Linkage of Asthma and Total Serum IgE Concentration to Markers on Chromosome 12q: Evidence from Afro-Caribbean and Caucasian Populations

GENOMICS 37, 41–50 (1996) 0518 ARTICLE NO. Linkage of Asthma and Total Serum IgE Concentration to M arkers on Chromosome 12q: Evidence from Afro-Caribbean and Caucasian Populations KATHLEEN C. BARNES,* ,1 JOHN D. NEELY,* ,† ,1 DAVID L. DUFFY,‡ ,1 LINDA R. FREIDHOFF,* DANIEL R. BREAZEALE,‡ CARSTEN SCHOU,§ RAANA P. NAIDU,Ø PAUL N. LEVETT,Ø BEATRICE RENAULT,\ RAJU KUCHERLAPATI,\ SEBASTIANO IOZZINO,* EVA EHRLICH,* TERRI H. BEATY,‡ AND DAVID G. M ARSH* ,† ,2 * Division of Clinical Immunology, Department of M edicine, and † Graduate Program in Cellular and M olecular M edicine, The Johns Hopkins University School of M edicine, Baltimore, M aryland, 21205; ‡ Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Baltimore, M aryland, 21205; § ALK Laboratories, Hørsholm, Denmark; ØFaculty of M edicine, University of the West Indies, Cave Hill Campus, Barbados; and \Department of M olecular Genetics, Albert Einstein College of M edicine, Bronx, New York Received April 12, 1996; accepted July 3, 1996 log of the odds for self-reported asthma. The importance of environmental exposure to allergens has been clearly established. A causal relationship exists between the level of exposure to common indoor allergens, such as house dust mites (Dermatophagoides spp.), and the development of asthma in atopic individuals (Sporik et al., 1990; Lau-Schadendorf and Wahn, 1991). The development of atopic sensitivity is, itself, also markedly influenced by the levels of allergen exposure (Young et al., 1992). Since allergic disease was first clearly established as having a familial basis (Cooke and VanderVeer, 1916), numerous twin and family studies have shown that genetic factors are involved in the determination of both asthma and total serum IgE concentration (Edfors-Lubs, 1971; Bazaral et al., 1974; Marsh et al., 1974; Gerrard et al., 1978; Hopp et al., 1984; Borecki et al., 1985; Meyers et al., 1987; Duffy et al., 1990; Hanson et al., 1991; Martinez et al., 1994). Borecki et al. (1985) provided evidence that a major IgE regulatory gene influences allergic susceptibility, but the best model of inheritance depended on the combinations of allergic symptoms considered. Other studies have implicated genes in at least four chromosomal regions in IgE responsiveness and/or bronchial hyperresponsiveness (BHR): HLAD in 6p21 (Marsh et al., 1982, 1990; Zwollo et al., 1991; Huang et al., 1991), IL4, ADRB2, and perhaps other loci in 5q31.1–q33 (Marsh et al., 1994; Meyers et al., 1994; Ohe et al., 1995; Postma et al., 1995; Rosenwasser et al., 1995; Turki et al., 1995; Song et al., 1996), FCER1B in 11q13 (Sandford et al., 1993; Shirakawa et al., 1994), and the TCRA/D locus in chromosome 14q11.2 (Moffatt et al., 1994). In addition, recent studies (DeSanctis et al., 1995; Ewart et al., 1996) have reported evidence for several loci controlling BHR in mice, which appear to be unrelated to the aforemen- To identify genes potentially relevant in atopic asthma, we analyzed markers in chromosome 12q15– q24.1 for linkage to asthma and total serum IgE concentration. Sib-pair analyses of 10 markers in 345 full- and 219 half-sib pairs from 29 multiplex Afro-Caribbean families provided evidence for linkage to this region for both asthma and total serum IgE. Certain alleles at these loci showed significant evidence of transmission disequilibrium with both asthma and high IgE. Using 6 of these markers and 11 additional markers, evidence for linkage of total IgE to 12q was also found in 12 Caucasian Amish kindreds (24 nuclear families) by both sibpair and transmission disequilibrium analyses. These findings suggest that the 12q15–q24.1 region may contain a gene(s) controlling asthma and the associated ‘‘high total IgE’’ trait. q 1996 Academic Press, Inc. INTRO DUCTIO N In recent years, genes have been mapped for several diseases that are primarily determined by single major genes. Progress has been more difficult for complex and multifactorial diseases, such as asthma, in which genetic and environmental factors interact to produce the ultimate disease phenotype. A strong case has been made for an IgE-mediated causation of asthma (Kay, 1988; Burrows et al., 1989; Sears et al., 1991; Freidhoff and Marsh, 1993). Burrows et al. (1989) showed that log[total IgE], adjusted for age, sex, and antigen (Ag)specific skin-test sensitivity, is linearly related to the 1 Authors who contributed equally to this study. To whom all correspondence should be addressed at Johns Hopkins Asthma & Allergy Center, 5501 Hopkins Bayview Circle, Baltimore, MD 21224. Telephone: (410) 550-2001. Fax: (410) 550-2527. E-mail: dgmarsh@welchlink.welch.jhu.edu. 2 41 0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved. 42 BARNES ET AL. tioned human loci. In none of these studies was physician-diagnosed asthma analyzed as a phenotype. To identify additional genes contributing to the susceptibility and manifestation of atopic diseases, including asthma, we focused on chromosome 12q15–q24.1, because this region had been reported to contain several candidate genes, including interferon-g (IFNG), stem cell factor (SCF; also known as mast cell growth factor, or MGF), insulin-like growth factor-1 (IGF1), and the b subunit of nuclear factor-Y (NFYB; Krauter et al., 1995). Our genetic studies were conducted in two markedly different populations. A group of 29 multiplex ‘‘asthma’’ families was recruited from an Afro-Caribbean population in which the exposure to indoor allergens implicated in asthma, especially the mites Dermatophagoides pteronyssinus and Blomia spp., is extremely high (Pearson and Cunnington, 1973). The second group of families, selected for IgE antibody (Ab) responsiveness in at least one child, is Caucasian, from the Pennsylvania Old Order Amish, whose exposure to allergens is much lower than in Barbados. Asthma and total serum IgE in the Barbados population and total IgE in the Amish population were analyzed for linkage to chromosome 12q markers. MATERIALS AND METHODS Family selection. Twenty-nine asthmatic probands were selected from six polyclinics and two private clinics from the island of Barbados and from the Accident and Emergency Department (A&ED) of Queen Elizabeth Hospital (QEH). Families were extended by recruiting all available parents, siblings, and relevant extended family members of the 29 probands into the study. All participants gave their informed consent as approved by The Johns Hopkins University Institutional Review Board. The total sample (N Å 507, 47% M, 506 Afro-Caribbean, one Caucasian), derived from the 29 probands, included 144 asthmatics (48% M) and unaffected family members in 184 nuclear families. A total of 384 siblings (44% M) yielded a maximum of 564 sib pairs with known asthma status and complete chromosome 12q marker data, which included 345 full-sib pairs (59 asthmatic sib pairs) and 219 half-sib pairs (17 asthmatic sib pairs; note: multiple partnerships are relatively common in Barbados). The mean age of the 384 sibs from Barbados was 24 { 14 (SD) years, ranging from 2 to 84 years, and there was not a significant difference in age according to gender. Among sibs, the mean age of the asthmatics was 19 { 14 (range, 3–81 years) and the mean age of the nonasthmatics was 26 { 13 (range, 2–84 years; P õ 0.0001). For all Barbados subjects, the mean age was 28 { 17 (SD) years (range, 2–89 years). The geometric mean total serum IgE level of the Barbados sibs was 397 ng/ml and was significantly higher among males than females (524 vs 318 ng/ml, P Å 0.004). The geometric mean total serum IgE concentration for all Barbados subjects was 372 ng/ml. Of the 209 Amish subjects, 11 kindreds (170 subjects) have been previously described (Marsh et al., 1994). Families were selected on the basis of detectable serum IgE Ab to common inhalant allergens in at least one child (adequate asthma data were not available for the Amish). An additional 39 members, including one new kindred, were recruited for the present study. A total of 146 siblings (64% M), providing 473 full-sib pairs, and their nuclear family members were analyzed. The mean ages and mean total IgE concentrations of the Amish sibs and the entire group of 209 subjects were similar to those previously reported (Marsh et al., 1994). The two groups of subjects studied are quite different in both ethnic background and environmental exposure to inhaled allergens. The Barbados population (Ç250,000 individuals) is primarily of African descent with Ç25% Caucasian admixture (C. Grimm, G. Nicholson, H. Fraser et al., pers. comm.) and is typical of other West Indian countries and the African American population. Asthma prevalence is high in Barbados; based on Emergency Department visits, at least 13% of the general population are believed to be affected. Exposure to indoor allergens, particularly the pyroglyphid house dust mite D. pteronyssinus and storage mites of the genus Blomia, is pervasive and present year-round (Pearson and Cunnington, 1973; K.C.B., unpublished data). Exposure to D. pteronyssinus allergens is greater than 30 times the proposed ‘‘at-risk level’’ reported by Platts-Mills, de Weck, and others (1989; §2 mg major allergen Der p 1/g of dust) and is probably combined with a similar exposure to Blomia spp. In a study of 123 related individuals living in Barbados, 17/26 asthmatics (65.4%) had detectable specific IgE Ab to Blomia tropicalis by RAST (K.C.B., unpublished data). Unlike other tropical environments, parasitosis is absent in Barbados and does not, therefore, account for the high prevalence of atopic disease. Conversely, the Pennsylvania Old Order Amish constitute a genetically isolated community. Allergen exposure differs substantially from that of the Barbadian subjects both spatially and temporally (different types of allergens are reflective of the temperate climate, e.g., D. farinae and pollens, and the seasonal variation is more pronounced). The levels of allergen are also quite different. Among the Amish, the upper quartile for age–sex-adjusted log[total IgE], 2.37 log ng/ml (234 ng/ml; 96.7 IU/ml), was chosen as the cutpoint for categorizing individuals with high total IgE. This corresponds roughly to the frequency of atopy commonly reported for Caucasian populations (Marsh and Blumenthal, 1990; Sibbald and Rink, 1991). In addition, 234 ng/ml is close to the widely accepted clinical cutpoint of 242 ng/ml (100 IU/ml) based on the minimum misclassification of atopic and nonatopic subjects in Caucasian populations (Johansson et al., 1972; Marsh et al., 1974). Selecting cutpoints over a wide range (150–400 ng/ml) made little difference in the sib-pair linkage results. In contrast to the Amish, the Barbadian families were selected for asthma (30% of the total subjects are asthmatic), and, as described, chronic exposure to high loads of indoor allergens is common, especially to D. pteronyssinus [Der p] (K.C.B., unpublished data). These two factors resulted in much higher total IgE concentrations, overall, for the Barbados subjects. In the Barbados dataset, asthmatics had a geometric mean total IgE (age–sex-adjusted) of 1031 ng/ml (426 IU/ml), and nonasthmatics had a geometric mean total IgE (age– sex-adjusted) of 367 ng/ml (152 IU/ml). Therefore, the cutpoint based on the median of 2.68 log ng/ml (482 ng/ml) was chosen to take into account these differences. The upper quartile corresponded to 3.21 log ng/ml (1607 ng/ml) and was deemed an inappropriately high cutpoint. The use of different cutpoints in the case of the transmission disequilibrium tests (TDT) did not alter evidence for distortion of segregation of particular alleles but did change the significance of the x2 test, as the numbers of affected offspring decreased. Similarly, mean sharing of marker alleles IBD among affected sib pairs remained constant using different cutpoints, but statistical significance decreased as there were fewer pairs. Asthma diagnosis. Asthma was defined as both: (1) A reported history of asthma using a standardized questionnaire adapted from the ongoing NHLBI Collaborative Studies on the Genetics of Asthma (Blumenthal et al., 1995), which included questions about respiratory symptoms (shortness of breath, cough, wheeze, chest tightness) and a history of physician-diagnosed asthma (past/current); and (2) Confirmation of asthma by an interview of the patient with our clinician (R.P.N.), one of the primary diagnosticians of asthma in Barbados as both a private practice clinician and as Director of the A&ED at QEH. The group of asthmatic subjects included 121 current asthmatics (symptoms within the past 12 months) and 23 past asthmatics. ‘‘Past’’ asthmatics met the same criteria as ‘‘current’’ asthmatics, except that symptomatology was documented to have occurred greater than 12 months prior to enrollment in the study. In most cases medical records were available for review, and diagnosis was confirmed via direct interviews with the patients. Cigarette smoking among the asthmatics in the study (5%, with only three subjects 43 LINKAGE OF ASTHMA AND TOTAL IgE TO 12q MARKERS TABLE 1 Affected Sib-Pair Analyses for Chromosome 12q Markers in 29 Barbados Kindreds for Asthma and Elevated Total Serum IgE Concentration Asthmaa Total IgEb Locus Eff DF (full/half sibs)c % alleles shared (full/half sibs)d P valuee Eff DF (full/half sibs)c % alleles shared (full/half sibs)d P valuee D12S1052 D12S379 D12S1064 D12S351 D12S311 D12S95 PAH D12S360 D12S78 D12S338 53/21 57/21 56/21 57/21 57/20 57/21 54/17 54/17 54/15 54/17 55.7/24.1 61.4/29.2 59.1/21.3 62.0/22.9 60.1/29.3 61.9/30.1 59.1/24.2 59.1/27.8 57.2/21.6 55.8/21.0 NS 0.001 0.060 0.060 0.010 0.010 0.067 0.018 NS NS 112/55 114/58 105/44 112/58 113/48 114/57 114/57 114/58 114/57 114/57 55.5/27.2 54.1/23.8 55.3/23.8 57.0/24.0 58.4/26.4 54.2/24.2 54.6/23.1 58.5/26.1 60.2/28.0 57.7/25.3 0.016 NS NS 0.060 0.007 NS NS 0.013 0.002 0.037 a For discordant sib pairs, percentage alleles shared (full/half sibs; Eff DF Å 110/87) ranged from 50.9/23.4 (D12S379) to 57.2/21.6 (D12S78), with all P values not significant. P values for concordant affected sib pairs were improved for several of the markers when halfsibs were not included in the analyses for asthma (D12S379, P Å 0.0009; D12S351, P Å 0.002; PAH, P Å 0.024) and total IgE (D12S1064, P Å 0.033; D12S351, P Å 0.004; D12S360, P Å 0.003; D12S78, P Å 0.0006; and D12S338, P Å 0.006). b Log[total IgE] values were age–sex-adjusted by linear standardization to males at age 20 years. The distribution of age–sex-adjusted log[total IgE] was then dichotomized into ‘‘high’’ and ‘‘low’’ phenotypes using a median cutpoint of 2.68 log ng/ml (482 ng/ml). c Effective degrees of freedom (Eff DF) reflects the number of independent sib pairs. There were a total of 345 full- and 219 half-sib pairs in the Barbados families. d Represents the mean proportion of marker alleles shared identical-by-descent (IBD). e P values õ0.05 show in boldface; P values §0.10 not presented. NS, not significant. reporting ú5 pack years of smoking) and the Barbados sample as a whole (7%) was low. Sib-pair and global genotypic TDT analyses in which past asthmatics were grouped with nonasthmatics did not significantly alter the overall findings, thus supporting the decision to include past asthmatics in the asthma category. Individuals reporting an uncertain history of asthma (40 subjects), and who were not confirmed as being asthmatic by the physician, were grouped with unaffected individuals as nonasthmatics. As expected, this consideration also did not significantly change the sib-pair and the global genotypic TDT analyses, because linkage was evidenced primarily in the concordant affected sib pairs in the Barbados families. IgE measurements. Total IgE concentrations were measured in duplicate on serum samples using the chemiluminometric Magic Lite immunoassay (Magic Lite Total IgE Extended Range; ALK, Copenhagen, Denmark/CIBA-Corning, Medfield, MA) and were expressed in nanograms per milliliter [2.42 ng Å 1 International Unit (IU)]. All measurements were repeated, again in duplicate, in a second independent assay, and any values differing by §10% were retested until the coefficient of variation was within 10%. Based on a linear regression analysis of independent measurements on the same samples, 4.8 ng/ml (2.0 IU/ml) was assigned as the lowest detectable IgE concentration. Genotyping. Seventeen markers on chromosome 12q (IFNG, D12S379, D12S95, D12S101, D12S393, D12S58, D12S332, IGF1, D12S318, PAH, D12S815, D12S360, D12S806, D12S78, D12S800, D12S338, and PLA2G1B) were analyzed in the Amish population. Subsequently, 10 markers (D12S1052, D12S379, D12S1064, D12S351, D12S311, D12S95, PAH, D12S360, D12S78, and D12S338) were analyzed for linkage in the Barbados population to expand our analyses in the region of interest. Microsatellite markers were analyzed by the polymerase chain reaction essentially according to Weber and May (1989), using DNA from peripheral blood mononuclear cells or EBV-transformed B cells. The reactions were performed as described previously (Marsh et al., 1994) with slight modifications: reactions were reduced to a 5-ml volume and contained 0.10 mM each primer and 0.15 U Taq polymerase. The optimized IFNG primers (TCTTACAACACAAAATCAAA and GCCTTCCTGTAGGGTATTAT) differ from the published sequences (Ruiz-Linares, 1993) and were designed in our laboratory. Other primer sequences were obtained from various databases, including the Genome Data Base (The Johns Hopkins University), the Cooperative Human Linkage Center (University of Iowa), and Généthon. All primers except those for IFNG and IGF1-PCR1 were supplied by Research Genetics (Huntsville, AL). Statistical analyses. Total serum IgE measurements were logtransformed to approximate better a Gaussian distribution. Log[total IgE] values in each study sample were adjusted by linear regression methods to the values expected for males at age 20. Affected sib-pair and quantitative Haseman–Elston sib-pair linkage analyses were performed using the program SIBPAL 2.7 included in the S.A.G.E. 2.2A suite (S.A.G.E. 1994). For the Amish families, a polymorphic marker 10 cM from a quantitative trait locus was simulated to investigate the importance of discordant sib pairs using a specially written program (D.L.D., unpublished data) comparable to SIMULATE (Terwilliger and Ott, 1994). This locus had parameters similar to those recovered in our previous segregation analysis of total serum IgE (Marsh et al., 1994): The allele frequency for the low allele was set at 0.41; genotype means were 0.78, 1.83, and 2.65 for genotypes AA, AB, and BB, respectively, with a common variance of 0.265. A threshold of 2.1 log ng/ml was used to define affected and unaffected subjects. When IgE levels were treated as a qualitative trait, the mean IBD in affected–affected pairs, IBD(AA), was 0.53 (SD Å 0.04), and in affected–unaffected pairs, IBD(AU) Å 0.47 (SD Å 0.03). In 22 of 100 generated samples, IBD(AA) õ0.525 and IBD(AU) õ0.475; in 10 of these, IBD(AU) was less than 0.450. Multiallelic TDTs were performed using the program ETDT (Sham and Curtis, 1995). For each marker, the number of times an allele was transmitted and not transmitted from heterozygous parents to their affected offspring was compared to the expected ratio of 1:1 using the Gibbs x2 test. Significant deviation from this expectation is evidence for linkage plus allelic association between the marker and the putative trait-determining locus. We present only the ‘‘genotypic’’ test of these authors (equivalent to the likelihood-ratio test of full symmetry in the M 1 M table of transmitted versus nontransmitted alleles, where M is the number of alleles in the system at the 44 BARNES ET AL. TABLE 2 Sib-Pair Analyses of Chromosome 12q Markers for Age–Sex-Adjusted Log[Total IgE] as a Continuous Trait in 29 Barbadian and 12 Amish Kindreds Log[total IgE]a Locus Het Eff DF Statistic P value 00.700 0.519 0.629 0.075 00.889 1.177 02.150 03.019 01.556 01.615 NS NS NS NS NS NS 0.016 0.001 0.061 0.054 0.903 00.918 00.313 01.550 01.134 01.501 01.586 01.967 01.670 01.365 00.940 02.361 01.571 01.051 01.550 01.652 01.669 NS NS NS 0.062 NS 0.068 0.058 0.026 0.049 0.087 NS 0.010 0.059 NS 0.062 0.051 0.049 Barbadosb D12S1052 D12S379 D12S1064 D12S351 D12S311 D12S95 PAH D12S360 D12S78 D12S338 0.75 0.75 0.83 0.81 0.78 0.81 0.80 0.78 0.88 0.83 227 236 227 239 236 239 239 240 237 239 Amishb IFNG D12S379 D12S95 D12S101c D12S393 D12S58 D12S332 IGF1 D12S318 PAH D12S815 D12S360 D12S806 D12S78 D12S800 D12S338 PLA2G1B 0.51 0.74 0.82 0.81 0.63 0.76 0.59 0.80 0.50 0.74 0.85 0.49 0.91 0.87 0.91 0.69 0.59 118 116 116 96c 116 116 116 116 118 119 121 121 119 119 119 119 116 a Log[total IgE] values were age–sex-adjusted by linear standardization to males at age 20 years. b There were a total of 345 full- and 219 half-sib pairs in the Barbados families and 473 full-sib pairs in the Amish. The precise number of sib pairs analyzed varied slightly for different markers. Analyses in the Amish using haplotypes yielded P values ranging from 0.05 to 0.08 for eight loci: IGFI–D12S806, D12S338, and PLA2G1B, with the smallest P value (0.047) for D12S360. c Some families could not be typed for D12D101 because of ‘‘null’’ alleles. marker locus), because the assumptions of the ‘‘allelic’’ test (which considers one marker allele at a time) often failed the test of overall goodness-of-fit. Allele-by-allele TDTs were calculated using Genetic Analysis System 2.0 (Young, 1995), with the one-tailed P values calculated by this program converted into two-tailed P values. Sibpair analyses for IGF1 were based on combined information from IGF1-MFD1 and IGF1-PCR1. For the TDT, only information from IGF1-MFD1 was used. The recently released multipoint linkage program GENEHUNTER (Kruglyak et al., 1996) was used to perform nonparametric affected relative analyses (based on multipoint IBD) on both asthma and high total IgE. The nonparametric linkage (NPL) score is a measure of IBD sharing among all affected pedigree members. Due to computational limitations on the maximum pedigree size, nuclear families were used. Sex-averaged linkage maps of the markers analyzed in the Barbados and Amish populations were prepared using CRIMAP 2.4 (Green et al., 1990) under the ‘‘fixed’’ option and the locus order indicated by the physical map of Krauter and others (1995). This map differs slightly from that recently reported by Whitehead Institute/MIT (1995) in the order of D12S360, D12S78, and D12S338. Variations in the P values between different markers reflect not only the degree of linkage to the putative trait locus but also the informativeness of the markers in different individuals. Analyzing fully informative haplotypes removes the effect of different degrees of heterozygosity for each individual marker. In the Amish dataset, haplotypes were constructed by minimizing the number of recombinations between neighboring markers in each family. If no recombination was observed between two markers for an offspring, then inherited parental alleles for a third intervening marker for which that child was homozygous were inferred. The complicated pedigrees in the Barbados dataset precluded our constructing reliable haplotypes. RESULTS Sib-pair analyses. In the families from Barbados, there were 345 full- and 219 half-siblings for whom genotypic data were available. In the case of a child for whom a parent was unavailable, parental alleles were inferred from the genotypes of siblings and other relatives. In affected sib-pair analyses (Table 1), D12S379, D12S311, D12S95, and D12S360 showed evidence of linkage demonstrated by significantly increased allelesharing in concordant asthmatic sib pairs (P Å 0.001, P Å 0.010, P Å 0.010, and P Å 0.018, respectively). Because elevated total IgE is commonly associated with asthma, we conducted another affected sib-pair analysis in which individuals having age–sex-adjusted total IgE values above the sample median of 482 ng/ml (199 IU/ml) were categorized as having ‘‘high IgE.’’ D12S1052, D12S311, D12S360, D12S78, and D12S338 showed increased allele-sharing in concordant high-IgE sib pairs (P Å 0.016, 0.0067, 0.013, 0.0015, and 0.037, respectively). In view of the potential ambiguities in assigning appropriate thresholds to discriminate between high and low total IgE, we also analyzed age– sex-adjusted log[total IgE] as a quantitative trait using the sib-pair method originally developed by Haseman and Elston (1972), as implemented in SIBPAL (Table 2). Evidence for linkage to log[total IgE] in the Barbadian families was observed for PAH (P Å 0.016) and D12S360 (P Å 0.001), and modest evidence of linkage was observed for D12S338 (P Å 0.054). Analyzing total IgE with and without ‘‘asthma’’ as a covariate made little difference in evidence for linkage, despite the observation that asthma itself was significantly correlated with IgE. The linkage between total IgE and D12S360 persisted even after including asthma as a covariate (P Å 0.003). We also analyzed total IgE as a dichotomous trait in 473 sib pairs from 24 nuclear families of 12 large kindreds in the Amish, using 17 12q markers. In the Amish, individuals were classified as having high IgE if they had age–sex-adjusted total IgE values in the upper quartile, greater than 234 ng/ml (97 IU/ml). Using different thresholds in these two populations considers the markedly different selection criteria and environ- LINKAGE OF ASTHMA AND TOTAL IgE TO 12q MARKERS TABLE 3 Sib-Pair Analyses for Chromosome 12q Markers in 12 Amish Kindreds for Total Serum IgE Concentration as a Dichotomous Trait Total IgEa Locus IFNG D12S379 D12S95 D12S101 D12S393 D12S58 D12S332 IGF1 D12S318 PAH D12S815 D12S360 D12S806 D12S78 D12S800 D12S338 PLA2G1B Sibs affected Sib pairsb % alleles shared P valuec 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 238 156 58 227 156 58 227 156 58 206 127 50 227 156 58 227 156 58 227 156 58 227 156 58 238 156 58 232 169 61 243 169 61 243 169 61 232 169 61 232 169 61 232 169 61 232 169 61 227 156 58 50.1 47.8 47.4 53.5 41.2 54.3 52.4 42.2 55.2 48.5 44.8 55.6 49.7 44.2 54.3 52.5 45.3 54.7 51.3 45.3 50.0 52.9 43.2 55.6 52.3 44.6 55.2 50.0 45.6 55.6 48.1 45.4 54.1 49.7 46.3 51.7 51.3 42.5 56.6 50.4 45.1 54.5 51.2 42.5 56.6 50.9 41.3 54.5 49.0 45.8 55.2 NS 0.099 NS 0.031 0.0001 NS NS 0.002 NS NS 0.030 NS NS 0.003 NS 0.070 0.015 NS NS 0.014 NS 0.086 0.003 0.074 0.070 0.004 0.082 NS 0.021 0.051 NS 0.019 NS NS 0.021 NS NS 0.001 0.050 NS 0.022 NS NS 0.001 0.050 NS 0.0002 NS NS 0.036 0.082 a In the Amish, the distribution age–sex-adjusted log[total IgE] was dichotomized into ‘‘high’’ and ‘‘low’’ phenotypes using a cutpoint of 2.37 log ng/ml (234 ng/ml), based on the upper quartile. b There were a total of 473 full-sib pairs in the Amish families. The precise number of pairs analyzed varied slightly for different markers. c Analyses using fully informative haplotypes yielded similar or higher degrees of significance for discordant sib pairs for ( P values in parentheses): D12S379 (0.0001), D12S95 (0.005), D12S101 (0.012), D12S393 (0.012), D12S58 (0.009), D12S332 (0.009), IGF1 (0.001), D12S318 (0.002), PAH (0.0008), D12S815 (0.0004), D12S360 (0.0002), D12S806 (0.0001), D12S78 (0.0003), D12S800 (0.0003), and D12S338 (0.0001). P values for concordant high IgE pairs using the haplotypes ranged from 0.036 to 0.059 for loci in the interval D12S815–D12S338. 45 mental exposures (see Materials and Methods). In the Amish, many of the 17 markers revealed evidence for linkage with total IgE as a binary trait, primarily by significantly decreased allele-sharing in discordant (high IgE–low IgE) sib pairs (Table 3). When we analyzed fully informative haplotypes (see Materials and Methods), the evidence for linkage to 12q became even more significant: D12S379, IGF1, and loci in the interval PAH–D12S338 yielded P values of 0.0001–0.001 among the discordant sib pairs, and D12S815– D12S338 yielded P values ranging from 0.036 to 0.059 for the concordant high IgE pairs (Table 2, footnote). When we analyzed log[total IgE] as a quantitative trait, D12S360 showed modest evidence for linkage in the Amish (P Å 0.010). Four neighboring 12q markers also showed some evidence for linkage in the Amish, with P values ranging from 0.03 to 0.05. Analyses for total IgE as a continuous trait using fully informative haplotypes yielded similar but slightly less significant results (Table 3, footnote). Transmission disequilibrium tests. In the Barbadian families, the global TDT for asthma was significant for D12S379, D12S95, and PAH, with the strongest evidence for allelic association to D12S95 (P Å 0.002; Table 4). Further TDT analyses, allele-by-allele, revealed that allele 146 (size in bp) of D12S95 and allele 247 of PAH were both transmitted to asthmatic offspring significantly more frequently than would be expected by chance (P Å 0.019 and P Å 0.0002, respectively). Conversely, allele 156 of D12S95 was transmitted to asthmatic offspring significantly less often than expected (P Å 0.020) (see also footnote to Table 4). Significant transmission disequilibria were also noted for D12S379, D12S95, and D12S360, with elevated total IgE. Of special note, allele 146 of D12S95 was found to be transmitted significantly more frequently to offspring with high IgE (P Å 0.0002). Analogous to our findings for asthma, a negative allelic association was observed for allele 156, with high IgE in the Barbadian families (P Å 0.011). Using the global genotypic TDT for high total IgE in the Amish revealed modestly significant results (P £ 0.05) for D12S379, D12S58, D12S806, D12S78, D12S800, D12S338, and PLA2G1B (Table 4). Allele-by-allele analyses revealed the strongest associations of high total IgE with particular alleles of D12S379 (allele 197, P Å 0.0064) and D12S58 (allele 91, P Å 0.0072) in the Amish dataset. Multipoint IBD affected relative analysis. We performed a multipoint affected relative analysis of asthma in the Barbados dataset for the entire region D12S1052 – D12S338, using the program GENEHUNTER (Kruglyak et al., 1996). The nonparametric score peaked close to D12S379 (NPL Å 0.991, P Å 0.003), gradually decreasing on either side (Table 5). DISCUSSION Our study suggests that a locus predisposing to both asthma and elevated total serum IgE concentration is 46 BARNES ET AL. TABLE 4 Global Genotypic Transmission Disequilibrium Tests (TDT) for Asthma and Elevated Total Serum IgE Concentration in the Barbados and Amish Families. Total IgEb Asthma Locusa x2 (DF) P value x2 (DF) P value Barbados D12S1052 D12S379 D12S1064 D12S351 D12S311 D12S95 PAH D12S360 D12S78 D12S338 18.38 30.23 40.81 29.63 21.62 52.92 36.53 39.91 55.13 22.82 (16) (17) (30) (19) (16) (27) (21) (28) (53) (23) NS 0.025 0.090 0.057 NS 0.002 0.019 0.067 NS NS 19.33 32.07 32.39 28.21 26.52 45.43 21.48 52.42 70.74 23.87 (18) (18) (29) (20) (19) (28) (23) (35) (55) (22) NS 0.022 NS NS NS 0.020 NS 0.029 0.075 NS 1.69 17.94 18.04 11.10 11.24 22.29 7.07 0.77 16.48 30.29 6.34 40.72 38.40 41.80 27.11 25.69 (2) (9) (13) (11) (6) (13) (8) (4) (9) (21) (4) (25) (23) (26) (15) (9) NS 0.036 NS NS 0.081 0.051 NS NS 0.058 0.086 NS 0.025 0.023 0.026 0.028 0.002 Amish IFNG D12S379 D12S95 D12S101 D12S393 D12S58 D12S332 IGF1 PAH D12S815 D12S360 D12S806 D12S78 D12S800 D12S338 PLA2G1B — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — — a Allele-by-allele TDTs with asthma in the Barbados families were significant for [marker followed by allele (underlined), ratio of transmitted:not transmitted, P value] D12S95 (146, 55:33, 0.019; 156, 30:51, 0.0196) and PAH (247, 51:20, 0.0002). Significant allele-by-allele TDTs were also observed with high total IgE and D12S95 (146, 79:38, 0.00019; 156, 50:80, 0.011) and D12S78 (183, 17:6, 0.034). In the Amish, allele-by-allele TDTs with high IgE were significant for D12S379 (197, 11:1, 0.0064) and D12S58 (91, 17:4, 0.0072). b Cutpoints for age–sex-adjusted log[total IgE] were 2.68 log ng/ ml for the Barbadians and 2.37 log ng/ml for the Amish, based on the upper 50 and 25% of the distributions, respectively. located in a candidate region in chromosome 12q15– q24.1. The genes IFNG, SCF, IGF1, NFYB, and leukotriene A4 hydrolase (LTA4H) all map to this region. Affected sib-pair analyses in 29 multiplex Afro-Caribbean families revealed linkage of asthma to D12S379, D12S311, D12S95, and D12S360, which span a distance of about 25 cM (Fig. 1). Additional sib-pair analyses provided concurrent evidence for linkage of the high total IgE phenotype to markers in this same region (D12S1052, D12S311, D12S360, D12S78, and D12S338). The global genotypic TDT and TDTs for individual alleles at D12S95 yielded the most striking evidence for linkage in the Barbadian families: allele 146 was significantly positively associated with both asthma and high total IgE, while allele 156 was significantly negatively associated with these traits (Table 4, including footnotes). Sib-pair and TDT analyses in the Amish also provided evidence for linkage of total IgE to this same region (Tables 2–4). Adjusting total IgE for asthma in the Barbados dataset did not affect evidence for linkage, which suggests that these two complex phenotypes are not genetically the same. While the overall consistency of our results in two populations using multiple statistical tests for linkage (sib-pair, TDT, and multipoint IBD affected relative analyses in the Barbados families and sib-pair and TDT analyses in the Amish) is encouraging, some differences are noteworthy. In the Barbadian families, evidence for linkage of total IgE to these 12q markers came in the form of significantly increased allele-sharing in concordant high-IgE sib pairs. The pattern of IBD-sharing observed in a similar sib-pair analysis of dichotomized IgE in the Amish was somewhat different in that most of the significance came from the discordant pairs. In sib-pair analysis of rare binary traits, it is known that most information resides in concordant affected pairs (Blackwelder and Elston, 1985). By contrast, in traits like atopy or high IgE, where 25–30% of the population expresses the trait, discordant pairs are statistically just as powerful. Using the pedigree structures of the Amish, we simulated a polymorphic marker 10 cM from a quantitative trait locus with parameters similar to those recovered in a segregation analysis of total serum IgE in these families (Marsh et al., 1994; see Materials and Methods) and found that results such as those seen in the present analysis are quite consistent with a true linkage. Although the TDT for high IgE and D12S95 was not as significant in the Amish as in the Barbados subjects, the overall observation of allelic association by the global TDT for several markers in this region is consistent with linkage. In fact, associations with individual alleles in the Amish were most significant TABLE 5 Multipoint IBD Affected Relative Analysis of Chromosome 12q Markers for Asthma in 29 Barbadian Kindreds Locus Relative position (cM) NPL score P value D12S1052 D12S379 D12S1064 D12S351 D12S311 D12S95 PAH D12S360 D12S78 D12S338 0.00 9.10 11.50 13.11 15.91 21.12 36.30 38.30 39.10 39.50 0.796 0.991 0.945 0.922 0.836 0.752 0.595 0.510 0.496 0.488 0.013 0.0029 0.0042 0.0051 0.0098 0.017 0.047 0.075 0.080 0.084 LINKAGE OF ASTHMA AND TOTAL IgE TO 12q MARKERS 47 FIG. 1. Linkage map of human chromosome 12q15–q24.1 based on recombination frequencies (sex-averaged) observed in the Pennsylvania Old Order Amish, using the locus order reported by Krauter et al. (1995; relative positions of D12S806 and D12S78 have not been resolved). Genes are illustrated as boxes and anonymous markers as vertical bars. Half bars indicate markers analyzed only in the Barbados dataset. The physical locations of SCF and LTA4H are not precisely known. In the Barbados families, the map distances obtained for D12S1052–D12S379–D12S1064–D12S351–D12S311–D12S95–PAH–D12S360–D12S78–D12S338 are 8.5, 3.2, 1.3, 3.0, 5.0, 15.1, 2.2, 0.8, and 0.0 cM, respectively. for D12S379 and D12S58, which are both near D12S95. It is not surprising to observe the most significant evidence for linkage with different markers in the same general region, nor to find that different alleles of the putative susceptibility gene show different segregation patterns in two diverse populations. An analogy can be drawn between our results for asthma and total IgE in the Amish and Barbados populations and results from recent genetic studies of schizophrenia. Straub et al. (1995) and Schwab et al. (1995) both reported linkage of schizophrenia to the same general region on chromosome 6p, but each obtained the most significant evidence with markers that are about 18 cM apart. It is interesting to note that, in both populations, the levels of significance in the sib-pair analyses for total IgE were greater when total IgE concentration was treated as a dichotomous rather than as a continuous trait (Tables 1 – 3). Appropriate dichotomization may capture an underlying dominant/recessive trait model, which has been previously postulated (see Marsh et al., 1974, 1994; Gerrard et al., 1978; Dizier et al., 1995). The distinctions in the results from the two populations may reflect differences in the selection criteria, the definitions of high IgE, the genetic backgrounds, and the environmental exposures. Whereas the AfroCaribbean families were selected for asthma, from a population with an already high asthma prevalence, and reside in an area with unusually high levels of dust mite exposure (an annual average range of Ç60–79 mg Der p 1/g dust was detected in subject’s homes; K.C.B., unpublished data), the Amish families were selected from a genetically isolated Caucasian community only on the basis of detectable specific IgE Ab in at least one child. Unfortunately, no reliable clinical data on asthma are available for the Amish. The striking contrast in the geometric mean age–sex-adjusted total IgE values, 506 ng/ml for the Barbadians and 85 ng/ml for the Amish, underscores these differences. Because several candidate genes map to 12q15– q24.1 (Fig. 1), it is relevant to consider their identified functions and possible involvement in the development of asthma and increased IgE responsiveness. The cytokine IFN-g is known to promote the differentiation of type 1 helper T (TH1) lymphocytes and inhibit differentiation and IL-4 production in TH2 lymphocytes, which are involved in IgE synthesis and eosinophilia. The product of IGF1 promotes the differentiation of both B and T lymphocytes (Clark et al., 1993; Jardieu et al., 1994). SCF, encoded by a gene mapped to 12q22 (Mathew et al., 1992), is required for the proliferation of hematopoietic stem cells as well as mature mast cells (Anderson et al., 1990; Zsebo et al., 1990), which produce IL-4 and important inflammatory mediators. LTA4H, which encodes a hydrolase involved in prostaglandin metabolism and the inflammatory response associated with asthma (Funk et al., 1987), has also been recently mapped to 12q22 (Mancini and Evans, 1995). NFYB is an attractive candidate because of the dual role of NF-Y in upregulating the transcription of both the IL4 and the HLAD genes (Benoist and Mathis, 1990; Szabo et al., 1993; Li-Weber et al., 1994). Conceivably, polymorphisms in these genes could influence bronchial inflammation, IgE production, and/or asthma. In the genetic dissection of complex traits such as asthma, the power to detect linkage to any single locus is usually low (Lander and Schork, 1994; Davies et al., 1994). Guidelines for accepting linkage using various tests, based on genome-wide scans, have recently been proposed (Lander and Kruglyak, 1995). Considered separately, our results obtained by following the candidate gene approach do not provide conclusive proof of linkage. Taken together, analyses of both asthma and total IgE phenotypes, using independent tests for linkage in two markedly different populations, the Afro-Caribbean Barbadians and the Caucasian Pennsylvania Amish, support the exis- 48 BARNES ET AL. tence of a gene(s) in chromosome 12q15 – q24.1 influencing overall IgE responsiveness and risk of atopic asthma. Evidence for linkage in these two diverse groups provides the basis for studying additional 12q markers in other populations. Replication of these results across various populations will be important in establishing the validity and relevance of the linkage. Further data will be needed to assist in identifying the most probable location, identity, and manner of action of the implicated gene(s). ACKNO WLEDGMENTS We thank the families in Barbados and the Amish families of Lancaster, Pennsylvania for their generous participation in this study; the physicians and staff of the Black Rock, Sir Winston Scott, Randal Phillips, Maurice Byer, Six Cross Roads, and St. John polyclinics and the Accident and Emergency Department, Queen Elizabeth Hospital; the staff of the Leptospira Laboratory, Barbados, for their technical support; and the Ministry of Health, Barbados, for permission to conduct this study. We are especially grateful to Maria Stockton and Kimberly Donnelly for assistance with the fieldwork in Barbados, to Wendy Warren for her fieldwork with the Amish under the direction of Dr. Wilma Bias, and for technical support with the Barbados data by Dana Mulkern, Suzen Moeller, and Xielun Xue. We greatly appreciate comments from Drs. Farhad Imani and Shau-Ku Huang. This work was funded by NIH Grant AI20059. K.C.B. was supported in part by a grant from the USDA–ARS; J.D.N. was also supported by a grant from the Lucille P. Markey Charitable Trust; and D.L.D. was the recipient of a Neil Hamilton Fairley Fellowship from the Australian National Health and Medical Research Council. The computer program package S.A.G.E. is supported by a U.S. Public Health Resource Grant (1 p41 RR03655) from the Division of Research Resources. REFERENCES Anderson, D. M., Lyman, S. D., Baird, A., Wignall, J. M., Eisenman, J., Rauch, C., March, C. J., Boswell, H. S., Gimpel, S. D., Cosman, D., and Williams, D. E. (1990). Molecular cloning of mast cell growth factor, a hematopoietin that is active in both membrane bound and soluble forms. Cell 63: 235–243. Bazaral, M., Orgel, H. A., and Hamburger, R. N. (1974). Genetics of IgE and allergy: Serum IgE levels in twins. J. Allergy Clin. Immunol. 54: 288–304. Benoist, C., and Mathis, D. (1990). Regulation of major histocompatibility complex class-II genes: X, Y and other letters of the alphabet. Annu. Rev. Immunol. 8: 681–715. Blackwelder, W. C., and Elston, R. C. (1985). A comparison of sibpair linkage tests for disease susceptibility loci. Genet. Epidemiol. 2: 85–97. Blumenthal, M. N., Banks-Schlegel, S., Bleecker, E. R., Marsh, D. G., and Ober, C. (1995). Collaborative studies on the genetics of asthma—National Heart, Lung, and Blood Institute. Clin. Exp. Allergy 25: 29–32. Borecki, I. B., Rao, D. C., Lalouel, J. M., McGue, M., and Gerrard, J. W. (1985). Demonstration of a common major gene with pleiotropic effects on immunoglobulin E levels and allergy. Genet. Epidemiol. 2: 327–338. Burrows, B., Martinez, F. D., Halonen, M., Barbee, R. A., and Cline, M. G. (1989). Association of asthma with serum IgE levels and skin-test reactivity to allergens. N. Engl. J. Med. 320: 271 – 277. Clark, R., Strasser, J., McCabe, S., Robbins, K., and Jardieu, P. (1993). Insulin-like growth factor-1 stimulation of lymphopoiesis. J. Clin. Invest. 92: 540–548. Cooke, R. A., and VanderVeer, V. A. (1916). Human sensitisation. J. Immunol. 1: 201–305. Davies, J. L., Kawaguchi, Y., Bennett, S. T., Copeman, J. B., Cordell, H. J., Pritchard, L. E., Reed, P. W., Gough, S. C. L., Jenkins, S. C., Palmer, S. M., Balfour, K. M., Rowe, B. R., Farrall, M., Barnett, A. H., Bain, S. C., and Todd, J. A. (1994). A genome-wide search for human type 1 diabetes susceptibility genes. Nature 371: 130–136. DeSanctis, G. T., Merchant, M., Beier, D. R., Dredge, R. D., Grobholz, J. K., Martin, T. R., Lander, E. S., and Drazen, J. M. (1995). Quantitative locus analysis of airway hyperresponsiveness in A/J and C57BL/6J mice. Nature Genet. 11: 150–154. Dizier, M. H., Hill, M., James, A., Faux, J., Ryan, G., le Souef, P., Lathrop, M., Musk, A. W., Demenais, F., and Cookson, W. O. C. M. (1995). Detection of a recessive major gene for high IgE levels acting independently of specific response to allergens. Genet. Epidemiol. 12: 93–105. Duffy, D. L., Martin, N. G., Battistutta, D., Hopper, J. L., and Mathews, J. D. (1990). Genetics of asthma and hay fever in Australian twins. Am. Rev. Respir. Dis. 142: 1351–1358. Edfors-Lubs, M.-L. (1971). Allergy in 7000 twin pairs. Acta Allergol. 26: 249–285. Ewart, S. L., Mitzner, W., DiSilvestri, D., Meyers, D. A., and Levitt, R. C. (1996). Airway hyperresponsiveness to acetylcholine: Evidence for linkage to murine chromosome 6. Am. J. Respir. Cell Mol. Biol. 14: 487–495. Freidhoff, L. R., and Marsh, D. G. (1993). The relationship among asthma, serum IgE levels and skin-test sensitivity to inhaled allergens. Int. Arch. Allergy Appl. Immunol. 100: 355–361. Funk, C. D., Radmark, O., Fu, J. Y., Matsumoto, T., Jornvall, H., Shimizu, T., and Samuelsson, B. (1987). Molecular cloning and amino acid sequence of leukotriene A(4) hydrolase. Proc. Natl. Acad. Sci. USA 84: 6677–6681. Gerrard, J. W., Rao, D. C., and Morton, N. E. (1978). A genetic study of immunoglobulin E. Am. J. Hum. Genet. 30: 46–58. Green, P., Falls, K., and Crooks, S. (1990). Cri-Map, Computer program Version 2.4, Washington University, St. Louis. Hanson, B., McGue, M., Roitman-Johnson, B., Segal, N. L., Bouchard, T. J., and Blumenthal, M. N. (1991). Atopic disease and immunoglobulin E in twins reared apart and together. Am. J. Hum. Genet. 48: 873–879. Haseman, J. K., and Elston, R. C. (1972). The investigation of linkage between a quantitative trait and a marker locus. Behav. Genet. 2: 3–19. Hopp, R. J., Bewtra, A. K., Watt, G. D., Nair, N. M., and Townley, R. G. (1984). Genetic analysis of allergic disease in twins. J. Allergy Clin. Immunol. 73, 265–270. Huang, S. K., Zwollo, P., and Marsh, D. G. (1991). Class II MHC restriction of human T-cell responses to short ragweed allergen, Amb a V. Eur. J. Immunol. 21: 1469–1473. Jardieu, P., Clark, R., Mortensen, D., and Dorshkind, K. (1994). In vivo administration of insulin-like growth factor-I stimulates primary B lymphopoiesis and enhances lymphocyte recovery after bone marrow transplantation. J. Immunol. 152: 4320–4327. Johansson, S. G. O., Bennich, H. H., and Berg, T. (1972). The clinical significance of IgE. Prog. Clin. Immunol. 1: 157–181. Kay, A. B. (1988). ‘‘The Allergic Basis of Asthma.’’ Balliére Tindall, London. Krauter, K., Montgomery, K., Yoon, S.-J., LeBlanc-Straceski, J., Renault, B., Marondel, I., Herdman, V., Cupelli, L., Banks, A., Lieman, J., Menninger, J., Bray-Ward, P., Nadkarni, P., Weissenbach, J., Le Paslier, D., Rigault, P., Chumakov, I., Cohen, D., Miller, P., Ward, D., and Kucherlapati, R. (1995). A second-generation YAC contig map of human chromosome 12. Nature 377: 321– 333. Kruglyak, L., Daly, M. J., Reeve-Daly, M. P., and Lander, E. S. LINKAGE OF ASTHMA AND TOTAL IgE TO 12q MARKERS (1996). Parametric and nonparametric linkage analysis: A unified multipoint approach. Am. J. Hum. Genet. 58: 1347–1363. Lander, E., and Kruglyak, L. (1995). Genetic dissection of complex traits: Guidelines for interpreting and reporting linkage results. Nature Genet. 11: 241–247. Lander, E. S., and Schork, N. J. (1994). Genetic dissection of complex traits. Science 265: 2037 – 2048. Lau-Schadendorf, S., and Wahn, U. (1991). Atopic diseases in infancy. The German multicenter atopy study (MAS-90). Pediatr. Allergy Immunol. 2: 63–69. Li-Weber, M., Davydov, I. V., Krafft, H., and Krammer, P. H. (1994). The role of NF-Y and IRF-2 in the regulation of human IL-4 gene expression. J. Immunol. 153: 4122–4133. Mancini, J. A., and Evans, J. F. (1995). Cloning and characterization of the human leukotriene A-4 hydrolase gene. Eur. J. Biochem. 231: 65–71. Marsh, D. G., and Blumenthal, M. N. (1990). ‘‘Genetic and Environmental Factors in Clinical Allergy.’’ Univ. of Minnesota Press, Minneapolis. Marsh, D. G., Bias, W. B., and Ishizaka, K. (1974). Genetic control of basal serum immunoglobulin E level and its effect on specific reaginic sensitivity. Proc. Natl. Acad. Sci. USA 71: 3588 – 3592. Marsh, D. G., Hsu, S. H., Roebber, M., Ehrlich-Kautzky, E., Freidhoff, L. R., Meyers, D. A., Pollard, M. K., and Bias, W. B. (1982). HLA-Dw2: A genetic marker for human immune response to short ragweed pollen allergen Ra5. I. Response resulting primarily from natural antigenic exposure. J. Exp. Med. 155: 1439–1451. Marsh, D. G., Zwollo, P., Huang, S. K., Ghosh, B., and Ansari, A. A. (1990). Molecular studies of human response to allergens. Cold Spring Harbor Symp. Quant. Biol. 54: 459–470. Marsh, D. G., Neely, J. D., Breazeale, D. R., Ghosh, B., Freidhoff, L. R., Ehrlich-Kautzky, E., Schou, C., Krishnaswamy, G., and Beaty, T. H. (1994). Linkage analysis of IL4 and other chromosome 5q31.1 markers and total serum immunoglobulin E concentrations. Science 264: 1152–1156. Martinez, F. D., Holberg, C. J., Halonen, M., Morgan, W. J., Wright, A. L., and Taussig, L. M. (1994). Evidence for mendelian inheritance of serum IgE levels in Hispanic and non-Hispanic white families. Am. J. Hum. Genet. 55: 555–565. Mathew, S., Murty, V. V. V. S., Hunziker, W., and Chaganti, R. S. K. (1992). Subregional mapping of 13 single-copy genes on the long arm of chromosome 12 by fluorescence in situ hybridization. Genomics 14: 775–779. Meyers, D. A., Postma, D. S., Panhuysen, C. I. M., Xiu, J., Amelung, P. J., Levitt, R. C., and Bleecker, E. R. (1994). Evidence for a locus regulating total serum IgE levels mapping to chromosome 5. Genomics 23: 464–470. Meyers, D. A., Beaty, T. H., Freidhoff, L. R., and Marsh, D. G. (1987). Inheritance of serum total IgE (basal levels) in man. Am. J. Hum. Genet. 41: 51–62. Moffatt, M. F., Hill, M. R., Cornélis, F., Schou, C., Faux, J. A., Young, R. P., James, A. L., Ryan, G., le Souef, P., Musk, A. W., Hopkin, J. M., Cookson, W. O. C. M. (1994). Genetic linkage of T-cell receptor a/d complex to specific IgE responses. Lancet 343: 1597 – 1600. Ohe, M., Munakata, M., Hizawa, N., Itoh, A., Doi, I., Yamaguchi, E., Homma, Y., and Kawakumi, Y. (1995). Beta2-adrenergic receptor gene polymorphism and bronchial asthma. Thorax 50: 353 – 359. Pearson, R. S. B., and Cunnington, A. M. (1973). The importance of mites in house dust sensitivity in Barbadian asthmatics. Clin. Allergy 3: 299–306. Platts-Mills, T. A. E., de Weck, A. L., et al. (1989). Dust mite allergens and asthma—A worldwide problem. J. Allergy Clin. Immunol. 83: 416–427. Postma, D. S., Bleecker, E. R., Amelung, P. J., Holroyd, K. J., Xu, 49 J., Panhuysen, C. I. M., Meyers, D. A., and Levitt, R. C. (1995). Genetic susceptibility to asthma—Bronchial hyperresponsiveness coinherited with a major gene for atopy. N. Engl. J. Med. 333: 894–900. Rosenwasser, L. J., Klemm, D. J., Dresback, J. K., Inamura, J. J., Mascali, J. J., Klinnert, M., and Borish, L. (1995). Promoter polymorphisms in the chromosome 5 gene cluster in asthma and atopy. Clin. Exp. Allergy 25(Suppl. 2): 74–78. Ruiz-Linares, A. (1993). Dinucleotide repeat polymorphism in the interferon-gamma (IFNG) gene. Hum. Mol. Genet. 2: 1508. S. A. G. E. (Statistical Analysis for Genetic Epidemiology) 2.2 (1994). Department of Biometry and Genetics, Louisiana State University Medical Center, New Orleans. Sandford, A. J., Shirakawa, T., Moffatt, M. F., Daniels, S. E., Ra, C., Faux, J. A., Young, R. P., Nakamura, Y., Lathrop, G. M., Cookson, W. O. C. M., and Hopkin, J. M. (1993). Localisation of atopy and b subunit of high-affinity IgE receptor (FceRI) on chromosome 11q. Lancet 341: 332–334. Schwab, S. G., Albus, M., Hallmayer, J., Hšnig, S., Borrmann, M., Lichtermann, D., Ebstein, R. P., Ackenheil, M., Lerer, B., Risch, N., Maier, W., and Wildenauer, D. B. (1995). Evaluation of a susceptibility gene for schizophrenia on chromosome 6p by multipoint affected sib-pair linkage analysis. Nature Genet. 11: 325 – 327. Sears, M. R., Burrows, B., Flannery, E. M., Herbison, G. P., Hewitt, C. J., and Holdaway, M. D. (1991). Relation between airway responsiveness and serum IgE in children with asthma and in apparently normal children. N. Engl. J. Med. 325: 1067–1071. Sham, P. C., and Curtis, D. (1995). An extended transmission disequilibrium test (TDT) for multi-allele marker loci. Ann. Hum. Genet. 59: 323–336. Shirakawa, T., Li, A., Dubowitz, M., Dekker, J. W., Shaw, A. E., Faux, J. A., Ra, C., Cookson, W. O., and Hopkin, J. M. (1994). Association between atopy and variants of the b subunit of the high-affinity immunoglobulin E receptor. Nature Genet. 7: 125– 130. Sibbald, B., and Rink, E. (1991). Epidemiology of seasonal and perennial rhinitis: Clinical presentation and medical history. Thorax 46: 895–901. Song, Z., Casolaro, V., Chen, R., Georas, S. N., Monos, D., and Ono, S. J. (1996). Polymorphic nucleotides within the human IL-4 promoter that mediate overexpression of the gene. J. Immunol. 156: 424–429. Sporik, R., Holgate, S. T., Platts-Mills, T. A. E., and Cogswell, J. J. (1990). Exposure to house-dust mite allergen (Der p I) and the development of asthma in childhood. N. Engl. J. Med. 323: 502– 507. Straub, R. E., MacLean, C. J., O’Neill, F. A., Burke, J., Murphy, B., Duke, F., Shinkwin, R., Webb, B. T., Zhang, J., Walsh, D., and Kendler, K. S. (1995). A potential vulnerability locus for schizophrenia on chromosome 6p24–22: Evidence for genetic heterogeneity. Nature Genet. 11: 287–293. Szabo, S. J., Gold, J. S., Murphy, T. L., and Murphy, K. M. (1993). Identification of cis-acting regulatory elements controlling interleukin-4 gene expression in T cells: Roles for NF-Y and NF-ATc . Mol. Cell. Biol. 13: 4793–4805. Terwilliger, J. D., and Ott, J. (1994). ‘‘Handbook of Human Genetic Linkage.’’ The Johns Hopkins Univ. Press, Baltimore. Turki, J., Pak, J., Green, S. A., Martin, R. J., and Liggett, S. B. (1995). Genetic polymorphisms of the b2-adrenergic receptor in nocturnal and nonnocturnal asthma: Evidence that Gly16 correlates with the nocturnal phenotype. J. Clin. Invest. 95: 1635 – 1641. Weber, J. L., and May, P. E. (1989). Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am. J. Hum. Genet. 44: 388–396. Whitehead Institute/MIT Center for Genome Research (1995). 50 BARNES ET AL. Human Genetic Mapping Project, Data Release 9, December, 1995. Young, A. (1995). Genetic Analysis System, Computer Program Version 2.0, Oxford University, Oxford. Young, R. P., Hart, B. J., Merrett, T. G., Read, A. F., and Hopkin, J. M. (1992). House dust mite sensitivity: Interaction of genetics and allergen dosage. Clin. Exp. Allergy 22: 205 – 211. Zsebo, K. M., Wypych, J., McNiece, I. K., Lu, H. S., Smith, K. A., Karkare, S. B., Sachdev, R. K., Yuschenkoff, V. N., Birkett, N. C., Williams, L. R., Satyagal, V. N., Tung, W., Bosselman, R. A., Mendiaz, E. A., and Langley, K. E. (1990). Identification, purification, and biological characterization of hematopoietic stem cell factor from buffalo rat liver-conditioned medium. Cell 63: 195 – 201. Zwollo, P., Ehrlich-Kautzky, E., Scharf, S. J., Ansari, A. A., Erhlich, H. A., and Marsh, D. G. (1991). Sequencing of HLA-D in responders and nonresponders to short ragweed allergen, Amb a V. Immunogenetics 33: 141–151.