 and 25 with a mean value of 13.96. The small average number of alleles per locus in Uda and WAD may be the result of a small number of founder animals since the degree of genetic variability among these animals will be small even in the presence of crossbreeding and mutation rates [32]. Different indices used in this study demonstrate the existence of genetic diversity among Nigerian sheep breeds. Variations in allelic richness were observed across all loci. Mean values among the various loci ranged from 3.66 in OarHH47 to 14.73 in OarJMP29, with mean values of 8.63. Dalvit et al. [33] found similar values of allelic richness with an average of 8.8, when they analyzed 10 European sheep breeds. Measures of genetic diversity based on allelic richness are considered important in conservation genetics because markerassisted methods for maximizing the number of alleles conserved have been shown to be effective [34]. Allelic richness may be a useful indicator of a decrease in Page 11 of 16 population size or of past bottlenecks [35]. It is also relevant in a long-term perspective, as selection limits are determined by the initial allelic composition rather than by heterozygosity [36]. As noted by El Mousadik & Petit [37] the often reported numbers of alleles per locus for the whole population or averaged over subpopulations are not comparable because of the much larger sample size of the whole population. Differences among populations are commonly quantified by the use of one of several statistics, including Wright’s inbreeding coefficient (FST) and Nei’s coefficient of gene variation (GST) [38]. The rather high level of genetic variability in Yankasa is due to the fact that this is the most numerous sheep breed in Nigeria [19]. These values (0.658 to 0.902) are within the range observed in other sheep breeds in other parts of the world. Arora et al. [10] observed 0.594 to 0.922 for sheep breeds from Southern Peninsular and Eastern regions of India. Values for Italian sheep breeds are 0.761 to 0.805 [39] and European sheep breeds ranged from 0.538 to 0.807 [40]. The observed heterozygosity values are generally lower than the expected heterozygosity in all the breeds and loci considered. The highest value of observed heterozygosity in Yankasa could also be attributed to its large number in Nigeria [19]. The results of GST analysis in this study reveal that the proportion of gene variation among the breeds is still low. The Shannon index of Nigerian sheep breed in this study revealed low species richness and evenness since all the indices were below 3.5, the mark set for high species evenness and richness [41]. This might not be unconnected with the level of heterozygote deficiency observed among this population, possibly due to the management system [42]. Data collected within the EU-ECONOGENE project on sheep and goat diversity in marginal areas indicate the presence of significant K=2 K=3 K=4 Figure 2 Population structure assessed by Structure. Bar plot, generated by DISTRUCT, depicts classifications with the highest probability under the model that assumes independent allele frequencies and inbreeding coefficients among assumed clusters. Each individual is represented by a vertical bar, often partitioned into colored segments with the length of each segment representing the proportion of the individual’s genome from K = 2, 3, 4 ancestral populations. Breeds are separated by black lines. Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 inbreeding in most of the breeds [7,43]. This is likely due to poor breeding management of frequently small herds, which leads to partial isolation and fragmentation both at the local and breed levels [44]. Differences in the values of global FST, FIT and FIS over all loci considered in this study supports the suitability of some microsatellite markers over the others in the study of genetic diversity in Nigerian sheep breeds. Selection based on estimated breeding values rather than phenotypic merits can lead to the extensive use of a small number of elite individuals in purebred livestock populations, and could potentially increase inbreeding [45]. It has therefore been suggested that breeds with wide range of genetic diversity are needed in the future for generating transgressive variation for quantitative trait loci mapping and developing new genotypes for particular management systems and market demands [46]. On the average, within-breed heterozygote deficit (FIS) was observed to be 33.5% whereas the total population (FIT) exhibited 39.5% deficit with significant values (p < 0.05). Some investigations have reported relatively low variability in local non-selected breeds, as is the case of certain Nigerian [19] and Chinese sheep [47]. The relative higher genetic identity is probably due to the continuous crossing between populations at least in the recent past [48]. The AMOVA results revealed that the greatest variation (60.716%) is within the individual, 30.545% among individuals within populations and 8.739 among populations which are consistent with FST results. Finally, the trend in genetic relationship between these Nigerian sheep breeds is the same for delta mu square, kinship coefficient and proportion of shared alleles. Indeed, our recent molecular characterization of Nigerian sheep using mtDNA sequences of the D-loop found 96 haplotypes, but only 5 haplotypes are common to all the breeds [20], showing relatively divergent haplotypes within breeds and geographical locations. This suggests that gene flow has occurred on a regional scale at some time in the recent past and that the breeds have not been subdivided by long term biogeographic barriers. Genetic structure of the populations The closest genetic distance between Yankasa and Balami at 0.184 and the farthest distance between Balami and WAD (0.665) may be reflective of their geographical locations in Nigeria since Yankasa and Balami are more of northern than southern breeds. This is further confirmed by the greater genetic distance between WAD and Balami observed in this study. These results are supported by Adebambo et al. [19] among these breeds. The pattern of differentiation revealed by the matrix of Nei’s genetic distances and the tree topology reflected the evolutionary history, geographical distributions and the gene flow among breeds. Genetic Page 12 of 16 structure of a breed at any time is the result of a balance between genetic drift (founder effect and selection) and gene flow [32]. WAD and Balami shared the highest number of alleles while the least is between Yankasa and Balami. However, the pattern of genetic distances deviated from the morphological distances obtained for the four sheep breeds. This may be related to varying sensitivity of the two distance estimates, although both methods were able to separate the southern WAD goats from their northern counterparts. A similar finding was reported in Ankole cattle [49] where the results of morphological analyses were not in concordance with the molecular genetic relationship results. The authors attributed this to the fact that microsatellites loci are selectively neutral whereas morphological traits are under selection. Results from the STRUCTURE analysis revealed that varying the number of presumed ancestral populations (K) produces clusters that are consistent with the observed morphological categorization. The first level of clustering (K = 2) reflects the presence of two clusters in the four breeds examined and further evaluation revealed a third strong cluster. This result suggests that the four breeds originated from three ancestral populations which diverged as a result of several years of adaptation and domestication. Further evaluation of the clusters revealed the presence of sub clusters and admixtures which are indicative of substantial gene flow between these breeds. WAD is the only breed with a minimal case of admixture. This may be due to geographical delineation of the breed and the breeding practices of the owners of these animals predominantly in the southern part of the country. Yankasa possess alleles which are shared by the other three breeds and this is consistent with the results discussed above. The mitochondrial data showed a different relationship in the neighbor-joining tree for the four Nigerian sheep breeds [20]. In that tree, the first divergence was for Yankasa breed, followed by WAD and later by Uda and Balami. This can be explained by differences in the breeding patterns, by the use of dams and rams in different management schemes. The higher level of concordance of morphological and mitochondrial DNA data could mean a more ancestral relationship among the breeds revealed by mitochondrial DNA that is maternally inherited. Differences found in the microsatellite data may indicate recent crossbreeding due to geographical closeness among the sympatric breeds, especially involving males from one breed crossing with females of the other breeds. Conclusion Morphological and genetic diversity of Nigerian sheep breeds is eroding gradually. These results suggest that within-breed genetic variation observed in Nigeria sheep Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 is more than between-breed and this variation could be a valuable tool for genetic improvement and conservation. The higher genetic variability in Yankasa may mean the presence of unique alleles reflecting the presence of certain functional genes which may possibly be related to better adaptability of Yankasa in more agro-ecological zones of Nigeria. The higher level of heterozygosity in this study provides the basis for further improvement through selection of primarily Yankasa as well as the other breeds. Methods Study area and population Samples were collected across Nigeria covering all agroecological zones from the arid North to the dense rainforest bordering the coast in the South. Nigeria is located in West Africa on the Gulf of Guinea (latitude 10º00’ N, longitude 8º00’ E) with a total area of 923,768 km2 (twice the size of California). Nigeria is bounded by Niger, Benin and Cameroon Republics on the North, West and East, respectively (Figure 3). The protocol for the experiment was approved by the Institutional Animal Use and Care Committee of the University of Agriculture, Abeokuta (UNAAB), Nigeria. A random sample of 402 sheep (132 males and 270 females) of the four Nigerian sheep breeds [Balami – 133, Uda – 94, West African Dwarf (WAD) – 52, Yankasa – 123] were selected from cities and villages across the country. There is no relationship between sires and dams of the animals sampled since they came from different parts of the country. The animals were reared in semi-intensive (323 animals) and Figure 3 Map of Nigeria showing sampled locations. Page 13 of 16 intensive (79 animals) systems of management. They were at least 15.5 months of age (2-tooth to 8-tooth age) and where records were missing; age was estimated using dentition as described by Wilson and Durkin [50]. Body weight (BW) (kg) and nine body linear measurements (cm), namely height at withers (HW), rump height (RH), body length (BL), ear length (EL), fore cannon bone length (FCL), tail length (TL), chest girth (CG), chest depth (CD) and rump width (RW) respectively were taken on each animal, following standard procedure and anatomical reference points earlier reported [24,28]. In addition, 5–7 ml of whole blood were collected from 384 sheep of the four breeds [Balami – 106, Uda – 94, West African Dwarf (WAD) – 52, Yankasa – 132] into heparinized tubes from the jugular vein of each animal and stored on ice before they were transferred to the laboratory for analysis. DNA extraction, polymerase chain reaction (PCR) and fragment analysis DNA was extracted from 50 μl of whole blood using the ZymoBead™ Genomic DNA Kit (Zymo Research Corp. Irvine, CA, USA) according to the manufacturer’s recommendations and DNA yield and quality were assessed using a Nanodrop ND-100 Spectrophotometer (Nanodrop Technologies, Inc., DE, USA). The DNA was amplified by PCR in a MyCycler™ Thermal Cycler (Biorad, Hercules, CA, USA) using 15 microsatellite markers selected from the FAO recommended list [51] described in Table 13. The 20 μl amplification reactions contained 2 μl containing 30-50 ng template DNA, Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 Page 14 of 16 Table 13 Microsatellite primer sequences that were used and their base lengths 1 2 Name Sequence Base length Annealing temperature (°C) Allele range (bp) Dye OarFCB193 TTCATCTCAGACTGGGATTCAGAAAGGC 28 54 96-136 6FAM GCTTGGAAATAACCCTCCTGCATCCC 26 56 96-150 NED 58 145-169 6FAM 56 150-188 6FAM 54 133-159 6FAM 50 110-130 VIC 55 96-130 VIC 50 112-130 VIC 57 121-145 VIC 58 130-152 VIC 59 159-211 NED 54 116-148 NED 56 126-158 NED 55 99-135 6FAM 60 167-193 NED OarJMP29 GTA TAC ACG TGG ACA CCG CTT TGT AC 26 GAA GTG GCA AGA TTC AGA GGG GAA G 25 3 OarJMP58 GAAGTCATTGAGGGGTCGCTAACC 24 CTTCATGTTCACAGGACTTTCTCTG 25 4 OarFCB304 CCCTAGGAGCTTTCAATAAAGAATCGG 27 CGCTGCTGTCAACTGGGTCAGGG 23 AATCCAGTGTGTGAAAGACTAATCCAG 27 GTAGATCAAGATATAGAATATTTTTCAACACC 32 CTCTATCTGTGGAAAAGGTGGG 22 GGGGGTTAGACTTCAACATACG 22 ATTAAAGCATCTTCTCTTTATTTCCTCGC 29 CAGCTGAGCAACTAAGACATACATGCG 27 5 6 7 OarAE129 BM8125 OarFCB128 8 OarCP34 GCTGAACAATGTGATATGTTCAGG 24 GGGACAATACTGTCTTAGATGCTGC 25 9 OarVH72 GGCCTCTCAAGGGGCAAGAGCAGG 24 CTCTAGAGGATCTGGAATGCAAAGCTC 27 31 10 OarHH47 TTTATTGACAAACTCTCTTCCTAACTCCACC GTAGTTATTTAAAAAAATATCATACCTCTTAAGG 34 11 DYMS1 AACAACATCAAACAGTAAGAG 21 CATAGTAACAGATCTTCCTACA 22 12 13 14 15 SRCRSP1 SRCRSP5 SRCRSP9 MCM140 TGC AAG AAG TTT TTC CAG AGC 21 ACC CTG GTT TCA CAA AAG G 19 GGA CTC TAC CAA CTG AGC TAC AAG 24 GTT TCT TTG AAA TGA AGC TAA AGC AAT GC 29 AGA GGA TCT GGA AAT GGA ATC 21 GCA CTC TTT TCA GCC CTA ATG 21 GTT CGT ACT TCT GGG TAC TGG TCT C 25 GTC CAT GGA TTT GCA GAG TCA G 22 2.0 μl of each primer, and 16 μl nuclease free water in a AccuPower TLA PCR Premix containing NTPs, MgCl2 and Taq DNA polymerase (Bioneer Corp., Irvine, CA, USA) using annealing temperatures shown in Table 13. PCR protocol was as follows: denaturing at 94°C for 5 minutes, 35 cycles of amplification at 94°C for 30 seconds, annealing at annealing temperature of marker for 30 seconds, extension at 72°C for 1 minute, final extension at 72°C for 5 minutes and held at 4°C until analysis. PCR products were separated by electrophoresis in 1.5% agarose gel stained with 0.5 μg/ml ethidium bromide. Electrophoresis was carried out at room temperature for 1 hour at 100 volts using a Bio-Rad Power Pac™ electrophoresis apparatus (Biorad, Hercules, CA, USA). The resulting amplified bands were visualized with UV light and photographed using the Alphalmager™ 2200 gel documentation and analysis system (Cell Biosciences, CA, USA), and were scored using GENEMate Quanti-Marker 100 bp DNA ladder (BioExpress, Kaysville, UT, USA). DNA fragment analysis of microsatellite markers was carried out using the Applied BioSystems 3730xl DNA Analyzer (Applied Biosystems, Carlsbad, CA, USA) at the Cornell University Genomics Core Facility. GeneMapper Software version 3.0 [52] (which combines the functions of GeneScan and Genotyper software in one convenient package) was used to generate microsatellite genotypes. Data analysis Means, standard deviations, standard errors and coefficients of variation were computed for all the traits measured using the GLM procedure of SAS statistical package [53]. Sources of variation in the linear model were breed, sex and system of management. Multivariate Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 analysis [discriminant analysis] was employed to investigate morphological structure, and quantify differences among the sheep populations. Stepwise discriminant analysis was performed to gain information about the most important traits in separating the four sheep breeds using the STEPDISC procedure. These most important variables were then subjected to canonical discriminant analysis using the CANDISC procedure to derive canonical functions and estimate Mahalanobis distances necessary for the differentiation of the sheep populations. The ability of these canonical functions to allocate individual sheep to its original breed was calculated as percentage correct assignment of each breed using the DISCRIM procedure (Nearest Neighbour Discriminant Analysis with Mahalanobis Distances) of the SAS statistical package. Microsatellite Analyzer (MSA) version 4.05 [54] and GENEPOP [55] were used to generate genetic diversity parameters. A model-based Bayesian clustering analysis was used to infer population structure and the level of admixture in the sheep breeds implemented in STRUCTURE v2.3 [56]. The STRUCTURE algorithm assumes K populations, each of which is in Hardy-Weinberg and linkage equilibria and characterized by a set of allele frequencies at each locus. Analysis was performed with a burn in length of 20,000 followed by 100,000 Markov chain Monte Carlo iterations for each of K = 1 to 6, with ten replicate runs for each K using independent allele frequencies and an admixture model. Results across ten runs at each K were compared based on similarity coefficients (SC) as previously described [57]. The breeds were assigned to wide clusters based on major ancestry and submitted to a second round of STRUCTURE analysis performed within each wide cluster. Abbreviations BL: Body length; BW: Body weight; CD: Chest depth; CG: Chest girth; EL: Ear length; FCL: Fore cannon bone length; HW: Height at withers; RH: Rump height; RW: Rump width; TL: Tail length. Competing interests The authors declare that they have no competing interests. Authors’ contributions IGI and BOA conceived the study; BOA, IGI, OAA, MOO, CONI designed the study; IGI and MO obtained funding for the study; BOA, MAA, AY, MW, TMS, OOA, BMI, SAA, GOO and JOE collected phenotypic data and contributed to morphological data analysis; BOA, AY, and OOA carried out morphological data analysis; BOA, MAA and MD carried out the molecular lab analysis; BOA, MAA, SOP, MD, KK and IGI carried out the molecular data analysis and interpretation, BOA, MAA, IGI, MO, AY and SOP wrote the manuscript. All authors read and approved the manuscript. Acknowledgements This study was supported by the College of Agriculture and Life Sciences, Cornell University, Ithaca, NY. USA. Additional support from the United States Agency for International Development (USAID) through the award of the Norman Borlaug Leadership Enhancement in Agriculture Program (LEAP) Fellowship to Moses Okpeku and as well as a research grant from International Foundation for Science, Stockholm to Moses Okpeku are Page 15 of 16 gratefully acknowledged. Special thanks to Dr. W. Ron Butler for the opportunity given to Brilliant O. Agaviezor, Mufliat A. Adefenwa and Abdulmojeed Yakubu as visiting graduate students at Cornell University. Author details 1 Department of Animal Breeding and Genetics, University of Agriculture, Abeokuta, Nigeria. 2Department of Cell Biology and Genetics, University of Lagos, Lagos, Nigeria. 3Department of Animal Science and Fisheries, University of Port Harcourt, Port Harcourt, Nigeria. 4Department of Animal Science, Nasarawa State University, Keffi, Shabu-Lafia Campus, Lafia, Nigeria. 5 Dept of Livestock Production, Niger Delta University, Amasomma, Bayelsa State, Nigeria. 6Dept of Animal Science, Cornell University, Ithaca, NY 14853, USA. 7Dept of Animal Science, Berry College, Mount Berry, GA 30149, USA. 8 Department of Animal Science, Adnan Menderes University, Aydin 09100, Turkey. Received: 30 December 2011 Accepted: 1 November 2012 Published: 24 November 2012 References 1. FAOSTAT: Food and Agriculture Organization of the United Nations. FAOSTAT Database on Agriculture. Rome, Italy: 2011 [http://faostat.fao.org/default.aspx.] 2. Yakubu A, Ibrahim IA: Multivariate analysis of morphostructural characteristics in Nigerian indigenous sheep. Ital J Anim Sci 2011, 10:17. 3. FAO: The State of Food and Agriculture, Livestock in the Balance. Rome: 2010:176. 4. Taberlet P, Coissac E, Pansu J, Pompanon F: Conservation genetics of cattle, sheep, and goats. C R Biol 2011, 334:247–254. 5. Gizaw S, van Arendonk JAM, Komen H, Windig JJ, Hanotte O: Population structure, genetic variation and morphological diversity in indigenous sheep of Ethiopia. Anim Genet 2007, 38:621–628. 6. Carneiro H, Louvandini H, Paiva SR, Macedo F, Mernies B, McManus C: Morphological characterization of sheep breeds in Brazil. Uruguay and Colombia. Small Rum Res 2010, 94:58–65. 7. Peter C, Bruford M, Perez T, Dalamitra S, Hewitt G, Erhardt G: Genetic diversity and subdivision of 57 European and Middle-Eastern sheep breeds. Anim Genet 2007, 38:37–44. 8. Cinkulov M, Popovski Z, Porcu K, Tanaskovska B, Hodzic A, Bytyqi H, Mehmeti H, Margeta V, Djedovic R, Hoda A, Trailovic R, Brka M, Markovic B, Vazic B, Vegara M, Oslaker I, Kantanen J: Genetic diversity and structure of the West Balkan pramenka sheep types as revealed by microsatellite and mitochondrial DNA analysis. J Anim Breed Genet 2008, 125:417–426. 9. D’Angelo CS, Gajecka M, Kim CA, Gentles AJ, Glotzbach CD, Shaffer LG, Koiffmann CP: Further delineation of nonhomologous-based recombination and evidence for subtelomeric segmental duplications in 1p36 rearrangements. Hum Genet 2009, 125:551–563. 10. Arora RJ, Bhatia SB, Mishra P, Jain A, Prakash B: Diversity analysis of sheep breeds from Southern peninsular and Eastern regions of India. Trop Anim Health Prod 2010, 43:401–408. 11. Arora R, Bhatia S, Mishra BP, Joshi BK: Population structure in Indian sheep ascertained using microsatellite information. Anim Genet 2011, 42:242–250. 12. Niu BF, Fu LM, Sun SL, Li WZ: Artificial and natural duplicates in pyrosequencing reads of metagenomic data. BMC Bioinform 2010, 11:187. 13. Paiva SR, Mariante AD, Blackburn HD: Combining US and Brazilian microsatellite data for a meta-analysis of sheep (Ovis aries) breed diversity: facilitating the FAO global plan of action for conserving animal genetic resources. J Hered 2011, 102:697–704. 14. Riva J, Rizzi R, Marelli S, Cavalchini LG: Body measurements in Bergamasca sheep. Small Rum Res 2004, 55:221–227. 15. Cervantes I, Baumung R, Molina A, Druml T, Gutierrez JP, Solkner J, Valera M: Size and shape analysis of morphofunctional traits in the Spanish Arab horse. Livestock Sci 2009, 125:43–49. 16. Dossa LH, Wollny C, Gauly M: Spatial variation in goat populations from Benin as revealed by multivariate analysis of morphological traits. Small Rum Res 2007, 73:150–159. 17. Zahedi-Zahra, Esmaeelkhanian S, Torshizi RV: Microsatellite variation of one breed of Iranian sheep with 12 markers. Pak J Biol Sci 2007, 10:4455–4460. 18. Kumar D, Sharma R, Pandey AK, Gour DS, Malik G, Ahlawat SPS, Jain A: Genetic diversity and bottleneck analysis of Indian Bellary sheep by microsatellite markers. Russ J Genet 2006, 43:996–1005. Agaviezor et al. Journal of Animal Science and Biotechnology 2012, 3:38 http://www.jasbsci.com/content/3/1/38 19. Adebambo OA, Williams JL, Blott S, Urquhart B: Genetic relationships between native sheep breeds in Nigeria based on microsatellite DNA polymorphisms. Anim Genet Res Inform Bull 2004, 34:27–39. 20. Agaviezor BO, Adefenwa MA, Peters SO, Yakubu A, Adebambo AO, Ozoje MO, Ikeobi CON, Ilori BM, Wheto M, Okpeku M, De Donato M, Imumorin IG: Mitochondrial D-loop genetic diversity of Nigerian indigenous sheep. Anim Genet Res 2012, 50:13–20. 21. Wilson AJ, Pemberton JM, Pilkington JG, Clutton Brock TH, Coltman DW, Kruuk LEB: Quantitative genetics of growth and cryptic evolution of body size in an island population. Evol Ecol 2007, 21:337–356. 22. Collyer ML, Adams DC: Analysis of 2 states multivariate phenotypic change in ecological studies. Ecology 2007, 88:683–692. 23. Yakubu A, Salako AE, Imumorin IG, Ige AO, Akinyemi MO: Discriminant analysis of morphometric differentiation in the West African Dwarf and Red Sokoto goats. South African J Anim Sci 2010, 40:381–387. 24. Yakubu A, Idahor KO, Haruna HS, Wheto M, Amusan S: Multivariate analysis of phenotypic differentiation in Bunaji and Sokoto Gudali cattle. Acta Agric Slov 2010, 96:75–80. 25. Ajayi OO, Yakubu A, Jayeola OO, Imumorin IG, Adeleke MA, Takeet MI, Ozoje MO, Ikeobi CON, Peters SO: Multivariate analysis of sexual size dimorphism in domestic turkeys (Meleagris gallopavo) in Nigeria. Trop Anim Hth Prod 2012, 44(5):1089–1095. doi:10.1007/s11250-011-0044-6. In press. 26. Vargas S, Larbi A, Sanchez M: Analysis of size and conformation of native Creole goat breeds and crossbreds used in smallholder agrosilvopastoral systems in Puebla, Mexico. Trop Anim Hth Prod 2007, 39:279–286. 27. Sun W, Chang H, Ren ZJ, Yang ZP, Geng RQ, Tsunoda K: Multivariate statistical analysis of morphological and ecological characters of some sheep populations in China. Sci Agric Sin 2004, 37:285–290. 28. Yakubu A, Akinyemi MO: An evaluation of sexual size dimorphism in Uda sheep using multifactorial discriminant analysis. Acta Agric Scand Sect A Anim Sci 2010, 60:74–78. 29. Polak J, Frynta D: Patterns of sexual size dimorphism in cattle breeds support Rensch’s rule. Evol Ecol 2010, 24:1255–1266. 30. Bacchi CS, Lanari MR, von Thungen J: Non-genetic factors affecting morphometric and fleece traits in guanaco (Lama guanicoe guanicoe). Small Rum Res 2010, 88:54–61. 31. Felsenstein J: Has natural selection been refuted? The Arguments of William Dembski. Rep Na Center Sci Educ (RNCSE) 2007, 27:20–26. 32. Farid A, O’Reilly E, Dollard C, Kelsey CR: Genetic analysis of ten sheep breeds using microsatellites. Canad J Anim Sc 2000, 80:9–17. 33. Dalvit C, Saccà E, Cassandro M, Gervaso M, Pastore E, Piasentier E: Genetic diversity and variability in Alpine sheep breeds. Small Rum Res 2008, 80:45–51. 34. Bataillon TM, David JL, Schoen DJ: Neutral genetic markers and conservation genetics: simulated germplasm collections. Genetics 1996, 144:409–417. 35. Nei M, Maruyama T, Chakraborty R: The bottleneck effect and genetic variability in populations. Evolution 1975, 29:1–10. 36. Petit RJ, El Mousadik A, Pons O: Identifying populations for conservation on the basis of genetic markers. Conserv Biol 1998, 12:844–855. 37. El Mousadik A, Petit RJ: High level of genetic differentiation for allelic richness among populations of the argan tree [Argania spinosa (L) Skeels] endemic to Morocco. Theor Appl Genet 1996, 92:832–839. 38. Ryman N, Leimar O: GST is still a useful measure of genetic differentiation - a comment on Jost’s D. Molec Ecol 2009, 18:2084–2087. 39. Bozzi R, Degl’Innocenti P, Rivera-Diaz P, Nardi L, Crovetti A, Sargentini C, Giorgetti A: Genetic characterization and breed assignment in five Italian sheep breeds using microsatellite markers. Small Rum Res 2009, 85:50–57. 40. Handley LL, Byrne K, Santucci F, Townsend S, Taylor M, Bruford MW, Hewitt GM: Genetic structure of European sheep breeds. Heredity 2007, 99:620–631. 41. Krebs C: Ecological Methodology. New York: HarperCollins; 1989:1–5. 42. Mukesh M, Sodhi M, Bhatia S: Microsatellite-based diversity analysis and genetic relationship of three Indian sheep breeds. J Anim Breed Genet 2006, 123:258–264. 43. Cañon J, Garcia D, Garcia-Atance MA, Obexer-Ruff G, Lenstra JA, AjmoneMarsan P, Dunner S, ECONOGENE Consortium: Geographical partitioning of goat diversity in Europe and the Middle East. Anim Genet 2006, 37:327–334. Page 16 of 16 44. Taberlet P, Valentini A, Rezaei HR, Naderi S, Pompanon F, Negrini R, AjmoneMarsan P: Are cattle, sheep, and goats endangered species? Mol Ecol 2008, 17:275–284. 45. Wiener G, Lee GJ, Wooliams JA: Consequences of inbreeding for financial returns from sheep. Anim Prod 1994, 59:245–249. 46. Notter DR: The importance of genetic diversity in livestock populations of the future. J Anim Sci 1999, 77:61–69. 47. Jia B, Chen J, Zhao RQ, Luo QJ, Yan GQ, Chen J: Microsatellite analysis of genetic diversity and phylogenetic relationship of eight sheep breeds in Xinjiang. Yi Chuan Xue Ba 2003, 30:847–854. 48. Pedrosa S, Uzun M, Arranz JJ, Gutiérrez-Gil B, San Primitivo F, Bayón Y: Evidence of three maternal lineages in Near Eastern sheep supporting multiple domestication events. Proc R Soc Lond 2007, 272:2211–2217. 49. Ndumu DB, Baumung R, Hanotte O, Wurzinger M, Okeyo MA, Jianlin H, Kibogo H, Solkner J: Genetic and morphological characterization of the Ankole Longhorn cattle in the African Great Lakes regions. Genet Sel Evol 2008, 40:467–490. 50. Wilson RT, Durkin JW: Age at permanent incisor eruption in indigenous goats and sheep in semi-arid Africa. Livest Prod Sci 1984, 11:451–455. 51. FAO: Molecular genetic characterization of animal genetic resources. FAO animal production and health guidelines. Rome. 2011, 9:65–84. 52. Genemapper Software Version 3.0. Applied Biosystems. Carlsbad, CA, USA: http://mvz.berkeley.edu/egl/resources/manuals/GeneMapper. 53. SAS: Statistical Analysis System User’s Guide, Statistic. NC 27513, USA: SAS Institute Inc. Cary; 2010. 54. Dieringer D, Schlotterer C: Microsatellite Analyser (MSA): a platform independent analysis tool for large microsatellite data sets. Molec Ecol Notes 2003, 3:167–169. 55. Raymond M, Rousset F: Genepop (Version 1.2): population genetics software for exact tests and ecumenicism. J Hered 1995, 86:248–249. 56. Pritchard JK, Stephens M, Donnelly P: Inference of population structure using multilocus genotype data. Genetics 2000, 155:945–959. 57. Rosenberg NA, Pritchard JK, Weber JL, et al: Genetic structure of human populations. Science 2002, 298:2381–2385. doi:10.1186/2049-1891-3-38 Cite this article as: Agaviezor et al.: Morphological and microsatellite DNA diversity of Nigerian indigenous sheep. Journal of Animal Science and Biotechnology 2012 3:38. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit