Fungal Genetics and Biology 40 (2003) 115–125
www.elsevier.com/locate/yfgbi
Further evidence for sexual reproduction in Rhynchosporium
secalis based on distribution and frequency of mating-type alleles
Celeste C. Linde,* Marcello Zala, Sara Ceccarelli, and Bruce A. McDonald
Institute of Plant Sciences, Plant Pathology Group, Federal Institute of Technology, ETH-Zentrum, LFW, CH-8092 Z€urich, Switzerland
Received 19 March 2003; accepted 25 July 2003
Abstract
Rhynchosporium secalis, the causal agent of scald on barley, is thought to be exclusively asexual because no teleomorph has been
found. Partial sequences of the HMG-box and a-domain of Rhynchosporium secalis isolates were identified and used to develop a
PCR assay for the mating-type locus. PCR amplification of only one of these two domains was possible in each strain, suggesting
that R. secalis has a MAT organization that is similar to other known heterothallic fungi. A multiplex PCR with primers amplifying
either a MAT1-1- or MAT1-2-specific amplicon was used to determine the distribution of mating types in several R. secalis populations. In total, 1101 isolates from Australia, Switzerland, Ethiopia, Scandinavia, California, and South Africa were included in
the analysis. Mating types occurred in equal frequencies for most of these populations, suggesting frequency-dependent selection
consistent with sexual reproduction. In addition, both mating types were frequently found occupying the same lesion or leaf,
providing opportunities for isolates of opposite mating type to interact and reproduce sexually. We propose that R. secalis should be
considered a sexual pathogen, although the sexual cycle may occur infrequently in some populations.
Ó 2003 Elsevier Inc. All rights reserved.
Keywords: Rhynchosporium secalis; Mating-type gene; a-Domain; HMG-domain; MAT locus; Mating type frequency; Sexual reproduction
1. Introduction
Rhynchosporium secalis is a haploid imperfect fungus
(deuteromycete) that causes scald on barley and various
other Gramineae hosts (Caldwell, 1937; Shipton et al.,
1974). The disease is present in all barley-growing areas
and is particularly damaging in temperate regions with
cool, moist winters. In regions of intensive barley production where environmental conditions are conducive
for disease, severe attacks of scald have caused yield
losses as high as 35–40% (James et al., 1968; Shipton
et al., 1974), although losses of 1–10% are more common (Shipton et al., 1974). The seed-borne nature of the
pathogen (Shipton et al., 1974) allows it to spread to
new locations via man-mediated gene flow. In a field,
short distance dispersal (up to a few meters) is achieved
by splash dispersal of conidia (McDonald et al., 1999;
Shipton et al., 1974). Although a teleomorph has never
*
Corresponding author. Fax: +41-1-632-15-72.
E-mail address: celeste.linde@ipw.agrl.ethz.ch (C.C. Linde).
1087-1845/$ - see front matter Ó 2003 Elsevier Inc. All rights reserved.
doi:10.1016/S1087-1845(03)00110-5
been identified, high pathogenic variation (e.g.,
McDermott et al., 1989) and high levels of genetic variation for neutral markers (McDermott et al., 1989;
McDonald et al., 1999; Salamati et al., 2000) are consistent with the presence of a teleomorph, most likely to
be a discomycete (Goodwin, 2002). The closest known
relative was shown to be Tapesia yallundae (Goodwin,
2002) which is heterothallic.
An important question regarding R. secalis is whether
it has the potential for sexual recombination as suggested by allele frequencies and lack of multilocus associations observed with RFLP and isozyme markers
(Goodwin et al., 1993; McDonald et al., 1999; Salamati
et al., 2000). The MAT genes of several heterothallic
ascomycetes have been cloned and identified recently
(reviewed in P€
oggeler, 2001). Heterothallic ascomycetes
require contributions from two genetically distinct parents to reproduce sexually. This process is controlled by
a single locus referred to as mating type (MAT) (Coppin
et al., 1997; Turgeon, 1998), which has two different
idiomorphs. Although the identification of MAT loci
116
C.C. Linde et al. / Fungal Genetics and Biology 40 (2003) 115–125
has become nearly routine for ascomycetes, it was only
recently that mating types could also be identified in
asexual fungi using PCR-based approaches (Arie et al.,
1997). So far, no teleomorph has been identified for
R. secalis, therefore determination of mating type using
traditional mating studies with tester strains was not
possible. Instead, we took the approach of identifying
the HMG- and a-boxes present in R. secalis using a
PCR-based approach based on primers designed from a
close relative, T. yallundae.
The presence of MAT genes is not sufficient to prove
the existence of a asexual stage or to confirm random
mating. However, if frequency-dependent selection is
operating on MAT genes (May et al., 1999), then mating
types should occur in equal frequencies (Milgroom,
1996). Many studies have attempted to determine mating type frequencies for various ascomycetes in the past,
with findings consistent with random mating based on
equal mating type frequencies in Tapesia acuformis and
T. yallundae (Douhan et al., 2002), Mycosphaerella
graminicola (Zhan et al., 2002), Ascochyta rabiei (Armstrong et al., 2001), some Cryphonectria parasitica
populations (Liu et al., 1996), and Cochliobolus carbonum (Welz and Leonard, 1995). Skewed mating type
ratios consistent with lack of sexual reproduction or
differences in fertility between mating types were found
for Magnaporthe grisea populations (Dayakar et al.,
2000; Mekwatanakarn et al., 1999; Notteghem and Silue, 1992; Viji and Uddin, 2002) and Ascochyta fabae f.
sp. lentis in Canada (Ahmed et al., 1996).
Asexual (mitosporic) fungi also have MAT genes as
identified for Bipolaris sacchari (Sharon et al., 1996b), as
well as Fusarium oxysporum and Alternaria alternata
(Arie et al., 2000; Sharon et al., 1996b). Organization of
mating-type idiomorphs in asexual fungi is similar to
that of sexually reproducing ascomycetes (Arie et al.,
2000). But the strains of asexual fungi do not interact to
reproduce sexually. It has been shown that asexuality in
these fungi results from a loss of function in genes other
than the MAT loci, as MAT1-2 of B. sacchari (Sharon
et al., 1996a) and MAT genes of A. alternata (Arie et al.,
2000) were confirmed to be functional in a close sexual
relative, Cochliobolus heterostrophus, by heterologous
expression.
The MAT-idiomorphs lack significant sequence similarity (Turgeon, 1998), except for the flanking regions
(Coppin et al., 1997). In ascomycetes, MAT idiomorphs
encode for proteins with confirmed or putative DNAbinding motifs, i.e., MAT1-2 encodes a high mobility
group (HMG) protein and MAT1-1 isolates encode an
a-domain protein (Kronstad and Staben, 1997; Turgeon, 1998). In homothallic species, each isolate carries
both MAT1-1 and MAT1-2 genes, usually closely linked
or fused (Yun et al., 2000). In this report, strains carrying the idiomorph which encodes a protein with an
a-box motif are designated MAT1-1, and strains carry-
ing the idiomorph that contains the HMG-motif are
designated MAT1-2, following nomenclature suggested
by Turgeon and Yoder (Turgeon and Yoder, 2000).
The objectives of this research were (i) to partly
identify the MAT loci in R. secalis. This was to enable us
to design primers for rapid identification of R. secalis
mating types, and (ii) to determine the mating type
frequencies of several R. secalis populations across
spatial scales ranging from field plots to continents.
Although equal mating type frequencies can be obtained
by chance, equal frequencies across many spatial scales
indicates the occurrence of sexual reproduction due to
frequency-dependent selection. Equal mating type frequencies would provide evidence additional to the index
of association tests conducted previously (Salamati
et al., 2000) showing that RFLP alleles in these populations are in gametic equilibrium, consistent with the
occurrence of sexual reproduction in R. secalis.
2. Materials and methods
2.1. Fungal isolation and DNA extraction
Isolation of small mycelial tufts from lesion borders
was as described previously (McDonald et al., 1999).
For the Californian, Scandinavian, and Australian
populations, DNA was extracted as described previously (McDonald et al., 1999), but for populations from
Switzerland, Ethiopia, and South Africa, DNA was
extracted with the DNeasy Plant Mini DNA extraction
kit (Qiagen GmbH, Hilden, Germany) according to the
specifications of the manufacturer.
2.2. Population descriptions
For clone-corrected data sets, barley leaves were
collected from 21 geographic locations in six countries
representing four continents. Leaves were collected from
naturally infected fields at a single point in time. The
biggest collection was made from Australia (Aus) in
1996 where seven field populations were sampled (McDonald et al., 1999). The infected leaves of collection 1
were sampled along four parallel transects from cultivar
Clipper planted at the Wagga Wagga Agricultural Institute, New South Wales. One leaf was collected at
30 cm intervals along 6 m transects which were separated
by 18 cm. Collection 2 was made from the same plot as
collection 1, but 30 days later near the end of the
growing season. The total geographic area covered in
this field was 4.3 m2 for collections 1 and 2. The remaining Australian collections, except collections 4 and
5, were taken from farmerÕs fields using a larger scale
six-site hierarchical sampling strategy as described previously (McDonald et al., 1999). Hierarchical collections
covered a total geographic area of 200 m2 , although only
C.C. Linde et al. / Fungal Genetics and Biology 40 (2003) 115–125
6 m2 was represented by the collection of leaves taken
from each field. Collection 3 was made from cultivar
OÕConner grown at Methul, New South Wales. Collection 4 was from barleygrass bordering the OÕConnor
field of collection 3 covering an area of 15 m2 . This
collection was unordered because very few infected
leaves were found. Collection 5 was from a 200 m
transect of bromegrass and barleygrass alongside a field
of cultivar Schooner at Rannock, New South Wales,
covering an area of 200 m2 , though only 10 m2 was
represented by the collection of leaves. Collection 6 was
from cultivar Arapolis planted at Horsham, Victoria.
Collection 7 was from cultivar Stirling planted at
Quindanning near Perth, Western Australia. This was
the only collection from Australia where seed was
treated with triadimenol.
In Switzerland (CH), infected leaves were collected
from six fields. Collection 1 was from an unknown
barley variety near Leuggern, Canton Aargau, collection
2 from a two-component mixture of unknown varieties
of two-row barley, near Lucens, Canton Vaud, and
collection 3 was from an unknown commercial two-row
variety planted near Cugy, Canton Vaud. These collections were eight-site hierarchical collections covering a
total geographic area of 300 m2 for each collection,
although only 8 m2 was represented by the collection
of leaves. Collection 4 originated from experimental
barley plots near the Reckenholz experimental station,
Canton Z€
urich. This collection was an eight-site unordered hierarchy, with each site representing a different
field plot measuring 1.5 m 3 m, and 15 leaves taken
equally spaced from each of these plots. The total geographic area covered by this collection was 800 m2 ,
although only 36 m2 was represented by the collection
of leaves. Collection 5 was from cultivar Baretta planted
at Eschikon, Canton Z€
urich, along two parallel transects separated by 2 m, covering a total geographic
area of 100 m2 . Collection 6 was from an unknown variety collected from a bio-farm near Dietikon, Canton
Z€
urich. Collection 6 was based on two parallel transects
separated by 3 m, covering a total geographic area of
120 m2 . Distances between collections from Switzerland ranged from 20 to 200 km.
The collections from Ethiopia (ET) were all collected
in 2002 from the highlands of Ethiopia. Collections 1
and 2 were from Edagahamus and Atsbi in the southern
part of the Tigrai region, and collections 3 and 4 from
Adineba and Zata in the northern Tigrai region. Distances between these fields ranged from 20 to 200 km.
Collections were made from unknown local varieties, in
an eight-site hierarchy, each covering a total geographic
area of 300 m2 , although only 8 m2 was represented
by the collection of leaves. Collections from Norway
were both from cultivar Tyra, collection 1 from southeastern Norway planted near Buskerud, and collection 2
from central Norway near Størdal. The collection from
117
Finland was from the cultivar Kymppi near Joikioinen.
All Scandinavian collections were hierarchical, covering
total geographic areas of 400, 18, and 400 m2 , respectively (Salamati et al., 2000).
The collection from California was a representative
sub-sample of a large, single field collection made in
1988 and characterized previously (McDermott et al.,
1989). This collection was from Composite Cross II and
CCV in Davis, California, covering an area of 200 m2 .
However, the crop area represented in this population
was much less (50 m2 ), as only a sub-sample of the
original collection was analyzed in this study. Leaves
were also collected from two locations in South Africa.
SA1 was an unordered collection from an unknown
cultivar near Bredasdorp from a 15 m2 area. SA2 was
collected along two 20 m transects separated by 1 m
from different F2 crosses at the Langewens experimental
station near Malmesbury.
2.3. Amplification of the HMG-box and a-domain by
PCR
PCR primers designed from the HMG-box (TyHMG
3131F and TyHMG 3668R) in MAT1-2 isolates, and the
a-domain (TyMat1 348F and TyMat1 1400R, primer
sequences in Table 1) in MAT1-1 isolates of T. yallundae
(idiomorph sequences provided by Dr. P. Dyer, Nottingham University, UK) were used in attempts to amplify the respective regions in R. secalis on a subset of 24
isolates of R. secalis from California, Scandinavia,
Australia, and Switzerland. Annealing temperatures for
all possible primer combinations were determined with a
gradient cycler (Biometra). Consequently, annealing
temperatures of 52 °C were used to amplify the highmobility group (HMG) region present in all ascomycete
MAT loci (Turgeon, 1998). Each PCR mixture contained 5–10 ng of genomic DNA in 20 ll reaction volumes containing 10 pmol of each primer, 0.1 mM dNTPs
(dATP, dCTP, dTTP, and dGTP), 2 ll of 10 reaction
buffer, and 0.5 U Taq polymerase (Amersham Pharmacia Biotech). For analyses of PCR products, 10 ll of
each reaction was subjected to agarose gel (1%) electrophoresis in 0.5 TBE buffer, and stained with ethidium bromide.
2.4. Amplification of HMG-box flanks by thermal asymmetric interlaced PCR
Thermal asymmetric interlaced PCR (TAIL-PCR)
with degenerate primers AD1, AD2, AD3, and AD4
(Liu and Whittier, 1995) and nested primers designed
within the HMG-box of R. secalis (Table 1), was performed to obtain upstream and/or downstream sequences of the HMG-box. TAIL-PCR was used to
extend the already identified sequence of the HMG-box
(400 bp) obtained with the T. yallundae MAT1-2
118
C.C. Linde et al. / Fungal Genetics and Biology 40 (2003) 115–125
Table 1
Primer sequences used to identify the HMG-box and a-domain of Rhynchosporium secalis
Primer
Sequence
Notes
TyHMG 3131F
TyHMG 3668R
RsHMG 356R
RsHMG 212R
RsHMG 336F
RsHMG 275F
RsHMG 297R
TyMAT1 348F
TyMAT1 1400R
RsMAT1F
RsMAT1R
RsMAT2F
RsMAT2R
TTCTCTGCTCCCGAGGATGC
CAGGTTGTGGTTGACGATGTC
GTATTGCTCTCTGATCTCGG
GTGGTCGATGTTGGAATAGATG
CCGAGATCAGAGAGCAATAC
GTACAACGTCGATGATGCCTCCG
CGGAGGCATCATCGACGTTGTAC
GAGCGAGAAATCCATCCTG
GTTACAGCGATGACTCCAGCG
CCAACGATCCGCCTAGCCACA
CATCGACAAGTAGCCACAGCT
CATCTATTCCAACATCGACCAC
CTCCTTGTATTGCTCTCTGATC
Initial amplification of HMG-box
Initial amplification of HMG-box
Primary TAIL-PCR
Tertiary TAIL-PCR
Tertiary TAIL-PCR
Secondary TAIL-PCR
Secondary TAIL-PCR
Identification of a-domain
Identification of a-domain
Multiplex
Multiplex
Primary TAIL-PCR, Multiplex
Multiplex
HMG-box primers, as described by Arie et al. (2000).
PCR conditions for TAIL-PCR were as described by
Liu and Whittier (1995), and primer sequences used for
the primary, secondary and tertiary PCRs are given in
Table 1.
2.5. Sequencing of PCR products
PCR products were extracted from gel slices with the
QIAquick Gel Extraction Kit (Qiagen, GmbH, Hilden,
Germany), or sequenced directly if only one amplicon
was present. Sequencing was performed on a ABI 3100
cycler using Taq-Cycle automated sequencing with
DyeDeoxy Terminators (BigDye Terminator v3.0 Cycle
Sequencing Ready Reaction; Applied Biosystems) with
both primers (except degenerate primers) to ensure reliability of the sequence data. Sequences were assembled
and aligned with Sequencher 4.1 (Gene Codes Corporation, Ann Arbor, Michigan). Sequence data from the
extreme primer ends of the products were omitted due to
possible errors resulting from misincorporation of
basepairs. BLAST searches (Altschul et al., 1997) and
BLAST2 (Tatusova and Madden, 1999) were done
against the NCBI/GenBank databases.
2.6. Multiplex PCR
Primers were designed from the sequences of the
HMG-box and a-domain of R. secalis. Primer pair
RsMAT1F and RsMAT1R amplified a 590 bp fragment in MAT1-1 isolates. Primer pair RsMAT2F and
RsMAT2R amplified a 360 bp fragment in MAT1-2
isolates. To confirm that these primers amplified the
mating-type idiomorphs of R. secalis, 60 randomly
selected isolates from California, Scandinavia, Australia, and Switzerland were amplified with the matingtype-specific primers. In all cases, only products
resembling either the MAT1-1- or MAT1-2-specific
bands were obtained. These primer combinations were
also tested on two isolates of T. yallundae (DNA
obtained from T.D. Murray, Washington State University, USA).
A mixture of all four primers was used in a multiplex
PCR to generate either the 590 or 360 bp fragment in
all isolates. All PCRs were conducted in 20 ll reaction
volumes containing 10 pmol of each primer, 5–20 ng
genomic DNA as template, 0.1 mM dNTPs (dATP,
dCTP, dTTP, and dGTP), 2 ll of 10 reaction buffer,
and 0.5 U Taq polymerase (Amersham Pharmacia Biotech). PCR was always performed on a Biometra thermocycler with the following conditions: an initial hold at
96 °C for 2 min, 40 cycles of 96 °C for 1 min, 58 °C for
1 min, 72 °C for 1 min; and a final hold at 72 °C for
5 min. Products (7 ll of reaction mixture) were separated
in 1% agarose gels, 0.5 TBE, and stained with ethidium bromide. All gel images were captured digitally.
2.7. Microgeographical distribution of mating types
(within lesions and leaves)
Spatial distribution of R. secalis mating types within
leaves and lesions were determined on heavily infected
barley leaves from the South African collections SA1
and SA2. One strain was isolated from each of three to
five lesions per leaf from SA1. Similarly, one strain was
isolated from each of two to seven lesions per leaf from
SA2. Two strains were isolated from one of the lesions
from each of the six leaves. In addition, multiple isolations from 12 lesions were made for the Australian
population, and two to three strains were isolated from
each of 50 leaves.
2.8. Macrogeographical distribution of mating types
(within fields and regions)
The mating type frequencies of a much larger collection of isolates (N ¼ 1101) representing four continents
(Africa, Europe, North America, and Australia) and 23
field populations (seven from Australia, six from Switzerland, four from Ethiopia, three from Scandinavia,
C.C. Linde et al. / Fungal Genetics and Biology 40 (2003) 115–125
one from California, and two from South Africa), was
determined using a multiplex PCR.
2.9. Clone correction
The fungal data set was clone-corrected for each
population using RFLPs. Clones were identified with
seven single-locus probes and one multicopy probe, pRS
26 (McDonald et al., 1999). In the case of the Swiss and
Ethiopian populations, the hybridization pattern obtained with the pRS 26 DNA fingerprint probe was too
simple to be used as a fingerprint (data not shown).
Instead, an Operon RAPD primer, OPL11 (Qiagen
Operon Technologies) was used with PCR conditions as
described in Liebhard et al. (2002) to obtain a fingerprint pattern that was combined with the data from the
individual RFLP loci. R. secalis isolates having the same
multilocus haplotype and DNA fingerprint were considered individual members of the same genotype (clone)
resulting from asexual reproduction. Only one isolate
from each clone was included in the analysis of mating
type frequency. Isolates from South Africa were not
analyzed using RFLPs or RAPDs. Instead, clones were
distinguished using rep-PCR with primers ERIC2F and
BOXA1R (Versalovic et al., 1991, 1994). PCR mixtures
for rep-PCR were similar to that of the multiplex reactions except with using the rep-PCR primers as stated
above. PCR conditions were; an initial hold at 96 °C for
2 min, then 35 cycles of 94 °C for 30 s, 52 °C for 1 min,
65 °C for 5 min; and then a final hold at 65 °C for 8 min.
Isolates having the same multilocus rep-PCR patterns
were considered clones.
2.10. Data analyses
Isolates were pooled across different spatial scales in a
hierarchy to determine mating type distribution within
lesions, within leaves, within field plots, within field
populations, and within country or region. To avoid
bias due to the repeated sampling of the same clone,
analyses were performed on a clone-corrected data set
only. We tested whether the proportion of MAT1-1 and
MAT1-2 isolates were equal in the populations studied.
A v2 test (Everitt, 1977) was used to determine whether
departures from a 1:1 frequency were significant. Contingency v2 analyses were performed on subpopulations
within a country (Everitt, 1977). This analysis determines whether individual subpopulations (different
fields in this case) within a larger population (country or
region in this case) differ in mating type frequency. In
addition, an exact binomial test for goodness-of-fit was
performed to determine whether observed mating type
frequencies within populations fit an empirical 1:1 ratio
(null hypothesis). When sample sizes are small, the exact
binomial test is more accurate than a v2 test (Sokal and
Rohlf, 1995).
119
3. Results
3.1. Amplification of the HMG-box and a-domain by
PCR
The primer pair TyHMG 3131F and TyHMG 3668R
did not amplify any fragment of the expected size
(540 bp) in any of the 24 isolates used. In three of the
isolates a 850 bp product, and in another three isolates
a 300 bp product was amplified. These products were
sequenced for isolate RS99CH5D6a (850 bp product)
and RS99CH5A7b (400 bp product). The sequence of
the small fragment did not show any similarity with
known HMG-boxes with a BLAST search. The larger
fragment (only 400 bp of reliable sequence was obtained)
showed high similarity with the MAT1-2 HMG-domain
of T. yallundae (97%) and M. graminicola (92%). TAILPCR was then used to extend this sequence. The tertiary
sequenced TAIL-PCR product of RsHMG 212R and
AD4 of 600 bp aligned to the existing 400 bp HMGdomain and extended this sequence to 679 bp (Accession
No. AY257473). The sequences between basepairs 337–
659 and 89–202 of R. secalis showed 80% similarity (E
value ¼ 7 1063 ) and 79% similarity (7 108 ), respectively to basepair regions 3230–3551 and 2972–3087
of the MAT1-2 HMG-domain of T. yallundae.
To identify MAT1-1 isolates, primer pair TyMAT1
348F and TyMAT1 1400R amplified a 1020 bp product of expected size in seven of the 24 isolates. None of
these seven isolates also gave an amplification product
with the TyHMG primers. The 1050 bp fragment of
isolate R14 was sequenced, and a 858 bp reliable sequence was obtained (Accession No. AY257472). The
sequence between bases 1–155 showed 80% similarity
(5 1024 ) to the sequence between bases 432 and 590 of
the T. yallundae MAT1-1 a-domain. Also bases 207–857
showed 81% similarity (1 10155 ) to bases 645–1298 of
the a-domain of T. yallundae.
3.2. Multiplex PCR
Mating types of R. secalis were readily identified in a
multiplex PCR following amplification of a 590 bp
MAT1-1-specific product (part of the a-domain) and a
360 bp MAT1-2-specific product (part of the HMGbox) (Fig. 1). A total of 1101 isolates were assayed for
mating type. Of these, 516 produced a MAT1-1-specific
fragment, and 496 isolates produced a MAT1-2-specific
fragment. One isolate produced a 590 bp MAT1-1specific product and a 300 bp product. No amplification product could be obtained for 64 isolates (5.8%)
(Table 2). It appears that DNA concentrations were too
low to perform PCR as amplification was also not
successful with rep-PCR primers for a tested subset of 20
of these isolates. Twenty-four isolates (2.2%) gave
two equally strong bands representing MAT1-1 and
120
C.C. Linde et al. / Fungal Genetics and Biology 40 (2003) 115–125
different genotypes. Mixed cultures can be explained by
the way we isolate R. secalis from the leaves. As we collect
small tufts of mycelium from lesion edges, there is a
possibility of isolating two different genotypes occupying
the same area on the lesion. This and previous studies
showed that it is common to find more than one genotype
within a scald lesion (Salamati et al., 2000). RFLP
analyses showed that 5% of isolations made using
mycelial tufts were mixed cultures (Salamati et al., 2000).
A faint MAT1-2 product was obtained in one of the
two T. yallundae isolates amplified with MAT1-2 specific
primers (RsMAT2F/RsMAT2R), but no product was
amplified with the MAT1-1 specific primer pair
(RsMAT1F/RsMAT1R), or when all four primers were
used together in a multiplex (Fig. 1).
Fig. 1. PCR amplification of two isolates each of Tapesia yallundae
(lanes 1 and 2) and Rhynchosporium secalis (lanes 5 and 6) with primers
RsMAT1F/R, and Tapesia yallundae (lanes 3 and 4) and Rhynchosporium secalis (lanes 7 and 8) with MAT1-2 specific primers,
RsMAT2F/R. Lanes 9–12 show a multiplex PCR with primers
RsMAT1F/R and RsMAT2F/R on Tapesia yallundae (lanes 9 and 10)
and Rhynchosporium secalis (lanes 11 and 12). First and last lanes are a
100 bp size ladder.
3.3. Microgeographical distribution of mating types
(within leaves, lesions, and field plots)
Table 2
Summary of mating type frequencies in a global collection of Rhynchosporium secalis
CR products
Number of
isolatesa
Percentage
MAT1-1
MAT1-2
MAT1-1 plus a 300 bp product
Both MAT1-1 and MAT1-2 products
No product
Total
516
496
1
24
64
1101
46.9
45.1
0.0
2.2
5.8
a
A fine scale investigation of R. secalis on barley leaves
from South Africa revealed that both mating types
could be isolated from three of six lesions where two
strains per lesion were tested. In the Australian populations we isolated different mating types in three out of
12 lesions tested. Six of the 12 lesions were occupied
by different genotypes as differentiated by RFLP
markers.
In 30% (15 out of 50) of the cases tested, both mating
types were isolated from the same leaf in the Australian
populations. Sixty-six percent (33 out of 50) of the leaves
were occupied by different genotypes. Both mating types
were isolated from three of the six leaves analyzed from
the South African populations.
In field plots with at least eight distinct genotypes,
spatial scales ranging from 1 to 4.5 m2 were tested for
mating type frequencies (Table 3). In only two cases
Number of isolates before clone-correction.
MAT1-2-specific bands (Table 2). These isolates were
thought to be mixed cultures, thus not representing single
clones. Single spores were isolated for 10 of these isolates
having both MAT alleles, and subjected to a new matingtype multiplex PCR. In all 10 cases, the single-spore
isolates could be identified as either MAT1-1 or MAT1-2,
confirming that these isolates had been mixed cultures of
Table 3
Mating type distribution of Rhynchosporium secalis on a small geographic scale within individual plots
Population
Aus1
Aus2
Aus3
Aus3
Aus3
Aus3
Aus6
CH3
CH3
CH4
ET3
Central Norway
Finland
y 2
Plot number
Plot size (m2 )
1
2
3
4
1
1
2
1
1
1
1
4.3
4.3
1.0
1.0
1.0
1.0
1.0
1.0
1.0
4.5
1.0
1.0
1.0
No. of isolates
MAT1-1
MAT1-2
26
13
4
4
3
7
6
3
5
8
2
3
6
23
27
4
7
11
2
2
11
3
6
7
6
3
v2 y
Pz
0.184
4.900
...
...
...
...
...
...
...
...
...
...
...
0.775
0.039
...
...
...
...
...
...
...
...
...
...
...
v value based on a 1:1 ratio with 1 degree of freedom.
A probability value as obtained with an exact binomial analysis to test whether mating type frequencies deviate significantly from a 1:1 ratio.
yz
. . . indicates populations where sample sizes were too small to perform a v2 test.
indicates mating type frequencies which are significantly different at P < 0:05.
z
C.C. Linde et al. / Fungal Genetics and Biology 40 (2003) 115–125
were sample sizes large enough to perform v2 and exact
binomial tests, and one of them (Aus2) deviated significantly (P < 0:05) from a 1:1 ratio with the v2 test as well
as the exact binomial test (P ¼ 0:039) (Table 3).
3.4. Macrogeographical distribution of mating types
(within fields and regions)
Different fields from the same geographical region e.g.
Australia, Switzerland, Ethiopia, Norway, and South
Africa, were analyzed for mating type frequencies and
tested for deviations from a 1:1 ratio as determined with
a v2 analyses and an exact binomial test (Table 4). In
Australia, two of the seven populations deviated significantly (v2 test, P < 0:05 and P < 0:01; exact binomial
test, P ¼ 0:039 and P ¼ 0:007, respectively) from a 1:1
mating type ratio, and one out of six populations in
Switzerland showed significant (v2 test, P < 0:01; exact
binomial test, P ¼ 0:001) differences in mating type frequencies. All four populations from Ethiopia, and both
populations from Norway and South Africa did not
deviate significantly from a 1:1 mating-type ratio (Table
4). Only one population each was analyzed from Finland
and California. In both of these populations mating type
frequencies deviated significantly (P < 0:05) from a 1:1
ratio (Table 4). Results with the v2 analyses were confirmed in all cases with the exact binomial test (Table 4).
3.5. Macrogeographical distribution of mating types
(within and among continents)
When subpopulations were combined to represent
larger geographic areas (country), mating type ratios did
not deviate significantly from a 1:1 ratio as determined
with a v2 analysis and one degree of freedom (Table 4).
To take into account the differences in sample sizes
among subpopulations, a contingency v2 analyses was
performed on subpopulations. This revealed that mating
type frequencies among Australian populations differed
significantly (v2 ¼ 16:230; P < 0:05; and df ¼ 6), as was
the case among Swiss populations (v2 ¼ 14:909; P <
0:05; and df ¼ 5), and the total collection (v2 ¼
50:561; P < 0:01; and df ¼ 22). Mating type frequencies
did not differ significantly among Australian populations when the Aus7 population was removed from the
analyses (v2 ¼ 7:172 and df ¼ 5). Similarly, after removal of the CH6 population from the Swiss populations, mating type frequencies did not differ significantly
among populations (v2 ¼ 5:000 and df ¼ 4). Upon removal of both Aus7 and CH6 from the contingency v2
analyses among all populations, mating type frequencies
did not differ significantly (v2 ¼ 31:158 and df ¼ 20). No
significant differences in mating type frequencies could
be detected among subpopulations from Norway and
Ethiopia (Table 4). Mating type frequencies of combined geographic regions (regions or countries) did not
121
differ significantly as tested with the exact binomial test
(Table 4). The contingency v2 analyses tests whether
fields within a country or region differ in mating type
frequencies. The exact binomial test determines whether
the combined mating type frequency for each specific
country or region deviates significantly from a 1:1 ratio.
In total 401 isolates could be identified as MAT1-1 and
381 as MAT1-2 (Table 4).
Comparison of mating type frequencies in the clonecorrected and non-clone-corrected data sets with a
contingency v2 analyses (Table 4), showed no significant
differences in mating type frequencies. A v2 analyses on
the non-clone-corrected data set showed that mating
type frequencies were significantly different for the same
populations, whether the data set was clone-corrected or
not (data not shown). An exception was the combined
Swiss population (df ¼ 1) where mating type frequencies
were significantly different in the non-clone-corrected
data set and non-significant in the clone-corrected data
set. We also found that the significance level increased in
the non-clone-corrected data set from P < 0:05 to
P < 0:01 in California, Aus2, and Finland populations
(data not shown).
4. Discussion
We partially sequenced the HMG- and a-domains in
two isolates of R. secalis. The domains were present in
different idiomorphs of the MAT gene, indicating that
R. secalis is heterothallic. Primers were designed within
the HMG- and a-domain to identify R. secalis mating
types in a multiplex PCR. Mating type frequencies were
determined in a large collection (N ¼ 1101) of R. secalis
from populations representing some of the major barley-growing regions of the world. Contrary to other
mating type distribution studies (e.g., Douhan et al.,
2002), our collections were clone-corrected to remove
bias due to clonal increase of specific mating types. The
only populations which were not clone-corrected were
those from South Africa. However, high levels of
genetic diversity were reported previously for South
African R. secalis populations (Robbertse and Crous,
2000), suggesting that clonal reproduction is not common in these populations. Mating type frequencies were
equal for most populations studied, consistent with
random mating. On a microgeographical scale, both
mating types were often found to occupy the same leaf
and lesions.
4.1. R. secalis resembles other heterothallic fungi
All heterothallic ascomycetes studied so far shared the
same organization of the MAT1-2 locus, having a HMGbox as DNA binding motif (Arie et al., 2000; Dyer et al.,
2001; Kronstad and Staben, 1997; Waalwijk et al., 2002;
122
Table 4
Mating type frequencies of Rhynchosporium secalis in populations from Australia, Switzerland, Ethiopia, Scandinavia, California, and South Africa
Area (m2 )a
Aus1
Aus2
Aus3
Aus4
Aus5
Aus6
Aus7
Australia
1996
1996
1996
1996
1996
1996
1996
1996
CH1
CH2
CH3
CH4
CH5
CH6
Switzerland
N
No. of isolates
MAT1-1b
MAT1-2b
4.3 (4.3)
4.3 (4.3)
200 (6)
15 (15)
200 (10)
200 (6)
200 (6)
823.6 (51.6)
26 (34)
13 (14)
25 (25)
16 (16)
15 (16)
16 (22)
17 (35)
128
23 (41)
27 (33)
30 (30)
9 (9)
18 (26)
20 (24)
4 (13)
131
1999
1999
1999
2000
2001
2001
1999–2001
300 (8)
300 (8)
300 (8)
800 (36)
100 (10)
120 (8)
1920 (78)
12 (20)
8 (8)
14 (14)
22 (25)
14 (14)
25 (31)
95
ET1
ET2
ET3
ET4
Ethiopia
2002
2002
2002
2002
2002
300 (8)
300 (8)
300 (8)
300 (8)
1200 (32)
SE. Norway
C. Norway
Norway
Finland
California
1996
1996
1996
1996
1988
SA1
SA2
South Africa
Total
collection
Mating type frequency
v2 c
v2 d
0.184
4.900
0.455
1.960
0.273
0.444
8.048
0.035
Contingency
v2 e
Pf
MAT1-1
MAT1-2
49
40
55
25
33
36
21
259
53.1
32.5
45.5
64.0
45.5
44.4
81.0
49.4
46.9
67.5
54.5
36.0
54.5
55.6
19.0
50.6
0.709
0.074
0.000
0.413
0.413
0.093
0.508
12 (12)
17 (22)
15 (15)
15 (15)
11 (11)
6 (6)
76
24
25
29
37
25
31
171
50.0
32.0
48.3
59.5
56.0
80.6
55.0
50.0
68.0
51.7
40.5
44.0
19.4
45.0
0.004
0.189
0.000
0.120
0.000
0.209
11 (12)
5 (5)
13 (15)
16 (18)
45
16 (17)
6 (7)
17 (19)
8 (8)
47
27
11
30
24
92
40.7
45.5
43.3
66.7
48.9
59.3
54.5
56.7
33.3
51.1
0.002
0.033
0.004
0.403
400 (10)
18 (6)
418 (16)
400 (10)
200 (50)
12 (13)
24 (65)
36
33 (50)
6 (6)
20
24
44
18
18
32
48
80
51
24
37.5
50.0
45.0
64.7
25.0
62.5
50.0
55.0
35.3
75.0
0.004
0.056
2002
2002
2002
15 (15)
40 (2)
55 (17)
31
27
58
28
19
47
59
46
105
52.5
58.7
55.2
47.5
41.3
44.8
0.153
1.391
1.152
0.396 (1)
0.795
0.302
0.329
1988–2002
4386.6 (254.6)
401
381
782
51.3
48.7
0.512
50.561 (22)
0.497
(21)
(60)
(21)
(40)
0.446
2.812
0.000
3.240
0.034
1.324
0.360
11.645
2.111
0.926
0.091
0.533
2.667
0.043
2.000
0.000
0.800
4.412
6.000
16.230 (6)
0.775
0.039
0.590
0.230
0.728
0.618
0.007
0.901
14.909 (5)
1.000
0.108
1.000
0.324
0.690
0.001
0.169
4.353 (3)
0.442
1.000
0.585
0.152
0.917
1.212 (1)
0.215
1.000
0.434
0.490
0.023
a
Numbers indicate the total area of the field covered by transect sampling or the sites of a hierarchical sampling (McDonald et al., 1999). Numbers in parentheses indicate the actual area from
which leaves were collected.
b
Values in parenthesis indicate number of MAT1-1 and MAT1-2 isolates in the data set before it was clone-corrected.
c 2
v value based on a contingency v2 between clone-corrected and non-clone-corrected mating type ratios with 1 degree of freedom.
d 2
v value based on a 1:1 ratio with 1 degree of freedom for the clone-corrected data set; indicates mating type frequencies are significantly different at P < 0:05; indicates significantly different
at P < 0:01.
e 2
v value based on a contingency v2 analyses among populations. Numbers in parentheses indicate degrees of freedom; indicates mating type frequencies among populations are significantly
different at P < 0:05; indicates significantly different at P < 0:01.
f
A probability value as obtained with an exact binomial analysis to test whether clone-corrected mating type frequencies deviate significantly from a 1:1 ratio.
C.C. Linde et al. / Fungal Genetics and Biology 40 (2003) 115–125
Year
collected
Population
C.C. Linde et al. / Fungal Genetics and Biology 40 (2003) 115–125
Yun et al., 2000). In the MAT1-1 locus on the other
hand, one can find either only an a-domain such as in the
loculascomycetes (P€
oggeler, 2001), or both an a- and a
HMG-domain as found in the pyrenomycetes and discomycetes (P€
oggeler, 2001; Singh et al., 1999; Turgeon et
al., 1993). Since we could amplify these domains in different idiomorphs of R. secalis, it should be heterothallic
and we presume its mating-type idiomorphs share the
same organization as that of its closest known relative, T.
yallundae (discomycete) (Goodwin, 2002). Further sequencing of both MAT idiomorphs is, however, necessary to confirm its MAT locus organization.
Partial identification of the HMG- and a-domains of
R. secalis enabled us to design primers to identify R.
secalis mating types in a multiplex PCR. Because these
primers were designed within regions which are similar
among genera and even fungal classes (Picard et al.,
1991; Singh et al., 1999), it is not surprising that the
MAT1-2 primers gave a faint amplification product in
one of the T. yallundae strains. However, neither the
MAT1-1 primers, nor the multiplex reaction resulted in
any amplification products in T. yallundae. The high
level of similarity between HMG-box sequences of T.
yallundae and R. secalis confirms the close genetic relationship between these two fungi (Goodwin, 2002) and
provides further opportunities to study their phylogenetic relationship based on MAT loci.
4.2. Mating type distribution at microgeographic scales–
diversity within and among lesions on a leaf and within
field plots
We found both mating types at all spatial scales tested. Both mating types could be detected in the same
lesions in barley leaves collected from South Africa
(three out of six lesions) and Australia (three out of 12
lesions). This is not unique to R. secalis, as both mating
types were also found within the same lesions of e.g. M.
graminicola (Linde et al., 2002), a fungus known to undergo regular sexual recombination (Chen and McDonald, 1996). Similarly, among lesion diversity on the
same leaf was high for both the Australian and South
African populations studied. Given the now known
heterothallic nature of R. secalis, and a possibility for
strains of opposite mating type to interact, co-occurrence
of isolates having different mating types within the same
lesion would theoretically allow mating interaction.
Mating types also occurred in equal frequencies at a
spatial scale of 4.3 m2 for one of the two plots analyzed.
4.3. Mating type distribution at macrogeographic
scales—diversity within a region
The null hypothesis in this analysis was that the
mating type frequencies would be equal across all spatial
scales if, as a result of frequency-dependent selection,
123
sexual reproduction is common in R. secalis. Mating
types occurred at equal frequencies for most field populations analyzed. For instance, the Aus7 population
was one of only two Australian populations with unequal proportions of mating types. This was also the
only population from Western Australia and was
therefore geographically separated from the other Australian populations. It was shown in an earlier RFLP
analysis that this population (Quindanning) was genetically distinct from other populations sampled in Australia and possibly represents a distinct founder event
(McDonald et al., 1999), which could explain the unequal mating type frequencies. Unequal mating type
frequencies were also observed in four other populations. Sexual reproduction may be less frequent in these
populations, or selection may have favored one mating
type over the other by chance. In either case, it is possible that the populations have not reached equilibrium.
For populations where mating types occurred at significantly different frequencies, it was either the MAT1-1
or MAT1-2 isolates that occurred in excess and not always just the one mating type. This finding, in addition
to the lack of differences in mating type frequencies of
clone-corrected vs. non-clone-corrected data sets, indicates that one mating type does not, on average, have an
advantage over the other mating type under clonal reproduction. This suggests that there is no selection bias
favoring one of the mating types in R. secalis.
4.4. Mating type distribution at macrogeographic
scales—diversity within and among continents
Finland was the only population in Scandinavia with
unequal mating type frequencies. This could represent a
founder event of R. secalis, although a previous study
indicated high genetic diversity in this population (Salamati et al., 2000) which is not consistent with a founder
effect. Mating type frequencies differed significantly
among populations in Australia (v2 ¼ 16:230 and df ¼ 6)
and Switzerland (v2 ¼ 14:909 and df ¼ 5). This was due
mainly to one population that was not in equilibrium.
When these populations were removed from the Australian or Swiss populations, mating type frequencies no
longer differed significantly among populations. Some
populations with significantly different mating type frequencies were also found for T. yallundae and T. acuformis populations in the US (Douhan et al., 2002). As
fungal plant pathogen populations in an agricultural
field are often founded by a small fraction of the total
population, it is perhaps not surprising that e.g. environmental conditions within each field are not always
favorable for sexual reproduction, and therefore not all
populations will undergo the frequent sexual cycles
needed to maintain a 1:1 ratio of mating types.
The equal frequencies of mating types across all
spatial scales in most field populations of R. secalis is
124
C.C. Linde et al. / Fungal Genetics and Biology 40 (2003) 115–125
consistent with frequency-dependent selection (May
et al., 1999), and therefore, random mating. This finding
supports previous work where it was suggested that R.
secalis must reproduce sexually to account for high genotypic diversity and random associations among
RFLP loci (McDonald et al., 1999; Salamati et al.,
2000). Identification of mating-type genes in R. secalis
opens up many possibilities to study the genetics of this
fungus as attempted sexual crossings can now be made
with known opposite mating types.
Acknowledgments
We thank the many collaborators who contributed
collections of leaf samples used in this study. They are
David Moody (Australia), Robert Loughman (Australia), Barbara Read (Australia), Marja Jalli (Finland),
Buskerud Extension Office (Buskerud forsøksring,
Norway), Kiros Meles (Ethiopia), Lucienne Mansvelt
(South Africa), Denise Liebenberg (South Africa), and
Vincent Michel (RAC, Switzerland). We also recognize
Pascal Zaffarano and Elena Turco for technical assistance, Paul Dyer (University of Nottingham, UK) for
providing the T. yallundae MAT sequences, Tim Murray
(Washington State University, USA) for providing T.
yallundae DNA, and Simon Foster (Rothamsted
Research Institute, UK) for useful discussions.
References
Ahmed, S., Morrall, R.A.A., Kaiser, W.J., 1996. Distribution of
mating types of Ascochyta fabae f. sp. lentis. Can. J. Plant Pathol.
18, 347–353.
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J.H., Zhang, Z.,
Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST:
a new generation of protein database search programs. Nucleic
Acids Res. 25, 3389–3402.
Arie, T., Christiansen, S.K., Yoder, O.C., Turgeon, B.G., 1997.
Efficient cloning of ascomycete mating type genes by PCR
amplification of the conserved MAT HMG box. Fungal Genet.
Biol. 21, 118–130.
Arie, T., Kaneko, I., Yoshida, T., Noguchi, M., Nomura,
Y., Yamaguchi, I., 2000. Mating-type genes from asexual
phytopathogenic ascomycetes Fusarium oxysporum and Alternaria alternata. Mol. Plant Microbe Interact. 13, 1330–
1339.
Armstrong, C.L., Chongo, G., Gossen, B.D., Duczek, L.J., 2001.
Mating type distribution and incidence of the teleomorph of
Ascochyta rabiei (Didymella rabiei) in Canada. Can. J. Plant
Pathol. 23, 110–113.
Caldwell, R.M., 1937. Rhynchosporium secalis of barley, rye, and other
grasses. J. Agric. Res. 55, 175–198.
Chen, R.S., McDonald, B.A., 1996. Sexual reproduction plays a major
role in the genetic structure of populations of the fungus Mycosphaerella graminicola. Genetics 142, 1119–1127.
Coppin, E., Debuchy, R., Arnaise, S., Picard, M., 1997. Mating types
and sexual development in filamentous ascomycetes. Microbiol.
Mol. Biol. Rev. 61, 411–428.
Dayakar, B.V., Narayanan, N.N., Gnanamanickam, S.S., 2000. Crosscompatibility and distribution of mating type alleles of the rice
blast fungus Magnaporthe grisea in India. Plant Dis. 84, 700–704.
Douhan, G.W., Murray, T.D., Dyer, P.S., 2002. Species and matingtype distribution of Tapesia yallundae and T. acuformis and
occurrence of apothecia in the US Pacific Northwest. Phytopathology 92, 703–709.
Dyer, P.S., Furneaux, P.A., Douhan, G., Murray, T.D., 2001. A
multiplex PCR test for determination of mating type applied to the
plant pathogens Tapesia yallundae and Tapesia acuformis. Fungal
Genet. Biol. 33, 173–180.
Everitt, B.S., 1977. The Analysis of Contingency Tables. Wiley, New
York.
Goodwin, S.B., 2002. The barley scald pathogen Rhynchosporium
secalis is closely related to the discomycetes Tapesia and Pyrenopeziza. Mycol. Res. 106, 645–654.
Goodwin, S.B., Maroof, M.A.S., Allard, R.W., Webster, R.K., 1993.
Isozyme variation within and among populations of Rhynchosporium secalis in Europe, Australia and the United States. Mycol.
Res. 97, 49–58.
James, W.C., Jenkins, J.E., Jemmet, J.L., 1968. The relationship
between leaf blotch caused by Rhynchosporium secalis and losses in
grain yield of spring barley. Ann. Appl. Biol. 62, 273–288.
Kronstad, J.W., Staben, C., 1997. Mating type in filamentous fungi.
Annu. Rev. Genet. 31, 245–276.
Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini,
R., Van de Weg, E., Gessler, C., 2002. Development and
characterisation of 140 new microsatellites in apple (Malus domestica Borkh.). Mol. Breed. 10, 217–241.
Linde, C.C., Zhan, J., McDonald, B.A., 2002. Population structure of
Mycosphaerella graminicola: from lesions to continents. Phytopathology 92, 946–955.
Liu, Y.C., Cortesi, P., Double, M.L., MacDonald, W.L., Milgroom,
M.G., 1996. Diversity and multilocus genetic structure in populations of Cryphonectria parasitica. Phytopathology 86, 1344–1351.
Liu, Y.G., Whittier, R.F., 1995. Thermal asymmetric interlaced PCR:
automatable amplification and sequencing of insert end fragments
from P1 and YAC clones for chromosome walking. Genomics 25,
674–681.
May, G., Shaw, F., Badrane, H., Vekemans, X., 1999. The signature of
balancing selection: fungal mating compatibility gene evolution.
Proc. Natl. Acad. Sci. USA 96, 9172–9177.
McDermott, J.M., McDonald, B.A., Allard, R.W., Webster, R.K.,
1989. Genetic variability for pathogenicity, isozyme, ribosomal
DNA and colony color variants in populations of Rhynchosporium
secalis. Genetics 122, 561–565.
McDonald, B.A., Zhan, J., Burdon, J.J., 1999. Genetic structure of
Rhynchosporium secalis in Australia. Phytopathology 89, 639–645.
Mekwatanakarn, P., Kositratana, W., Phromraksa, T., Zeigler, R.S.,
1999. Sexually fertile Magnaporthe grisea rice pathogens in
Thailand. Plant Dis. 83, 939–943.
Milgroom, M.G., 1996. Recombination and the multilocus structure of
fungal populations. Annu. Rev. Phytopathol. 34, 457–477.
Notteghem, J.L., Silue, D., 1992. Distribution of the mating type
alleles in Magnaporthe grisea populations pathogenic on rice.
Phytopathology 82, 421–424.
Picard, M., Debuchy, R., Coppin, E., 1991. Cloning the mating types
of the heterothallic fungus Podospora anserina : developmental
features of haploid transformants carrying both mating types.
Genetics 128, 539–547.
P€
oggeler, S., 2001. Mating-type genes for classical strain improvements
of ascomycetes. Appl. Microbiol. Biotechnol. 56, 589–601.
Robbertse, B., Crous, P.W., 2000. Genotypic variation in Rhynchosporium secalis pathotypes collected in the Western Cape Province
of South Africa. S. Afr. J. Sci. 96, 391–395.
Salamati, S., Zhan, J., Burdon, J.J., McDonald, B.A., 2000. The
genetic structure of field populations of Rhynchosporium secalis
C.C. Linde et al. / Fungal Genetics and Biology 40 (2003) 115–125
from three continents suggests moderate gene flow and regular
recombination. Phytopathology 90, 901–908.
Sharon, A., Yamaguchi, K., Christiansen, S., Horwitz, B.A., Yoder,
O.C., Turgeon, B.G., 1996a. An asexual fungus has the potential
for sexual development. Mol. Gen. Genet. 251, 60–68.
Sharon, A., Yamaguchi, K., Christiansen, S., Horwitz, B.A., Yoder,
O.C., Turgeon, B.G., 1996b. An asexual fungus has the potential
for sexual development. Mol. Gen. Genet. 251, 60–68.
Shipton, W.A., Boyd, J.R., Ali, S.M., 1974. Scald of barley. Rev. Plant
Pathol. 53, 839–861.
Singh, G., Dyer, P.S., Ashby, A.M., 1999. Intra-specific and interspecific conservation of mating-type genes from the discomycete
plant-pathogenic fungi Pyrenopeziza brassicae and Tapesia yallundae. Curr. Genet. 36, 290–300.
Sokal, R.R., Rohlf, F.J., 1995. Biometry: the principles and practice of
statistics in biological research. Freeman, New York.
Tatusova, T.A., Madden, T.L., 1999. BLAST 2 SEQUENCES, a new
tool for comparing protein and nucleotide sequences. FEMS
Microbiol. Lett. 174, 247–250.
Turgeon, B.G., 1998. Application of mating type gene technology to
problems in fungal biology. Annu. Rev. Phytopathol. 36,
115–137.
Turgeon, B.G., Bohlmann, H., Ciuffetti, L.M., Christiansen, S.K.,
Yang, G., Schafer, W., Yoder, O.C., 1993. Cloning and analysis of
the mating-type genes from Cochliobolus heterostrophus. Mol. Gen.
Genet. 238, 270–284.
125
Turgeon, G., Yoder, O.C., 2000. Proposed nomenclature for mating
type genes of filamentous ascomycetes. Fungal Genet. Biol. 31, 1–5.
Versalovic, J., Koeuth, T., Lupski, J.R., 1991. Distribution of
repetitive DNA-sequences in Eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 19, 6823–6831.
Versalovic, J., Schneider, M., de Bruijn, F.J., Lupski, J.R., 1994.
Genomic fingerprinting of bacteria using repetitive sequence-based
polymerase chain reaction. Methods Mol. Cell Biol. 5, 25–40.
Viji, G., Uddin, W., 2002. Distribution of mating type alleles and fertility
status of Magnaporthe grisea causing gray leaf spot of perennial
ryegrass and St. Augustinegrass turf. Plant Dis. 86, 827–832.
Waalwijk, C., Mendes, O., Verstappen, E.C.P., de Waard, M.A.,
Kema, G.H.J., 2002. Isolation and characterization of the matingtype idiomorphs from the wheat septoria leaf blotch fungus
Mycosphaerella graminicola. Fungal Genet. Biol. 35, 277–286.
Welz, H.G., Leonard, K.J., 1995. Gametic phase disequilibria in
populations of race-2 and race-3 of Cochliobolus carbonum. Eur. J.
Plant Pathol. 101, 301–310.
Yun, S.H., Arie, T., Kaneko, I., Yoder, O.C., Turgeon, B.G., 2000.
Molecular organization of mating type loci in heterothallic,
homothallic, and asexual Gibberella/Fusarium species. Fungal
Genet. Biol. 31, 7–20.
Zhan, J., Kema, G.H.J., Waalwijk, C., McDonald, B.A., 2002.
Distribution of mating type alleles in the wheat pathogen
Mycosphaerella graminicola over spatial scales from lesions to
continents. Fungal Genet. Biol. 36, 128–136.