Pesticide Biochemistry and Physiology 66, 195–205 (2000) doi:10.1006/pest.1999.2462, available online at http://www.idealibrary.com on Mechanisms Responsible for Cypermethrin Resistance in a Strain of German Cockroach, Blattella germanica Steven M. Valles,*,1 Ke Dong,† and Richard J. Brenner* *USDA-ARS, Center for Medical, Agricultural and Veterinary Entomology, 1600 SW 23rd Drive, Gainesville, Florida 32608; and †Pesticide Research Center, Department of Entomology, Michigan State University, East Lansing, Michigan 48824 Received August 23, 1999; accepted October 18, 1999 Cypermethrin resistance level and mechanisms responsible for the resistance were investigated in a strain (Aves) of German cockroach, Blattella germanica (L.), collected recently from a Gainesville, Florida residence. Topical bioassay data revealed that the Aves strain was highly resistant to cypermethrin, exhibiting a resistance ratio of 93-fold, which was reduced to 29-fold when cockroaches were pretreated with piperonyl butoxide and reduced to 18-fold when pretreated with S,S,S-tributyl phosphorotrithioate. The synergist data implicated enhanced oxidative and hydrolytic metabolism as resistance mechanisms in the Aves German cockroach strain. This conclusion was further supported by significantly higher oxidative (2.4- to 4.2-fold) and hydrolytic (1.6- to 3.6-fold) detoxification enzyme activities toward surrogate substrates and significantly higher in vitro [14C]cypermethrin metabolism. Microsomal NADPH-dependent (1.8-fold) and NADPHindependent (2.2-fold) [14C]cypermethrin metabolism were significantly greater in the Aves strain than in the Orlando insecticide-susceptible strain. In vivo penetration studies with [14C]cypermethrin indicated that decreased cypermethrin penetration may also be a contributing resistance mechanism in the Aves strain. Finally, the Leu993Phe mutation, shown previously to be associated with knockdown resistance (kdr), was present in the Aves strain. q 2000 Academic Press Historically, control efforts have been directed against the German cockroach, Blattella germanica (L.), because of its potential to harbor and transmit human disease-causing pathogens (1). However, within the last decade, cockroachinduced asthma has been recognized as a serious health problem, providing additional incentive for German cockroach control efforts (2). Unfortunately, a major impediment to effective German cockroach control is the development of insecticide resistance. Pyrethroid insecticides have been used extensively to control the German cockroach, and, as a result, resistance to this class of insecticides appears to have become prevalent among German cockroach populations (3–6). Target site insensitivity (kdr) has been reported to be a major mechanism of pyrethroid resistance in 1 To whom correspondence should be addressed. Fax: (352) 374-5818. E-mail: svalles@gainesville.usda.ufl.edu. many German cockroach strains (7–9). However, the overwhelming majority of reports concerned with elucidating German cockroach insecticide resistance mechanisms have concluded that multiple resistance is a common motif in this insect (3, 7, 10, 11). Knowledge of the contribution that each mechanism plays in the overall resistance level is essential to a complete understanding of the resistance phenomenon. The purpose of this investigation was to examine the mechanisms responsible for cypermethrin resistance in a recently collected population of the German cockroach. MATERIALS AND METHODS Chemicals Technical-grade aldrin, dieldrin, m-phenoxybenzyl alcohol, 3-phenoxybenzoic acid, and S,S,S-tributylphosphorotrithioate (DEF) were purchased from ChemService (West Chester, PA). Cypermethrin and [14C]cypermethrin with 195 0048-3575/00 $35.00 Copyright q 2000 by Academic Press All rights of reproduction in any form reserved. 196 VALLES, DONG, AND BRENNER radiocarbon in the phenoxy position (2.1 GBq/ mmol [56.8 mCi/mmol], cis:trans ratio of 47.5:52.5) were generously provided by Zeneca Agrochemicals (Berkshire, England). [14C]Cypermethrin was purified using two-dimensional thin-layer chromatography (TLC) plates (Silica Gel 60; Merck, Darmstadt, Germany) as described by Shono et al. (12). Purity was verified by TLC using authentic standards. Glucose 6-phosphate, glucose 6-phosphate dehydrogenase, NADP, NADPH, EDTA, dithiothreitol (DTT), and phenylmethylsulfonyl fluoride (PMSF) were purchased from Sigma (St. Louis, MO). Piperonyl butoxide (PBO) and 1-phenyl2-thiourea (PTU) were purchased from Aldrich (Milwaukee, WI). All other chemicals were procured from commercial suppliers. Insects The German cockroach strain (designated the Aves strain) characterized in this study was collected by vacuum (13) from a single-family home in Gainesville, Florida on 11 June 1998. The colony was initiated with approximately 200 individuals in various stages of development. The Aves strain was maintained in 8-liter glass jars with rolled cardboard for use as harborage, water, and no. 5001 laboratory rodent diet (PMI Feeds, St. Louis, MO). The Orlando strain is the standard insecticide-susceptible German cockroach strain and was used for comparison with the Aves strain in all assays (14). Bioassays Adult males were anesthetized with CO2 (15) and treated topically with cypermethrin in 1 ml of acetone. The cypermethrin solution was applied to the first abdominal sternite in five concentrations causing .0% and ,100% mortality. At least three replications containing 10 cockroaches per dose were conducted. PBO (100 mg per cockroach) or DEF (30 mg per cockroach) was applied to the first abdominal sternite 1 h before insecticide application (7). Mortality, the inability of a cockroach to right itself within 10 s after being flipped onto its dorsum, was recorded 24 h after insecticide treatment. Preparation of Microsomes Microsomes were prepared as described by Valles and Yu (16). Briefly, 10 to 15 adult males were decapitated and the content of the alimentary canal was removed to minimize detoxification enzyme inhibition (17). The tissues were recombined (less the head) and homogenized in 10 to 20 ml of 50 mM sodium phosphate buffer, pH 7, for in vitro cypermethrin assays or 50 mM sodium phosphate buffer, pH 7, containing 10% glycerol, 0.1 mM DTT, 1 mM EDTA, 1 mM PMSF, and 1 mM PTU for microsomal detoxification enzyme assays with surrogate substrates using a motor-driven Teflon pestle and glass mortar. The homogenate was filtered through two layers of cheesecloth and then centrifuged at 10,000gMax for 15 min. The supernatant was filtered through glass wool and further centrifuged at 105,000gMax for 1 h. The resulting pellet (microsomes) was rinsed and suspended in 50 mM sodium phosphate buffer, pH 7.0. The above procedures were performed at 0–48C. Enzyme Assays All enzyme reactions were conducted within linear ranges of incubation time and protein concentration determined previously (18). Microsomal epoxidase activity was measured by the epoxidation of aldrin to dieldrin (19). Microsomal O-dealkylase activity was measured using methoxyresorufin as substrate as described by Mayer et al. (20) and modified by Yu (21). NDemethylase activity was based on the Ndemethylation of p-chloro-N-methylaniline (PCMA) to p-chloroaniline (19, 22). Total cytochrome P450 was determined by the method of Omura and Sato (23). General esterase activity was measured with a-naphthyl acetate (a-NA) and p-nitrophenyl acetate (PNPA) as substrates. Microsomal and cytosolic subcellular fractions were used in the esterase assays and prepared from the entire cockroach (excluding the head). Gut contents were removed prior to homogenization of the tissues to minimize inhibition by digestive enzymes (17). Homogenization of tissues took place in 0.05 M sodium phosphate buffer, pH CYPERMETHRIN RESISTANCE IN GERMAN COCKROACH 7. The a-NA and PNPA esterase assays were conducted as described by Valles et al. (18) and Valles (5), respectively. Glutathione S-transferase activity was measured with 1-chloro-2,4-dinitrobenzene (CDNB) as substrate as described by Habig and Jakoby (24) and modified by Yu (25). Enzyme preparation was accomplished as described under Preparation of Microsomes. The 105,000gMax supernatant (soluble fraction) was used as the enzyme source. Homogenization and centrifugation took place in 0.1 M sodium phosphate buffer, pH 6.5. In vitro [14C]Cypermethrin Metabolism Qualitative and quantitative in vitro metabolism of cypermethrin were studied using a modified version of the method described by Korytko and Scott (26). Metabolism studies were conducted with the 105,000gMax supernatant (soluble fraction) and pellet (microsomes) derived from the fat body, midgut, integument, and whole body (excluding the head) of adult males of the insecticide-resistant and insecticide-susceptible German cockroach strains. The 2-ml reaction mixture contained 50 mM sodium phosphate buffer, pH 7, 0.5 mg of protein (0.125 mg of protein with midgut and fat body tissue sources), and 12,000 dpm (0.04 mg) of [14C]cypermethrin in 40 ml of ethylene glycol monomethyl ether. For oxidative metabolism, the reaction mixture was fortified with an NADPHgenerating system (1.8 mmol NADP, 18 mmol glucose 6-phosphate, and 1 unit of glucose 6phosphate dehydrogenase). Esterase activity was inhibited by adding DEF to the reaction mixture. When DEF was used, 20 ml of a 10 mM acetone solution was first added to a reaction vessel. After the acetone evaporated, radiolabeled cypermethrin was added, followed by buffer and the NADPH-generating system. Reactions were initiated by the addition of the enzyme source. Duplicate incubations were carried out at 288C in a shaking water bath for 30 min. In all instances, equivalent boiled enzyme source was used as a blank to correct for nonenzymatic cypermethrin degradation. Cypermethrin decomposition in 197 boiled controls averaged 18.8 6 7.5% (SD). The enzyme source was boiled in a water bath for 15 min before use. The reaction was terminated by the addition of 200 ml of 4 M HCl followed by plunging the reaction vessel in ice. Cypermethrin and its metabolites were extracted with 4 ml of diethyl ether with shaking for 15 min. The ether layer was transferred to a 15-ml tapered centrifuge tube. The entire extraction process was repeated four times. The combined ether extract was taken to dryness under a gentle stream of nitrogen. The interiors of the tubes were rinsed with 1 ml of acetone and again dried. Cypermethrin and its metabolites were dissolved in 100 ml of acetone and spotted onto silica gel 60 F254 TLC plates with a 250 mm thickness (Merck). The tubes were rinsed three times with 100 ml of additional acetone, which was also spotted onto the TLC plate. Cold cypermethrin, m-phenoxybenzyl alcohol, and 3-phenoxybenzoic acid were spotted alongside the unknowns. The plates were developed once in benzene:acetone (6:1), allowed to dry for 4 h, and then exposed to Biomax MR-2 film (Eastman Kodak, Rochester, NY) for 72 h at 2708C. Standards were located on the plate using short-wave UV light. Each discernable band indicated on the autoradiogram was scraped from the TLC plate, placed into a 20-ml scintillation vial with 10 ml of scintillation cocktail, and counted in a Packard Model 4530 (Downers Grove, IL) liquid scintillation counter with a 95% counting efficiency for 14C. A quench curve was established with a set of extended quenched standards from Packard Instrument Co. Polar metabolites with Rf values between 0 and 0.2 were combined. The remaining portion of the lane also was scraped and counted. Radioactivity in the aqueous fraction was also quantified by liquid scintillation counting. Mean percentage recovery for the cypermethrin metabolism experiments was 92.6 6 0.8%. Cypermethrin metabolism was calculated by subtracting the cypermethrin spot of the active sample from the boiled control. This difference was divided by the total amount of [14C] recovered for the experiment to determine the proportion of cypermethrin metabolized. Qualitative 198 VALLES, DONG, AND BRENNER comparisons for cypermethrin metabolism also were conducted for each sample. The percentages in Table 3 were derived by totaling all radioactivity from the TLC plate and that remaining in the aqueous fraction. Values for each TLC spot were first blank subtracted. The proportion of each spot was calculated based on the radioactivity recovered for that particular run. Protein determinations were made by the method of Bradford (27) using bovine serum albumin as the standard. All enzyme assays were conducted at least three times with duplicate determinations per replicate. in 5 ml of acetone in a scintillation vial and swirled for 15 s. This external extraction method was repeated and the acetone extracts were allowed to dry overnight. Scintillation cocktail was added to both vials and counted by liquid scintillation counting. The sum of these values was used as the amount of cypermethrin not penetrating the cuticle. Statistics Bioassay data were analyzed by probit analysis (32). Enzyme activities were compared with the Orlando insecticide-susceptible strain by Student’s t test. Detection of kdr- and super-kdr Mutations For detection of kdr- and super-kdr mutations, a method described in Dong et al. (9) was used. Briefly, 50 cockroaches pretreated with PBO and DEF (100 mg and 30 mg/cockroach, respectively) were placed in a 1-pint jar coated with 300 mg of cypermethrin. Five cockroaches that were knocked down last in the residue bioassay were collected for sequence analysis. Total RNA was isolated from heads and thoraces of these 5 individuals. First-strand cDNA was synthesized using a primer that anneals to the 38 end of the para gene (aatcaagcgaagatgtga). A pair of para primers, primer 1 (gatgacgaggtccaacagtta) and primer 2 (cttgttggtttcattgtc), were then used in polymerase chain reaction (PCR) to amplify a 0.9-kb para fragment, in which kdr and super-kdr mutations should reside (8, 28–30). The PCR product was sequenced using primer 2. In vivo Penetration Cuticular cypermethrin penetration was measured by a method modified from Argentine et al. (31). A sublethal dose of [14C]cypermethrin (3200 dpm, 10.6 ng) was applied to the first abdominal sternite in 1 ml of acetone. The cockroaches were briefly fanned to evaporate the acetone, then placed in 20-ml glass scintillation vials (two cockroaches per vial) for 0, 1, 2, 4, 8, and 24 h. After the specified time period, two cockroaches were removed from their holding vial with featherweight forceps and submerged RESULTS Topical bioassay results (Table 1) indicated that the Aves German cockroach strain was 93fold resistant to cypermethrin compared with the Orlando insecticide-susceptible strain. Topical application of PBO and DEF 1 h before insecticide treatment reduced the resistance level to 29- and 18-fold, respectively. Microsomal oxidase activities (aldrin epoxidase, methoxyresorufin O-demethylase, and pchloro-N-methylaniline [PCMA] N-demethylase) were 2.4- to 3.8-fold greater in the Aves German cockroach strain than in the insecticidesusceptible Orlando strain (Table 2). Cytochrome P450 content was 4.2-fold higher in the Aves German cockroaches than in the Orlando insecticide-susceptible strain. Significantly higher activities were also noted for microsomal and cytosolic general esterases with a-naphthyl acetate and p-nitrophenyl acetate substrates. Glutathione S-transferase activity with CDNB substrate was 2.6-fold higher in the Aves strain than in the Orlando insecticide-susceptible strain. Qualitatively, [14C]cypermethrin metabolism was similar between the Aves and the Orlando strains when the soluble fraction (cytosol) and microsomes (without an NADPH source) were used as enzyme sources (Table 3, Fig. 1). However, qualitative differences were noted for the microsomes when in the presence of an NADPH 199 CYPERMETHRIN RESISTANCE IN GERMAN COCKROACH TABLE 1 Lethal Dose Values for Cypermethrin in the Presence and Absence of Synergists for Insecticide-Resistant (Aves) and Insecticide-Susceptible (Orlando) German Cockroach Strains Strain Synergista n Orlando Aves Orlando Aves Orlando Aves — — PBO PBO DEF DEF 150 160 150 120 120 150 a b c d Slope 6 SE x2b 6 6 6 6 6 6 2.1 1.2 6.8 1.1 0.1 3.6 5.0 3.0 4.4 2.0 4.0 2.0 0.8 0.7 1.0 0.4 0.7 0.4 LD50 (95% FL)c 0.90 83.54 0.16 4.68 0.51 9.01 (0.79–0.99) (72.27–97.92) (0.10–0.24) (3.47–6.41) (0.44–0.64) (6.24–11.61) LD90 (95% FL)c RRd 2.3 (1.77–4.14) 252.3 (178.2–554.6) 0.38 (0.24–4.67) 31.5 (18.20–95.32) 1.33 (0.96–2.44) 61.0 (36.05–206.24) — 92.8 — 29.3 — 17.7 PBO, piperonyl butoxide (100 mg/cockroach); DEF, S,S,S-tributyl phosphorotrithioate (30 mg/cockroach). Pearson’s x2 goodness of fit test. All P values are .0.05, indicating goodness of fit. Micrograms of cypermethrin per gram of cockroach body weight. RR, resistance ratio at the 50% lethal dose value (LD50 Aves/LD50 Orlando). source and 100 mM DEF. The most notable difference was the production of a compound having the same Rf as phenoxybenzyl alcohol (Rf 5 0.29) by the Orlando insecticide-susceptible strain and not by the Aves strain. Conversely, the unidentified metabolite at Rf 0.34 was produced by the Aves strain but not by the Orlando insecticide-susceptible strain. Regardless of enzyme source or strain, the major metabolites produced were of a polar nature, as evidenced by little movement from the origin (Fig. 1). Significant quantitative differences in [14C]cypermethrin metabolism were observed in the Aves strain compared with the Orlando insecticide-susceptible strain for microsomes derived from whole cockroach bodies in the TABLE 2 Detoxification Enzyme Activities toward Surrogate Substrates in Insecticide-Resistant (Aves) and InsecticideSusceptible (Orlando) German Cockroach Strains Specific activity (nmol/min/mg protein) 6SEM Detoxification enzyme Orlando Cytochrome P450a Aldrin epoxidase MRR O-demethylase PCMA N-demethylase 0.092 0.15 0.20 3.33 Microsomal oxidase 6 0.028 6 0.02 6 0.02 6 0.14 a-NA esterase (SF) a-NA esterase (MC) PNPA esterase (SF) PNPA esterase (MC) 288.4 330.5 266.3 111.6 6 6 6 6 CDNB conjugation a Esteraseb 13.8 16.7 7.5 12.4 Glutathione S-transferase 1125.5 6 100.4 Aves 0.39 6 0.02*c 0.37 6 0.04* 0.76 6 0.12* 8.14 6 0.54* 498.5 513.1 444.3 402.6 6 6 6 6 8.2* 10.8* 15.4* 37.4* 2885.8 6 144.4* R/Sd 4.2 2.5 3.8 2.4 1.7 1.6 1.7 3.6 2.6 nmol/mg protein. Esterase activity measured with a-naphthyl acetate (a-NA) or p-nitrophenyl acetate (PNPA) as substrates using soluble fraction (SF) or microsomal (MC) subcellular fractions as enzyme sources. c Asterisk indicates significant difference from the Orlando strain (P , 0.05) by Student’s t test. d Aves (R) value/Orlando (S) value. b 200 VALLES, DONG, AND BRENNER TABLE 3 Percentage Distribution of [14C]Cypermethrin Metabolites from Various Tissue Preparations of Insecticide-Resistant (Aves) and Insecticide-Susceptible (Orlando) German Cockroach Strains Distribution of radioactivity (% 6SEM) Microsomes (2NADPH) Soluble fraction R fa 0.64 0.52 0.44 0.38 0.34 0.29 Originb Aqueousc Remainingd a b c d Orlando 55.0 6 0 0 4.8 6 0 1.5 6 35.2 6 0.7 6 3.0 6 1.9 1.1 0.5 1.8 0.3 1.6 Aves 55.3 6 0 0 2.9 6 0 1.6 6 37.5 6 1.4 6 1.4 6 Orlando 0.9 0.2 0.1 0.9 0.1 0.1 70.7 6 0 0 0 1.8 6 0 22.1 6 2.8 6 2.6 6 0.8 0.1 0.1 1.0 0.5 Microsomes (1NADPH, 1DEF) Aves 59.9 6 0 0 0 2.0 6 0 34.0 6 2.5 6 1.8 6 0.5 0.1 0.5 0.7 0.3 Orlando Aves 77.8 6 0.7 1.5 6 0.1 4.1 6 0.3 0 0 2.0 6 0.1 10.6 6 0.2 3.3 6 0.6 0.8 6 0.1 69.0 6 1.1 1.3 6 0.1 8.1 6 0.6 0 2.6 6 0.2 0 14.4 6 0.3 3.6 6 0.4 1.0 6 0.2 Rf : 0.64 5 cypermethrin; 0.29 5 m-phenoxybenzyl alcohol; 0.23-phenoxybenzoic acid. Includes TLC scraping of plate area of Rf values 0 to 0.2. Radioactivity remaining in the aqueous fraction. Radioactivity remaining on the TLC plate after visible spots indicated on the autoradiogram were removed. presence and absence of an NADPH source (Table 4). No significant differences in [14C]cypermethrin metabolism were observed in Aves and Orlando strains with whole-body soluble fraction (cytosol), whole-body microsomes in the presence of the esterase inhibitor DEF, or fat body microsomes. To examine whether target-site insensitivity was a contributing resistance mechanism in the Aves strain, we amplified and sequenced a PCR FIG. 1. Autoradiogram of TLC separation of [14C]cypermethrin and metabolites produced by (A) soluble fraction, (B) microsomes without an NADPH source, and (C) microsomes fortified with NADPH in the presence of 100 mM DEF. Rf values: 0.64, cypermethrin; 0.52, 0.44, 0.38, and 0.34, unknowns; 0.29, m-phenoxybenzyl alcohol. (*) Polar metabolites (Rf values 0 to 0.2) were unidentified and combined for quantification purposes (see Table 3). 201 CYPERMETHRIN RESISTANCE IN GERMAN COCKROACH TABLE 4 Percentage of [14C]Cypermethrin Metabolized in Vitro by Insecticide-Resistant (Aves) and Insecticide-Susceptible (Orlando) German Cockroach Strains Tissueb Strain Cofactor Synergist/ inhibitora Orlando Aves Orlando Aves Orlando Aves Orlando Aves Orlando Aves Orlando Aves Orlando Aves — — NADPH NADPH — — — — — — — — — — — — DEF DEF — — DEF DEF — — — — — — Subcellular fraction Source Quantity (mg) Soluble Fraction Soluble Fraction Microsomes Microsomes Microsomes Microsomes Microsomes Microsomes Microsomes Microsomes Microsomes Microsomes Microsomes Microsomes Whole body Whole body Whole body Whole body Whole body Whole body Whole body Whole body Midgut Midgut Fat body Fat body Integument Integument 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.125 0.125 0.125 0.125 0.5 0.5 % Cypermethrin metabolized/30 min (6SE)c 35.8 34.8 11.6 21.8 13.8 30.4 3.8 2.1 44.9 58.4 20.2 24.5 11.2 28.9 6 6 6 6 6 6 6 6 6 6 6 6 6 6 1.4 1.8 1.8 1.9* 2.0 4.5* 1.5 1.2 1.7 0.1* 1.7 2.8 0.9 1.7* a DEF, S,S,S-tributylphosphorotrithioate (0.1 mM ). Whole body, entire cockroach (without the head) used as the tissue source. c Mean percentage recovery was 92.6 6 0.8%; values followed by an asterisk are significantly different (P , 0.05) from the Orlando strain by Student’s t test. b fragment of 0.9 kb that encodes the IIS4–IIS6 region of the Para sodium channel protein. Sequence comparison revealed the Leu993Phe kdr mutation in this strain. However, the second mutation (Met918Thr) associated with the house fly super-kdr was not detected in Aves cockroaches. Radioactivity recovered from external rinses of adult males from the Aves strain was significantly greater at 4, 8, and 24 h than with the Orlando strain (Fig. 2). In addition, adult males of the Aves strain were significantly heavier than those of Orlando. Aves adult males had a mean weight of 57.7 6 0.6 mg per male which was 21.7% heavier than Orlando adult males at 47.4 6 0.6 mg per male. DISCUSSION Topical bioassay data revealed that the Aves strain was highly resistant to cypermethrin, exhibiting a resistance ratio of 93-fold. The cypermethrin resistance level was reduced to 29fold when cockroaches were pretreated with PBO (a cytochrome P450 monooxygenase inhibitor) and reduced to 18-fold when pretreated with DEF (an esterase inhibitor). The synergist data implicated enhanced oxidative and hydrolytic metabolism as resistance mechanisms in the Aves German cockroach strain. This conclusion was further supported by significantly higher oxidative and hydrolytic detoxification enzyme activities toward surrogate substrates in the Aves strain than in the Orlando strain (Table 2). However, the most compelling data substantiating enhanced metabolism as a resistance mechanism in the Aves strain was significantly higher in vitro [14C]cypermethrin metabolism. When using microsomes derived from whole cockroach bodies, NADPH-dependent and NADPH-independent metabolism were significantly greater in the Aves strain than in the Orlando strain. Based on these data, enhanced cypermethrin metabolism catalyzed by cytochromes P450 and microsomal esterases can be considered a major mechanism of cypermethrin 202 VALLES, DONG, AND BRENNER FIG. 2. Radioactivity from external cuticular acetone washes after topical treatment of insecticide-resistant (Aves, C) and insecticide-susceptible (Orlando, ●) German cockroaches with [14C]cypermethrin. Significant differences (Student’s t test, P , 0.05) between strains are indicated by an asterisk. resistance in the Aves strain. However, additional factors are suggested, based on the inability of PBO or DEF to completely eliminate cypermethrin resistance. Once it was determined that microsomal esterases were an important resistance mechanism in the Aves strain, several additional in vitro metabolism experiments were conducted to further characterize this enzyme(s). The cypermethrin hydrolyzing enzymes were susceptible to DEF (100 mM), which reduced cypermethrin metabolism to 3.8 and 2.1% in the Orlando and Aves strains, respectively (Table 4). An examination of different tissue sources revealed that the microsomal esterase(s) responsible for increased cypermethrin metabolism in the Aves strain was found in the midgut and integument, with the greatest quantities apparently localized in the latter (Table 4). Although fat body is an important source of detoxification enzymes in insects, no significant differences in cypermethrin metabolism were observed in strains with fat body-derived microsomal esterases. Interestingly, enhanced cypermethrin detoxification catalyzed by microsomal esterases was observed in the Marietta (7) and Union 511 (5) cypermethrin-resistant German cockroach strains, indicating that this may be a common resistance mechanism among German cockroaches (data not shown). This report is the first to identify a microsomal esterase as a resistance mechanism in the German cockroach. In fact, reports describing microsomal esterase-based insecticide resistance mechanisms in insects are sparse. Kao et al. (33) characterized a microsomal esterase partially responsible for malathion resistance in the house fly. They showed that the Hirokawa strain exhibited a fivefold increase in microsomal carboxylesterase activity as compared with an insecticide-susceptible strain. In addition, insecticide-metabolizing esterases have been identified and purified from mouse (34) and rat (35) liver microsomes, attesting to the significance of membrane-bound hydrolytic detoxification enzymes. Interestingly, despite significantly higher cytosolic general esterase activity toward anaphthyl acetate and PNPA substrates in the Aves strain, no significant difference in cypermethrin metabolism by the cytosolic fraction was observed in the Orlando and Aves strains. Elevated cytosolic general esterase activity has been frequently reported in insecticide-resistant German cockroaches (7, 36–38). Typically, it has been assumed that higher cytosolic general esterase activity toward surrogate substrates in resistant strains indicated concomitant increases in hydrolytic insecticide metabolism or sequestration. Indeed, significantly higher rates of hydrolysis toward a-naphthyl acetate and PNPA by microsomal esterases were associated with CYPERMETHRIN RESISTANCE IN GERMAN COCKROACH correspondingly higher in vitro cypermethrin detoxification in the Aves strain. Conversely, cypermethrin metabolism by cytosol was similar between strains despite higher specific activities toward surrogate substrates in the Aves strain. However, insecticide sequestration by esterases has been reported to be a major resistance mechanism in several German cockroach strains (37, 38). Perhaps the enzyme(s) responsible for elevated cytosolic general esterase activity in the Aves strain serves in a sequestering capacity. Qualitative examination of cypermethrin metabolism revealed that the major metabolites for all enzyme systems examined in vitro were relatively polar (Fig. 2, Table 3). No qualitative differences were observed in the Orlando and Aves strains when metabolism occurred with cytosolic or microsomal (without an NADPH source) enzyme sources. However, the strains differed by a single metabolite band when NADPH-fortified microsomes were used as the enzyme source. Scharf et al. (39) reported that an overexpressed cytochrome P450 isoform was present in the crossresistant Munsyana German cockroach strain. After protein purification methods, Scharf et al. (39) identified a cytochrome P450 isoform that was not expressed constitutively in the insecticide-susceptible (Johnson Wax) strain, indicating that isoform differences are possible within resistant German cockroaches. Target-site insensitivity (kdr-type) may also play an important role in cypermethrin resistance in the Aves strain. The G to C substitution at nt 2979 of the sodium channel protein ( para gene) resulting in a leucine to phenylalanine mutation was found in the Aves strain (8). Although the para mutation has been found in this and additional pyrethroid-resistant German cockroach strains (9), the level of resistance conferred by the mutation is still unclear. Decreased cypermethrin penetration also appears to be an important resistance mechanism in the Aves strain. Based on external washes over a 24-h period, significantly more radioactivity was recovered from the Aves strain than from the Orlando strain at 4, 8, and 24 h. These data suggest slower cuticular penetration in Aves 203 German cockroaches. Decreased insecticide penetration has been reported to be an important resistance mechanism in the German cockroach toward fenvalerate (40), permethrin (3, 10), propoxur (11), and carbaryl (41). Despite possessing multiple insecticide-resistance mechanisms (enhanced detoxification, decreased penetration, and perhaps target-site insensitivity), the Aves German cockroach strain exhibits comparatively lower levels of insecticide resistance. Unlike insect pests within orders such as Diptera and Lepidoptera, which often exhibit resistance ratios in excess of 1000-fold or greater, the German cockroach rarely exceeds insecticide resistance levels of 200- to 300-fold. Furthermore, despite the low levels of insecticide resistance exhibited by the German cockroach, multiple mechanisms are nearly always attributed to the resistance. Perhaps, the fact that the German cockroach has taken an evolutionary strategy of generalization can explain this apparent discrepancy. For example, although the resistance level to any single insecticide or insecticide class may be comparatively low, extensive crossresistance to other insecticides is common. ACKNOWLEDGMENTS We thank Drs. S. J. Yu (University of Florida) and P. E. A. Teal and J. Becnel (USDA-ARS) for critical reviews of the manuscript and C. A. Strong and Dr. Zhiqi Liu for technical assistance. We also thank Zeneca Agrochemicals for providing the radiolabeled cypermethrin. REFERENCES 1. R. J. Brenner, Economics and medical importance of German cockroaches, in “Understanding and Controlling the German Cockroach” (M. K. Rust, J. M. Owens, and D. A. Reierson, Eds.), pp. 77–92, Oxford Univ. Press, New York, 1995. 2. J. Roberts, Cockroaches linked with asthma, Br. Med. J. 312, 1630 (1996). 3. D. D. Anspaugh, R. L. Rose, P. G. Koehler, E. Hodgson, and R. M. Roe, Multiple mechanisms of pyrethroid resistance in the German cockroach, Blattella germanica (L.), Pestic. Biochem. Physiol. 50, 138 (1994). 4. J. Hemingway, S. J. Dunbar, A. G. Monro, and G. J. Small, Pyrethroid resistance in German cockroaches (Dicyoptera: Blattellidae): Resistance levels and underlying mechanisms, J. Econ. Entomol. 86, 1631 (1993). 5. S. M. Valles, Toxicological and biochemical studies 204 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. VALLES, DONG, AND BRENNER with field populations of the German cockroach, Blattella germanica, Pestic. Biochem. Physiol. 62, 190 (1998). D. G. Cochran, Prevalence of the cypermethrin resistance gene in field-collected populations of the German cockroach, Res. Pest Manag. 10, 18 (1999). S. M. Valles and S. J. Yu, Detection and biochemical characterization of insecticide resistance in the German cockroach (Dictyoptera: Blattellidae), J. Econ. Entomol. 89, 21 (1996). K. Dong, A single amino acid change in the para sodium channel protein is associated with knockdown-resistance (kdr) to pyrethroid insecticides in German cockroach, Insect Biochem. Mol. Biol. 27, 93 (1997). K. Dong, S. M. Valles, M. E. Schart, B. Zeichner, and G. W. Bennett, Knockdown resistance (kdr) mutation in pyrethroid-resistant German cockroaches, Pestic. Biochem. Physiol. 60, 195(1998). D. L. Bull and R. S. Patterson, Characterization of pyrethroid resistance in a strain of the German cockroach (Dictyoptera: Blattellidae), J. Econ. Entomol. 86, 20 (1993). B. D. Siegfried and J. G. Scott, Mechanisms responsible for propoxur resistance in the German cockroach, Blattella germanica (L.), Pestic. Sci. 33, 133 (1991). T. Shono, K. Oshawa, and J. E. Casida, Metabolism of trans- and cis-cypermethrin, and decamethrin by microsomal enzymes, J. Agric. Food Chem. 27, 316 (1979). S. M. Valles, A vacuum-assisted apparatus for collection of live German cockroaches (Dictyoptera: Blattellidae) from the field, J. Entomol. Sci. 32, 416 (1997). P. G. Koehler and R. S. Patterson, A comparison of insecticide susceptibility in seven nonresistant strains of the German cockroach, Blattella germanica (Dictyoptera: Blattellidae), J. Med. Entomol. 23, 298 (1986). S. M. Valles and P. G. Koehler, Influence of carbon dioxide anesthesia on chlorpyrifos toxicity in the German cockroach (Dictyoptera: Blattellidae), J. Econ. Entomol. 87, 709 (1994). S. M. Valles and S. J. Yu, Tissue localization, induction, and developmental expression of cytochrome P450 monooxygenases in the German cockroach, Pestic. Biochem. Physiol. 54, 31 (1996). S. M. Valles and S. J. Yu, German cockroach (Dictyoptera: Blattellidae) gut contents inhibit cytochrome P450 monooxygenases, J. Econ. Entomol. 89, 1508 (1996). S. M. Valles, S. J. Yu, and P. G. Koehler, Detoxifying enzymes in adults and nymphs of the German cockroach: Evidence for different microsomal monooxygenase systems, Pestic. Biochem. Physiol. 49, 183 (1994). S. J. Yu, Induction of microsomal oxidases by host plants in the fall armyworm, Spodoptera frugiperda (J.E. Smith), Pestic. Biochem. Physiol. 17, 59 (1982). R. T. Mayer, J. W. Jermyn, M. D. Burke, and R. A. Prough, Methoxyresorufin as a substrate for the fluorometric assay of insect microsomal O-dealkylases, Pestic. Biochem. Physiol. 7, 349 (1977). S. J. Yu, Insecticide resistance in the fall armyworm, 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. Spodoptera frugiperda, Pestic. Biochem. Physiol. 30, 84 (1991). D. Kupfer and L. L. Bruggeman, Determination of enzymic demethylation of p-chloro-N-methylaniline: Assay of aniline and p-chloroaniline, Anal. Biochem. 17, 502 (1966). T. Omura and R. Sato, The carbon monoxide-binding pigment of liver microsomes, J. Biol. Chem. 239, 2379 (1964). W. H. Habig and W. B. Jakoby, Assays for differentiation of glutathione S-transferases, Methods Enzymol. 77, 398 (1981). S. J. Yu, Interactions of allelochemicals with detoxication enzymes of insecticide-susceptible and resistant fall armyworms, Pestic. Biochem. Physiol. 22, 60 (1984). P. J. Korytko and J. G. Scott, CYP6D1 protects thoracic ganglia of houseflies from the neurotoxic insecticide cypermethrin, Arch. Insect Biochem. Physiol. 37, 57 (1998). M. M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72, 248 (1976). M. Miyasaki, K. Ohyama, D. Y. Dunlap, and F. Matsumura, Cloning and sequencing of the para-type sodium channel gene from susceptible and kdr-resistant German cockroaches (Blattella germanica) and house fly (Musca domestica), Mol. Gen. Genet. 252, 61 (1996). M. S. Williamson, D. Martinez-Torres, C. A. Hick, and A. L. Devonshire, Identification of mutations in the housefly para-type sodium channel gene associated with knockdown resistance (kdr) to pyrethroid insecticides, Mol. Gen. Genet. 252, 51 (1996). T. J. Smith, S. H. Lee, P. J. Ingles, D. C. Knipple, and D. M. Soderland, The L1014F point mutation in the house fly Vsscl sodium channel confers knockdown resistance to pyrethroids, Insect Biochem. Mol. Biol. 27, 807 (1997). J. Argentine, K. Y. Zhu, S. H. Lee, and J. M. Clark, Biochemical mechanisms of Azinphosmethyl resistance in isogenic strains of Colorado potato beetle, Pestic. Biochem. Physiol. 48, 63 (1994). SAS Institute, “SAS Procedures Guide for Personal Computers,” SAS Institute, Cary, NC, 1988. L. R. Kao, N. Motoyama, and W. C. Dauterman, Studies on hydrolases in various house fly strains and their role in malathion resistance, Pestic. Biochem. Physiol. 22, 86 (1984). Y. S. Huang, L. Woods, and L. G. Sultatos, Solubilization and purification of A-esterase from mouse hepatic microsomes, Biochem. Pharmacol. 48, 1273 (1994). T. Suzuki and J. Miyamoto, Purification and properties of pyrethroid carboxyesterase in rat liver microsomes, Pestic. Biochem. Physiol. 8, 186 (1978). B. D. Siegfried and J. G. Scott, Biochemical characterization of hydrolytic and oxidative enzymes in insecticide resistant and susceptible strains of the German CYPERMETHRIN RESISTANCE IN GERMAN COCKROACH cockroach (Dictyoptera: Blattellidae), J. Econ. Entomol. 85, 1092 (1992). 37. S. K. Prabhakaran and S. T. Kamble, Purification and characterization of an esterase isozyme from insecticide resistant and susceptible strains of German cockroach, Blattella germanica (L.), Insect Biochem. Mol. Biol. 25, 519 (1995). 38. M. E. Scharf, J. Hemingway, G. J. Small, and G. W. Bennett, Examination of esterases from insecticide resistant and susceptible strains of the German cockroach, Blattella germanica (L.), Insect Biochem. Mol. Biol. 27, 489 (1997). 205 39. M. E. Scharf, J. J. Neal, C. B. Marcus, and G. W. Bennett, Cytochrome P450 purification and immunological detection in an insecticide resistant strain of German cockroach (Blattella germanica, L.), Insect Biochem. Mol. Biol. 28, 1 (1998). 40. D. Wu, M. E. Scharf, J. J. Neal, D. R. Suiter, and G. W. Bennett, Mechanisms of fenvalerate resistance in the German cockroach, Blattella germanica (L.), Pestic. Biochem. Physiol. 61, 53 (1998). 41. T. Y. Ku and J. L. Bishop, Penetration, excretion, and metabolism of carbaryl in susceptible and resistant German cockroaches, J. Econ. Entomol. 60, 1328 (1967).