ORIGINAL RESEARCH The Microbiome Activates CD4 T-cell–mediated Immunity to Compensate for Increased Intestinal Permeability Karen L. Edelblum,1,2 Gil Sharon,3 Gurminder Singh,2,4 Matthew A. Odenwald,2 Anne Sailer,2 Severine Cao,2 Sarina Ravens,5 Irene Thomsen,5 Kamal El Bissati,6,7 Rima McLeod,6,7 Chen Dong,8 Sandeep Gurbuxani,2 Immo Prinz,5 Sarkis K. Mazmanian,3 and Jerrold R. Turner2,4 1 Department of Pathology and Laboratory Medicine, Rutgers New Jersey Medical School, Newark, New Jersey; Departments of Pathology, 6Ophthalmology and Visual Sciences, and 7Pediatrics, University of Chicago, Chicago, Illinois; 3 Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, California; 5Institute of Immunology, Hannover Medical School, Hannover, Germany; 8Institute for Immunology, Tsinghua University, Beijing, China; and 4Departments of Pathology and Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts 2 SUMMARY Despite common perceptions, studies of human subjects and experimental animals show that intestinal barrier loss is insufficient to induce disease in healthy individuals. Here we define a compensatory immune response that prevents pathogen invasion in mice with chronic barrier loss. BACKGROUND & AIMS: Despite a prominent association, chronic intestinal barrier loss is insufficient to induce disease in human subjects or experimental animals. We hypothesized that compensatory mucosal immune activation might protect individuals with increased intestinal permeability from disease. We used a model in which intestinal barrier loss is triggered by intestinal epithelial-specific expression of constitutively active myosin light chain kinase (CA-MLCK). Here we asked whether constitutive tight junction barrier loss impacts susceptibility to enteric pathogens. METHODS: Acute or chronic Toxoplasma gondii or Salmonella typhimurium infection was assessed in CA-MLCK transgenic or wild-type mice. Germ-free mice or those lacking specific immune cell populations were used to investigate the effect of microbial-activated immunity on pathogen translocation in the context of increased intestinal permeability. RESULTS: Acute T gondii and S typhimurium translocation across the epithelial barrier was reduced in CA-MLCK mice. This protection was due to enhanced mucosal immune activation that required CD4þ T cells and interleukin 17A but not immunoglobulin A. The protective mucosal immune activation in CA-MLCK mice depended on segmented filamentous bacteria (SFB), because protection against early S typhimurium invasion was lost in germ-free CA-MLCK mice but could be restored by conventionalization with SFBcontaining, not SFB-deficient, microbiota. In contrast, chronic S typhimurium infection was more severe in CA-MLCK mice, suggesting that despite activation of protective mucosal immunity, barrier defects ultimately result in enhanced disease progression. CONCLUSIONS: Increased epithelial tight junction permeability synergizes with commensal bacteria to promote intestinal CD4þ T-cell expansion and interleukin 17A production that limits 286 Edelblum et al enteric pathogen invasion. (Cell Mol Gastroenterol Hepatol 2017;4:285–297; http://dx.doi.org/10.1016/j.jcmgh.2017.06.001) Keywords: Barrier Function; Tight Junction; Microbiota; CD4 T Cell; Mucosal Immunity; Salmonella. T he intestinal epithelium supports nutrient absorption and secretion but also serves as a selectively permeable barrier that separates the mucosal immune system from the intestinal lumen.1–3 The association of many inflammatory bowel disease risk alleles with mucosal immunity and bacterial recognition4 suggests that intact epithelial barrier, which limits microbial contact with the immune system, may prevent a severe inflammatory response in susceptible individuals. Consistent with this idea, intestinal barrier function is compromised in Crohn’s disease and has been identified as a marker of impending disease reactivation.5,6 Nevertheless, modest barrier loss is present in a subset of healthy first-degree relatives of Crohn’s disease patients and has been associated with specific polymorphisms of the muramyl dipeptide receptor NOD2.7,8 These human data correlate with results from rodent models showing that epithelial barrier dysfunction alone is not sufficient to initiate disease.9–11 The mechanisms that prevent disease in individuals with increased intestinal permeability are poorly understood. Although mouse models can be useful in dissecting these processes, most display far greater intestinal permeability increases than those seen in healthy individuals with modest barrier loss7,12,13 and use mechanisms that may not be relevant to human disease. We have focused on myosin light chain kinase, which is well-recognized as a physiologically and pathophysiologically relevant regulator of tight junctions and the intestinal barrier.3,14 Transgenic mice that express constitutively active myosin light chain kinase (CA-MLCK)14–16 within the intestinal epithelium exhibit targeted increases in intestinal tight junction permeability,9 but, unlike most other rodent models, they do not display evidence of epithelial damage such as increased epithelial proliferation and migration.9–11 Therefore, CA-MLCK mice provide an exquisitely targeted model of increased intestinal tight junction permeability that is not associated with epithelial damage but is quantitatively and qualitatively similar to barrier defects observed in healthy Crohn’s disease relatives. It is now widely recognized that the intestinal microbiota shape mucosal immunity through mechanisms including stimulation of innate immune cells by commensal-derived products and induction of T-cell polarization.17,18 These data indicate the presence of a continuous feedback loop in which commensal bacteria “instruct” host immunity to induce tolerance to the local microenvironment or, alternatively, serve as a rheostat to modulate pathogen clearance or autoimmunity. In addition to the epithelial barrier, several mechanisms have evolved to limit pathogen invasion,19 including the synthesis of antimicrobial immunoglobulin (Ig) A and IgG by plasma cells in the lamina propria (LP) that is in turn transported across the epithelium into the intestinal lumen.20 Cellular and Molecular Gastroenterology and Hepatology Vol. 4, No. 2 Increased intestinal permeability is not sufficient to promote spontaneous disease.9–11,21,22 However, constitutive barrier loss in CA-MLCK mice does induce subclinical immune activation and increased susceptibility to experimental immune-mediated colitis.9 Notably, the barrier loss in these mice is due to selective effects on tight junction permeability and is insufficient to trigger epithelial damage.9,23 We hypothesized that the barrier defects resulting from CA-MLCK expression would render these mice more susceptible to enteric infection. Surprisingly, our data show that CA-MLCK mice are protected against early pathogen invasion. This protection depended on adaptive immunity via LP CD4þ T-cell expansion, interleukin 17A (IL17A) production, and enhanced neutrophil recruitment in infected CA-MLCK mice relative to infected wild-type (WT) mice. Protection was abrogated in germ-free CA-MLCK mice, indicating that commensal microbes promote a mild Th17 response that limits early pathogen translocation. Although increased tight junction permeability protected against acute bacterial invasion, CAMLCK mice did develop more severe intestinal and systemic disease during chronic infection. These data provide new insight into the mechanisms that mucosal immunity adapts to physiological-range epithelial barrier defects and how this compensation eventually fails in the context of chronic inflammatory disease. Materials and Methods Animals Mice were 8–12 weeks of age, maintained on a C57BL/6 background, and housed under specific pathogen–free (SPF) conditions. WT, Rag1 KO, and Tcrd KO mice were obtained from the Jackson Laboratories, Bar Harbor, ME. In our colony, all mice were colonized with segmented filamentous bacteria (SFB). CA-MLCK mice9 were crossed to TcrdH2BeGFP (TcrdEGFP),24 IL17A KO,25 or IghA KO26 mice (provided by Dennis Metzger, Albany Medical College, Albany, NY). Germ-free (GF) transgenic CA-MLCK mice were produced by rederivation of SPF C57BL/6J females mated with SPF CA-MLCK males. Briefly, uteri from donor mothers were removed on E19.5 by cesarean section and transferred into a GF isolator in aseptic Virkon solution (DuPont, Parlin, NJ). Offspring were then extracted from the uterus and reared by a GF foster Swiss-Webster mother. Healthy offspring were genotyped, and males harboring the transgene were subsequently used for breeding with GF C57BL/6J females. Abbreviations used in this paper: CA-MLCK, constitutively active myosin light chain kinase; CFU, colony-forming unit; GF, germ-free; Ig, immunoglobulin; IL, interleukin; LP, lamina propria; SEM, standard error of the mean; SFB, segmented filamentous bacteria; SPF, specific pathogen–free; WT, wild-type. Most current article © 2017 The Authors. Published by Elsevier Inc. on behalf of the AGA Institute. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 2352-345X http://dx.doi.org/10.1016/j.jcmgh.2017.06.001 September 2017 For colonization experiments, littermate WT and CA-MLCK mice were removed from the GF isolator at 3–4 weeks of age and gavaged with 100 mL cecal contents from C57BL/6NTac (Taconic Farms, Hudson, NY) or C57BL/6J mice (Jackson Laboratories). Cecal contents were resuspended in sodium bicarbonate solution under anaerobic conditions (1:2 v/v). Salmonella typhimurium exposure and tissue sampling were performed 4 weeks after colonization on age-matched GF and conventionalized mice. All studies were conducted in an Association of the Assessment and Accreditation of Laboratory Animal Care (AALAC)– accredited facility according to protocols approved by Rutgers New Jersey Medical School, the University of Chicago, and the California Institute of Technology Institutional Animal Care and Use Committees. Pathogen Infection DsRed-labeled S typhimurium strain SL3201 were provided by Andrew Neish, Emory University, Atlanta, GA. Mice were anesthetized by intraperitoneal injection of ketamine/ xylazine, a 3- to 4-cm loop of jejunum or ileum was exposed, and the luminal surface of the intestine was exposed as described previously.27 For 30 minutes 108 colony-forming units (CFUs) DsRed-SL3201 were applied directly to the exposed luminal surface, after which mice were killed, and the loop of intestine was fixed for analysis by fluorescence microscopy as previously described.28 Systemic infection of S typhimurium was assessed by oral gavage with 108 CFUs DsRed-SL3201 after 24 hours of pretreatment with 100 mg/mL streptomycin. Mice were killed 9 days after infection on the basis of the severity of clinical scores or if an individual mouse lost more than 20% of its initial body weight. Organs were harvested and either fixed in 10% neutral buffered formalin or embedded in optimal cutting temperature (OCT; Sakura, Torrance, CA) medium for further immunohistochemical analysis. Clinical scores were determined on the basis of fur texture, posture, and activity on a scale of 0–2 each, with a potential combined score of 6. Histologic scores of colitis were determined on a scale of 0–2 on the basis of the following criteria: crypt dilation and elongation, presence of crypt abscesses, extent of epithelial erosion, and regeneration as well as the number of apoptotic cells and goblet cells, with a potential combined score of 14. Histologic scores of the spleen were determined on a scale of 0–3 on the basis of the immune cell infiltrate and the presence of neutrophils. The ME49 strain of Toxoplasma gondii was maintained as tachyzoites by serial passage in human foreskin fibroblasts as previously described.29 The 10- to 12-week-old female HLA-B*0702 transgenic mice29 were infected intraperitoneally with 1  104 ME49 type II tachyzoites. Tissue cysts were isolated from the brains of these mice 22 days after infection and quantified.30 Mice were gavaged with 10 cysts in 100 mL sterile phosphate-buffered saline and killed after 1 hour to assess parasite translocation. Immunofluorescence and Image Analysis Mouse intestine was fixed in 1% paraformaldehyde for 2 hours, washed with 50 mmol/L NH4Cl, and cryoprotected Immune Compensation for Barrier Loss 287 in 30% sucrose (w/v) at 4 C overnight. Tissue was then embedded in OCT medium, snap-frozen, and stored at –80 C. Alternatively, cryosections of tissue that was snapfrozen without prior fixation were fixed in 1:1 methanol:acetone for 10 minutes at –20 C. Frozen sections were immunostained as previously described31 by using primary antibodies, rabbit anti-myeloperoxidase, rabbit anti-CD3 (Abcam, Cambridge, MA), rabbit anti-LDH1 antiserum,32 rat anti-CD4, rat anti-IgA (BD Pharmingen, San Jose, CA), followed by AlexaFluor-conjugated phalloidin or secondary antibodies and Hoechst 33342 dye (Invitrogen, Carlsbad, CA). Slides were mounted with Prolong Gold (Invitrogen) and visualized on a DMI6000 inverted epifluorescence microscope equipped with a Rolera EMC2 CCD camera (QImaging, Surrey, BC, Canada), 20/0.50 PH2, 40/ 0.60CORR/PH, or 63/0.70CORR objectives, and Metamorph 7 acquisition software (Molecular Devices, Sunnyvale, CA). Four mm Z-stacks were acquired with 0.2 mm spacing, and images were deconvolved for 10 iterations by using Autodeblur (Media Cybernetics, Rockville, MD). Morphometric analysis of S typhimurium and T gondii was quantified as previously described.28 Briefly, invasion was quantified as the number of organisms that had invaded into an epithelial cell or crossed into the LP. Epithelial invasion required the organism to be localized basal to the perijunctional actomyosin ring, as defined by phalloidin staining. Unprocessed images were used for quantitative analyses to avoid potential deconvolution artifact. For each mouse, 6–8 fields, each containing approximately 0.1 mm2 of epithelialcovered villus mucosa, were analyzed by a blinded observer. Intestinal Permeability Mice were fasted for 3 hours and then gavaged with 1 mg/mL fluorescein and 20 mg/mL 70 kDa rhodamine dextran in water. Blood was collected 3 hours later via the retro-orbital sinus. Fluorescence intensity was determined by using a plate reader at 495 nm excitation/525 nm emission and 555 nm excitation/585 nm emission. Intestinal permeability was reported as serum fluorescein recovery normalized to that of 70 kDa rhodamine dextran, which cannot cross tight junctions. CD4 Depletion and Adoptive Transfer CD4þ T cells were depleted by injecting mice intraperitoneally with 0.2 mg GK1.5 (University of Chicago Monoclonal Antibody Core). Injection of 0.2 mg IgG isotype control (F156-6B9.7) was used as a control. CD4þ T-cell depletion was confirmed after 48 hours by either flow cytometric analysis of retro-orbital blood (before infection) or splenocytes (on death). Eight-week-old Rag1 KO or Rag1 KO CA-MLCK mice were injected with 2  106 CD4þ splenocytes from sexmatched 10-week-old C57BL/6 donor mice. CD4þ T cells were enriched by negative selection (Miltenyi Biotech, San Diego, CA), sorted to 98% purity by flow cytometry, and injected retro-orbitally. Infections were performed 2 weeks after adoptive transfer. Age-matched mice not receiving adoptive transfer were used as controls. 288 Edelblum et al Immunoglobulin A Enzyme-linked Immunosorbent Assay Fecal samples were homogenized in 0.01% NaN3 in phosphate-buffered saline and centrifuged, and the supernatant was used for analysis. Plates were coated with 2 mg/mL goat anti-mouse IgA (Southern Biotech, Birmingham, AL) in phosphate-buffered saline, and samples were diluted in 1% bovine serum albumin and incubated overnight at 4 C. Mouse IgA (clone M18-254; BD Pharmingen, San Diego, CA) was used to generate a standard curve. After washes in phosphate-buffered saline containing 0.05% Tween, anti-IgA-avidin phosphatase (Southern Biotech) was added, and p-nitrophenyl phosphate was used to develop the reaction. Samples were read by plate reader at 405 nm. Immunoglobulin A Repertoire Analysis 454 sequencing. After RNA extraction from fecal pellets, cDNA synthesis was performed with SuperScript III (Invitrogen) by using random hexamer primer. Template libraries of rearranged IgA sequences were generated by polymerase chain reaction using a primer specific for the constant Ca (IgA) region (50 CGTATCGCCTCCCTCGCGCCAT CAG(MID)GAGCTCGTGGAGTGTCAGTG-30 ) and a primer binding at all Vh genes (50 -CTATGCGCCTTGCCAGCCC GCTCAGGAGGTGCAGCTGCAGGAGTCTGG-30 ).33,34 MIDs of 4-nucleotides at constant Ca/Cm primers allowed to pool samples within sequencing lanes. Following polymerase chain reaction conditions were used: 95 C, 4 minutes; 25 (94 C, 30 seconds; 62 C, 30 seconds; 72 C, 35 seconds); and 72 C for 10 minutes. Amplicons were purified by Qiaquick Gel Extraction kit (Qiagen, Germantown, MD) and prepared for 454 sequencing using the GS FLX Titanium SV emPCR Lib-A kit and Genome Sequencer FLX system as recommended by the manufacturer. Sequence analysis. Sequences were annotated and compared with reference sequences of the ImMunoGeneTics (IMGT) HighV-QUEST database.35,36 IMGT results were sorted for productive sequences and further analyzed with Excel and VBA (Microsoft Corp, Redmond, WA).33 To compare between samples we randomly analyzed 5000 CDR3 sequences per sample. The Shannon index is used to measure IgA repertoire diversity and was calculated with R studio (version 0.94.110; http://www.r-project.org/, http://rstudio.org/) and the library “vegan” (command: diversity). For quantification of VDJ segment usage only major chains were taken into consideration. Cellular and Molecular Gastroenterology and Hepatology Vol. 4, No. 2 not normally distributed, Kruskal-Wallis one-way analysis of variance on ranks was performed, and the Dunn method was used for multiple pairwise comparisons. Results Epithelial Constitutively Active Myosin Light Chain Kinase Expression Results in Increased Intestinal Permeability The epithelial tight junction is intimately associated with a perijunctional actomyosin ring that modulates paracellular permeability via MLCK. CA-MLCK expression9,14 within the intestinal epithelium markedly increased perijunctional myosin II regulatory light chain phosphorylation (Figure 1A) and also enhanced small intestinal paracellular, ie, tight junction, permeability in a size-selective manner (Figure 1B). Despite this barrier defect, CA-MLCK mice did not develop spontaneous colitis. On the basis of these data and the potential link between enteric infection and subsequent development of inflammatory bowel disease,37,38 we hypothesized that constitutive barrier dysfunction may predispose these animals to enteric infection. Increased Intestinal Epithelial Permeability Activates Processes That Limit Early Pathogen Translocation Intestinal permeability, the converse of barrier function, is regulated through paracellular flux. Paracellular transport via the tight junction is size-selective and precisely regulated. In contrast, unrestricted flux, which represents flux across damaged epithelia,3,39,40 allows passage of large molecules and whole bacteria. CA-MLCK mice exhibit increases in paracellular permeability that are similar to those seen in Crohn’s disease patients during remission as well as in a subset of their healthy relatives.9 Therefore, we Statistical Analysis All data are presented as either the mean ± standard error of the mean (SEM) or with a 95% confidence interval. P values of direct comparisons between 2 independent samples were determined by a two-tailed Student t test and considered to be significant if P  .05. Mann-Whitney rank sum tests were performed in cases in which the data were not normally distributed. Comparisons between multiple independent variables were determined by one-way analysis of variance, and Holm-Sidak method was used for pairwise comparisons. In instances in which the data were Figure 1. Constitutive epithelial expression of CA-MLCK increases intestinal permeability. (A) MLC phosphorylation (green) at the epithelial perijunctional actomyosin ring (f-actin, red) in WT and CA-MLCK mice. Nuclei are shown in blue. Scale bar, 20 mm. (B) Small intestinal permeability is shown as ratio of paracellular flux of fluorescein and 70 kDa rhodamine dextran in WT and CA-MLCK mice. n ¼ 8–9 mice per genotype; data from 2 independent experiments are shown. *P < .05. September 2017 chose this model to investigate the impact of physiologically relevant tight junction barrier defects on host defense. As previously reported in the colon,9 LP CD4þ T-cell numbers were increased in the small intestine of CA-MLCK, relative to WT, mice (Figure 2A and B). To investigate how tight junction barrier loss and the associated LP immune expansion affect susceptibility to enteric pathogens, CA-MLCK and WT mice were infected orally with the intracellular protozoan parasite T gondii (Figure 2C). Within 1 hour, the number of parasites that had transmigrated across the epithelium and into the LP was reduced by 50% ± 8% in CA-MLCK mice relative to WT (Figure 2D). Paradoxically, this indicates that increased intestinal permeability limits parasite invasion. To determine whether this barrier defect also conferred protection against other Immune Compensation for Barrier Loss 289 pathogens, mice were exposed to S typhimurium. As with the protozoan, bacterial translocation was reduced by 76% ± 6% in CA-MLCK relative to WT mice (Figure 2E and F). To determine whether the increased LP infiltration of adaptive immune cells was required for CA-MLCK–mediated protection against bacterial invasion, Rag1 knockout (KO); CA-MLCK mice lacking both B and T cells were challenged with S typhimurium. Bacterial translocation in Rag1 KO; CA-MLCK mice was similar to that in Rag1 KO mice alone (Figure 2E and F), indicating that adaptive immunity is required for the protective effect of CA-MLCK expression. gd T cells also contribute significantly to protection from early pathogen invasion.28,41 This was confirmed in our experiments, which showed greater S typhimurium invasion in Tcrd KO mice, which lack gd T cells (Figure 2E and F). Figure 2. Increased intestinal permeability limits early enteric pathogen invasion. (A) Fluorescence micrographs of CD3þ CD4þ LP T cells in WT and CA-MLCK mice. CD3, red; CD4, green; nuclei, blue. White arrowheads indicate CD4þ T cells. Scale bar, 20 mm. (B) Morphometric analysis of LP CD4þ T cells. n ¼ 4–5 mice. **P < .01. (C) WT and CA-MLCK mice were orally administered T gondii cysts and killed after 1 hour (SAC). Alternatively, mice were exposed to S typhimurium through the addition of 108 CFUs directly to the mucosal surface for 30 minutes. (D) Morphometric analysis of parasite translocation 1 hour after infection. n ¼ 5–6 mice from 2 independent experiments. *P < .05. (E) Fluorescence micrographs of S typhimurium (red, arrows)–infected WT and CA-MLCK mice crossed to Rag1- or gd T-cell (Tcrd)–deficient backgrounds. Nuclei, blue; f-actin, green. White arrowheads indicate translocation of S typhimurium, whereas yellow arrowheads are bacteria not counted. Scale bar, 20 mm. (F) Morphometric analysis of S typhimurium invasion. n ¼ 5–7 mice from at least 2 independent experiments. Approximately 200 villi were counted for each condition. *P < .05, **P < .01. (G) Morphometric analysis of gd T cells in WT and CA-MLCK mice. n ¼ 4 mice. Mean ± SEM are shown. 290 Edelblum et al However, CA-MLCK expression within Tcrd KO mice markedly reduced bacterial invasion, indicating that although important to overall host defense, gd T cells did not account for the observed effects of CA-MLCK expression (Figure 2E and F). Consistent with this, gd T-cell numbers were similar in CA-MLCK and WT mice (Figure 2G). Taken together, these data demonstrate that increased epithelial permeability promotes immune activation to markedly reduce early invasion of parasites and bacterial pathogens during the initial stages of infection. This protection requires adaptive immunity but is gd T-cell–independent. CD4þ T Cells Are Required for Constitutively Active Myosin Light Chain Kinase–induced Protection Against Bacterial Invasion To better elucidate the immune cell populations contributing to the invasion-resistant phenotype of CA-MLCK mice, we depleted CD4þ T cells and challenged mice with luminal S typhimurium (Figure 3A and B). CD4þ T-cell depletion had no effect on early bacterial translocation in WT mice but increased bacterial invasion more than 5-fold in CA-MLCK mice, relative to mice receiving Cellular and Molecular Gastroenterology and Hepatology Vol. 4, No. 2 control IgG (Figure 3C). The disparity between CA-MLCK and WT mice suggests that our initial hypothesis that increased tight junction permeability would enhance pathogen invasion was correct. However, the data also indicate that constitutive barrier dysfunction also elicits a CD4þ T-cell response that confers protection against acute pathogen invasion. The data above indicate that CD4þ T cells are necessary for the protection observed in CA-MLCK mice. To determine whether these cells were sufficient to confer protection, WT CD4þ T cells were adoptively transferred into Rag1 KO or Rag1 KO; CA-MLCK recipients (Figure 3D). Within 2 weeks, CD4þ T cells were effectively reconstituted in the LP of both CA-MLCK and WT mice (Figure 3E). Notably, 73% more LP CD4þ T cells were present in the LP of Rag1 KO; CA-MLCK, relative to Rag1 KO, recipients (Figure 3E). Whereas CD4þ T-cell transfer into Rag1 KO mice had no effect on bacterial invasion, CD4þ T-cell transfer into Rag1 KO; CA-MLCK mice reduced invasion by 43% (Figure 3F). These data demonstrate that CD4þ T cells are sufficient to limit early S typhimurium invasion. Because CD4þ T cells from WT mice were protective in Rag1 KO; CA-MLCK mice, the data indicate that changes in the local mucosal Figure 3. CD4D T cells are required to confer protection against bacterial invasion in CA-MLCK mice. (A) After administration of anti-CD4 (GK1.5) or control IgG intraperitoneally, WT and CA-MLCK mice were exposed to S typhimurium through direct application of bacteria to small intestinal mucosal surface for 30 minutes and then killed (SAC). (B) Percentage of CD3þ CD4þ T splenocytes 48 hours after anti-CD4 administration. #P < .001. (C) Morphometric analysis of S typhimurium invasion after administration of anti-CD4 or control IgG. n ¼ 6–9 mice from 2 independent experiments. *P < .05, #P < .001. (D) Rag1 KO mice and those also expressing the CA-MLCK Tg received CD4þ T-cell adoptive transfer. After 2 weeks of engraftment, mice were exposed to S typhimurium for 30 minutes. (E) Morphometric analysis of CD4þ LP T cells in Rag1 KO and Rag1 KO CA-MLCK mice after CD4þ T-cell adoptive transfer. n ¼ 7–8 mice from 2 independent experiments. *P < .05. (F) Analysis of S typhimurium translocation in Rag1 KO and Rag1 KO; CA-MLCK mice receiving CD4þ T-cell adoptive transfer. n ¼ 7–11 mice from 2 independent experiments. *P < .05. September 2017 microenvironment resulting from constitutive barrier loss are sufficient to impart this phenotype. This may reflect expansion or enhanced recruitment of CD4þ T cells to the LP of Rag1 KO; CA-MLCK mice. In either case, it is clear that the compensatory response to epithelial barrier loss includes promotion of a new CD4þ T-cell function that is not otherwise present, as indicated by the failure of CD4þ T cells to reduce bacterial invasion in Rag1 KO mice. We also asked whether other components of adaptive immunity might contribute to the protective phenotype observed in CA-MLCK mice. Plasma cell production of commensal-specific IgA interferes with commensal antigen expression and promotes immune exclusion by limiting bacterial association with the mucosal surface, and this has been implicated in the mucosal immune response to loss of JAM-A expression.22 Morphometric analysis showed that CA-MLCK mice exhibited an increase in IgAþ plasma cells within the LP compared with WT (Figure 4A). However, there were no differences in mucosal transforming growth factor beta transcripts, expression or localization of the polymeric Ig receptor (pIgR), or the amount of secreted Immune Compensation for Barrier Loss 291 (luminal) IgA between CA-MLCK and WT mice (Figure 4B).9 Despite the lack of quantitative increases in luminal IgA, we hypothesized that increased exposure to bacterial products as a result of enhanced paracellular permeability could promote expansion of plasma cells expressing microbespecific IgA. To test this, complementary determining region 3 region sequences were analyzed from productive IgA VDJ rearrangements. Although the values indicate a highly diverse IgA repertoire in all samples (Figure 4C), no differences were observed between WT and CA-MLCK mice. Furthermore, analysis of the frequency of somatic hypermutations within IgA-producing plasma cells during affinity maturation also failed to identify significant differences between the CA-MLCK and WT mice (Figure 4D). Therefore, barrier loss does not affect the quality of mucosal IgA. Previous studies have linked barrier loss to IgA production. Therefore, we asked whether, despite the negative data above, increases in LP IgA-producing plasma cells could contribute to protection against early pathogen invasion. CA-MLCK mice were bred onto an IgA-deficient Figure 4. IgAD plasma cell number is increased, yet not required for CA-MLCK–mediated protection against bacterial translocation. (A) Morphometric analysis of IgAþ plasma cells in the LP. n ¼ 4–6 mice. Mean ± SEM, *P ¼ .05. (B) Enzymelinked immunosorbent assay for fecal IgA. n ¼ 7–10 mice. Mean ± SEM. (C) Shannon Index was calculated from CDR3 sequence pools of given samples. The mean is shown. (D) Mutation frequencies in CDR1/2 and FR sequences calculated from the average number of SHM within the Vh region. Frequencies were calculated through division of mutation numbers by the number of nucleotides within the given FR or CDR regions. Mean ± standard deviation. (E) Morphometric analysis of S typhimurium invasion in WT and CA-MLCK mice on an IghA KO background. n ¼ 5–7 mice from 2 independent experiments. Mean is shown, *P ¼ .05. (F) Morphometric analysis of LP IgAþ plasma cells 48 hours after administration of anti-CD4 or control IgG. Mean ± SEM, **P < .01. IghA, immunoglobulin A; SHM, somatic hypermutations. 292 Edelblum et al background (IghA KO). Bacterial invasion was similar to CA-MLCK mice regardless of IgA expression (Figure 4E), indicating that IgA was not required for the CA-MLCK–mediated protective effect. Because IgA is generated through both T-cell–dependent and –independent mechanisms,42 we assessed the role of CD4þ T cells in generating increased numbers of LP IgAþ plasma cells in CA-MLCK mice. CD4þ T-cell depletion did not affect IgA-producing plasma cell number in the LP of CA-MLCK or WT mice (Figure 4F). Because of the requirement for CD4þ T cells in the enhanced immunity of CA-MLCK mice, these data lend further support to the conclusion that IgA is not required for the protection observed in CA-MLCK mice. Interleukin 17A Expression Promotes Neutrophil Recruitment to Prevent Early Bacterial Invasion in Constitutively Active Myosin Light Chain Kinase Mice Certain strains of commensal bacteria modulate specific immune responses. For example, SFB are known to promote Th17 differentiation in the small intestine,18,43 and activation of these Th17 cells is critical to pathogen clearance and maintenance of host defense.44,45 To determine the role of IL17 in CD4þ T-cell–mediated protection against bacterial invasion, CA-MLCK mice were generated on an IL17Adeficient background. IL17A deficiency significantly increased acute S typhimurium invasion in CA-MLCK transgenic mice (Figure 5A). More strikingly, IL17A knockout eliminated CD4þ T-cell expansion within the LP of CA-MLCK mice (Figure 5B). These data show that IL17A is required to generate the increased numbers of LP CD4þ T cells seen in CAMLCK mice and that both IL17A and CD4þ T cells are necessary for early protection against S typhimurium translocation. One mechanism by which Th17 cells contribute to host defense is induction of granulopoiesis and neutrophil recruitment via CXCL1 and CXCL2 to promote bacterial Cellular and Molecular Gastroenterology and Hepatology Vol. 4, No. 2 clearance.46,47 S typhimurium exposure induced rapid neutrophil recruitment into the LP of CA-MLCK but not WT mice (Figure 5C). This acute recruitment was eliminated in IL17A KO mice, indicating that IL17A may prime innate immunity for immediate response to initial pathogen exposure. Commensal Bacteria Are Essential for Activation of Host Defense in Response to Intestinal Epithelial Barrier Dysfunction The mucosal immune system and microbiota regulate one another during differentiation of the immune response.2 To test the hypothesis that commensal bacteria drive the mucosal CD4þ T-cell expansion that limits early pathogen invasion, CA-MLCK mice were rederived under GF conditions. Consistent with previous reports, GF mice exhibited significantly diminished numbers of LP lymphocytes. Furthermore, LP CD4þ T-cell and IgAþ plasma cell numbers were similar in GF CA-MLCK and GF WT mice, indicating that the differences induced by CA-MLCK expression in conventional mice are dependent on the microbiota (Figure 6A and B). When challenged with S typhimurium, invasion was similar in GF CA-MLCK and GF WT mice (Figure 6C). SFB are commensal bacteria known to promote Th17 differentiation in the small intestine and, although abundant in C57BL/6NTac mice from Taconic Farms, are undetectable in C57BL/6J from Jackson Laboratories.48 Previous studies have shown that in addition to driving Th17 differentiation, SFB colonization of C57BL/6J from Jackson Laboratories promotes Th17-dependent neutrophil recruitment47 similar to that observed here (Figure 5C). To compare the effects of SFB-containing and SFB-deficient microbiota, GF CA-MLCK and WT mice were conventionalized with cecal contents from Taconic Farms (TAC) and Jackson Laboratories (JAX) mice. The enhanced resistance to acute bacterial translocation observed in CA-MLCK mice was restored by SFB-containing (TAC) microbiota, but not by SFB-deficient Figure 5. IL17A is required to limit bacterial translocation through promotion of neutrophil recruitment. (A) Morphometric analysis of S typhimurium invasion in WT and CA-MLCK mice on an IL17A-deficient background. n ¼ 6–7 mice from 2 independent experiments. *P < .05, **P < .01. (B) Morphometric analysis of CD4þ LP T cells in WT and CA-MLCK mice crossed to IL17A-deficient mice. **P < .01. (C) Morphometric analysis of neutrophils within the small intestinal LP in uninfected and infected (30 minutes) WT, CA-MLCK, IL17A KO or IL17A KO; CA-MLCK mice. n ¼ 3–5 mice. #P < .001. September 2017 Immune Compensation for Barrier Loss 293 Constitutive Barrier Dysfunction Increases Susceptibility to Chronic Salmonella Infection The data above demonstrate that tight junction barrier loss results in markedly enhanced pathogen invasion in CD4 T-cell–depleted mice. In immunocompetent mice, tight junction barrier loss also activates mucosal immune responses that limit acute S typhimurium invasion. We asked whether these compensatory immune responses were sufficient to prevent chronic infection and systemic salmonellosis. Nine days after infection, CA-MLCK mice exhibited more severe disease, as assessed clinically by reduced activity and hunched posture (Figure 7A and B), as well as greater mucosal damage and LP lymphoplasmacytic infiltrates (Figure 7C and D). Differences between CA-MLCK and WT mice were also apparent within the spleen. CA-MLCK mice had sinus thrombi and dense lymphohistiocytic infiltrates that were reminiscent of, but more diffuse than, typhoid nodules, whereas WT mice displayed neutrophil-rich intrasplenic abscesses (Figure 7E and F). Thus, although increased intestinal epithelial tight junction permeability activates protective immune activation that limits early invasion, this is ultimately insufficient to compensate for barrier loss in the context of chronic disease. Discussion Figure 6. Commensal bacteria are essential for promoting mucosal immune responses to early Salmonella invasion in response to increased intestinal permeability. (A) Fluorescence micrographs of CD3þ CD4þ LP T cells in WT and CA-MLCK mice raised under either SPF or GF conditions. Scale bar, 20 mm. Morphometric analysis of CD4þ LP T cells in GF WT and CA-MLCK mice are shown. n ¼ 6–8 mice from 2 independent experiments. (B) Fluorescence micrographs of IgAþ plasma cells in the LP in WT and CA-MLCK mice raised under either SPF or GF conditions. Scale bar, 20 mm. Morphometric analysis of IgAþ plasma cells in GF WT and CA-MLCK mice is shown. n ¼ 5–8 mice from 2 independent experiments. (C) Morphometric analysis of S typhimurium invasion (30 minutes) in WT and CA-MLCK mice maintained under GF conditions or conventionalized with Taconic (TAC) or Jackson (JAX) microbiota. n ¼ 5–8 mice from 2 independent experiments. **P < .01. (JAX) microbiota (Figure 6C). Together with the aforementioned results, these data suggest that SFB-induced Th17 differentiation is central to the protection against acute S typhimurium invasion in CA-MLCK mice. Targeted increases in paracellular flux through the epithelial tight junction enhance susceptibility to experimental, immune-mediated colitis.9 Although tight junction– specific barrier loss is insufficient to allow translocation of intact microbes, we hypothesized that it would increase susceptibility to enteric infection. Our data support this hypothesis in the absence of adaptive immunity but also demonstrate that chronic tight junction barrier loss stimulates a subclinical immune response that limits acute invasion of enteric pathogens. This early protection requires CD4þ T cells and IL17A, but not IgA. Consistent with previous studies by us and others,9,21,22 we found that CD4þ LP T-cell number is increased in response to constitutive barrier loss. Notably, the physiologically relevant, tight junction–specific barrier loss studied here is not associated with chronic epithelial damage or homeostatic increases in epithelial proliferation. Furthermore, unlike transient, damage-associated barrier loss,21 regulatory T-cell populations are not expanded in CA-MLCK mice.9,21 The increased paracellular permeability resulting from MLCK activation induced an immune response that limited not only early bacterial invasion but also the transmigration of T gondii. We found that CD4þ T cells, and in particular Th17 cells, were necessary to limit acute S typhimurium invasion in CA-MLCK mice. The data further suggest that IL17A-induced neutrophil recruitment contributes to this enhanced immunity. Studies in GF CA-MLCK mice showed that commensal bacteria are required for both CD4þ LP T-cell expansion and early protection against bacterial invasion. Finally, after adoptive transfer to T and B cell–deficient (Rag1 KO) CA-MLCK mice, increased numbers of CD4þ T cells from WT mice were 294 Edelblum et al Cellular and Molecular Gastroenterology and Hepatology Vol. 4, No. 2 Figure 7. Constitutive barrier dysfunction enhances susceptibility to Salmonella-induced colitis. (A) WT and CA-MLCK gavaged with streptomycin 24 hours before oral infection with 108 CFU S typhimurium. (B) Clinical scores are shown. n ¼ 17– 18 mice from at least 3 independent experiments, *P < .05. Hematoxylineosin micrographs and histologic scores of colon (C and D) and spleen (E and F) for infected mice are shown. n ¼ 8–10 mice from at least 3 independent experiments are shown. # P < .001. SAC, sacrifice; SL, S. typhimurium, strain SL3201. recruited to the LP of CA-MLCK mice where they contributed to enhanced protection against early bacterial translocation. Taken together, these findings demonstrate that the continuous low-level exposure of LP cells to commensal products as a result of physiologically relevant tight junction barrier loss drives a subclinical immune response that functions as a compensatory mechanism that limits invasion of bacterial and protozoan pathogens. Careful consideration must be given to models of barrier dysfunction to better understand the effect of permeability in disease states because of the broad definition of “barrier defect” in the current literature.1 For example, although intrarectal ethanol administration has been used to transiently disrupt barrier function,21 the mechanism involves epithelial damage that likely enhances flux across the unrestricted pathway. Similarly, although JAM-A–deficient mice exhibit markedly increased intestinal permeability in addition to mucosal immune activation and inflammatory cell recruitment,10,11 the cause of the barrier loss is likely multifactorial. Although claudins-10 and -15 are upregulated in JAM-A KO mice,11 these claudins function as paracellular channels with diameters of 5–6 Å3,39,40 and, therefore, cannot be responsible for the marked increases in large molecule flux reported in these mice. Furthermore, in vitro and in vivo studies have demonstrated that loss of JAM-A increases intestinal epithelial apoptosis and results in compensatory increases in epithelial proliferation in vivo.10,11 Neither of these changes are present in CA-MLCK transgenic mice. As expected for tight junction–specific barrier loss, the increased permeability induced by intestinal epithelial CA-MLCK expression is substantially lower than that observed in JAM-A knockout mice. However, the degree of barrier loss in CA-MLCK mice is quantitatively and qualitatively similar to the barrier defects reported in healthy first-degree relatives of Crohn’s disease patients.7,8 The subclinical immune activation exhibited in CA-MLCK mice confers a protective phenotype in response to acute exposure to S typhimurium or T gondii. It will be interesting to determine whether similar mucosal immune activation is present in the subset of healthy first-degree relatives of Crohn’s disease patients who manifest barrier loss and whether this confers increased risk of developing disease. The studies in GF mice indicate that mucosal immune priming in CA-MLCK mice is driven by the microbiota, which is supported by studies showing that SFB colonization induces IL17A production by CD4þ T cells to promote neutrophil recruitment.47 Consistent with this, colonization of GF CA-MLCK mice with SFB-deficient microbiota failed to restore the protective phenotype. In contrast, colonization with microbiota containing SFB was able to reduce Salmonella invasion in GF mice. Thus, although GF mice fail to develop a mature mucosal immune compartment and exhibit reduced mucus thickness,49 it is not the absence of all microbes that abrogates the protection. Rather, it is the difference between TAC and JAX microbiota, most likely SFB, that explains CA-MLCK–induced microbial resistance. It is tempting to speculate that loss of these beneficial September 2017 commensals may also, in part, explain the association between acute enteritis-driven dysbiosis and the onset of chronic inflammatory bowel disease in a subset of patients.37,38 Similar to our initial observations demonstrating increased susceptibility of CA-MLCK mice to immunemediated colitis,9 we found that CA-MLCK expression in the intestinal epithelium resulted in more severe Salmonella-induced colitis after prolonged bacterial infection. This contrasts sharply with the protective phenotype exhibited in response to acute exposure to S typhimurium or T gondii. Due to the critical roles for IL17-dependent neutrophil recruitment in early protection against microbial invasion, it would be reasonable to hypothesize that although this early neutrophil influx clears bacteria to confer acute protection, sustained neutrophil recruitment leads to tissue destruction and more severe chronic disease. In the context of systemic infection, these data support the potential link between enteric infection and subsequent development of inflammatory bowel disease.37,38 Overall, these data indicate that increased intestinal epithelial tight junction permeability results in a shift in the symbiotic relationship between mucosal immunity and commensal microbes by increasing the frequency of sampling or the diversity of luminal antigens available to prime mucosal surveillance. This increased sampling may allow for constant modulation of tolerance to commensal bacteria and provide immediate protection to limit early pathogen invasion. Finally, the mechanisms identified here may explain both the absence of disease in relatives of Crohn’s disease patients, despite barrier loss, as well as the increased disease susceptibility induced by barrier dysfunction. Immune Compensation for Barrier Loss 5. 6. 7. 8. 9. 10. References 1. Kiesler P, Fuss IJ, Strober W. Experimental models of inflammatory bowel diseases. Cell Mol Gastroenterol Hepatol 2015;1:154–170. 2. Ohland CL, Jobin C. Microbial activities and intestinal homeostasis: a delicate balance between health and disease. Cell Mol Gastroenterol Hepatol 2015;1:28–40. 3. Turner JR. Intestinal mucosal barrier function in health and disease. Nat Rev Immunol 2009;9:799–809. 4. Jostins L, Ripke S, Weersma RK, Duerr RH, McGovern DP, Hui KY, Lee JC, Schumm LP, Sharma Y, Anderson CA, Essers J, Mitrovic M, Ning K, Cleynen I, Theatre E, Spain SL, Raychaudhuri S, Goyette P, Wei Z, Abraham C, Achkar JP, Ahmad T, Amininejad L, Ananthakrishnan AN, Andersen V, Andrews JM, Baidoo L, Balschun T, Bampton PA, Bitton A, Boucher G, Brand S, Buning C, Cohain A, Cichon S, D’Amato M, De Jong D, Devaney KL, Dubinsky M, Edwards C, Ellinghaus D, Ferguson LR, Franchimont D, Fransen K, Gearry R, Georges M, Gieger C, Glas J, Haritunians T, Hart A, Hawkey C, Hedl M, Hu X, Karlsen TH, Kupcinskas L, Kugathasan S, Latiano A, Laukens D, Lawrance IC, Lees CW, Louis E, Mahy G, Mansfield J, Morgan AR, Mowat C, Newman W, Palmieri O, Ponsioen CY, Potocnik U, Prescott NJ, Regueiro M, Rotter JI, Russell RK, Sanderson JD, Sans M, Satsangi J, 11. 12. 13. 14. 15. 295 Schreiber S, Simms LA, Sventoraityte J, Targan SR, Taylor KD, Tremelling M, Verspaget HW, De Vos M, Wijmenga C, Wilson DC, Winkelmann J, Xavier RJ, Zeissig S, Zhang B, Zhang CK, Zhao H, International IBDGCSilverberg MS, Annese V, Hakonarson H, Brant SR, Radford-Smith G, Mathew CG, Rioux JD, Schadt EE, Daly MJ, Franke A, Parkes M, Vermeire S, Barrett JC, Cho JH. Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nature 2012;491:119–124. D’Inca R, Di Leo V, Corrao G, Martines D, D’Odorico A, Mestriner C, Venturi C, Longo G, Sturniolo GC. Intestinal permeability test as a predictor of clinical course in Crohn’s disease. Am J Gastroenterol 1999;94: 2956–2960. Wyatt J, Vogelsang H, Hubl W, Waldhoer T, Lochs H. Intestinal permeability and the prediction of relapse in Crohn’s disease. Lancet 1993;341:1437–1439. Hollander D, Vadheim CM, Brettholz E, Petersen GM, Delahunty T, Rotter JI. Increased intestinal permeability in patients with Crohn’s disease and their relatives: a possible etiologic factor. Ann Intern Med 1986; 105:883–885. Buhner S, Buning C, Genschel J, Kling K, Herrmann D, Dignass A, Kuechler I, Krueger S, Schmidt HH, Lochs H. Genetic basis for increased intestinal permeability in families with Crohn’s disease: role of CARD15 3020insC mutation? Gut 2006;55:342–347. Su L, Shen L, Clayburgh DR, Nalle SC, Sullivan EA, Meddings JB, Abraham C, Turner JR. Targeted epithelial tight junction dysfunction causes immune activation and contributes to development of experimental colitis. Gastroenterology 2009;136:551–563. Vetrano S, Rescigno M, Cera MR, Correale C, Rumio C, Doni A, Fantini M, Sturm A, Borroni E, Repici A, Locati M, Malesci A, Dejana E, Danese S. Unique role of junctional adhesion molecule-a in maintaining mucosal homeostasis in inflammatory bowel disease. Gastroenterology 2008;135:173–184. Laukoetter MG, Nava P, Lee WY, Severson EA, Capaldo CT, Babbin BA, Williams IR, Koval M, Peatman E, Campbell JA, Dermody TS, Nusrat A, Parkos CA. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med 2007; 204:3067–3076. Nalle SC, Kwak HA, Edelblum KL, Joseph NE, Singh G, Khramtsova GF, Mortenson ED, Savage PA, Turner JR. Recipient NK cell inactivation and intestinal barrier loss are required for MHC-matched graft-versus-host disease. Sci Transl Med 2014;6:243ra87. Gerlach K, McKenzie AN, Neurath MF, Weigmann B. IL-9 regulates intestinal barrier function in experimental T cellmediated colitis. Tissue Barriers 2015;3:e983777. Shen L, Black ED, Witkowski ED, Lencer WI, Guerriero V, Schneeberger EE, Turner JR. Myosin light chain phosphorylation regulates barrier function by remodeling tight junction structure. J Cell Sci 2006;119:2095–2106. Clayburgh DR, Barrett TA, Tang Y, Meddings JB, Van Eldik LJ, Watterson DM, Clarke LL, Mrsny RJ, Turner JR. Epithelial myosin light chain kinase-dependent barrier 296 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. Edelblum et al dysfunction mediates T cell activation-induced diarrhea in vivo. J Clin Invest 2005;115:2702–2715. Turner JR, Rill BK, Carlson SL, Carnes D, Kerner R, Mrsny RJ, Madara JL. Physiological regulation of epithelial tight junctions is associated with myosin lightchain phosphorylation. Am J Physiol 1997;273: C1378–C1385. Shih VF, Cox J, Kljavin NM, Dengler HS, Reichelt M, Kumar P, Rangell L, Kolls JK, Diehl L, Ouyang W, Ghilardi N. Homeostatic IL-23 receptor signaling limits Th17 response through IL-22-mediated containment of commensal microbiota. Proc Natl Acad Sci U S A 2014; 111:13942–13947. Ivanov II, Frutos Rde L, Manel N, Yoshinaga K, Rifkin DB, Sartor RB, Finlay BB, Littman DR. Specific microbiota direct the differentiation of IL-17-producing T-helper cells in the mucosa of the small intestine. Cell Host Microbe 2008;4:337–349. Hooper LV, Littman DR, Macpherson AJ. Interactions between the microbiota and the immune system. Science 2012;336:1268–1273. Cao AT, Yao S, Gong B, Elson CO, Cong Y. Th17 cells upregulate polymeric Ig receptor and intestinal IgA and contribute to intestinal homeostasis. J Immunol 2012; 189:4666–4673. Boirivant M, Amendola A, Butera A, Sanchez M, Xu L, Marinaro M, Kitani A, Di Giacinto C, Strober W, Fuss IJ. A transient breach in the epithelial barrier leads to regulatory T-cell generation and resistance to experimental colitis. Gastroenterology 2008;135:1612–1623 e5. Khounlotham M, Kim W, Peatman E, Nava P, MedinaContreras O, Addis C, Koch S, Fournier B, Nusrat A, Denning TL, Parkos CA. Compromised intestinal epithelial barrier induces adaptive immune compensation that protects from colitis. Immunity 2012;37:563–573. Weber CR, Raleigh DR, Su L, Shen L, Sullivan EA, Wang Y, Turner JR. Epithelial myosin light chain kinase activation induces mucosal interleukin-13 expression to alter tight junction ion selectivity. J Biol Chem 2010; 285:12037–12046. Prinz I, Sansoni A, Kissenpfennig A, Ardouin L, Malissen M, Malissen B. Visualization of the earliest steps of gammadelta T cell development in the adult thymus. Nat Immunol 2006;7:995–1003. Yang H, Madison B, Gumucio DL, Teitelbaum DH. Specific overexpression of IL-7 in the intestinal mucosa: the role in intestinal intraepithelial lymphocyte development. Am J Physiol Gastrointest Liver Physiol 2008; 294:G1421–G1430. Harriman GR, Bogue M, Rogers P, Finegold M, Pacheco S, Bradley A, Zhang Y, Mbawuike IN. Targeted deletion of the IgA constant region in mice leads to IgA deficiency with alterations in expression of other Ig isotypes. J Immunol 1999;162:2521–2529. Marchiando AM, Shen L, Graham WV, Weber CR, Schwarz BT, Austin JR 2nd, Raleigh DR, Guan Y, Watson AJ, Montrose MH, Turner JR. Caveolin-1dependent occludin endocytosis is required for TNF-induced tight junction regulation in vivo. J Cell Biol 2010;189:111–126. Cellular and Molecular Gastroenterology and Hepatology Vol. 4, No. 2 28. Edelblum KL, Singh G, Odenwald MA, Lingaraju A, El Bissati K, McLeod R, Sperling AI, Turner JR. Gammadelta intraepithelial lymphocyte migration limits transepithelial pathogen invasion and systemic disease in mice. Gastroenterology 2015;148:1417–1426. 29. Cong H, Mui EJ, Witola WH, Sidney J, Alexander J, Sette A, Maewal A, El Bissati K, Zhou Y, Suzuki Y, Lee D, Woods S, Sommerville C, Henriquez FL, Roberts CW, McLeod R. Toxoplasma gondii HLA-B*0702-restricted GRA7(20-28) peptide with adjuvants and a universal helper T cell epitope elicits CD8(þ) T cells producing interferon-gamma and reduces parasite burden in HLA-B*0702 mice. Hum Immunol 2012;73:1–10. 30. Hutson SL, Mui E, Kinsley K, Witola WH, Behnke MS, El Bissati K, Muench SP, Rohrman B, Liu SR, Wollmann R, Ogata Y, Sarkeshik A, Yates JR 3rd, McLeod R. T. gondii RP promoters & knockdown reveal molecular pathways associated with proliferation and cell-cycle arrest. PLoS One 2010;5:e14057. 31. Edelblum KL, Shen L, Weber CR, Marchiando AM, Clay BS, Wang Y, Prinz I, Malissen B, Sperling AI, Turner JR. Dynamic migration of gammadelta intraepithelial lymphocytes requires occludin. Proc Natl Acad Sci U S A 2012;109:7097–7102. 32. Al-Anouti F, Tomavo S, Parmley S, Ananvoranich S. The expression of lactate dehydrogenase is important for the cell cycle of Toxoplasma gondii. J Biol Chem 2004; 279:52300–52311. 33. Lindner C, Wahl B, Fohse L, Suerbaum S, Macpherson AJ, Prinz I, Pabst O. Age, microbiota, and T cells shape diverse individual IgA repertoires in the intestine. J Exp Med 2012;209:365–377. 34. Lindner C, Thomsen I, Wahl B, Ugur M, Sethi MK, Friedrichsen M, Smoczek A, Ott S, Baumann U, Suerbaum S, Schreiber S, Bleich A, Gaboriau-Routhiau V, Cerf-Bensussan N, Hazanov H, Mehr R, Boysen P, Rosenstiel P, Pabst O. Diversification of memory B cells drives the continuous adaptation of secretory antibodies to gut microbiota. Nat Immunol 2015;16:880–888. 35. Brochet X, Lefranc MP, Giudicelli V. IMGT/V-QUEST: the highly customized and integrated system for IG and TR standardized V-J and V-D-J sequence analysis. Nucleic Acids Res 2008;36:W503–W508. MP, Giudicelli V, Ginestoux C, 36. Lefranc Jabado-Michaloud J, Folch G, Bellahcene F, Wu Y, Gemrot E, Brochet X, Lane J, Regnier L, Ehrenmann F, Lefranc G, Duroux P. IMGT, the international ImMunoGeneTics information system. Nucleic Acids Res 2009; 37:D1006–D1012. 37. Gradel KO, Nielsen HL, Schonheyder HC, Ejlertsen T, Kristensen B, Nielsen H. Increased short- and long-term risk of inflammatory bowel disease after salmonella or campylobacter gastroenteritis. Gastroenterology 2009; 137:495–501. 38. Garcia Rodriguez LA, Ruigomez A, Panes J. Acute gastroenteritis is followed by an increased risk of inflammatory bowel disease. Gastroenterology 2006; 130:1588–1594. 39. Nalle SC, Turner JR. Intestinal barrier loss as a critical pathogenic link between inflammatory bowel disease September 2017 40. 41. 42. 43. 44. 45. 46. 47. and graft-versus-host disease. Mucosal Immunol 2015; 8:720–730. Anderson JM, Van Itallie CM. Physiology and function of the tight junction. Cold Spring Harb Perspect Biol 2009; 1:a002584. Ismail AS, Severson KM, Vaishnava S, Behrendt CL, Yu X, Benjamin JL, Ruhn KA, Hou B, DeFranco AL, Yarovinsky F, Hooper LV. Gammadelta intraepithelial lymphocytes are essential mediators of host-microbial homeostasis at the intestinal mucosal surface. Proc Natl Acad Sci U S A 2011;108:8743–8748. Fagarasan S, Kawamoto S, Kanagawa O, Suzuki K. Adaptive immune regulation in the gut: T cell-dependent and T cell-independent IgA synthesis. Annu Rev Immunol 2010;28:243–273. Goto Y, Obata T, Kunisawa J, Sato S, Ivanov II, Lamichhane A, Takeyama N, Kamioka M, Sakamoto M, Matsuki T, Setoyama H, Imaoka A, Uematsu S, Akira S, Domino SE, Kulig P, Becher B, Renauld JC, Sasakawa C, Umesaki Y, Benno Y, Kiyono H. Innate lymphoid cells regulate intestinal epithelial cell glycosylation. Science 2014;345:1254009. Ouyang W, Kolls JK, Zheng Y. The biological functions of T helper 17 cell effector cytokines in inflammation. Immunity 2008;28:454–467. Geddes K, Rubino SJ, Magalhaes JG, Streutker C, Le Bourhis L, Cho JH, Robertson SJ, Kim CJ, Kaul R, Philpott DJ, Girardin SE. Identification of an innate T helper type 17 response to intestinal bacterial pathogens. Nat Med 2011;17:837–844. Fossiez F, Djossou O, Chomarat P, Flores-Romo L, AitYahia S, Maat C, Pin JJ, Garrone P, Garcia E, Saeland S, Blanchard D, Gaillard C, Das Mahapatra B, Rouvier E, Golstein P, Banchereau J, Lebecque S. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J Exp Med 1996;183:2593–2603. Flannigan KL, Ngo VL, Geem D, Harusato A, Hirota SA, Parkos CA, Lukacs NW, Nusrat A, Gaboriau-Routhiau V, Cerf-Bensussan N, Gewirtz AT, Denning TL. IL-17A-mediated neutrophil recruitment limits expansion of segmented filamentous bacteria. Mucosal Immunol 2017;10:673–684. Immune Compensation for Barrier Loss 297 48. Ivanov II, Atarashi K, Manel N, Brodie EL, Shima T, Karaoz U, Wei D, Goldfarb KC, Santee CA, Lynch SV, Tanoue T, Imaoka A, Itoh K, Takeda K, Umesaki Y, Honda K, Littman DR. Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 2009;139: 485–498. 49. Johansson ME, Jakobsson HE, Holmen-Larsson J, Schutte A, Ermund A, Rodriguez-Pineiro AM, Arike L, Wising C, Svensson F, Backhed F, Hansson GC. Normalization of host intestinal mucus layers requires long-term microbial colonization. Cell Host Microbe 2015;18:582–592. Received February 22, 2017. Accepted June 5, 2017. Correspondence Address correspondence to: Karen L. Edelblum, PhD, Rutgers New Jersey Medical School, 205 South Orange Avenue, Cancer Center G1228, Newark, New Jersey 07103. e-mail: ke163@njms.rutgers.edu; or Jerrold R. Turner, MD, PhD, Brigham and Women’s Hospital, 20 Shattuck Street, Thorn 1428, Boston, Massachusetts 02115. e-mail: jrturner@bwh.harvard.edu. Acknowledgments The authors thank Sara McBride for help with mouse rederivation, Taren Thorn and Kimberly Ly for animal care, and the Frank W. Fitch Monoclonal Antibody Core Facility at the University of Chicago for monoclonal antibody production. Author contributions Conceptualization, K.L.E and J.R.T.; methodology, K.L.E., G. Sharon, and S.K.M.; formal analysis, S.R. and I.T.; investigation, K.L.E., G. Sharon, G. Singh, A.S., S.C., S.G., S.R., K.E.B., and J.R.T.; resources, S.K.M., R.M., C.D., I.P., and J.R.T.; writing-original draft, K.L.E.; writing-review and editing, K.L.E., G. Sharon, S.K.M., R.M., K.E.B., I.P., S.R., and J.R.T.; visualization, K.L.E., S.R, and I.P.; supervision, K.L.E., S.K.M., and J.R.T.; funding, K.L.E., S.K.M., and J.R.T. Conflicts of interest The authors disclose no conflicts. One author (J.R.T.) is a member of the CMGH Board of Editors (BOE). In accordance with journal policy, the review process for this manuscript was managed by a Guest Associate Editor, and the author BOE member was blinded to the entire process. Funding Supported by National Institute of Health grants K01DK093627 and F32DK084859 (K.L.E.), R01DK078938, R01GM099535 (S.K.M.), R01DK61931 and R01DK68271 (J.R.T.); Department of Defense W81XWH-09-1-0341 (J.R.T.); Crohn’s and Colitis Foundation of America (S.K.M. and J.R.T.) and Broad Medical Research Foundation (J.R.T.); The Human Frontiers Science Program - Long Term Fellowship (G. Sharon); and the Heritage Medical Research Institute (S.K.M.)