Journal of Infectious Diseases Advance Access published January 28, 2013 1 sc rip t Role of Interleukin-6 (Il6) in innate immunity to Mycobacterium tuberculosis infection Alejandra N. Martinez1, Smriti Mehra2, Deepak Kaushal1,3,* 1 Divisions of Bacteriology & Parasitology, Tulane University Health Sciences Center, New Orleans, LA 2 Division of Microbiology Tulane National Primate Research Center, Covington, LA 3 Department of Microbiology & Immunology, Tulane University Health Sciences Center, New nu Corresponding author: Dr. Deepak Kaushal, Associate Professor of Microbiology and Ma Immunology, Tulane National Primate Research Center, 18703 Three Rivers Road, Covington, Ac c ep ted LA, 70433. Tel: (985)-871-6254; Fax: (985)-871-6390; email: dkaushal@tulane.edu. © The Author 2013. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e‐mail: journals.permissions@oup.com Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 Orleans, LA 2 Abstract sc rip t Background. Mycobacterium tuberculosis (Mtb) can grow within the hostile intracellular environment by actively evading macrophage antibacterial functions. The stress response factor SigH contributes to this process by modulating -chemokine and Il6 expression. Hence, Il6 is of critical importance for acquired immunity against TB. Here, we attempted to better characterize the role of Il6 in the immune response to Mtb infection. of the Il6 transcript in host macrophages infected with Mtb and Mtb:-sigH. The outcome was measured by the analysis of bacterial burden and transcriptome-wide analysis of host gene- Ma expression. Transcriptome results were confirmed via quantitative PCR and ELISA. Infection of host macrophages where Il6 had been silenced, with both Mtb and Mtb:-sigH, resulted in increased expression of interferon-inducible genes, especially those involved in type-1 interferon signaling. The expression of Ly-6 genes was significantly higher in cells infected with Mtb:∆- ted sigH mutant relative to the wild type Mtb (p0.05). Conclusions/Significance. Mtb regulates host Il6 production to inhibit type I interferonsignaling and, consequently, disease progression. The attenuated mutant Mtb:∆-sigH has a ep delayed activation of macrophages compared to the wild type and a delayed inflammatory stimuli as consequence. These findings have important implications for the better understanding Ac c of the mechanisms behind Mtb virulence and pathogenesis and provide an initial roadmap to further investigate the mechanisms that may account for the deleterious effects of type I IFN in Mtb infection. Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 nu Methodology/Principal findings. An siRNA based approach was used to silence the expression 3 INTRODUCTION sc rip t Resistance to Mycobacterium tuberculosis (Mtb) requires the host to restrict bacterial replication via a successful Th1 response (1). Hence, pro-inflammatory cytokines and chemokines induced by Mtb are crucial for immunity to TB. Macrophages play an important role in the innate immune response to pathogens due to their potent antimicrobial functions and thus, are essential in shaping adaptive immune responses (2, 3). Nevertheless, Mtb can evade macrophage functions and actively grow within their hostile intracellular environment (4). As strategy, Mtb inhibits nu resists antimicrobial agents that damage the bacterial cell envelope, and counters toxic reactive Ma oxygen and nitrogen intermediates (1, 5). The evasion of these innate immune defenses allows Mtb to replicate within the host and escape early immune detection. Therefore, regulation of early immune events by pathogens also interferes with the induction of pro-inflammatory cytokines and consequently, with the disease outcome (2, 6, 7). ted Mtb can restrict macrophage activation and pro-inflammatory responses through the stress response factor SigH (8). Transcriptional comparison of infected macrophages demonstrated that the Mtb:-sigH mutant strain induced significantly higher levels of Il6 than ep Mtb, suggesting its critical importance for acquired immunity against TB. Il6 is a pleiotropic proinflammatory cytokine and its increased production is a hallmark of many human chronic Ac c inflammatory diseases. Tnf and Il6 are differentially required for protective immune responses in mice infected with Mtb. However, despite its importance in mediating inflammation, Il6 is not as essential for anti-mycobacterial effector mechanisms as Tnf (9). Il6 is critical to resistance against TB after infection with high doses of intravenously delivered Mtb but is dispensable for control of Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 phagosome maturation and acidification, interferes with responses to gamma interferon (Ifng), 4 mycobacterial growth after low dose aerosol infection (10-12). In addition, it has been shown sc rip t that Il6 is essential for generating protective Th1 immune responses after vaccination with a subunit vaccine against Mtb (13) but has an inhibitory function with respect to Ifng signaling (12). Hence, we used a siRNA based approach in attempt to further characterize the role of Il6 and components of the macrophage signaling machinery that regulate intracellular survival of MATERIALS AND METHODS Murine cell line and Il-6 siRNA Ma Macrophage cell lines derived from C57BL6/J wild type and TLR2-knockout mice were obtained from BEI Resources (Cat# NR-9456, NR-9457, NR-9567, Manassas, VA) and were cultured as adherent cells in DMEM supplemented with 10% heat-inactivated FBS under a humidified 5% CO2 atmosphere as recommended. ON-TARGETplus SMARTpool of four ted distinct siRNA species targeting different sequences of the Il6 transcript was obtained from Dharmacon (Cat# L-043739-00-0005). Pre-designed siRNA obtained from Life Technologies included GAPDH siRNA (Cat# AM4624) as a positive control, and siRNA with scrambled ep sequence as a negative control (Cat# 12935200). Ac c Infection with Mtb and Mtb:-sigH strains Mtb CDC1551 and Mtb:Δ-sigH mutant strain were cultured as previously described (14, 15). Bacterial cultures and infection of C57BL/6 at an MOI of 1:10 and after 4 h, the cells were washed extensively to remove extracellular bacilli (8, 16). Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 nu Mtb. 5 siRNA transfection sc rip t Transfection was performed by mixing Il6 siRNA and 1 μl of Lipofectamine™ RNAiMAX (Invitrogen) for 20 minutes at room temperature. The complex was added to a single well of a 24 well plate, holding 1x105 pre-infected cells per well. Transfections with the positive and negative controls were performed in parallel. All transfections were undertaken in a final volume of 600 μl with siRNA at a final concentration at 100 nM. Transfections were harvested at 24 or 48 hours Real-time PCR Ma RT-PCR was performed with cDNA corresponding to 100 ng of each independent RNA sample, using the SYBR green Supermix kit (Applied Biosystems) with specific primers for each target (Table 1) obtained from PrimerBank (http://pga.mgh.harvard.edu/primerbank/) unless sequence is specified. Relative expression levels were normalized using 18S rRNA as an invariant ted transcript, and data was analyzed using the Δ∆Ct method. The average relative expression levels and the standard deviations were determined in triplicate. ep ELISA and 4-Plex Assay Supernatants collected from infected and siRNA-treated cells or in medium alone were assayed by the Mouse Il6 ELISA kit (Invitrogen) according to the manufacturer's instructions. Ac c Supernatants were also used for quantification of secreted Ifng, Il15, Ccl2 and Cxcl10 using the mouse cytokine 4 milliplex™ map kit (Millipore). Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 nu post-transfection. 6 DNA Microarray experiments and analysis sc rip t 24 hours post-infection/silencing, host transcripts extracted from ~3×105 cells using the RNeasy kit (Qiagen), were used to profile the expression of mouse genome using 4×44 mouse microarrays (Agilent) as described earlier (17-19). Control samples (infected and treated with negative control siRNA) were labeled with Cy3, whereas experimental samples (infected with Mtb, Mtb:Δ-sigH and silenced with Il-6 siRNA) were labeled with Cy5. The analysis methods have previously been described earlier (17-19). Genes whose expression changed by at least 50% nu analysis, total transcripts extracted from ~3×105 cells were labeled and hybridized to miRCURY Ma LNA™ microRNA Arrays (Exiqon Inc) as described (20). CFU counts Intracellular bacteria were obtained by lysing the cells with sterile PBS containing 0.1% saponin ted (Sigma). The released bacilli were serially diluted in PBS containing 0.01% Tween-80 (Merck) and plated on Middlebrook 7H10/OADC agar in triplicate. CFUs were counted after 21 days of ep incubation at 37°C. Statistical analysis Statistical significance was determined using ANOVA and Mann-Whitney tests in GraphPad Ac c Prism, except for microarray results where a t-test script within Spotfire DecisionSite/S+ Array Analyzer was used. Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 (P<0.05) were considered differentially expressed in a significant manner. For microRNA 7 sc rip t RESULTS Down-regulation of Il6 mRNA and protein by siRNA delivery in C57BL6/J macrophages cells in vitro Real time-PCR and ELISA analysis were performed 24 h after transfection to evaluate the level of Il6 mRNA and protein expression. GAPDH siRNA was used as the silencing reference standard. The difference between GAPDH transfected samples and the corresponding negative nu GAPDH mRNA by >85% in either Mtb or Mtb-sigH infected cells (data not shown). Similarly, Ma the Il6 siRNA induced significant reduction of 49% (FC = -1.98) and 65% (FC = -2.86) (P < 0.01) in Il6 mRNA levels in macrophages infected with Mtb and Mtb:-sigH, respectively (Fig 1A). The protein expression levels were also down-regulated by 41% (FC = -1.7) and 47% (FC = -1.9) (P < 0.05) in Mtb and Mtb:-sigH infected cells, respectively (Fig 1B). ted Mtb normally limits the magnitude of Tlr2 activation, thereby preventing robust activation of macrophage pro-inflammatory responses, including Il-6 (21). Thus, we analyzed the expression and efficacy of Il6 silencing in Tlr2-/ bone marrow macrophages infected with Mtb. ep We found that Il6 expression was severely reduced after infection with wild type Mtb as well as with the mutant. The residual levels of Il6 mRNA were higher, but not significant, in Mtb:-sigH Ac c infected cells (Fig 1C). Moreover, the silencing effect was very similar to what was found in wild type infected macrophages. Thus, Il6 mRNA levels were reduced by 47% (FC = -1.88) and 58% (FC= -2.37) (P < 0.01) in Tlr2-/ macrophages infected with Mtb and Mtb:-sigH, respectively (Fig 1C). These results show that increased signaling through Tlr2 leads to higher Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 control was used to calculate the percent remaining GAPDH mRNA. The siRNA knocked down 8 levels of Il-6 by Mtb:-sigH infected macrophages and suggest that SigH functions by limiting sc rip t the magnitude of Tlr2-dependent innate immune response. Despite similar Il6 mRNA levels, Il6 protein levels were significantly lower in Mtb:sigH infected cells compared to Mtb (Fig 1B; p 0.05). Conversely, Mtb:-sigH induced significant higher levels of Il6 gene expression compared to Mtb (Fig 1A; p 0.05). Thus, since microRNAs (miRs) regulate protein translation and/or mRNA destabilization we used a expression profile of miRs from C57BL6/J macrophages infected with Mtb or Mtb:-sigH for 24 hours. From the miRs that were significantly downregulated, let-7a and miR-142-3p directly Ma target Il6 (22-24). Here, let-7a and miR-142-3p were down-regulated in cells infected with Mtb, whereas, only miR-142-3p was found to be significantly down-regulated in cells infected with Mtb:-sigH (Table 2). Since let-7a and miR-142-3p directly inhibit Il6 (22, 24) we suggest the ted down-regulation of both miRs as the mechanism used by the immune system to induce higher levels of Il6 protein as compared to Mtb:-sigH. Effect of Il6 knock-down on bacterial growth ep In order to analyze whether down-regulation of Il6 might affect an already established infection with Mtb, macrophages were silenced for 24 and 48 hours. Briefly, C57BL6/J macrophages were Ac c infected for four hours with Mtb or Mtb:-sigH at an MOI of 1:10 and then the expression of Il6 silenced. Compared to the negative scrambled control, administration of Il6 siRNA for 24 hr had no significant effect on mycobacterial growth for either Mtb strain. However, after 48 hr of silencing CFUs were found to be significantly increased in both Mtb as well as Mtb:-sigH Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 nu microRNA array approach to determine if miRs were involved in Il6 regulation. We analyzed the 9 (p < 0.01) (Fig 2). Hence, reduced Il6 expression resulted in increased susceptibility during sc rip t experimental Mtb infection and indicates that Il6 has an effect on protective immune response. The global transcriptomic response to Il6 silencing To study the impact of Il6 on host phagocytes, we compared the transcriptome profiles of infected C57Bl6/J M silenced for Il6 to those treated with the negative silencing control considered. Thus, when biological replicates of infected C57bl6/J M silenced for Il6 were compared to the infected non-silenced control, the expression of 204 genes was induced by Mtb Ma infection, while the expression of 313 genes was induced by infection with Mtb:-sigH, by at least 50% in each of the duplicate experiments. Of these, 141 genes were induced commonly by infection with either tubercle bacilli. After 24 hours of silencing, interferon inducible genes showed to be up-regulated by both ted Mtb strains (Table 3). However, the expression of these genes was not significantly different in the mutant compared to the wild type Mtb. In addition, pathway analysis of the expression profiles showed that the majority of the transcripts were associated with type I Ifnab signaling. ep These results demonstrate that Il6 down-regulates interferon responses in murine macrophages infected with either Mtb or Mtb:∆-sigH and plays an important role in the process that leads to Ac c disease susceptibility. In order to confirm the results obtained from microarrays we performed quantitative PCR for type I Ifn pathway genes. The expression of Cxcl10, Ifit1, Ifit2, Rsad2 and Irg1 was significantly higher in cells infected with either strain of tubercle bacilli, when Il6 expression was silenced, relative to when the control scrambled RNA was used (Table 3). Conversely, even Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 nu (scrambled siRNA). Genes that showed an alteration in expression by more than 1.5 fold were 10 though the expression of Il15, Cxcl11 and Ifit3 was up-regulated these findings were not sc rip t significant. The expression of three Toll-like receptor (Tlr) genes was differentially regulated following infection with either Mtb strain. However, the differences between the two strains were not significant. Hence, the expression of Tlr2, Tlr3 and Tlr4 was induced by 1.93, 1.70, 1.75 fold, respectively by silencing of Il6 in Mtb infected cells and by 2.06, 1.75, 1.62 fold in those infected with the mutant. Tlrs recognize pathogen-associated molecules, which stimulate nu of cells to type I Ifn likely involves up-regulation of caspases and pro-apoptotic innate sensors, Ma such as Tlrs and the inflammasomes (21, 25). Thus, our results suggest that the knock down of Il6 up-regulates type 1 Ifns, which in turn induce Tlrs in a positive feedback manner. Furthermore, microarray analysis revealed that four genes belonging to the lymphocyte antigen 6 complex (Ly6) were induced in response to Il6 silencing. In mice, expression of Ly6 ted locus encodes a family of 10–12 kDa proteins that are linked to the cell surface by a glycosylphosphatidyl-inositol anchor and have cell signaling and cell adhesion properties (26). Our results showed that while the expression of all four Ly6 genes was higher in Mtb relative to ep the mutant, the expression of Ly6c and Ly6i, but not Ly6a and Ly6f, was higher in a statistically significant manner (Fig 3A; p0.05). Since Type 1 Ifn is directly involved in Ly6c monocyte Ac c differentiation (27) we, thus, suggest that Ly6 genes might play an important role in host defense against Mtb infection. Moreover, the expression of the other four genes Cish, Csf1r, Ifitm6 and Cxcl2, appeared to be significantly different in cells infected with Mtb:∆-sigH mutant relative to the wild type Mtb, when Il6 expression was silenced (Fig 3B). These genes play crucial roles in Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 the efferent limb of the immune system to secrete cytokines and activate macrophages. Exposure 11 immunity against bacterial and viral infections and in governing the extent of disease progression sc rip t and severity. Confirmation of microarray results at the protein level by cytokine/chemokine assay We performed bead array assays for Cxcl10, IFN-, Ccl2 and Il-15 in the supernatants obtained from silenced and infected cells with either Mtb strain. IFN- protein levels were not elevated in chemokine Cxcl10 was increased. Hence, similar to the transcript analysis, silenced macrophages infected with the mutant induced higher levels of Cxcl10 protein (2.2 fold; p0.05) compared to Ma those infected with wild type Mtb (1.5 fold; p>0.05) (Fig. 4A). This result is in accordance to the in vivo study where Ifna2 and Ifng proteins were not elevated in serum from patients with active TB, but Cxcl10 was significantly increased (28). Likewise, even though microarray analysis showed up-regulation of Il15 expression, its ted protein levels could not be detected. This result can be explained by the very short in vivo t1/2 of soluble Il15, as well as the unique mechanism of Il-15 trans-presentation (29). Moreover, since Ly6c-high monocytes, also known as inflammatory monocytes (Ly6chigh/Ccr2+/Cx3cr1low), have ep been shown to be the main producers of Ccl2 in mice (27) and were up regulated in the microarray studies, we looked at Ccl2 protein expression. Results showed that silencing of Il-6 Ac c had no significant effect on Ccl2 protein expression yet, there was a significant difference in the induction between the two strains. Thus, wild type Mtb induced higher levels of Ccl2 compared to the mutant Mtb:∆-sigH, when Il6 was silenced (p0.05) (Fig. 4B). This result shows that the attenuated mutant Mtb:∆-sigH has a delayed activation and recruitment of monocytes to the site of infection compared to the virulent strain. This is consistent with our in-vivo observations, Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 nu the supernatant of macrophages infected with Mtb or Mtb:∆-sigH, although the IFN-inducible 12 where incorporation of BrdU in bone-marrow derived monocytes was significantly induced in sc rip t macaques infected with Mtb, but not Mtb:∆-sigH (18). DISCUSSION Mtb interferes with host signaling pathways activated by Ifng (30-32) for its survival. It exploits Il-6 induction as one of the mechanisms to inhibit Ifng (31). Here, we show that the down- nu transcription of Ifn-related genes (Table 3). This result was validated by significantly increased Ma qPCR transcript and protein levels of Ifn- inducible chemokine Cxcl10 in silenced macrophages (Fig 4A). Although Ifng is known to be protective during immune responses to intracellular pathogens, including mycobacteria the role of type I Ifnab is less clear (25, 33). It has been shown that activation of type I Ifn signaling is crucial for defense against viral infections but may ted be harmful during bacterial, including mycobacterial infections (34-36). Ifn signaling triggers hematopoietic stem cell proliferation (37) and, thus, mediates monocyte differentiation (27). A recent report showed that Ifn-I receptor knockout (Ifnar1-/-) ep mice developed significant defects in the infiltration of Ccl2-producing Ly6chi monocytes in the lung after influenza infection (27). Here, we show that despite the enhanced expression of Ly6 related genes in silenced macrophages the difference of Ccl2 protein levels between silenced and Ac c control infected macrophages were not significant (Fig. 4B). Nonetheless, macrophages infected with virulent Mtb induced higher levels of Ccl2 and had a less effective silencing of Il-6 compared to the attenuated mutant Mtb:∆-sigH. Based on these results and previous in-vivo observations (18), we conclude that Mtb induces an earlier and more robust macrophage Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 regulation of Il6 in murine macrophages infected with virulent or attenuated Mtb induces 13 activation compared to Mtb:∆-sigH and, thus, partially impairs silencing effectiveness. This sc rip t differential activation of macrophages likely confers Mtb, as opposed to Mtb:∆-sigH, the ability to resist host cellular immunity and progress to active disease or to succumb to the host protective responses. In this study, silencing of Il6 prompted significant opposite regulatory effects on the transcript levels of Cxcl2 and Cish in cells infected with Mtb:∆-sigH mutant relative to the Mtb (Fig 3B). Type I Ifn has been shown to inhibit the production of Cxcl2 during influenza nu bacterial infections (25). Here, the down-regulation of Cxcl2 by Mtb:∆-sigH as opposed to the Ma up-regulation by Mtb is consistent with the higher protein levels of IFN-inducible chemokine Cxcl10 presented by Mtb:∆-sigH compared to Mtb infected cells (Fig 4A). On the contrary, Cish was found to be up-regulated in Mtb:∆-sigH and down-regulated in Mtb infected cells. Cish SNPs correlate with increased susceptibility to TB (38) and is essential for the maturation of DCs ted and the generation of an effective CTL response (39). Hence, it appears that Mtb may utilize antigens expressed by the SigH regulon during the infection process via yet to be characterized mechanism(s), to repress the production of Cish. Absence (or reduced expression) of Cish would ep thus result in the maintenance of DCs in an immature phase and prevent the accumulation of an effective CTL response, both of which would be beneficial for the persistence of the pathogen. Ac c The expression of both Ifitm6 and Csf1r was higher upon infection with Mtb:∆-sigH relative to Mtb infected cells (Fig 3B; p0.05). Ifitm6 belongs to the family of interferon-induced transmembrane protein and the higher levels of Ifitm6 found in Mtb:∆-sigH infected cells are a consequence of its more effective silencing. Csf1 and its receptor regulate key effector functions Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 infection, thus decreasing neutrophil recruitment and dampening host defense against secondary 14 of macrophages and contribute to excessive inflammatory responses in sepsis (41). Thus, we sc rip t suggest that SigH may modulate Csf1r to regulate inflammation. Our results showed that overexpression of type I Ifnab-inducible transcripts, caused by the down-regulation of Il6, was concomitant with an increase in bacterial burden after 48 hours of silencing, indicating disease progression. Similarly, an in vivo study showed that Mtb CFUs in lungs from C57BL6/J treated with the soluble inhibitor of Il6 trans-signaling (sgp130Fctg) were slightly but significantly increased after 21 days, but not 14 days, compared to infected control nu study that showed increased expression of type I Ifn-inducible transcripts in the blood of patients Ma with active tuberculosis (28). In addition, to further substantiate the correlation between disease severity and increased type I Ifn response there have been reports of TB reactivation during Ifna treatment for hepatitis C and D viral infection (36, 42). Modulation of pro-inflammatory responses is highly relevant to Mtb pathogenesisand ted here, we show that Mtb dampens Tlr2-dependent pro-inflammatory responses and suggest that the SigH regulon restricts the onset and magnitude of such responses by limiting Tlr2 activation in macrophages. In addition, microarray analysis revealed that Tlr2, Tlr3 and Tlr4 were up- ep regulated upon Il-6 silencing. Accordingly, many of the pro-inflammatory responses, including secretion of Il-6 are down-stream of signaling through Tlrs. We therefore suggest that Tlrs are induced in a positive feedback manner by the knock down of Il6. Ac c Both type I Ifns and Tlr induce Il15 through Myd88 (46). In this study, we provide evidence that Il15 expression is under transcriptional control of type I interferons and Tlrs, which in turn are regulated by Il6. Exogenous Il15 increase NK lytic activity and monocytes have shown to play a regulatory role in NK activation (47). Our microarray experiments showed an Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 mice (9). The deleterious role of type I Ifns in the pathogenesis of TB is corroborated by a recent 15 induction of Il15 upon silencing of Il6, suggesting an indirect effect of Il6 in the activation of NK sc rip t cells. This hypothesis requires further investigation. Recently, studies have demonstrated a role for miRs in the regulation of inflammatory responses (reviewed in 48). Here we used microarray technology to identify miRs that mediate modulation of Il6. It has been reported that let-7a and miR-142-3p directly inhibit Il6 expression (22-24). In view of that, we found that Mtb down-regulates both miRs, whereas, Mtb:-sigH miRs by Mtb, but not Mtb:-sigH, induces higher Il6 gene translation into protein. This posttranscriptional regulation explains the reduced Il6 protein levels presented by Mtb:-sigH Ma infected cells compared to Mtb infected cells and suggests compensation as a defense mechanism. Also, the delayed activation of macrophages infected with Mtb:-sigH results in reduced subsequent inflammatory stimuli and improved silencing efficiency. Thus, it appears that macrophages regulate Il6 production to inhibit type I Ifn-signaling ted and, consequently, disease progression. Our data indicates that a SigH-dependent Mtb factor interacts with the host innate immune system to modulate the Il6 levels, leading to disease susceptibility. These findings have important implications for the better understanding of the ep mechanisms behind Mtb virulence and pathogenesis, although, in order to fully understand the complex signaling network induced by silencing of Il6 additional in vivo experiments are Ac c required. We anticipate that type I IFN acts by increasing the susceptibility of macrophage to apoptosis-inducing stimuli (Trinchieri, 2010). Hence, our data provides an initial roadmap to further investigate the mechanisms that may account for the deleterious effects of type I IFN in Mtb infection. Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 nu down-regulates only miR-142-3p. Thus, we show evidence that the down-regulation of both 16 ACKNOWLEDGEMENTS sc rip t This work was supported in part by NIH grants: AI089323, HL106790, AI091457, RR026006, RR020159, RR000164/OD011104 and C06AI058609 as well as awards from the Howard Hughes Medical Institutes (Kwa-Zulu Natal Research Institute in TB and HIV-AIDS), the Louisiana Vaccine Center (LVC), the Tulane Research Enhancement Fund, the Tulane Center for Infectious Diseases, the Office of the Director, TNPRC and a bridge-grant from the Office of the Vice-President for Professor of Microbiology & Immunology, Tulane National Primate Research Center, 18703 Three dkaushal@tulane.edu ted AUTHOR CONTRIBUTIONS Ma Rivers Road, Bldg 20, Covington, LA, 70433. Tel: (985) 871-6224; Fax: (985) 871-6260; email: Design: ANM, DK; Research: ANM, SM; Data analysis: ANM, SM, DK; Writing: ANM, DK; ep Funding: DK. FOOTNOTES Ac c 1. The authors declare no conflict of interest in connection with this manuscript. 2. All procedures were approved by the Tulane Institutional Biosafety Committee (IBC). Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 nu Research, Tulane University. *Address for correspondence: Dr. Deepak Kaushal, Associate 17 sc rip t REFERENCES 1. Ehrt S, Schnappinger D. 2009. Mycobacterial survival strategies in the phagosome: defence against host stresses. Cell Microbiol. 11:1170–1178. 2. Bhatt K, Salgame P. 2007. Host innate immune response to Mycobacterium tuberculosis. J Clin Immunol. 27:347–362. 3. Flannagan RS, Cosio G, Grinstein S. 2009. Antimicrobial mechanisms of phagocytes and nu 4. Flynn JL, Chan J. 2003. Immune evasion by Mycobacterium tuberculosis: living with the Ma enemy. Curr Opin Immunol. 15:450–455. 5. Harding CV, Boom WH. 2010. Regulation of antigen presentation by Mycobacterium tuberculosis: a role for Toll-like receptors. Nat Rev Microbiol. 8:296–307. 27:393–422. ted 6. Cooper AM. 2009. Cell-mediated immune responses in tuberculosis. Annu Rev Immunol. 7. Roy CR, Mocarski ES. 2007. Pathogen subversion of cell-intrinsic innate immunity. Nat. Immunol. 8:1179–1187. ep 8. Dutta NK, Mehra S, Martinez AN, et al. 2012. The stress-response factor SigH modulates the interaction between Mycobacterium tuberculosis and host phagocytes. PLoS One. 7(1):e28958. Ac c 9. Sodenkamp J, Waetzig GH, Scheller J, et al. 2012. Therapeutic targeting of interleukin-6 trans-signaling does not affect the outcome of experimental tuberculosis. Immunobiology. In press. Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 bacterial evasion strategies. Nat Rev Microbiol.7:355–366. 18 10. Ladel CH, Blum C, Dreher A, Reifenberg K, Kopf M, Kaufmann SH. 1997. Lethal sc rip t tuberculosis in interleukin-6-deficient mutant mice. Infect. Immun. 65: 4843. 11. Saunders BM, Frank AA, Orme IM, Cooper AM. 2000. Interleukin-6 induces early gamma interferon production in the infected lung but is not required for generation of specific immunity to Mycobacterium tuberculosis infection. Infect. Immun. 68: 3322. 12. Nagabhushanam V, Solache A, Ting LM, Escaron CJ, Zhang JY, Ernst JD. 2003. Innate inhibition of adaptive immunity: Mycobacterium tuberculosis-induced IL-6 inhibits nu 13. Leal IS, Smedegard B, Andersen P, Appelberg R. 1999. Interleukin-6 and interleukin-12 Ma participate in induction of a type 1 protective T-cell response during vaccination with a tuberculosis subunit vaccine. Infect. Immun. 67: 5747. 14. Kaushal D, Schroeder BG, Tyagi S, et al. 2002. Reduced immunopathology and mortality despite tissue persistence in a Mycobacterium tuberculosis mutant lacking alternative ted sigma factor, SigH. Proc Natl Acad Sci USA 11: 8330–8335. 15. Mehra S, Kaushal D. 2009. Functional genomics reveals extended roles of the Mycobacterium tuberculosis stress response factor sigmaH. J Bacteriol. 191:3965-80. ep 16. Mehra S, Dutta NK, Mollenkopf HJ, Kaushal D. 2010. Mycobacterium tuberculosis MT2816 encodes a key stress-response regulator. J Infect Dis. 202(6):943-53. 17. Mehra S, Pahar B, Dutta NK, Conerly CN, Philippi-Falkenstein K, Alvarez X, Kaushal Ac c D. 2010. Transcriptional reprogramming in nonhuman primate (rhesus macaque) tuberculosis granulomas. PLoS One 5: e12266. Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 macrophage responses to IFN-gamma. J Immunol. 171:4750-7. 19 18. Mehra S, Golden NA, Stuckey K, et al. 2012. The Mycobacterium tuberculosis stress sc rip t response factor SigH is required for bacterial burden as well as immunopathology in primate lungs. J Infect Dis. 205:1203-13. 19. Gautam A, Dixit S, Philipp MT, Singh SR, Morici LA, Kaushal D, Dennis VA. 2011. Interleukin-10 alters effector functions of multiple genes induced by Borrelia burgdorferi in macrophages to regulate Lyme disease inflammation. Infect Immun. 79:4876-92. 20. Bao L, Hazari S, Mehra S, Kaushal D, Moroz K, Dash S. 2012. Increased Expression of nu Regulated by miR-298. Am J Pathol. 180:2490-503. Ma 21. Madan-Lala R, Peixoto KV, Re F, Rengarajan J. 2011. Mycobacterium tuberculosis Hip1 dampens macrophage proinflammatory responses by limiting toll-like receptor 2 activation. Infect Immun. 279(12):4828-38. 22. Iliopoulos D, Hirsch HA, Struhl K. 2009. An epigenetic switch involving NF-kappaB, 139(4):693-706. ted Lin28, Let-7 MicroRNA, and IL6 links inflammation to cell transformation. Cell. 23. Nam Y, Chen C, Gregory RI, Chou JJ, Sliz P. 2011. Molecular basis for interaction of ep let-7 microRNAs with Lin28. Cell. 147:1080-91. Epub 2011 Nov 10. 24. Sun Y, Varambally S, Maher CA, Cao Q, Chockley P, Toubai T, Malter C, Nieves E, Tawara I, Wang Y, Ward PA, Chinnaiyan A, Reddy P. 2011. Targeting of microRNA- Ac c 142-3p in dendritic cells regulates endotoxin-induced mortality. Blood. 117:6172-83. 25. Trinchieri G. 2010. Type I interferon: friend or foe? J Exp Med. 207:2053-2063. Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 P-Glycoprotein and Doxorubicin Chemoresistance of Metastatic Breast Cancer Is 20 26. Bamezai A. 2004. Mouse Ly-6 proteins and their extended family: markers of cell sc rip t differentiation and regulators of cell signaling. Arch Immunol Ther Exp (Warsz). 52(4):255-66. 27. Seo SU, Kwon HJ, Ko HJ, et al. 2011. Type I interferon signaling regulates Ly6C(hi) monocytes and neutrophils during acute viral pneumonia in mice. PLoS Pathog. 7(2):e1001304. 28. Berry MP, Graham CM, McNab FW, et al. 2010. An interferon-inducible neutrophil- nu 29. Colpitts SL, Stoklasek TA, Plumlee CR, Obar JJ, Guo C, Lefrançois L. 2012. Cutting Ma edge: the role of IFN-α receptor and MyD88 signaling in induction of IL-15 expression in vivo. J Immunol. 188(6):2483-7. 30. Fortune SM, Solache A, Jaeger A, et al. 2004. Mycobacterium tuberculosis inhibits macrophage responses to IFN-gamma through myeloid differentiation factor 88- ted dependent and -independent mechanisms. J Immunol 172: 6272–6280. 31. Pai RK, Convery M, Hamilton TA, Boom WH, Harding CV. 2003. Inhibition of IFNgamma-induced class II transactivator expression by a 19-kDa lipoprotein from ep Mycobacterium tuberculosis: a potential mechanism for immune evasion. J Immunol 171: 175–184. 32. Casanova JL, Abel L. 2002. Genetic dissection of immunity to mycobacteria: the human Ac c model. Annu. Rev. Immunol. 20: 581–620. 33. Decker T, Muller M. & Stockinger, S. 2005. The yin and yang of type I interferon activity in bacterial infection. Nature Rev Immunol. 5: 675–687. Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 driven blood transcriptional signature in human tuberculosis. Nature. 466(7309):973-7. 21 34. Manca C et al, Hypervirulent M. tuberculosis W/Beijing strains upregulate type I IFNs sc rip t and increase expression of negative regulators of the Jak-Stat pathway. J. Interferon Cytokine Res. 25, 694–701 (2005). 35. Ordway D et al, The hypervirulent Mycobacterium tuberculosis strain HN878 induces a potent TH1 response followed by rapid down-regulation. J. Immunol. 179, 522–531 (2007). 36. Telesca C, Angelico M, Piccolo P, et al. 2007. Interferon-alpha treatment of hepatitis D nu 37. Essers MA, Offner S, Blanco-Bose WE, Waibler Z, Kalinke U, et al. (2009. IFNalpha Ma activates dormant haematopoietic stem cells in vivo. Nature 458: 904–908. 38. Khor CC, Vannberg FO, Chapman SJ, et al. 2010. CISH and susceptibility to infectious diseases. N Engl J Med. 362:2092-101. 39. Miah MA, Yoon CH, Kim J, Jang J, Seong YR, Bae YS. 2012. CISH is induced during ted DC development and regulates DC-mediated CTL activation. Eur J Immunol. 42:58-68. 40. Sadagopal S, Braunstein M, Hager CC, et al. 2009. Reducing the activity and secretion of microbial antioxidants enhances the immunogenicity of BCG. PLoS One. 4:e5531. ep 41. Irvine KM, Burns CJ, Wilks AF, Su S, Hume DA, Sweet MJ. 2006. A CSF-1 receptor kinase inhibitor targets effector functions and inhibits pro-inflammatory cytokine Ac c production from murine macrophage populations. FASEB J. 20:1921-3. 42. Sabbatani S, Manfredi R, Marinacci G, Pavoni M, Cristoni L, Chiodo F. 2006. Reactivation of severe, acute pulmonary tuberculosis during treatment with pegylated interferon-alpha and ribavirin for chronic HCV hepatitis. Scand J Infect Dis. 38:205-8. Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 induces tuberculosis exacerbation in an immigrant. J. Infect. 54: e223–e226. 22 43. Lopez B, Aguilar D, Orozco H, et al. 2003. A marked difference in pathogenesis and sc rip t immune response induced by different Mycobacterium tuberculosis genotypes. Clin. Exp. Immunol. 133:30–37. 44. Manca C, Reed MB, Freeman S, Mathema B, Kreiswirth B, Barry CE 3rd, Kaplan G.. 2004. Differential monocyte activation underlies strain specific Mycobacterium tuberculosis pathogenesis. Infect. Immun. 72:5511–5514. 45. Reed MB, Domenech P, Manca C, et al. 2004. A glycolipid of hypervirulent tuberculosis nu 46. Mattei, F., G. Schiavoni, F. Belardelli, and D. F. Tough. 2001. IL-15 is expressed by Ma dendritic cells in response to type I IFN, double-stranded RNA, or lipopolysaccharide and promotes dendritic cell activation. J. Immunol. 167: 1179–1187. 47. Schierloh P, Alemán M, Yokobori N, Alves L, Roldán N, Abbate E, del C Sasiain M, de la Barrera S. 2005. NK cell activity in tuberculosis is associated with impaired CD11a 116(4):541-52. ted and ICAM-1 expression: a regulatory role of monocytes in NK activation. Immunology. 48. O'Connell RM, Rao DS, Chaudhuri AA, Baltimore D. 2010. Physiological and ep pathological roles for microRNAs in the immune system. Nat Rev Immunol. 10:111-122. Ac c Trinchieri G. 2010. Type I interferon: friend or foe?J Exp Med. 207(10): 2053-2063. Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 strains that inhibits the innate immune response. Nature 431:84–87. 23 sc rip t TABLE FOOTNOTES Table 1. Primer sequences and IDs. This table describes the oligonucleotide sequences for those mouse DNA-specific primers that were specifically designed by us for quantitative PCR experiments (Il6, 18S rRNA and Gapdh) as part of this study. Mouse genome specific-primers Table 2. MicroRNA levels. Cells were infected with Mtb and Mtb:-sigH for 24 hrs and microRNA levels assessed in total isolated RNA as described in “Materials and Methods”. Here Ma we specifically assessed the expression of let-7a and miR-142-3p, two microRNAs that are known to target Il6. FC indicates difference in fold change in cells infected with either Mtb and Mtb:-sigH relative to uninfected cells. ted Table 3. Key immune function genes which exhibit an elevated expression following Il6 silencing concomitant with either Mtb or Mtb:-sigH infection. The microarray expression fold-change values of nine key immune function genes are shown following Il6 silencing along ep with either infection with either Mtb or Mtb:-sigH, relative to the use of control scrambled Ac c RNA. Quantitative PCR fold-changes and P-values are also shown. FIGURE LEGENDS Figure 1. Il6 gene silencing treatment of C57BL6/J macrophages infected with Mtb or Mtb:-sigH. (A) Wild type cells were incubated in the presence of Il6 siRNA or scrambled control for 24 h. Il6 induction was evaluated by real-time PCR analysis performed as described Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 nu were generated for Cxcl10, Cxcl11, Il15, Irg1, Ifit1, 2 and 3 using PrimerBank IDs. 24 in ‘Materials and Methods’ section. (B) Tlr2-/- cells were incubated in the presence of Il6 siRNA sc rip t or negative scrambled control for 24 hours. (C) Culture supernatants from wild type treated cells were assayed for Il6 ELISA. The results are the means ± SE of three independent experiments. *, P < 0.05; ** P < 0.01. Figure 2. Bacterial burden following treatment with Il6 siRNA in C57BL6/J cells infected mycobacterial growth for either Mtb strain. After 48 h of silencing, CFUs were found to be significantly increased in both silenced Mtb strains *, P < 0.05; ** P < 0.01. This figure shows Ma the means ± standard deviations for three biological replicates. Figure 3. Comparison of host immunity gene expression in C57BL6/J macrophages infected with Mtb or Mtb:-sigH and transfected with Il6 siRNA. (A) Ly6 genes expression ted and (B) Cish, Csf1r, Ifitm6, Cxcl2. Expression values are shown for DNA microarray experiments. Results for Mtb infected cells are represented by green circles, while those for Mtb:-sigH are represented by the red boxes. Values represent responses that were statistically Ac c P < 0.01. ep different between the Il-6 siRNA versus scrambled negative control treatments *, P < 0.05; ** Figure 4. Enhanced induction of Cxcl10 by Il6 siRNA treatment. Macrophages from C57BL6/J were infected with the wild type Mtb or the Mtb:-sigH mutant strain and transfected with Il6 siRNA. Supernatants were collected at 24 h post silencing and assayed for (A) Cxcl10 and (B) Ccl2 by a cytokine milliplex™ assay. Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 nu with Mtb or Mtb:-sigH. Administration of Il6 siRNA for 24 hr had no significant effect on A ns 2500 * *** Mtb Mtb:Δ‐sigH 2ΔΔ%& 2000 1500 1000 sc 0 *** 500 *** *** Ma pg/mL 400 nu B 300 200 Ac ce pte d 100 0 Mtb Mtb:Δ‐sigH C ns ns 4 ** 3 2ΔΔ%& rip t 500 2 1 0 Mtb Mtb:Δ‐sigH Scrambled Ctrl siRNA IL-6 siRNA u s c r i p t a n d M A c c e p t e 26 Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 u s c r i p t a n d M A c c e p t e 27 Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 u s c r i p t a n d M A c c e p t e 28 Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 29 Table 1. Primer sequences and ID numbers. IL-6 PrimerBank ID Fwd: 5’ CCACGGCCTTCCCTACTTC3’ Rev: 5’ TTGGGAGTGGTATCCTCTGTGA3’ 18S rRNA Fwd: 5' TTGACGGAAGGGCACCACCAG 3' Rev: 5' GCACCACCACCCACGGAATCG 3' - - - - Rev: 5’ ACCAGTGGATGCAGGGATGATGTT 3’ - Rsad2 - 237512932c1 CXCL-10 - CXCL-11 - IL-15 - Irg1 - Ifit1 - Ifit2 - Ifit3 - nu - 371940989c1 9507070c1 Ma 363000959c1 ep Ac c 950650a1 145301610c3 162461505c1 6754288a1 Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 Fwd: 5’ CTTTGGCATTGTGGAAGGGCTCAT 3’ ted GAPDH sc rip t Primer sequence Target 30 Table 2. MicroRNA levels microRNA Mtb-∆sigH FC FC let-7a -2.3 - miR-142-3p -2.3 -2.1 Ma ted ep Ac c Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 nu sc rip t Mtb 31 Table 3. FC array FC array name Mtb Ifit2 Ifit3 Rsad2 Irg1 Mtb:∆sigH (p‐vaue) (p‐value) (p‐value) (p‐value) 2.83 3.13 2.2 2.7 (0.05) (0.01) 1.5 1.4 (NS) (NS) 1.89 1.73 (NS) (NS) 2.14 2.13 (0.05) (0.05) 1.76 1.65 2.76 1.92 1.72 2.41 2.35 3.45 2.07 1.53 2.33 2.14 1.60 2.17 1.97 3.05 2.09 1.63 Ac c ep Igtp Mtb (0.01) (0.001) 1.81 1.41 (NS) (NS) 2.14 2.13 (0.05) (0.05) 1.91 1.72 (0.001) (0.001) ND ND Downloaded from http://jid.oxfordjournals.org/ by guest on April 6, 2016 Ifit1 Mtb:∆sigH nu IL15 FC qPCR Ma Cxcl11 FC qPCR ted Cxcl10 FDR sc rip t Gene