DIABETES-INSULIN-GLUCAGON-GASTROINTESTINAL Chemerin Exacerbates Glucose Intolerance in Mouse Models of Obesity and Diabetes Matthew C. Ernst, Mark Issa, Kerry B. Goralski, and Christopher J. Sinal Department of Pharmacology (M.C.E., K.B.G., C.J.S.) and College of Pharmacy (M.I., K.B.G.), Dalhousie University, Halifax, Nova Scotia, Canada B3H 1X5 O besity, characterized by an excess of adipose tissue, has reached epidemic proportions worldwide, particularly in the highly industrialized Western societies (1). This condition has a number of negative psychosocial impacts, reduces life expectancy, and imposes a great economic burden (1). Obese individuals are also at increased risk for hypertension, dyslipidemia, cardiovascular disease, and type 2 diabetes (2– 4). A major factor underlying the adverse metabolic consequences of obesity is believed to be a decreased sensitivity to the biological actions of insulin, a pathophysiological state known as insulin resistance (5, 6). Initially, glucose tolerance remains relatively unaffected because the individual compensates by increasing insulin secretion to overcome the cellular resistance. However, this hyperinsulinemic state can exacerbate insulin resistance and result in glucose intolerance, hyperlipidemia, and ultimately type 2 diabetes (7). In addition to an important energy storage function, adipose tissue serves as an active endocrine organ that secretes a number of hormone-like compounds, collectively termed adipokines (8 –11). Adipokines affect adiposity, adipocyte metabolism, and inflammatory responses in adipose tissue and have important roles in the regulation of systemic lipid and glucose metabolism through endocrine actions in the adipose, brain, liver, and skeletal muscle tissue (11–14). Serum levels of many adipokines are affected by the degree of adiposity and body mass index (BMI), signifying that the synthesis and secretion of adipokines is dynamic and modifiable (15). Thus, decreased insulin sensitivity associated with obesity may reflect an imbalance in the secretion of proinflammatory/prodiabetic and antiinflammatory/antidiabetic adipokines that occur as a consequence of the dysfunctional adipose tissue that develops with obesity (15–23). Chemerin, also known as tazarotene-induced gene 2 (TIG2) and retinoic acid receptor responder 2 (RARRES2), ISSN Print 0013-7227 ISSN Online 1945-7170 Printed in U.S.A. Copyright © 2010 by The Endocrine Society doi: 10.1210/en.2009-1098 Received September 14, 2009. Accepted February 17, 2010. First Published Online March 12, 2010 Abbreviations: BMI, Body mass index; CCRL2, chemokine (C-C motif) receptor-like 2; CMKLR1, chemokine-like receptor 1; DIO, diet-induced obesity; 2-DOG, 2-关1,2-3H(N)兴deoxy-D-glucose; GLUT4, glucose transporter 4; GPCR, G protein-coupled receptor; GPR1, G protein-coupled receptor 1; GSA, glucose-specific activity; GTT, glucose tolerance test; RT, reverse transcription; TBST, Tris-buffered saline with 0.1% Tween 20. 1998 endo.endojournals.org Endocrinology, May 2010, 151(5):1998 –2007 Downloaded from https://academic.oup.com/endo/article-abstract/151/5/1998/2456507 by guest on 21 May 2020 Obesity, characterized by an excess of adipose tissue, is an established risk factor for cardiovascular disease and type 2 diabetes. Different mechanisms linking obesity with these comorbidities have been postulated but remain poorly understood. Adipose tissue secretes a number of hormone-like compounds, termed adipokines, that are important for the maintenance of normal glucose metabolism. Alterations in the secretion of adipokines with obesity are believed to contribute to the undesirable changes in glucose metabolism that ultimately result in the development of type 2 diabetes. In the present study, we have shown that serum levels of the novel adipokine chemerin are significantly elevated in mouse models of obesity/diabetes. The expression of chemerin and its receptors, chemokine-like receptor 1, chemokine (C-C motif) receptor-like 2, and G protein-coupled receptor 1 are altered in white adipose, skeletal muscle, and liver tissue of obese/diabetic mice. Administration of exogenous chemerin exacerbates glucose intolerance, lowers serum insulin levels, and decreases tissue glucose uptake in obese/diabetic but not normoglycemic mice. Collectively, these data indicate that chemerin influences glucose homeostasis and may contribute to the metabolic derangements characteristic of obesity and type 2 diabetes. (Endocrinology 151: 1998 –2007, 2010) Endocrinology, May 2010, 151(5):1998 –2007 1999 Materials and Methods Animal protocol and housing All protocols and procedures were approved by the Dalhousie University Committee on Laboratory Animals and are in accordance with the Canadian Council on Animal Care guidelines. Lepob/ob (ob/ob), Leprdb/db (db/db), and C57BL/6 mice were obtained from The Jackson Laboratory (Bar Harbor, ME). The low-fat diet containing 10% kcal from fat (D12450B) and highfat diet containing 45% kcal from fat (D12451) were purchased from Research Diets (New Brunswick, NJ). Mice were housed in groups of two to five in filter-top cages with a fixed 12-h light,12-h dark cycle. Lepob/ob, Leprdb/db, and C57BL/6 littermates were fed standard mouse chow (Prolab RMH 3000; PMI Nutrition International, Inc., St. Louis, MO). At 13 wk of age, ob/ob, db/db, and C57BL/6 mice were anesthetized with an ip injection of 80 mg/kg sodium pentobarbital (CMTC Pharmaceuticals, Cambridge, Ontario, Canada). Blood was collected by cardiac puncture, allowed to clot for 2 h at room temperature, and then centrifuged; serum was stored at ⫺80 C until used. Liver, skeletal muscle, and epididymal white adipose tissue were snap frozen in liquid nitrogen before RNA extraction. C57BL/6 mice used in the diet-induced obesity (DIO) experiments were switched to the low- or high-fat diet at 6 wk of age for 18 wk. DIO mice and C57BL/6 controls were anesthetized at 25 wk of age. RNA isolation and quantification Liver RNA was isolated using Trizol reagent (Invitrogen, Burlington, Ontario, Canada), and white adipose and skeletal muscle RNA were isolated using RNeasy Mini Kits (QIAGEN, Mississauga, Ontario, Canada) as per the manufacturer’s instructions. To quantify RNA, samples were diluted in ribonuclease-free water and placed in a UV spectrophotometric plate, and the absorbance at 260 and 280 nm was measured using a PowerWavex spectrophotometer plate reader (Bio-Tek Instruments, Winooski, VT). The quantity of RNA was calculated using Beer’s law with an extinction coefficient of 40 ␮g/ml. Reverse transcription (RT) and quantitative real-time PCR From the isolated RNA samples, 0.5 ␮g RNA was reverse transcribed using AffinityScript reverse transcriptase (Stratagene, La Jolla, CA) as per the manufacturer’s instructions, and 1 ␮l cDNA product was amplified by quantitative real-time PCR. All genes were normalized to mouse cyclophilin A expression. PCR primer sequences were as follows: mCyclophilinA forward, GAGCTGTTTGCAGACAAAGTTC, and reverse, CCCTGGCACATGAATCCTGG; mChemerin forward, TACAGGTGGCTCTGGAGGAGTTC, and reverse, CTTCTCCCGTTTGGTTTGATTG; mCMKLR1 forward, CAAGCAAACAGCCACTACCA, and reverse, TAGATGCCGGAGTCGTTGTAA; mCCRL2 forward, CTCTGCTTGTCCTCGTGCTT, and reverse, GCCCACTGTTGTCCAGGTAG; and mGPR1 forward, CACCTTTCGGGGTGTCATT, and reverse, AAGGAAATGTGTTAATGTTCTG. To measure gene expression, 1 ␮l RT product was combined with 19 ␮l of a master mix containing Brilliant SYBR Green QPCR 2⫻ Master Mix (Stratagene), Rox reference dye (Stratagene), water, and gene-specific primers (2.5 ␮M). The Mx3000P Thermocycler was programmed with cycling conditions consisting of 10 min at 95 C for initial denaturation followed by 40 cycles of 95 C for 20 sec, 60 C for 18 sec, and 72 C for 30 sec for Downloaded from https://academic.oup.com/endo/article-abstract/151/5/1998/2456507 by guest on 21 May 2020 is a novel adipokine that has a role in adaptive and innate immunity, and regulates adipocyte differentiation and metabolism by binding to and activating the seventransmembrane-spanning G protein-coupled receptor (GPCR), chemokine-like receptor 1 (CMKLR1) (10, 24 –27). Chemerin also serves as a ligand for chemokine (C-C motif) receptor-like 2 (CCRL2) and G protein-coupled receptor 1 (GPR1). Evidence suggests that CCRL2 is a nonsignaling receptor that binds chemerin and increases the local concentration of the peptide (28, 29). However, the function of GPR1 in mammals has not been elucidated. Chemerin is secreted as an 18-kDa inactive proprotein that can be rapidly converted by C-terminal proteolytic cleavage into its active 16-kDa form, which is found in plasma, serum, and hemofiltrate (25–27, 30, 31). Previously, we have reported that loss of chemerin or CMKLR1 expression in 3T3-L1 preadipocytes severely impairs differentiation into mature adipocytes and reduces the expression of genes involved in glucose and lipid metabolism, including perilipin, glucose transporter 4 (GLUT4), adiponectin, and leptin (10). Takahashi et al. (32) reported that recombinant mouse chemerin modestly increased insulin-stimulated tyrosine phosphorylation of insulin receptor substrate-1 and glucose uptake in 3T3 adipocytes. In contrast, Kralisch et al. (33) reported that chemerin significantly decreased insulin-stimulated glucose transport in 3T3 adipocytes. Similarly, Sell et al. (34) reported that chemerin reduces glucose uptake in human skeletal muscle cells at the level of insulin receptor substrate-1 and Akt. These findings illustrate the need to clarify the role of chemerin in glucose metabolism. Recent clinical studies have demonstrated that serum chemerin levels are elevated in obese patients compared with healthy patients. These cases reported positive correlations between serum chemerin levels and BMI, serum triglycerides, and blood pressure (35–37). It has also been shown that insulin increases, whereas metformin decreases, white adipose secretion and serum chemerin levels (38). The expression of chemerin and its three receptors in tissues central to glucose homeostasis indicates that changes in the biological actions of chemerin may contribute to disruptions in glucose metabolism that occur with obesity. Therefore, we have proposed that chemerin contributes to the pathology of insulin resistance through the regulation and modulation of glucose homeostasis in white adipose, skeletal muscle, and liver tissue. To investigate this, we examined the expression of chemerin and the cognate receptors in murine models of obesity and diabetes. Furthermore, we also tested the effect of chemerin on blood glucose and insulin levels in these models. endo.endojournals.org 2000 Ernst et al. Chemerin and Glucose Homeostasis denaturation, annealing, and polymerization. The Mx3000E Pro software was used to calculate the threshold cycle. Relative gene expression was normalized to cyclophilin A expression using the ⌬⌬Ct method (39). Total serum chemerin measurements Western blotting Approximately 500 mg adipose, skeletal muscle, or liver tissue was homogenized in 1.5 ml ice-cold subcellular fractionation buffer 关250 mM sucrose, 20 mM HEPES (pH 7.4), 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol兴 and centrifuged at 10,000 ⫻ g for 10 min at 4 C. The protein concentration of the clarified homogenate was quantitated using a Lowry assay, and 40 ␮g was separated on a 15% SDS-polyacrylamide gel and subsequently transferred overnight (25 V) to a nitrocellulose membrane. After rinsing with PBS, the membranes were incubated in blocking solution 关5% nonfat skim milk dissolved in Tris-buffered saline with 0.1% Tween 20 (TBST)兴 for 1 h at room temperature. After this, the membranes were incubated overnight at 4 C with an antimouse chemerin antibody (AF2325; R&D Systems, Minneapolis, MN) diluted 1:500 in blocking solution. After washing four times for 5 min in TBST, the membrane was further incubated with a horseradish peroxidase-conjugated donkey antigoat IgG secondary antibody (1:10,000 in blocking buffer) for 1 h at room temperature. After washing four times for 5 min in TBST, the immunoreactive chemerin protein (⬃16 kDa) was visualized using ECL-plus reagent (GE Healthcare, Piscataway, NJ) and a Storm 840 phosphor imager (GE Healthcare). Quantification of bioactive chemerin using the CMKLR1 Tango bioassay HTLA cells, kindly provided by Dr. Gilad Barnea (29), were maintained in DMEM supplemented with 10% fetal bovine serum, 0.1% penicillin/streptomycin, 100 ␮g/ml streptomycin, 0.5 mg/ml G418, 5 ␮g/ml puromycin, and 0.2 mg/ml hygromycin. For assays, the cells were seeded on 96-well plates at a density of 12,000 cells per well in plating medium (same as maintenance medium but without selection agents). After 24 h, for each well, 25 ng CMKLR1-TL-tTA plasmid, 25 ng pCMV-␤-galactosidase reference plasmid, and 50 ng carrier plasmid pBSK were added to 10 ␮l Opti-Mem reduced-serum medium. After the sequential addition of 0.1 ␮l polyethylenimine, incubation for 10 min at room temperature, and the addition of 40 ␮l plating medium, the entire volume of resulting transfection mix was added to each well. After 24 h, the transfection mix was removed and replaced with serum samples diluted 1:10 in a total of 50 ␮l Opti-Mem. After an additional 24 h incubation, the medium was aspirated, the cells were washed once with 100 ␮l PBS and incubated for 5 min with shaking (10,000 rpm) in 100 ␮l reporter lysis buffer (RLT; Promega, Nepean, Ontario, Canada) followed by a rapid freeze/thaw cycle to lyse the cells. For the luciferase assay, 10 ␮l lysate was transferred to a 96-well white luminometer microplate. Luciferase activity was measured using luciferase assay reagent (Promega) and a Luminoskan Ascent luminometer (Thermo Fisher Scientific, Waltham, MA). For the ␤-galactosidase assay, 30 ␮l lysate was transferred to a clear 96-well plate incubated with 30 ␮l 2⫻ ␤-galactosidase assay buffer (Promega) for 15 min at 37 C. The reaction was stopped by the addition of 100 ␮l 1 M Na2CO3, and the absorbance at 420 nm was measured. The luciferase and ␤-galactosidase measurements were corrected for the respective blanks, and sample activity was expressed as the ratio of luciferase/␤-galactosidase activity (Promega). A standard curve was derived from activity measurements of serial dilutions (0.1–30 nM) of recombinant mouse chemerin prepared in Opti-Mem and treated identically to serum samples. Apparent serum chemerin concentrations were extrapolated from a standard curve generated by nonlinear regression and fitting to a one-site binding hyperbola using GraphPad Prism version 4.00 (GraphPad Software, La Jolla, CA). Glucose tolerance tests (GTTs) GTTs were performed on Lepob/ob, Leprdb/db, and C57BL/6 littermate controls at 12 wk of age and DIO mice at 24 wk of age. Mice were weighed before the test, and after an 18-h overnight fast, were injected ip with filter-sterilized D-glucose (BDH Inc., Toronto, Ontario, Canada) at 2 mg/g and either PBS or 4 or 40 ng/g recombinant human chemerin. Blood samples were collected from the saphenous vein at 0, 15, 30, 45, 60, 90, and 120 min after injection, and glucose concentrations were measured using a glucometer (Freestyle Freedom). Serum insulin measurements Serum insulin levels were measured using a rat/mouse insulin ELISA as per manufacturer’s instructions (Millipore). Briefly, sample wells were washed before the addition of assay buffer, matrix solution, quality controls, serum samples, standards ranging from 0.2–10 ng/ml, and detection antibody. After 2 h incubation, sample wells were washed and incubated with enzyme solution for 30 min. Next, the wells were washed, and the substrate solution was added and incubated for 15 min. Stop solution was added immediately afterward, and the absorbance was measured at 450 and 590 nm. In vivo tissue glucose uptake during a GTT GTT were performed on Leprdb/db and C57BL/6 littermate controls at 12 wk of age. Mice were weighed before the test and, after an 18-h overnight fast, were injected ip with filter-sterilized 3 D-glucose (BDH) at 2 mg/g, 10 ␮Ci 2-关1,2- H(N)兴deoxy-D-glucose (2-DOG) (PerkinElmer, Waltham, MA), and either PBS or 40 ng/g recombinant human chemerin. Blood samples were collected from the saphenous vein at 0, 15, 30, 45, and 60 min after injection, and glucose concentrations were measured using a glucometer (Freestyle Freedom). At 60 min, mice were anesthetized, and liver, skeletal muscle, and epididymal white adipose tissue samples were snap frozen in liquid nitrogen. To determine glucose-specific activity (GSA), plasma samples from 0, 15, 30, 45, and 60 min were deproteinized using perchloric acid and neutralized with KHCO3. Radioactivity was measured using a scintillation counter, and GSA was calculated by determining the area under the curve of sample radioactivity divided by glucose Downloaded from https://academic.oup.com/endo/article-abstract/151/5/1998/2456507 by guest on 21 May 2020 Serum chemerin levels were measured using a mouse chemerin ELISA, as per manufacturer’s instructions (Millipore, Billerica, MA). Briefly, sample wells were washed with wash buffer before the addition of assay buffer, quality controls, serum samples, and standards ranging from 3.125–200 ng/ml. After 1.5 h incubation, sample wells were washed and incubated with the detection antibody for 1 h. The wells were again washed, and the enzyme solution was added and incubated for 30 min. Next, the wells were washed, and the substrate solution was added and incubated for 30 min. Stop solution was added immediately afterward, and the absorbance was measured at 450 and 590 nm. Endocrinology, May 2010, 151(5):1998 –2007 Endocrinology, May 2010, 151(5):1998 –2007 endo.endojournals.org 2001 concentration for the duration of the experiment. To determine tissue accumulation of 2-DOG, 100 –500 mg tissue was homogenized in distilled water, and the homogenate was transferred to perchloric acid. The sample was centrifuged to remove precipitated protein, and the supernatant was neutralized with KHCO3. The precipitate was removed by centrifugation, and the radioactivity in the supernatant was measured in a scintillation counter. To calculate 2-DOG uptake, tissue radioactivity was divided by the GSA and the mass of the tissue homogenized. Statistics Results Characterization of the mRNA levels of chemerin and its cognate receptors Previous studies have reported that the mRNA levels of chemerin and CMKLR1 are highest in liver and white adipose tissue (10). However, a relative comparison of the mRNA levels of chemerin and its cognate receptors in C57BL/6 white adipose, liver, and skeletal muscle tissue, tissues with roles important in glucose homeostasis, has not been performed. Using quantitative real-time PCR, we found that mouse chemerin mRNA levels were significantly lower in skeletal muscle compared with white adipose and liver tissue (Fig. 1). CMKLR1 mRNA levels were approximately 5-fold lower in skeletal muscle and 36-fold lower in liver tissue relative to white adipose tissue. In contrast, the mRNA levels of CCRL2 and GPR1 were significantly higher in skeletal muscle tissue when compared with liver and white adipose tissue. To determine the effect of obesity and diabetes on the mRNA levels of FIG. 1. Chemerin and cognate receptors are differentially expressed in tissues important in glucose homeostasis. Relative mRNA levels of chemerin, CMKLR1, CCRL2, and GPR1 were determined in C57BL/6 mouse white adipose, skeletal muscle, and liver tissues by quantitative real-time PCR. White adipose served as the reference tissue (expression ⫽ 1.0) to which all other tissues were compared. n ⫽ 4 –5. Each bar represents the mean ⫾ SEM. *, P ⬍ 0.05, one-way ANOVA followed by Bonferroni’s multiple-comparison test. FIG. 2. The mRNA levels of chemerin and its cognate receptors are altered in ob/ob mice. Relative mRNA levels of chemerin, CMKLR1, CCRL2, and GPR1 were determined in C57BL/6 and ob/ob white adipose, skeletal muscle, and liver tissue by quantitative real-time PCR. C57BL/6 expression served as the reference (expression ⫽ 1.0) to which ob/ob mice were compared (n ⫽ 5–10). Each bar represents the mean ⫾ SEM. *, P ⬍ 0.05, unpaired t test. chemerin and its receptors, leptin-deficient (ob/ob) and leptin receptor-deficient (db/db) mouse models were used. In ob/ob mice, CMKLR1 mRNA was 2.3-fold lower in white adipose tissue and 4.8-fold higher in skeletal muscle compared with congenic C57BL/6 controls (Fig. 2). Chemerin mRNA levels were also significantly higher in ob/ob skeletal muscle compared with C57BL/6 controls (Fig. 2). Similar to ob/ob mice, CMKLR1 levels were significantly lower (2.7-fold) in white adipose tissue and higher (4.3-fold) in skeletal muscle of db/db mice compared with C57BL/6 mice (Fig. 3). In contrast to ob/ob mice, CCRL2 mRNA levels were significantly higher in db/db white adipose tissue and GPR1 mRNA levels were Downloaded from https://academic.oup.com/endo/article-abstract/151/5/1998/2456507 by guest on 21 May 2020 All data are expressed as mean ⫾ SEM. All comparisons were performed using an unpaired t test or a one- or two-way ANOVA unless otherwise stated. A Bonferroni’s test was used for post hoc analysis of the significant ANOVA. A difference in mean values between groups was considered to be significant when P ⬍ 0.05. 2002 Ernst et al. Chemerin and Glucose Homeostasis Endocrinology, May 2010, 151(5):1998 –2007 FIG. 3. The mRNA levels of chemerin and its cognate receptors are altered in db/db mice. Relative mRNA levels of chemerin, CMKLR1, CCRL2, and GPR1 were determined in C57BL/6 and db/db white adipose, skeletal muscle, and liver tissue by quantitative real-time PCR. C57BL/6 expression served as the reference (expression ⫽ 1.0) to which ob/ob mice were compared (n ⫽ 5–10). Each bar represents the mean ⫾ SEM. *, P ⬍ 0.05, unpaired t test. significantly lower in db/db liver. Also in contrast to ob/ob mice, chemerin mRNA was significantly higher in db/db liver tissue (Fig. 3). Quantitation of serum chemerin Several recent studies have demonstrated that serum chemerin levels in humans are positively associated with characteristics of the metabolic syndrome, including obesity, plasma triglycerides, and blood pressure (35–37). To determine whether mouse serum chemerin levels also correlated with obesity, total chemerin levels were quantified in serum from C57BL/6, ob/ob, and db/db mice. In both ob/ob and db/db mice, total serum chemerin levels were approximately 2-fold higher than C57BL/6 controls (Fig. 4A). Chemerin is secreted as an 18-kDa inactive proprotein, known as prochemerin, that can be rapidly converted The impact of chemerin on blood glucose levels Adipokines, including leptin, adiponectin, visfatin, resistin, omentin, and IL-6, modulate energy metabolism, insulin sensitivity, and glucose tolerance. Knockdown of chemerin expression by adenovirus-delivered short hairpin RNA in mature adipocytes causes a decrease in the expression genes important in glucose homeostasis and the pathogenesis of insulin resistance, including GLUT4, adiponectin, and leptin (10). However, the systemic effects of chemerin on glucose homeostasis remain unknown. To investigate chemerin function in vivo, ip injections of PBS, recombinant human chemerin, and human insulin were performed in 12-wk-old C57BL/6 mice, and blood glucose levels were monitored over a 2-h period. As expected, insulin significantly decreased blood glucose levels relative to vehicle (data not shown). In contrast, ip injections of recombinant human chemerin did not significantly impact blood glucose levels (data not shown). Obesity and type 2 diabetes are associated with alterations in energy metabolism, glucose homeostasis, and resistance to the actions of insulin. Serum levels and tissue sensitivity of adipokines are also affected by the degree of adiposity and BMI. Therefore, GTT were performed in the presence and absence of chemerin with both normoglycemic (C57BL/6) Downloaded from https://academic.oup.com/endo/article-abstract/151/5/1998/2456507 by guest on 21 May 2020 into its active 16-kDa form by the proteolytic removal of the C-terminal amino acids by plasmin, carboxypeptidases, or serine proteases of the coagulation, fibrinolytic, and inflammatory cascades (25, 30, 40 – 42). Consequently, it was important to determine whether these elevated total serum chemerin levels corresponded to an increase in bioactive chemerin. A limitation of the ELISA is that it detects both prochemerin and bioactive chemerin (i.e. total chemerin). Using a CMKLR1-Tango assay (29), we detected a 2-fold greater level of bioactive chemerin in the serum of ob/ob or db/db mice compared with C57BL/6 controls (Fig. 4B). Interestingly, the serum concentration of bioactive chemerin in all mice was 3- to 3.5-fold greater than the concentration of total chemerin (Fig. 4C). To begin to elucidate the tissue source of the elevated serum chemerin with obesity/diabetes, total chemerin protein levels were analyzed by Western blotting of white adipose, liver, or skeletal muscle homogenates. Despite the high levels of mRNA for chemerin in adipose and liver, absolute chemerin immunoreactivity in these tissues was quite weak (Fig. 4D). Total chemerin protein levels were 2.4fold higher in adipose tissue homogenates prepared from obese, diabetic db/db mice compared with normoglycemic C57BL/6 mice. In contrast, chemerin protein levels were similar in liver tissue homogenates prepared from either group of mice. In skeletal muscle, chemerin protein was undetectable by Western blotting. Endocrinology, May 2010, 151(5):1998 –2007 endo.endojournals.org 2003 FIG. 5. Chemerin treatment exacerbates glucose intolerance in ob/ob mice. Vehicle or chemerin (4 or 40 ng/g) was injected ip to C57BL/6 (A and C) and ob/ob (B and D) mice with glucose (2 mg/g). A and B, Blood samples were collected over a 2-h period, and blood glucose levels were analyzed. C and D, Serum samples were also collected throughout the GTT and analyzed for serum insulin levels (n ⫽ 10). Each bar represents mean ⫾ SEM. *, P ⬍ 0.05; **, P ⬍ 0.01 vs. vehicle, two-way ANOVA followed by Bonferroni’s multiple-comparison test. The impact of chemerin on in vivo tissue glucose uptake To determine whether the exacerbated glucose intolerance caused by chemerin in vivo (Figs. 5B, 6B, and 7B) was associated with a reduction in basal and/or insulin-mediated glucose uptake, we performed in vivo tissue glucose uptake experiments in db/db mice. Because the maximal effect of 40 ng/g chemerin was seen at 60 min in the GTT (Fig. 6B), this endpoint was selected for the glucose uptake assay. Consistent with GTT results, chemerin had no significant impact on tissue glucose uptake in C57BL/6 control mice (Fig. 8A). However, chemerin treatment significantly decreased both liver and total tissue (white adipose, liver, and skeletal muscle) glucose uptake (Fig. 8B). A Downloaded from https://academic.oup.com/endo/article-abstract/151/5/1998/2456507 by guest on 21 May 2020 erbated glucose intolerance, with significantly elevated blood glucose levels at 30 and 45 min (Fig. 5B). The lower dose of 4 ng/g had no significant effect. Similar to the ob/ob results, chemerin exacerbated glucose intolerance in db/db mice, with significantly elevated blood glucose levels at 60 and 90 min (Fig. 6B). Again, the lower dose of 4 ng/g did not have a significant effect. Interestingly, 4 ng/g recombinant human chemerin exacerbated glucose intolerance in DIO mice, with significantly elevated blood glucose levels at 15, 30, and 45 min (Fig. 7B). However, 40 ng/g did not have a significant effect on glucose tolerance in this model. To determine whether the exacerbated glucose intolerance caused by FIG. 4. Serum chemerin levels are elevated in mouse models of obesity and diabetes. Blood chemerin administration to the obese/diwas collected using cardiac puncture and was allowed to coagulate for 2 h. A and B, The abetic mouse models was associated with resulting serum was analyzed for total chemerin using a mouse chemerin ELISA (A) and bioactive chemerin levels using a CMKLR1 Tango assay (B). C, We then calculated the ratio of changes in serum insulin, levels of this bioactive to total chemerin levels. n ⫽ 5. Each bar is the mean ⫾ SEM. **, P ⬍ 0.01 vs. hormone were measured throughout the C57BL/6, one-way ANOVA followed by Bonferroni’s multiple-comparison test. D, Total GTT. In ob/ob mice, 40 ng/g of chemerin chemerin protein was also examined in white adipose (WA), liver (LV), and skeletal muscle (SM) tissues using Western blotting. ND, Not detected. Values represent mean relative significant decreased serum insulin levels densitometry data ⫾ SEM. *, P ⬍ 0.05, unpaired t test. at 15, 30, and 45 min (Fig. 5D). Similarly, 40 ng/g chemerin significantly reduced and diabetic (ob/ob, db/db, and DIO) mouse models. serum insulin levels in db/db mice at 60 min (Fig. 6D). In DIO Chemerin administration had no effect on glucose toler- mice, both 4 and 40 ng/g chemerin significantly decreased ance in C57BL/6 control mice (Figs. 5A, 6A, and 7A). In serum insulin levels at 120 min (Fig. 7D). Consistent with the ob/ob mice, 40 ng/g recombinant human chemerin exac- GTT data, chemerin treatment had no effect on serum insulin levels in C57BL/6 control mice (Figs. 5C, 6C, and 7C). 2004 Ernst et al. Chemerin and Glucose Homeostasis Endocrinology, May 2010, 151(5):1998 –2007 Discussion Downloaded from https://academic.oup.com/endo/article-abstract/151/5/1998/2456507 by guest on 21 May 2020 Herein, we report for the first time that the novel adipokine chemerin exacerbates glucose intolerance in mouse models of obesity and diabetes. Consistent with recent human data (35–37), we observed a significantly higher amount of serum chemerin in two different genetic mouse models of obesity. Furthermore, our novel findings are the first to evaluate the mRNA levels of chemerin and its cognate receptors in white adipose, liver, and skeletal muscle tissue of mouse models of obesity. CCRL2 is believed to be an atypical silent, or nonsignaling, receptor that binds chemerin and increases local conFIG. 6. Chemerin treatment exacerbates glucose intolerance in db/db mice. Vehicle or centrations of the bioactive peptide chemerin (4 or 40 ng/g) was injected ip to C57BL/6 (A and C) and db/db (B and D) mice with glucose (2 mg/g). A and B, Blood samples were collected over a 2-h period, and blood (28). GPR1, a signaling GPCR closely glucose levels were analyzed. C and D, Serum samples were also collected throughout the related to CMKLR1, is activated by GTT and were analyzed for serum insulin levels. n ⫽ 10. Each bar represents mean ⫾ SEM. chemerin; however, the physiological *, P ⬍ 0.05; **, P ⬍ 0.01 vs. vehicle, two-way ANOVA followed by Bonferroni’s multiplecomparison test. function of this receptor in mammals has not been elucidated (29). Consistent with previous studies (10, 24, 25), we highly reproducible decrease in white adipose tissue gluobserved that chemerin mRNA levels were highest in cose uptake was also observed with chemerin treatment of white adipose and liver tissue, and CMKLR1 levels were db/db mice; however, this effect just failed to achieve stahighest in white adipose tissue. For the first time, we report tistical significance (P ⫽ 0.06). here that the mRNA levels of CCRL2 and GPR1 are significantly higher in skeletal muscle tissue, when compared with both white adipose and liver tissue. This suggests that under normal conditions, the relative importance of GPR1-mediated chemerin signaling in skeletal muscle would be greater than CMKLR1. Previously, we reported that CMKLR1 mRNA levels were modestly, but not significantly, lower in visceral white adipose tissue of ob/ob mice vs. C57BL6/J controls (10). In the present study, we observed a significant decrease in mRNA levels of CMKLR1 in white adipose tissue and a significant increase in skeletal muscle tissue of ob/ob and db/db mice compared with C57BL/6 controls. The reason for this discrepancy may be that for the present study, FIG. 7. Chemerin treatment exacerbates glucose intolerance in DIO mice. Vehicle or we used 12- to 13-wk-old mice, which chemerin (4 or 40 ng/g) was injected ip to C57BL/6 (A and C) and DIO (B and D) mice with glucose (2 mg/g). A and B, Blood samples were collected over a 2-h period, and have a more severe obese/diabetic pheblood glucose levels were analyzed. C and D, Serum samples were also collected notype compared with the younger throughout the GTT and were analyzed for serum insulin levels (n ⫽ 10). Each bar mice used for the previous study. The represents mean ⫾ SEM. *, P ⬍ 0.05 vs. vehicle, two-way ANOVA followed by Bonferroni’s multiple-comparison test. role of chemerin in skeletal muscle en- Endocrinology, May 2010, 151(5):1998 –2007 ergy metabolism and the effect of CMKLR1 overexpression in vitro have not yet been examined, but a decrease in CMKLR1 mRNA levels in white adipose tissue and an increase in skeletal muscle tissue suggest a redistribution in the targeting of chemerin activity mediated through this receptor. GPR1 mRNA levels showed a trend to decrease in ob/ob white adipose and db/db white adipose and skeletal muscle tissue and were significantly decreased in db/db liver tissue. However, the functional role and signaling cascade of GPR1 remains unknown, and further studies are required to determine the effect of a reduction in GPR1 mRNA levels. The mRNA levels of CCRL2 were significantly increased in white adipose tissue of db/db mice and trended toward an increase in ob/ob white adipose tissue. Interestingly, chemerin was initially described as a chemoattractant protein with a role in adaptive and innate immunity (25–27, 30, 31, 42, 43). Therefore, by increasing the local concentration of bioactive chemerin, an elevation in CCRL2 mRNA levels may contribute to the increase in leukocyte infiltration observed in white adipose tissue found in obesity. Many studies have demonstrated that serum levels of adipokines, including leptin and adiponectin, are affected by the degree of adiposity and BMI (15–23). Consistent 2005 with recent human studies (35, 36), we found that total serum chemerin levels were elevated in mouse models of obesity and diabetes. The elevation of chemerin mRNA levels in skeletal muscle of ob/ob mice and liver tissue of db/db mice is a possible explanation for the elevated serum chemerin levels in these mice. However, despite the 2-fold higher levels of chemerin mRNA levels in db/db when compared with C57BL/6 mice, total chemerin protein levels in liver were not significantly different between these models. Furthermore, chemerin protein was undetectable in skeletal muscle homogenates prepared from C57BL/6 or db/db mice. However, total chemerin protein levels were elevated 2.4-fold in white adipose homogenates prepared from db/db vs. C57BL/6 mice, suggesting that white adipose-derived chemerin contributes to the elevated circulating chemerin levels. Given that white adipose chemerin mRNA levels were not correspondingly higher, it is most likely that the elevated adipose and, possibly, serum chemerin derives from changes in posttranslational processes (i.e. proteolytic processing and secretion). Nonetheless, these data alone are insufficient grounds to conclude that white adipose tissue is the source of elevated serum chemerin. However, it is worth noting that this postulate would be consistent with independent human studies that reported a direct relationship between BMI and serum chemerin (35– 37), increased chemerin secretion from adipose tissue explants of obese vs. lean subjects (34), and a reduction of serum chemerin levels with bariatric surgery (44). Chemerin is secreted as an 18-kDa inactive proprotein that is processed to an active 16-kDa form that is responsible for receptor binding and physiological activity (25– 27, 30, 31). A significant limitation of the chemerin ELISA is that it detects both prochemerin and bioactive chemerin. Using the Tango assay described here, we determined that serum total chemerin protein levels and bioactive chemerin levels were approximately 2-fold higher in mouse models of obesity compared with C57BL/6 mice. Furthermore, the concentration of bioactive chemerin was 3-fold higher than total chemerin protein levels in serum. Several peptides between eight and 19 amino acids in length that correspond to the C terminus of chemerin have similar activity to recombinant mouse chemerin (42, 45). Another study reported that chemerin activation requires two cleavages, with the first producing bioactive chemerin with very low activity and the second producing fully activated bioactive chemerin (41). Therefore, serum levels of bioactive chemerin are likely higher than the concentration of total chemerin protein because there are chemerin derivatives in the serum with activities similar to or greater than the single form of recombinant mouse chemerin used to generate the standard curve for the ELISA and Tango assays. Thus, it is critical to measure Downloaded from https://academic.oup.com/endo/article-abstract/151/5/1998/2456507 by guest on 21 May 2020 FIG. 8. Chemerin decreases in vivo tissue glucose uptake in db/db mice. Vehicle or chemerin (4 or 40 ng/g) was injected ip to C57BL/6 (A) and db/db (B) mice with glucose (2 mg/g) and 10 ␮Ci 2-DOG. Blood samples were collected over a 1-h period, and blood glucose concentration and radioactivity were measured. After 60 min, mice were euthanized, tissues were snap frozen and homogenized, and radioactivity was measured. GSA was calculated by dividing blood radioactivity by blood glucose concentration and calculating the area under the curve. Tissue radioactivity 关disintegrations per minute (DPM)兴 was normalized to GSA and the mass of tissue homogenized (n ⫽ 5–10). Each bar represents the mean ⫾ SEM. *, P ⬍ 0.05, unpaired t test. SKM, Skeletal muscle; WA, white adipose. endo.endojournals.org 2006 Ernst et al. Chemerin and Glucose Homeostasis to determine whether any direct interaction between chemerin signaling, GLUT2-mediated glucose uptake, and insulin secretion exist. In summary, we provide evidence that serum chemerin levels are elevated in obesity and diabetes and that chemerin exacerbates glucose intolerance in these models by decreasing serum insulin levels and glucose uptake in liver tissue. Thus, further characterization of the function of chemerin and CMKLR1 and GPR1 signaling in hepatocytes and pancreatic ␤-cells has the potential to lead to novel therapeutic approaches for the treatment of obesity and type 2 diabetes. Acknowledgments Address all correspondence and requests for reprints to: Dr. Christopher J. Sinal, Department of Pharmacology, Dalhousie University, 5850 College Street, Halifax, Nova Scotia, Canada B3H 1X5. E-mail: csinal@dal.ca. This work was supported by the Canadian Institutes for Health Research (C.J.S. and K.B.G.). M.C.E. is the recipient of a studentship from the Nova Scotia Health Research Foundation. Disclosure Summary: The authors have nothing to disclose. References 1. Hossain P, Kawar B, El Nahas M 2007 Obesity and diabetes in the developing world: a growing challenge. N Engl J Med 356:213–215 2. Muoio DM, Newgard CB 2006 Obesity-related derangements in metabolic regulation. Annu Rev Biochem 75:367– 401 3. James PT, Rigby N, Leach R 2004 The obesity epidemic, metabolic syndrome and future prevention strategies. Eur J Cardiovasc Prev Rehabil 11:3– 8 4. Poirier P, Giles TD, Bray GA, Hong Y, Stern JS, Pi-Sunyer FX, Eckel RH 2006 Obesity and cardiovascular disease: pathophysiology, evaluation, and effect of weight loss. Arterioscler Thromb Vasc Biol 26:968 –976 5. Reaven GM 2003 The insulin resistance syndrome. Curr Atheroscler Rep 5:364 –371 6. Wilcox G 2005 Insulin and insulin resistance. Clin Biochem Rev 26:19 –39 7. Patti ME, Kahn CR 1996 Lessons from transgenic and knockout animals about noninsulin-dependent diabetes mellitus. Trends Endocrinol Metab 7:311–319 8. Ahima RS, Flier JS 2000 Adipose tissue as an endocrine organ. Trends Endocrinol Metab 11:327–332 9. Frühbeck G, Gómez-Ambrosi J, Muruzábal FJ, Burrell MA 2001 The adipocyte: a model for integration of endocrine and metabolic signaling in energy metabolism regulation. Am J Physiol Endocrinol Metab 280:E827–E847 10. Goralski KB, McCarthy TC, Hanniman EA, Zabel BA, Butcher EC, Parlee SD, Muruganandan S, Sinal CJ 2007 Chemerin, a novel adipokine that regulates adipogenesis and adipocyte metabolism. J Biol Chem 282:28175–28188 11. Goralski KB, Sinal CJ 2007 Type 2 diabetes and cardiovascular disease: getting to the fat of the matter. Can J Physiol Pharmacol 85:113–132 Downloaded from https://academic.oup.com/endo/article-abstract/151/5/1998/2456507 by guest on 21 May 2020 both levels because disease and/or drugs have the potential to affect chemerin expression, secretion, and processing. Studies have shown that both serum levels of and the physiological response to many adipokines are altered with obesity. Consistent with this, recombinant chemerin administration exacerbated glucose intolerance in obese/ diabetic (ob/ob, db/db, and DIO) but not normoglycemic C57BL/6 mouse models. The consistent impact of chemerin on glucose tolerance in all of the models of obesity/diabetes suggests that leptin or leptin receptor deficiency is not directly responsible for the observed differences in glucose tolerance. However, this cannot be ruled out based upon the present data because altered leptin signaling (i.e. leptin resistance) is common with obesity. Because chemerin affected glucose intolerance only in obese/diabetic mice, the most likely mechanisms are by reducing serum insulin levels or by further modulation of the already perturbed insulin signaling cascade. By collecting serum throughout the GTT and quantifying serum insulin levels, we determined that chemerin treatment significantly reduced insulin levels in obese and diabetic mice but had no effect in C57BL/6 mice. Consistent with the glucose tolerance data, total tissue glucose uptake significantly decreased in obese mice treated with chemerin but not in C57BL/6 mice. Glucose uptake was also consistently reduced in white adipose tissue; however, statistical significance was not attained (P ⫽ 0.06) in this set of experiments. No effect of chemerin was apparent for skeletal muscle glucose uptake in normoglycemic or obese/diabetic mice. Given that the greatest impact of chemerin was on hepatic glucose uptake, modulation of GLUT4 is unlikely as a mechanism because this transporter does not contribute substantially to insulin-stimulated glucose uptake in this tissue. Rather, after an increase in blood glucose concentration, glucose uptake into liver tissue is principally facilitated by GLUT2, a passive glucose transporter (46). Glucose is then phosphorylated by glucokinase and used in various metabolic pathways, such as glycogen synthesis. GLUT2 is also highly expressed in pancreatic ␤-cells and initiates insulin secretion by increasing the concentration of glucose within the cell. Because we observed both a decrease in serum insulin levels and a decrease in liver glucose uptake, it is possible that chemerin is reducing GLUT2-mediated glucose transport in these tissues, thus resulting in a decrease in glucose uptake and insulin secretion. In addition, studies have shown that CMKLR1 activation results in intracellular calcium release and phosphorylation of ERK kinases (26). This is interesting because the insulin secretion cascade also causes intracellular calcium release and ERK activation, suggesting that chemerin treatment may impair insulin secretion by competing for these responses. Additional studies are required Endocrinology, May 2010, 151(5):1998 –2007 Endocrinology, May 2010, 151(5):1998 –2007 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 2007 and is required for optimal induction of IgE-mediated passive cutaneous anaphylaxis. J Exp Med 205:2207–2220 Barnea G, Strapps W, Herrada G, Berman Y, Ong J, Kloss B, Axel R, Lee KJ 2008 The genetic design of signaling cascades to record receptor activation. Proc Natl Acad Sci USA 105:64 – 69 Zabel BA, Allen SJ, Kulig P, Allen JA, Cichy J, Handel TM, Butcher EC 2005 Chemerin activation by serine proteases of the coagulation, fibrinolytic, and inflammatory cascades. J Biol Chem 280: 34661–34666 Zabel BA, Ohyama T, Zuniga L, Kim JY, Johnston B, Allen SJ, Guido DG, Handel TM, Butcher EC 2006 Chemokine-like receptor 1 expression by macrophages in vivo: regulation by TGF-␤ and TLR ligands. Exp Hematol 34:1106 –1114 Takahashi M, Takahashi Y, Takahashi K, Zolotaryov FN, Hong KS, Kitazawa R, Iida K, Okimura Y, Kaji H, Kitazawa S, Kasuga M, Chihara K 2008 Chemerin enhances insulin signaling and potentiates insulin-stimulated glucose uptake in 3T3-L1 adipocytes. FEBS Lett 582:573–578 Kralisch S, Weise S, Sommer G, Lipfert J, Lossner U, Bluher M, Stumvoll M, Fasshauer M 2009 Interleukin-1␤ induces the novel adipokine chemerin in adipocytes in vitro. Regul Pept 154:102–106 Sell H, Laurencikiene J, Taube A, Eckardt K, Cramer A, Horrighs A, Arner P, Eckel J 2009 Chemerin is a novel adipocyte-derived factor inducing insulin resistance in primary human skeletal muscle cells. Diabetes 58:2731–2740 Bozaoglu K, Bolton K, McMillan J, Zimmet P, Jowett J, Collier G, Walder K, Segal D 2007 Chemerin is a novel adipokine associated with obesity and metabolic syndrome. Endocrinology 148:4687– 4694 Stejskal D, Karpisek M, Hanulova Z, Svestak M 2008 Chemerin is an independent marker of the metabolic syndrome in a Caucasian population: a pilot study. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub 152:217–221 Bozaoglu K, Segal D, Shields KA, Cummings N, Curran JE, Comuzzie AG, Mahaney MC, Rainwater DL, VandeBerg JL, MacCluer JW, Collier G, Blangero J, Walder K, Jowett JB 2009 Chemerin is associated with metabolic syndrome phenotypes in a MexicanAmerican population. J Clin Endocrinol Metab 94:3085–3088 Tan BK, Chen J, Farhatullah S, Adya R, Kaur J, Heutling D, Lewandowski KC, O’Hare JP, Lehnert H, Randeva HS 2009 Insulin and metformin regulate circulating and adipose tissue chemerin. Diabetes 58:1971–1977 Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2⫺⌬⌬CT method. Methods 25:402– 408 Wittamer V, Bondue B, Guillabert A, Vassart G, Parmentier M, Communi D 2005 Neutrophil-mediated maturation of chemerin: a link between innate and adaptive immunity. J Immunol 175:487– 493 Du XY, Zabel BA, Myles T, Allen SJ, Handel TM, Lee PP, Butcher EC, Leung LL 2009 Regulation of chemerin bioactivity by plasma carboxypeptidase N, carboxypeptidase B (activated thrombin-activable fibrinolysis inhibitor), and platelets. J Biol Chem 284:751–758 Wittamer V, Grégoire F, Robberecht P, Vassart G, Communi D, Parmentier M 2004 The C-terminal nonapeptide of mature chemerin activates the chemerin receptor with low nanomolar potency. J Biol Chem 279:9956 –9962 Nagpal S, Patel S, Jacobe H, DiSepio D, Ghosn C, Malhotra M, Teng M, Duvic M, Chandraratna RA 1997 Tazarotene-induced gene 2 (TIG2), a novel retinoid-responsive gene in skin. J Invest Dermatol 109:91–95 Ress C, Tschoner A, Engl J, Klaus A, Tilg H, Ebenbichler CF, Patsch JR, Kaser S 2010 Effect of bariatric surgery on circulating chemerin levels. Eur J Clin Invest 40:277–280 Cash JL, Hart R, Russ A, Dixon JP, Colledge WH, Doran J, Hendrick AG, Carlton MB, Greaves DR 2008 Synthetic chemerin-derived peptides suppress inflammation through ChemR23. J Exp Med 205:767– 775 Uldry M, Thorens B 2004 The SLC2 family of facilitated hexose and polyol transporters. Pflugers Arch 447:480 – 489 Downloaded from https://academic.oup.com/endo/article-abstract/151/5/1998/2456507 by guest on 21 May 2020 12. Friedman JM, Halaas JL 1998 Leptin and the regulation of body weight in mammals. Nature 395:763–770 13. Havel PJ 2004 Update on adipocyte hormones: regulation of energy balance and carbohydrate/lipid metabolism. Diabetes 53(Suppl 1): S143–S151 14. Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P, Carling D, Kimura S, Nagai R, Kahn BB, Kadowaki T 2002 Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat Med 8:1288 –1295 15. Fain JN, Madan AK, Hiler ML, Cheema P, Bahouth SW 2004 Comparison of the release of adipokines by adipose tissue, adipose tissue matrix, and adipocytes from visceral and subcutaneous abdominal adipose tissues of obese humans. Endocrinology 145:2273–2282 16. Dandona P, Weinstock R, Thusu K, Abdel-Rahman E, Aljada A, Wadden T 1998 Tumor necrosis factor-␣ in sera of obese patients: fall with weight loss. J Clin Endocrinol Metab 83:2907–2910 17. Folsom AR, Qamhieh HT, Wing RR, Jeffery RW, Stinson VL, Kuller LH, Wu KK 1993 Impact of weight loss on plasminogen activator inhibitor (PAI-1), factor VII, and other hemostatic factors in moderately overweight adults. Arterioscler Thromb 13:162–169 18. Itoh K, Imai K, Masuda T, Abe S, Tanaka M, Koga R, Itoh H, Matsuyama T, Nakamura M 2002 Relationship between changes in serum leptin levels and blood pressure after weight loss. Hypertens Res 25:881– 886 19. Primrose JN, Davies JA, Prentice CR, Hughes R, Johnston D 1992 Reduction in factor VII, fibrinogen and plasminogen activator inhibitor-1 activity after surgical treatment of morbid obesity. Thromb Haemost 68:396 –399 20. Samad F, Pandey M, Loskutoff DJ 1998 Tissue factor gene expression in the adipose tissues of obese mice. Proc Natl Acad Sci USA 95:7591–7596 21. Samad F, Yamamoto K, Pandey M, Loskutoff DJ 1997 Elevated expression of transforming growth factor-␤ in adipose tissue from obese mice. Mol Med 3:37– 48 22. Yudkin JS, Stehouwer CD, Emeis JJ, Coppack SW 1999 C-reactive protein in healthy subjects: associations with obesity, insulin resistance, and endothelial dysfunction: a potential role for cytokines originating from adipose tissue? Arterioscler Thromb Vasc Biol 19:972–978 23. Zhang B, Graziano MP, Doebber TW, Leibowitz MD, WhiteCarrington S, Szalkowski DM, Hey PJ, Wu M, Cullinan CA, Bailey P, Lollmann B, Frederich R, Flier JS, Strader CD, Smith RG 1996 Downregulation of the expression of the obese gene by an antidiabetic thiazolidinedione in Zucker diabetic fatty rats and db/db mice. J Biol Chem 271:9455–9459 24. Roh SG, Song SH, Choi KC, Katoh K, Wittamer V, Parmentier M, Sasaki S 2007 Chemerin: a new adipokine that modulates adipogenesis via its own receptor. Biochem Biophys Res Commun 362: 1013–1018 25. Wittamer V, Franssen JD, Vulcano M, Mirjolet JF, Le Poul E, Migeotte I, Brézillon S, Tyldesley R, Blanpain C, Detheux M, Mantovani A, Sozzani S, Vassart G, Parmentier M, Communi D 2003 Specific recruitment of antigen-presenting cells by chemerin, a novel processed ligand from human inflammatory fluids. J Exp Med 198:977–985 26. Meder W, Wendland M, Busmann A, Kutzleb C, Spodsberg N, John H, Richter R, Schleuder D, Meyer M, Forssmann WG 2003 Characterization of human circulating TIG2 as a ligand for the orphan receptor ChemR23. FEBS Lett 555:495– 499 27. Zabel BA, Silverio AM, Butcher EC 2005 Chemokine-like receptor 1 expression and chemerin-directed chemotaxis distinguish plasmacytoid from myeloid dendritic cells in human blood. J Immunol 174:244 –251 28. Zabel BA, Nakae S, Zúñiga L, Kim JY, Ohyama T, Alt C, Pan J, Suto H, Soler D, Allen SJ, Handel TM, Song CH, Galli SJ, Butcher EC 2008 Mast cell-expressed orphan receptor CCRL2 binds chemerin endo.endojournals.org