© 2007 The Japan Mendel Society Cytologia 72(2): 195–203, 2007 Production and Fertility Restoration of an Interspecific Hybrid between Gossypium hirsutum L. and G. raimondii U. Naganoor Ananthan Saravanan, Sundaram Ganesh Ram*, Venkatesan Thiruvengadam, Rajasekaran Ravikesavan and Thondikulam Subramaniam Raveendran Centre for Plant Breeding and Genetics, Tamil Nadu Agricultural University, Coimbatore 641 003, India Received January 29, 2007; accepted April 12, 2007 Summary Interspecific hybrids between 2 cultivated varieties (MCU 5 and MCU 7) of tetraploid cotton (Gossypium hirsutum) and diploid perennial species G. raimondii were synthesized. The resulting triploid F1s were pollen sterile and exhibited irregular meiosis with frequent formation of univalents and multivalents. Mean chromosome association of the triploid hybrids were 11.50 I⫹9.97 II⫹2.31 III⫹0.16 IV and 0.50 I⫹11.35 II⫹0.96 I. Successful synthesis of hexaploids involoving G. raimondii by doubling the genomes of the triploid hybrids with 0.1% colchicine and enhancement of fertility status in hybrids is reported for the first time. The mean chromosomal association of hexaploid hybrids were 4.05 I⫹26.91 II⫹4.45 III⫹1.23 IV⫹0.32 V and 1.26 I⫹25.81 II⫹1.18 III⫹5.19 IV respectively. The heterozygosity of triploid and hexaploid hybrids was also confirmed through SSR marker analysis. Further utility of the developed hybrids with respect to jassid resistance breeding in cotton is discussed. Key words Chromosome doubling, Gossypium hirsutum, G. raimondii, Interspecific hybrid, Meiosis. Cotton, often known as King of fibres, is the principal raw material of textile industry in many countries. About 190 million people in the third world derive their income from cotton growing and processing. The economy of many countries depends on production, processing, utilization and export of cotton. In addition, cotton is also a predominant food and feed crop being the second best potential source of plant proteins after soybean, and the fifth best oil producing plant after soybean, palm tree, colza and sunflower (Texier 1993). In the recent years cotton production is stagnant in many countries due to several biotic constraints particularly due to insect pests. Bollworms and sucking pests are the 2 major groups, which cause considerable damage to the crop leading to severe loss in yield and fibre quality. Among the sucking pests of cotton, jassids (Amrasca bigutulla bigutulla) is the most serious causing irreparable damage such as reddening, stunting, delayed maturity and lowered productivity and fibre quality. Loss in lint and seed yield has been estimated as 20–35% by sucking pests alone (Parnel et al. 1949). In the present situation it is impossible to raise a good crop without pest control in cotton and for which a major quantum of insecticides manufactured are used. In spite of colossal use of insecticides, complete pest control is not achieved, besides which the indiscriminate use of pesticides by cotton farmers has also resulted in increase in the cost of production, development of resistance to insecticides in major pests, resurgence of secondary pests and elimination of natural enemies in cotton ecosystem. Hence, there is a need for continuous development of new strategies to meet the emerging challenges in pest scenario of cotton. One of the viable and cost effective approaches is to * Corresponding author, e-mail: ganeshgene@yahoo.com 196 N. A. Saravanan et al. Cytologia 72(2) develop cultivars that possess built-in resistance to insect pests. Insect resistant cultivars are compatible with other strategies of integrated pest management practices, besides being sustainable and ecofriendly. Interspecific hybridization had been an essential tool to cotton breeders who aim to improve the productivity (Tayyab 1990), fibre properties (Sappenfield 1970) and resistance to pests (Lukefahr et al. 1971) and diseases (Knight 1963). Further repeated use of genetically related materials in breeding programme would result in depletion of variability and increase in vulnerability to new strains of pathogen and pests. As an alternate strategy, wild species and primitive races in cotton provide a useful gene bank for incorporating high level of resistance to all major insect pests. Hence, the use of wild species in hybridization programme offers a great scope for pest management. However, transfer of desirable traits from wild species is a tedious process as it poses several problems such as cross incompatibility, hybrid sterility and hybrid break down which are associated with the ploidy differences. Among wild species G. raimondii, G. tomentosum, G. armourianum and G. tryphyllum are reported to be jassid resistant (Narayanan et al. 1984). The present investigation reports successful interspecific hybridization between cultivated tetraploid upland cotton (Gossypium hirsutum) with the diploid wild species G. raimondii and restoration of fertility status in the triploid hybrid through chromosome doubling. Materials and methods Interspecific hybridisation An accession of Gossypium raimondii (2n⫽2x⫽26), a wild diploid perennial species was established in cytogenetics glass house of Centre for Plant Breeding and Genetics, Tamil Nadu Agricultural University, Coimbatore, India. Hybridisation was effected between cultivated tetraploid species G. hirsutum (cvs MCU 5 and MCU 7) and G. raimondii using the former as ovule parent owing to its higher ploidy status. Seeds of putative hybrids were germinated in polythene bags containing pot mixture and sand (3 : 1) and transplanted to field as soon as seedlings attain four to 5 leaf stages. Cytological observations Young flower buds of appropriate size of both parents and hybrids were fixed in Carnoy’s II fluid (6 : 3 : 1 absolute ethanol : chloroform : glacial acetic acid) for 24 h and later stored in 70% ethanol in a refrigerator until observation. Cytological smears of pollen mother cells (PMC) were prepared with 1% acetocarmine on microscopic slides. The slides were warmed over a hotplate and observed for meiotic stages using Olympus research microscope. Pollen fertility analysis was carried out in triploid and hexaploid hybrids by acetocarmine squash technique. Induction of polyploidy Seeds of the putative F1 triploid hybrids were sown in the poly bags for colchicine treatment. When the seedlings attained 2 leaf stage, a thin wad of absorbent cotton was spread over the apical meristems and 4 to 5 drops of 0.1% aqueous solution of colchicine was applied. The treatment was given twice a day for 5 consecutive days. Confirmation of hybridity Heterozygosity of the triploid and hexaploid hybrids were confirmed through simple sequence length polymorphisms (SSLPs) by using SSR primers for cotton (www.mainlab.clemson.edu/cmd). DNA was isolated from young leaves of parents, triploid and doubled hexaploid hybrids using the standard CTAB method (Dellaporta et al. 1983) and DNA concentrations were estimated and stan- 2007 197 Interspecific hybridization in Gossypium Table 1. Crossability between G. hirsutum and G. raimondii Crosses Number of flowers crossed Number of bolls set Number of viable seeds obtained Number of viable hybrids obtained G. hirsutum (MCU 5)⫻G. raimondii G. hirsutum (MCU 7)⫻G. raimondii 643 514 27 18 109 87 24 19 Table 2. Sl. No. Characters Morphological characters of parents and hybrids G. hirsutum tetraploid 2n⫽4x⫽52 1 Habit Annual 2 3 4 5 Stem colour Leaf colour Leaf incision Leaf shape Dark green Dark green Shallow Palmate with 2–3 shallow lobes Medium smooth Thick prominent Purple green Slightly hairy Mildly pubescent to slightly hair Embedded Light yellow Yellow Dense — 6 7 8 9 10 Leaf texture Leaf veins Petiole colour Leaf hairiness Stem pubescence 11 12 13 14 15 16 17 18 Position of stigma Corolla colour Anther colour Anther density Seed set on backcrossing Boll shape Boll size Bract size 19 20 Petal size Petal spot Oval Medium Medium Medium Absent G. raimondii Diploid 2n⫽2x⫽26 Perennial profused branching Brown Light green Shallow Cordate Smooth Thick prominent Light green Hairy Pubescent Protruded Cream Purple Dense — Conical Small Large with long teeth Very large Dark red G. hirsutum⫻ G. raimondii Triploid 2n⫽3x⫽39 G. hirsutum⫻ G. raimondii Hexaploid 2n⫽6x⫽78 Perennial Perennial Light green Dark green Shallow Palmate with two lobes Smooth Thick Green Hairy Mildly pubescent Light green Green Shallow Palmate with 2 to 3 shallow lobes Smooth Thick Green Hairy Mildly pubescent Partly protruded Yellow Yellow Moderately dense No seed set was found No boll set — Medium Protruded Cream to yellow Yellow Dense Occasional Medium Light red Large Dark red Conical Medium Medium dardized by measuring absorption in UV-Vis spectrophotometer at 260 nm. Following initial screening of 10 primers, Polymorphic SSR profiles were generated with 2 primers viz., BNL 3280 (F: GCAGAACTGCCACTTGTTTG R: AGAAAATGGGTTGTGCTTGG) and BNL 3147 (F: ATGGCTCT CTCTGAG CGTGT R: CGGTTCAGAGGCTTTGTTGT) following the SSR amplification protocol developed by Zhang et al. (2002) in Gene-Amp thermal cycler (Applied Biosystems). Amplified products were separated by electrophoresis on 3% agarose gels for 1 h 20 min at 100 V and visualized with UV transilluminator after staining with ethidium bromide. Results Interspecific hybridization Seed set upon crossing between G. hirsutum and G. raimondii varied with cross combinations 198 N. A. Saravanan et al. Cytologia 72(2) 2007 Interspecific hybridization in Gossypium 199 (Table 1). The seed set and survival of hybrid plants till maturity were poor indicating the operation of pre and post zygotic barriers. Twenty four and 19 plants were established in the field for the crosses MCU 5⫻G. raimondii and MCU 7⫻G. raimondii respectively and the plants were more vigorous than either parents. The plants were perennials with profuse monopodial and sympodial branching (Table 2 and Fig. 1a). The triploid hybrid plants resembled the paternal parent in habit, leaf texture, leaf veination, petiole colour, leaf hairiness, leaf shape, corolla colour, petal spot, bract size and flower size, while their leaf colour, position of staminal column and anther density resembled the maternal parent. Hexaploids of both crosses showed a pronounced increase in leaf size. The hexaploids also exhibited typical higher ploidy characters of stunted growth, thicker leaves and abnormal branching (Fig. 1b). The flowers of hexaploids were larger than their triploid counterparts and their anthers were also more conspicuous than those of triploids. The hexaploid hybrid also produced bolls which were not developed in triploid hybrids. The bolls produced were smaller in size than the tetraploid parent but larger than the wild species G. raimondii (Fig. 1c). Fibres produced by the seeds of hexaploid hybrid were light brown in colour, slightly shorter in length than the upland parent species and seeds were few in number (Fig. 1d). Cytological observations Course of meiosis was regular in both the diploid and tetraploid parental species. The division was normal with regular pairing of chromosomes. There was normal synapsis resulting in formation of 13 and 26 bivalents in diploid and tetraploid parents respectively. The bivalets oriented themselves into regular equatorial alignment in metaphase I. The disjunction of chromosomes was also equal at anaphase I and pollen fertility was also high (>90%). Chromosome number in all the triploid hybrid plants were found to be 2n⫽3x⫽39. The fertility status of pollen in the triploid hybrids were as low as 16.25 and 12.76% respectively and the size of pollen grains were also variable (Table 3 and Fig. 1e). The triploid hybrid of the cross G. hirsutum (MCU 5)⫻G. raimondii recorded a maximum bivalent association of 13 II along with 10 I and 1 III (Table 4). The most frequent association was 13 I⫹7 II⫹4 III with a mean association of 11.50 I⫹9.97 II⫹2.31 III⫹0.16 IV (Fig. 1g). In this triploid the number of bivalents varied from 7–18 with an average of 10.03. The triploid hybrid G. hirsutum (MCU 7)⫻G. raimondii recorded maximum bivalent association of 15 II along with 9 I. The number of bivalents was seen to vary from 8 to 15 with an average of 11.35. The most frequent association of 10 I⫹13 II⫹1 III was observed. It also recorded a mean association of 13.50 I⫹11.35 II⫹0.96 III. Anaphase I was irregular in both the crosses and cytomixis was frequently observed in many PMCs. Pollen fertility status of hexaploid hybrids obtained by chromosome doubling were high (82.75 and 82.45%) and size of the pollengrains were also large and uniform as compared to their triploid counterparts (Table 3 and Fig. 1f). The hexaploid hybrid G. hirsutum(MCU 5)⫻G. raimondii showed a mean association of 4.05 I⫹26.91 II⫹4.55 III⫹1.23 IV⫹0.32 V per PMC (Table 5 and Fig. 1h). Number of quadrivalents varied from 2 to 5 per PMC and the most frequent association was 7 I⫹28 II⫹5 III. The mean number of bivalents varied from 23 to 31 with an average of 26.91 II. The hexaploid hybrid G. hirsutum (MCU 7)⫻G. raimondii recorded maximum bivalent association of 25 accompanied with 22 I and 2 III. A mean association of 24.55 I⫹19.68 II⫹3.73 III⫹0.73 Fig. 1. Interspecific hybridization between Gossypium hirsutum and G. raimondii a) triploid hybrid b) hexaploid hybrid (Inkay: boll set in hexaploid hybrid) c) bolls of parents and hexaploid hybrid (1tetraploid parent, 2-hexaploid hybrid, and 3-diploid parent) d) seeds of parents and hexaploid hybrid (1-tetraploid parent, 2-hexaploid hybrid and 3-diploid parent) e) sterile pollen grains of triploid hybrid hybrid f) fertile pollen grains of hexaploid hybrid g) irregular meiosis in triploid hybrid (10 I⫹13 II⫹1 III) h) metaphase in hexaploid hybrid with higher bivalents (3 I⫹17 II⫹7 III⫹5 IV) i and j) SSR banding patterns for primers BNL 3280 and BNL 3147 (1-tetraploid parent, 2-triploid hybrid, 3-hexaploid hybrid and 4-diploid parent). 200 N. A. Saravanan et al. Table 3. Cytologia 72(2) Pollen fertility status and pollen grain polymorphism of parents and hybrids Pollen fertility (%) Pollen size (m m) Combination MCU 5 MCU 7 G. raimondii MCU 5⫻Gossypium raimondii Triploid MCU 5⫻Gossypium raimondii Hexaploid MCU 7⫻Gossypium raimondii Triploid MCU 7⫻Gossypium raimondii Hexaploid Table 4. PMC observed 1 2 4 3 1 2 3 5 2 1 2 6 Total Mean 1 5 3 2 1 4 1 3 2 Total Mean Range Mean Range 84.67 85.29 76.25 16.25 82.75 12.76 82.45 71.36–88.45 73.66–93.25 71.24–83.22 4.15–29.33 79.77–85.66 2.37–20.14 72.71–88.94 87.29 92.21 116.23 Highly variable 124.35 Highly variable 133.76 79.66–93.18 84.26–95.13 102.54–131.25 — 117.25–129.56 — 124.72–144.32 Chromosome association in triploid hybrids G. hirsutum (MCU 5)⫻G. raimondii I II III IV V 16 6 13 10 18 8 14 13 10 13 3 13 368 11.5 10 12 8 13 9 8 11 10 10 8 18 7 319 9.97 1 3 2 1 1 5 1 2 3 2 — 4 74 2.31 — — 1 — — — — — — 1 — — 5 0.16 — — — — — — — — — — — — — 13.50 Table 5. PMC observed Mean 3 7 5 3 2 2 4 4 2 89 4.05 4 1 2 5 2 1 3 5 3 — — — 26 11.35 G. hirsutum (MCU 7)⫻G. raimondii I II III IV V 16 17 11 15 14 14 9 10 18 — — — 351 0.96 10 8 11 12 8 12 15 13 9 — — — 295 — 1 2 2 — 3 1 — 1 1 — — — 25 — — — — — — — — — — — — — — — — — — — — — — — — — — — Chromosome association in hexaploid hybrids G. hirsutum (MCU 5)⫻G. raimondii I PMC observed II III IV V 17 28 24 31 27 27 23 27 31 592 26.91 7 5 4 3 3 6 4 5 2 100 4.55 5 — 2 1 2 1 4 — 2 27 1.23 — — 1 — 1 — — — 1 7 0.32 PMC observed 3 5 1 3 2 1 4 3 1 22 G. hirsutum (MCU 7)⫻G. raimondii I II III IV V 34 25 21 18 17 22 25 24 28 540 24.55 12 19 22 20 24 25 22 19 22 433 19.68 4 5 3 4 3 2 3 4 2 82 3.73 2 — 1 2 1 — — 1 — 16 0.73 — — — — — — — — — — — 2007 Interspecific hybridization in Gossypium 201 IV was observed per PMC. The most frequent association was 25 I⫹19 II⫹5 III. The number of bivalents was seen to vary from 12 to 25 with an average of 19.68. Confirmation of hybridity For the primer BNL 3280 (Fig. 1j) four distinct alleles could be distinguished out of which allele 4 was commonly seen in parents and hybrids. Allele 1 was female parent specific and found to be present in both triploid and hexaploid hybrids. While allele 2 was paternal parent specific and found to be present in hexaploid hybrid. In the case of primer BNL 3147, only 2 alleles were present, out of which allele 1 was male parent specific and also present in both triploid and hexaploid hybrids. Allele 2 was commonly seen in parents and hybrids. Inheritance of SSR markers of both parental species in hybrids indicates presence of parts of genomes of both parents in the hybrids. Discussion Present investigation was carried out to synthesize interspecific hybrids between Gossypium hirsutum and G. raimondii with the objective to transfer the genes resistant to jassids from the wild diploid species to cultivated tetraploid hirsutum cotton. The success of transferring useful resistance trait from one species to another is inversely proportional to the frequency of structural differences in the breeding material. Major and minor chromosomal structural differences, sequential affinities between chromosomes of different genomes and genic differences among races of cultivated species of cotton create problems in effective introgression (Hutchinson et al. 1947, Narayanan 1977, Narayanan et al. 1983). Nevertheless, most of these problems can be curcumvented through proper choice of parental species, bridge crossing, bud pollination, or spraying of stigma extracts, reciprocal crosses, polyploidy and grafting of the style and embryo culture (Narayanan et al. 1988, He et al. 1984, Gill and Bajaj 1984). Two triploid hybrids of the crosses G. hirsutum (MCU 5)⫻G. raimondii, G. hirsutum (MCU 7)⫻G. raimondii developed by interspecifc hybridization were characterized by vigorous rapid growth with profuse branching and tolerance to jassids. Evidently, these characters were transmitted from the wild parent G. raimondii. The observations made by Deodikar (1949) in the triploid hybrids involving G. anomalum were also similar to those obtained in the present study. The triploid hybrids were found to be intermediate between the parents in plant height, growth habit, number of monopodial branches, number of anthers per flower, size of anther, length of pistil and bracterial teeth number which are in accordance to observations of of Mehetre et al. (2003). In the present study, leaf shape, flower shape, petal spot, flower colour, flower size, stem and leaf hairiness of G. raimondii were dominant as the F1 triploid hybrids and their hexaploids exhibited these characters. Memon and Ahmed (1970) described similar interspecific triploid hybrid in terms of vigour, tallness, petal spot and hairiness and reported these characters are being transmited from G. anomalum. However the hybrids had flower shape and petal colour of G. hirsutum indicating the dominance nature of these characters in cultivated upland hirsutums and recessive in wild relatives. The triploid hybrids of both crosses were sterile which is due to the variations of the genomes involved and ploidy barriers. The most common strategy proposed for overcoming the ploidy barrier for restoration of fertility among interspecific derivatives, is the synthesis of a sterile intergenomic F1 and doubling chromosome complement to achieve the fertility (Stewart 1995). Umbeck and Stewart (1985) also suggested that the doubling of interspecific hybrids is necessary to restore pollen fertility and it enabled repeated back crossing with the cultigens. Thus polyploidisation has been used as the main tool to overcome the sterility of interspecific hybrids. In the present study triploid hybrids of both crosses were polyploidised using colchicine and fertility status of the hybrids was enhanced. In the earlier studies, attempts to hybridize G. hirsutum and G. raimondii (Bar- 202 N. A. Saravanan et al. Cytologia 72(2) ducci and Madoo 1940 and Mehetre et al. 2002) resulted in successful triploid hybrids but restoration of fertility through polyploidisation has been not reported so far. The morphological expressions like slower growth, abnormal branching, stunted growth, large sized flowers, increased pollen grain size, boll and seed set as compared to F1 triploids suggested that the chromosome complements of these colchicine treated plants were successfully doubled. Stephens (1942) reported that doubled tetraploid showing “gigas characters”, slower growth, coarser and fleshier vegetative parts, increased size of pollen grains, and broader leaves as compared with normal diploid. Brown and Menzel (1952) also observed that amphidiploids were distinguished from their corresponding F1 hybrids by larger, thicker, less lobed leaves, larger and broader bracteole, flower parts, larger anther, more regular shedding of pollen and often by more irregular, ruffled, some what lobed petal margins. Brubackar et al. (1999) also confirmed the doubling of G. sturtianum⫻G. hirsutum and its reciprocal hybrid G. hirsutum⫻G. sturtianum by increased flower size. In the development of intergenomic hybrids for resistance, a thorough knowledge about the chromosomal behaviour in hybrids and back cross progenies is essential as it forms the basic information over which the breeding programme is formulated. The cytological analysis in F1 hybrids, G. hirsutum (MCU 5)⫻G. raimondii and G. hirsutum (MCU 7)⫻G. raimondii showed the mean pairing associations of 11.50 I⫹9.97 II⫹2.31 III⫹0.16 IV and 13.50 I⫹11.35 II⫹0.96 III respectively. The chromosome association observed in these hybrids did not differ much from earlier report (Barducci and Madoo 1940). The formation of trivalents and higher chromosome associations in triploids and hexaploids indicate the pairing affinities between the genome involved. Endrizzi (1962) reported that the main force, which controls regular pairing behaviour in Gossypium, is the differences in the degree of chromosome condensation. Homeologous chromosome are differently sized among Gossypium genomes which rarely pair. The univalents observed in this study can be attributed to asynapsis because of lack of homology between the different sets of chromosomes or to the failure of the chromosomes to remain associated (desynapsis). On comparison hexaploid hybrids recorded mean associations of 4.05 I⫹26.91 II⫹4.45 III⫹1.23 IV⫹0.32 V and 1.26 I⫹25.81 II⫹1.18 III⫹5.19 IV respectively which clearly indicates that there is considerable increase in the number of bivalents in hexaploids as compared to their triploid counterparts leading to enhancement of fertility status. In hexaploid hybrids of both crosses normal boll formation was observed with well developed seeds. Brown and Menzel (1952) concluded that the triploid hybrids of the cross G. hirsutum and G. stocksii from which the hexaploids are derived, are almost completely sterile while all the hexaploids, are more or less fertile, the degree of fertility being different with the varying accessions of diploid species involved. Having restored the fertility status of interspecific hybrids among G. hirsustum and G. raimondii repeated backcrossing of the hexaploids with respective cultivated tetraploids and screening the segregants carrying resistant genes for jassids is in progress so that high yielding resistant genotypes could be isolated in due course. References Barducci, T. B. and Madoo, R. M. 1940. Relationship of Gossypium raimondii. Nature. 145: 553. Brown, M. S. and Menzel, M. Y. 1952. Polygenomic hybrids in Gossypium. I. Cytology of hexaploids, pentaploids and hexaploid combinations. Genetics. 37: 242–263. Brubaker, C. L., Brown, A. H. D., Stewart, J. M., Kilby, M. J. and Grace, J. P. 1999. Production of fertile hybrid germplasm with diploid Australian Gossypium species for cotton improvement. Euphytica. 108: 199–213. Dellaporta, S. L., Wood, J. and Hicks, J. B. 1983. A plant DNA minipreparation: version II, Plant Mol. Biol.Rep. 1: 19–21. Deodikar, G. B. 1949. Cytogenetic studies on cross of G. anomalum with cultivated cotton. I. (G. hirsutum⫻G. anomalum) doubled⫻G. hirsutum. Indian J. Agric. Sci. 19: 389–399. Endrizzi, J. E., 1962. The diploid like cytological behaviour of tetraploid cotton. Evolution. 16: 325–329. Gill, M. S. and Bajaj, Y. P. S. 1984b. Interspecifc hybridization in the genus Gossypium through embryo culture. Euphytica. 33: 305–311. 2007 Interspecific hybridization in Gossypium 203 He, L. Q., Zhou, X. T. and Chen, S. L. 1984. Cotton axillary bud grafting technique and its application. Shanghai Nongyekeji. 2: 20–21. Hutchinson, J. B., Silow, R. A. and Stephens, S. G. 1947. The evaluation of Gossypium and the differentiation of cultivated cotton. Oxford University Press, London. Knight, R. L. 1963. The genetics of blackarm resistance. XII. Transfer of resistance from Gossypium herbaceum to G. barbadense. J. Genet. 58: 328–346. Lukefahr, M. J., Houghtaling, J. E. and Graham, H. M. 1971. Suppression of Heliothis populations glabrous cotton strains. J. Econ. Entomol. 64: 486–488. Mehetre, S. S., Aher, A. R., Patil, V. R. and Shinde, G. C. 2003a. Cytomorphological studies in hybrid between haploid of Gossypium hirsutum (L.) and diploid Gossypium arboreum (L.). Indian J. Genet. 63: 137–142. —, Gawande, V. L., Aher, A. R. and Shinde, G. C. 2003b. Cytomorphology of interspecific hybrids between Gossypium hirsutum L., its haploid and Gossypium raimondii. Indian J. Genet. 63: 319–324. —, Patil, V. R. and Aher, A. R. 2002. Gossypium raimondii: a source of new restorer on the basis of CMS background of G. hirsutum L. Caryologia. 55: 227–232. Memon, A. M. and Ahmed, M. 1970. Morphological, cytological and fertility studies in interspecific hybrid G. hirsutum L. Var. M4⫻G. anomalum, Waw. Et. Peyr. Pak. Cott. 14: 253–265. Narayanan, S. S., Sree Rangasamy, S. R. and Madhava Menon, P. 1983. Cytological study of synthetic allotetraploid hybrids in Gossypium. SV. Int. Genet. Congr. Part II. 1231: 679. —, Singh, J. and Verma, P. K. 1984. Introgressive gene transfer in Gossypium. Goal, problems, strategies and achievement. Cotton Fib. Trop. 39: 123–135. —, Singh, V. V., Kothandaraman, R. and Singh, P. 1988. Role of genetic resources, earliness and plant type on boll worm resistance in cotton. Paper presented in Group discussions on boll worm resistance in cotton on 8–9 March, 1988 at CICR, Nagpur. pp. 120–133. — and Singh, P. 1994. Resistance to Heliothis and other serious insect pests in Gossypium sp-A review. ISCI Journal. 19: 10–24. Parnell, F. R., King, H. E. and Ruston, D. F. 1949. Jassid resistance and hariness of the cotton plant. Bull. Ent. Res. 39: 539–575. Sappenfield, W. D. 1970. ‘Notice of release of a variety of upland cotton, Delcot 277’. MO Agric. Exp. Stn. and USDA Memo. Stephens, S. G. 1942. Colchicine produced polyploids in Gossypium. I. An autotetraploid Asiatic cotton and certain of its hybrids with wild diploid species. J. Genet. 44: 272–295. Stewart, J. M. C. D. 1995. Potential for crop improvement with exotic germplasm and genetic engineering. In: Challenging the future. G. A. Constable and N. W. Forrester. (eds.) Proceedings of the world cotton research conference-1, Brishbane, Australia, February 14–17, pp. 313–327, Melborune, Australia. Tayyab, M. A. 1990. Use of wild species in heterosis breeding of cotton. PKV Res. J. 14: 1–4. Texier, P. H. 1993. Le cotton, cinquieme producteur mondial d’huile alimentaire. Coton Develop. 8: 2–3. Zhang J., Guo, W. Z. and Zhang, T. Z. 2002. Molecular linkage map of allotetraploid cotton (G. hirsutum L.⫻G. barbadense L.) with a haploid population. Theor. appl. genet. 105: 1166–1174.