Behavioural Brain Research 231 (2012) 181–186 Contents lists available at SciVerse ScienceDirect Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr Research report GABA system changes in methylphenidate sensitized female rats L. Freese a,b,∗ , E.J. Muller a , M.F. Souza a , N.S. Couto-Pereira a , C.F. Tosca a , M. Ferigolo b , H.M.T. Barros a a b Division of Pharmacology, Basic Health Sciences Department, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, RS, Brazil Universidade Federal de Ciências da Saúde de Porto Alegre/National Services of Orientation and Information on the Prevention of Drug Use – VIVAVOZ, Brazil a r t i c l e i n f o Article history: Received 13 August 2011 Received in revised form 6 March 2012 Accepted 10 March 2012 Available online 20 March 2012 a b s t r a c t Methylphenidate (MPD) is a psychostimulant that is prescribed to treat attention-deficit/hyperactivity disorder (ADHD) and has been used as a recreational drug. In animal models, repetitive exposure to methylphenidate can induce a behavioral sensitization. Stimulants are able to change neuronal circuits in the mesolimbic pathway, and the GABA system is one of the most involved neurotransmitter systems in this process. Women represent a risk group for psychostimulant abuse because they respond more strongly, which is probably due to the influence of sex hormones. The objective of the present study was to investigate the influence of sex hormones on behavioral sentsitization and changes to glutamic acid decarboxylase (GDA65 and GDA67) isoenzymes and ␣2 GABAA receptor subunit mRNA expression in the prefrontal cortex and the striatum of rats, as induced by methylphenidate administration (2.5 mg/kg, i.p.). Female rats were divided into 2 hormonal conditions: ovariectomized and intact group. Repeated methylphenidate treatment led to behavioral sensitization, which was stronger in females with circulating hormones (intact group). The analysis of mRNA levels in the striatum, in both groups, showed a decline in GAD65, but not GAD67, transcription after repeated methylphenidate treatment. In the prefrontal cortex, both GAD65 and GAD67 showed an increase in transcription with repeated methylphenidate treatment. There was no change in the transcription level of ␣2 GABAA receptor subunits. In conclusion, it was shown that sex hormones were able to modify behavioral sensitization to methylphenidate and the drug affected the GABA system in brain areas known to be involved in the development of drug dependence. © 2012 Elsevier B.V. All rights reserved. 1. Introduction The psychostimulant methylphenidate (MPD) is the most prescribed drug to treat children, adolescents and adults with attention deficit hyperactivity disorder (ADHD) [1,2], but little is known about its long-term effects [3]. In recent years MPD has been more frequently prescribed due to the increasing number of diagnoses. Its widespread clinical use increased the risk of non-medical use of this drug [4,5]. Because it has pharmacological stimulant properties similar to amphetamine and cocaine, MPD has the potential of abuse [6,7]. In fact, these psychostimulants similarly block dopamine and noradrenaline transporters in pre-synaptic neurons, thus increasing the availability of these neurotransmitters in the synaptic cleft [8,9]. However, the expression of such effects depends on a number of variables such as route of administration, prior drug history and diagnostic status [10–13]. Cocaine ∗ Corresponding author at: Pharmacology Division, Universidade Federal de Ciências da Saúde de Porto Alegre – UFCSPA, Sarmento Leite, 245, 3rd floor – Centro, CEP: 90050-170, Porto Alegre, RS, Brazil. Tel.: +55 51 3003 8821; fax: +55 51 3003 8821. E-mail address: freese@ufcspa.edu.br (L. Freese). 0166-4328/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.bbr.2012.03.017 and amphetamine induce a variety of neuroplastic changes in brain function and behavior [14,15]. Chronic exposure to low to moderate doses of MPD causes behavioral sensitization [3,16–18]. Behavioral sensitization is characterized by augmented locomotor activity to subsequent psychostimulant challenge [19–21]. Sensitization is most commonly manifested as enhanced behavioral responses and has been associated to drug addiction development [19]. Behavioral sensitization can be different in males and females [22,23]. It has already been well established that sex influences sensitization to psychostimulants in general, and studies with methylphenidate both in humans and rats also show this trend [24]. Female rats exhibit more robust psychostimulant-induced sensitization [22–24], which has been strongly associated with gonadal hormones [22,23]. Several neurotransmitter systems are involved in the process of behavioral sensitization to psychostimulants [7,15]. GABAergic systems can modify the activity of dopaminergic neurons [14] and besides influencing glutamate and dopamine systems and indirectly modifying GABA signaling, psychostimulants may also influence the activity of GABAergic neurons directly. It has been reviewed that cocaine or amphetamine-treated male animals present variable changes in GAD65 and GAD67 isoenzymes in 182 L. Freese et al. / Behavioural Brain Research 231 (2012) 181–186 different brain areas [25]. And it has been demonstrated that repeated administration of cocaine may induce changes in levels of enzymes GAD65 and GAD67 in different brain regions, decreases GADs mRNA ratio in dorsolateral striatum (dSTR) and increases it in the prefrontal cortex (PFC) of female rats. Additionally, in this same study it was demonstrated that the GABAergic system was less impaired by cocaine in intact females in comparison to ovariectomized rats [25]. GABAA receptors containing ␣2 subunits that are highly represented in the PFC, which is the main region involved in signaling motivation, and in the striatum that is related to motor activation effects of stimulant drugs [26]. These regions are associated with neuroadaptations, which to mediate facets of reinforcement [19]. As pointed above, there is pertinent information regarding brain GABAergic effects by psychostimulants in male animals. There are not sufficient reports showing the effect of MPD associated to hormonal influence on the sensitization process in female rat and the participation of the GABA system in response to MPD administration in different hormonal conditions in females needs more detailing. Thus, the objective of present study was to evaluate both hormonal influence on the sensitization process and the GABA system involvement in female rats, by comparing the effects of MPD on GAD65 , GAD67 and ␣2 subunits GABA mRNA expression in the PFC and dSTR in intact and castrated female rodents. 2. Materials and methods 2.1. Animals Experiments were conducted with adult female Wistar rats, weighing around 185 g (n = 48), obtained from the animal house of the Universidade Federal de Ciências da Saúde de Porto Alegre, Brazil (UFCSPA). Rats were housed in groups of five in polypropylene cages (40 × 33 × 17 cm) under standard environmental conditions, such as temperature-controlled rooms (22 ± 2 ◦ C) and a 12-h light/dark cycle (7:00 am to 7:00 pm). All animals received Nuvilab CR-1 commercial chow phytoestrogens free Nuvital® (Curitiba, Paraná, Brazil) and filtered drinking water ad libitum. Female rats were randomized to subgroups of ovariectomized (OVX, n = 24) and intact (INT, n = 24) animals. Bilateral ovariectomy was performed under anesthesia with xylazine (10 mg/kg) and ketamine (75 mg/kg), via i.p., 2 weeks before starting the experiment. Castration was confirmed by vaginal smears microscopic analysis. All in vivo experiments followed the guidelines of the International Council for Laboratory Animal Science (ICLAS) and in concordance with the Brazilian law for the Scientific Use of Animals. This study protocol was approved by the Ethical Committee for Animal Experimental Procedures of UFCSPA, Porto Alegre, Brazil. 2.2. Drugs Methylphenidate hydrochloride (Sigma Chemicals, St Louis MO) was diluted in 2% Tween 80 in sterile saline (vehicle) at 2.5 mg/kg/mL. Control rats received saline solution in the same volume (1 mL/kg). The dosage was selected based on previous studies [16,27]. This dose produces plasmatic peak in rat similar to those therapeutic doses used to treat attention deficit hyperactivity disorder (ADHD) in human beings (∼40 ng/mL) [28]. All drug administrations were performed around 12:00 p.m. 2.3. Procedures In the first day of the experiment rats in both subgroups were allocated to receive acute or repeated (5 consecutive days) doses of MPD, 2.5 g/kg, or saline (CTR), 1 mL/kg, via i.p. After 7 days of washout, rats from acute (ACT) or repeated (RPT) group received 2.5 g/kg of MPD, i.p. whereas the control group received only saline (challenge day). 2.4. Behavioral analysis According to our protocol of sensitization, in the day 1, animals were individually habituated to the behavioral testing procedure by placement in a photocell cage (80 × 26 × 22 cm; Alsbarch, Porto Alegre, BR) for 30 min, before the injection of saline or MPD. After saline or MPD administration, according to the treatment group, rats were returned to the cages and their horizontal activity was scored for 60 min. The photocell cage was coupled to a digital counter that was incremented by consecutive interruption of adjacent beams. In the challenge day, 7 days later, rats from the ACT e RPT group received both a single dose of MPD, 2.5 mg/kg, i.p., and rats from CTR group received saline. Immediately after the administration they were tested again in the photocell cage for locomotor activity behavior during 60 min. At the end of the behavior test, vaginal smears were collected for estrus cycle phase determination Fig. 1. Distribution of rats in each estrous cycle stage according to the hormonal condition and the treatment with methylphenidate (2.5 mg/kg, i.p.). INT, intact; OVX, ovariectomized; CTR, control; ACT, acute; RPT, repeated. [29] (see Fig. 1). Afterwards rats were euthanized by decapitation and the striatum were dissected and stored at −80 ◦ C for further mRNA analysis. 2.5. RT-PCR procedure Total RNA was extracted from the striatum using TrizolTM Isolation Reagent Kit (Invitrogen, São Paulo, Brazil) according to the instructions of the manufacturer. The yield of total RNA was determined by measuring the absorbance (260/280 nm) of diethylpyrocarbonate (DEPC)-treated water aliquots of samples. All RNAs samples were resuspended in DEPC-treated water (Invitrogen, São Paulo, Brazil) and stored at −80 ◦ C. A semi-quantitative RT-PCR technique was used to determine the presence of ␣2 and ␣4 GABAA subunit transcripts in the samples and determine the levels of GAD65 and GAD67 mRNA. A 3 ␮g aliquot of total RNA extracted from the hippocampus was reverse transcribed using the SuperScriptTM III Platinum Synthesis System for RT-PCR (Invitrogen Life Technologies) according to the instructions of the manufacturer. Relative RT-PCR was performed to measure gene expression of GAD65 and GAD67 mRNAs and the presence of ␣2 GABAA subunit. Specific oligonucleotides derived from the coding region of the published sequences of GAD65 (5′ GCTCTACGGAGACTCTGAGAAG 3′ and 5′ CGGTTGGTCTGACAATTCCC 3′ ), GAD67 (5′ TGTGGCGTAGCCCATGGATG 3′ and 5′ ACTGGTGTGGGTGGTGGAAG 3′ ) and ␣2 (5′ GACAATGACCACATTAAGCATCAG 3′ and 5′ TCTTGGCTTCGGCTGGCTTGTTCTC 3′ ) were used. Primer sequences were designed to span intron regions when genomic sequence data were available, resulting in the predicted 318- and 330-bp sequence, respectively. The ␤-actin primer set (5′ AGAGGGAAATCGTGCGTGAC 3′ and 5′ CAATAGTGATGACCTGGCCGT 3′ ) that generated a 138-bp product was used as an internal control. ␤-actin was co-amplified within the same reaction to evaluate inter-sample variation in cDNA contents and PCR efficiency. PCR included 2 ␮L of the RT product and was carried out with Taq DNA polymerase (InvitrogenTM Life Technologies Inc.) in a final volume of 25 ␮L, 1.5 mM MgCl2 , 0.2 ␮M of the specific primer, and 200 ␮M dNTPs. PCR was performed in a Mastercycler® Personal thermal cycler (Eppendorf, Germany). The amplification protocol consisted of an initial denaturation step at 94 ◦ C for 3 min, followed by 40 cycles at 94 ◦ C for 1 min, annealing at 60 ◦ C for 1 min, extension at 72 ◦ C for 1 min, and a final extension at 72 ◦ C for 5 min. The linear amplification range for each gene was tested on the adjusted cDNA. The less expressed transcripts of GAD65 , GAD67 , ␣2 GABAA subunit required >32 PCR cycles for detection. ␤-actin primers were added when 5 cycles were remaining in the specified gene’s linear amplification range. RT-PCR assays without cDNA samples were carried out as negative controls. All reactions were performed in duplicate. After amplification, 10 ␮L of the PCR products was analyzed on a 2.0% ethidium bromide agarose gel. The intensity of each band was assessed by optical densitometry (ImageMaster® VDS, Amersham Pharmacia Biotech). An ImageMaster UDS System captured the images® . The optical density (OD) of the GAD65 , GAD67 and ␣2 GABAA subunits and ␤-actin bands were measured using the program ‘Software Gel Analyzer’. DNA band intensity was normalized against the corresponding values of the ␤-actin band intensity. Data are reported as the ratio of the GAD65 /␤-actin, GAD67 /␤-actin and ␣2 /␤-actin these were used for statistical analysis. 2.6. Data analysis For analysis of data we used a Two Way ANOVA, considering the factors treatment (CTR, AGD and RPT) and hormonal condition (OVX and INT) for the analysis of dependent variables: locomotion on the challenge, ratio mRNA of izoenzimas GADs and ␣2 subunit. The Tukey test was used for post hoc comparisons when appropriate. L. Freese et al. / Behavioural Brain Research 231 (2012) 181–186 183 RPT) as well as when it was analyzed the hormonal conditions (see Fig. 4A). Regarding ␣2 GABAA R subunit mRNA expression in the dSTR, there was no difference between RPT and ACT, as well as treated groups and control groups neither related to hormonal condition. 4. Discussion Fig. 2. Differences in locomotor response as a function of hormones during a 60 min test, following acute (ACT) or repeated (RPT) treatment with methylphenidate (2.5 mg/kg, i.p.) in female rats. * P < 0.001 vs. CTR counterparts. # P < 0.001 vs. ACT counterparts. † P < 0.001 vs. RPT OVX. INT, intact; OVX, ovariectomized. All data were presented as means ± standard error of the mean. Differences were considered significant at P < 0.05. 3. Results 3.1. Effects of MPD on locomotor activity The estrous cycle stage of both intact and ovariectomized female rats was determined after the final locomotion test, and is shown in Fig. 1. Some changes in the hormone cycle of ovariectomized female rats may be due to remnants of ovarian follicles after the surgical procedure of ovariectomy. The locomotor activity levels of all groups were recorded during 1 h. MPD elicited a significant (F(2,66) = 109.812; P < 0.001) and robust increase in the horizontal activity of all three rat subgroups (CTR, ACT and RPT), with the RPT rats exhibiting the most intense increase in activity also when compared to the ACT group (P < 0.001). Significant interaction between treatment with MPD (ACT and RPT) and hormonal condition (OVX and INT) (F(2,66) = 10.287; P = 0.002) was detected, intact rats had more locomotor behavior due to MPD (P = 0.002) (see Fig. 2). 3.2. Effects of MPD on GADs and on ˛2 GABAA subunit mRNAS expression in the prefrontal cortex Both, acute and repeated MDP treatment groups (ACT and RPT) showed an increase in GAD65 mRNA expression in the PFC when compared to CTR (see Fig. 3A) (P = 0.005). As showed in Fig. 3B, GAD67 mRNA levels in the PFC was increased in RPT group in both (F(2.34) = 5.632, P = 0.008). There was no difference in PFC ␣2 subunit mRNA expression in MPD treatment groups. Also, no significant difference between hormonal condition (INT and OVX) (see Fig. 5). 3.3. Effects of MPD on GADs and ˛2 GABAA subunit mRNAs expression in the dorsolateral striatum As shown in Fig. 4A, the RPT group presented a decrease in GAD65 /ß-actin ratio optical density when compared to ACT group (F(2.25) = 7.056; P = 0.012) as well as when compared to CTR group (F(2.25) = 7.056; P = 0.006). There was no difference in GAD67 mRNA expression between treated groups and their control counterparts. In the same way, there was no difference between the treatment types (ACT and Repeated treatment with MPD produces behavioral sensitization, reproducing previous studies [3,16–18]. In this study, we showed that MPD may induce behavioral sensitization in female rats. Also, an interaction between behavioral sensitization to MPD and the female hormonal status was seen. The effects of behavioral responses caused by psychostimulants may be directly affected by sex hormones [30,31]. Preclinical and clinical studies suggest that females may be particularly vulnerable to the reinforcing effects of stimulant drugs [32,33]. Female rats show more intense hyperlocomotion behavior and show greater sensitization to cocaine than males [22]. Here we show that female rats with intact hormonal regulation have increased locomotor activity after repeated MPD treatment, compared to ovariectomized counterparts. We also found that the physiological presence of sex hormones may influence MPD effects, with increased behavioral responses after a single or repeated MPD administration in non-ovariectomized (intact) female rats. The increased behavioral locomotor effects of other psychostimulants, cocaine and amphetamines, has been described [22,30,34], Understanding the effects of chronic drug use on GABAergic neurotransmission is critical for understanding the neuroplasticity associated to psychostimulant effects. GABAergic neurons play an important role in the modulation of the dopamine system that is involved in the initiation of behavioral sensitization [19,21], by reducing dopamine release and inhibiting dopaminergic activity [35]. The observed upward shifts in the GABA synthesis pathway may be caused by the potentiation of the excitatory effects of psychostimulants, a consequence of long-term reduction of the inhibitory capacity of the central nervous system [36] In the PFC, GABAergic interneurons can regulate dopaminergic and glutamatergic neurotransmission. Animals sensitized to cocaine show an increase in mPFC GABA release in response to a cocaine challenge after 1 or 7 days [37]. Since GAD enzyme is expressed only in GABA neurons, it may be used as a marker for GABAergic function [38]. Changes in GAD65 and GAD67 levels appear to be involved with the processes of neuroplasticity. The GAD65 isoenzyme plays an important role in regulating the vesicular pool of GABA and its function is more evident in times of prolonged neuronal activity [45]. GAD65 is located in the synapses and responds more quickly to demands caused by GABA neuronal activity. On the other hand, GAD67 has major importance in the production of nonvesicular GABA and it is involved in the overall metabolic activity the cell [39]. Our findings demonstrate that repeated treatment with MPD significantly increased the expression of GAD65 and GAD67 in the PFC of female rats, regardless of the hormonal condition. The expression of GAD65 , the quick-response enzyme, increased significantly even in the acute treatment with MPD. These results suggest that there is a process of neuroplasticity induced by psychostimulants in the GABAergic system in the PFC, even after a single MPD administration and more vesicular GABA is recruited under those conditions. Contrary to our results, the literature points out that at least 4–6 h are necessary to observe changes in GAD mRNA induced by acute administration of amphetamine [36] or cocaine [40]. In fact, the effects of MPD are very different from those of cocaine in intact and gonadectomized female rats GAD isoenzymes [25]. MPD seems to have a much faster regulatory control in GAD65 expression. 184 L. Freese et al. / Behavioural Brain Research 231 (2012) 181–186 Fig. 3. (A) GAD65 mRNA expression levels in the PFC after acute (ACT) or repeated (RPT) treatment with methylphenidate (2.5 mg/kg i.p.) in female rats. In the lower part of the figure is shown GAD65 and B-actin mRNA bands expression of from animals groups. (B) GAD67 mRNA expression levels in the PFC after acute (ACT) or repeated (RPT) treatment with methylphenidate (2.5 mg/kg i.p.) in female rats. Data are reported as means ± SEM. PFC, prefrontal cortex; CTR, control; * P < 0.05 vs. CTR counterparts. In the lower part of the figure is shown GAD67 and B-actin mRNA bands expression of from animals groups. In the lower part of the figure is shown GAD67 and B-actin mRNA bands expression of from animals groups. Bands are presented in accordance with the order they appear on the graphic. Striatal complex is a putative site of action for the motor activating effects of drugs of abuse and associated neuroadaptations and may mediate several facets of cocaine reinforcement [19]. Repeated treatment with MPD was also able to induce changes in the striatum of animals. In this study, GAD65 expression mRNA in the dSTR but not the GAD67 expression mRNA, significantly decreased after repeated MPD administration compared to controls. The different effects in the GAD isoenzymes after repeated exposure to MPD or cocaine in female rats [25], denotes another important diverse neurochemical effect between psychostimulants. The ␣2 GABAA R subunit appears to mediate the ability of dopamine to act as a “gain amplifier” so that, in the absence of ␣2 subunit, facilitation of dopamine transmission by cocaine is no longer effective in strengthening behavior directed by conditioned cues [41]. Western blot analysis showed that repeated treatment with methamphetamine in rats decreased the expression of ␣2 in the nucleus accumbens [42]. However, we show here that the transcriptional levels of ␣2 subunit of the GABAA receptor in the striatum and the PFC did not change in female rats. The explanation for the significant differences of our results with MPD compared to those who use cocaine or methamphetamine may be due to different effects of these drugs, leading to different mechanisms of plasticity. Another explanation may be that the relationship mRNA/protein is not always linear [43]. Moreover, the studies cited did not use female rats. The female steroid hormones, like progesterone and estrogen, can influence neurotransmitter systems, including the GABA system [44]. As GABA is the main inhibitory neurotransmitter in the CNS, one could expect to correlate the increasing of GABA system activity with lower locomotor activity. Although we cannot confirm that the increasing of the GAD65 and GAD67 mRNA are closely related to increasing synthesis or release of GABA we can infer that if those enzymes increase their expression the system is activated [45]. Interestingly, here we showed that repeated treatment with MPD increased the expression of GAD65 specifically in the PFC of female rats, and decreased its expression in the dSTR. As already known, the PFC is an important area of the limbic circuitry involved in the control of emotions and cognition and the striatum Fig. 4. (A) Amount of GAD65 mRNA expression in the dorsolateral striatum (dSTR) after acute (ACT) or repeated (RPT) treatment with methylphenidate (2.5 mg/kg i.p.) in female rats. In the lower part of the figure is shown GAD65 and B-actin mRNA bands expression of from animals groups. (B) Amount of GAD67 mRNA expression in the dorsolateral striatum (dSTR) after acute (ACT) or repeated (RPT) treatment with methylphenidate (2.5 mg/kg i.p.) in female rats. Data are reported as means ± SEM. dSTR; CTR, control. * P < 0.05 vs. CTR counterparts. # P < 0.05 vs. ACT counterparts. In the lower part of the figure is shown GAD67 and B-actin mRNA bands expression of from animals groups. Bands are presented in accordance with the order they appear on the graphic. In the lower part of the figure is shown GAD67 and B-actin mRNA bands expression of from animals groups. Bands are presented in accordance with the order they appear on the graphic. L. Freese et al. / Behavioural Brain Research 231 (2012) 181–186 185 Fig. 5. (A) mRNA expression of ␣2 GABAA subunit in PFC after acute (ACT) or repeated (RPT) treatment with methylphenidate (2.5 mg/kg i.p.) in female rats. In the lower part of the figure is shown GABAA ␣2 subunit and B-actin mRNA bands expression of from animals groups. (B) mRNA expression of ␣2 GABAA subunit in the dSTR after acute (ACT) or repeated (RPT) treatment whit methylphenidate (2.5 mg/kg i.p.) in female rats. Data are reported as means ± SEM. dSTR, dorsolateral striatum; CTR, control. In the lower part of the figure is shown GABAA ␣2 subunit and B-actin mRNA bands expression of from animals groups. Bands are presented in accordance with the order they appear on the graphic. is involved in the motor activity [14,19,24,46]. Coincidently here we showed lower GAD65 expression and higher locomotor activity in the dSTR, after repeated treatment with MPD. Thus the increasing of the dopaminergic activity and decreasing of GABA activity in the dSTR could explain in part the stimulatory effect and impulsivity observed after repeated MPD administration. The increasing of GAD65 and GAD67 mRNA expression after repeated MPD treatment in the PFC could be related to other behaviors, such as craving. In summary, this study shows that gonadal hormones play a role in methylphenidate sensitization in female rats. It also describes that the decrease in the GAD65 transcript in the striatum, may be a marker for repeated MPD treatment in animals. Also, it was seen in the PFC, that the transcription of GAD67 is more selective and a better marker for repeated MFD treatment. No significant interaction of MPD treatment with the female hormonal condition of the rats was found, regarding the GAD enzymes expression in the brain. More studies are necessary to further investigate de the influence of sexual hormones on methylphenidate treatment induced brain changes. Finally, it is clear that the status of drug of abuse and the risk of long-term use of MPD will need more investigation, in respect to its mechanisms of action and that the simple comparison with the other psychostimulants will not suffice. Conflict of interest The authors have no conflict of interest. Acknowledgments The authors thank the support from CNPq (HMTB) and the fellowships from CAPES (LF, MFS). References [1] Faraone SV, Spencer T, Aleardi M, Pagano C, Biederman J. Meta-analysis of the efficacy of methylphenidate for treating adult attentional-deficit/hyperactivity disorder. J Clin Psychopharmacol 2004;24:24–9. [2] Sweetman SC. Methylphenidate hydrochloride. In: Sweetman SC, editor. Martindale: the complete drug reference. thirty-sixth ed. London: Pharmaceutical Press; 2009. p. 2159–60. [3] Yang P, Beasley A, Eckermann K, Swann A, Dafny N. Valproate modulates the expression of methylphenidate (Ritalin) sensitization. Brain Res 2000;874:216–20. [4] Wu LT, Pilowsky DJ, Schlenger WE, Galvin DM. Misuse of methamphetamine and prescription stimulants among youths and young adults in the community. Drug Alcohol Depend 2007;89:195–205. [5] Teter C, McCabe SE, LaGrange K, Cranford JA, Boyd CJ. Illicit use of specific prescription stimulants among college students: prevalence, motives, and routes of administration. Pharmacotherapy 2006;26:1501–10. [6] Volkow ND, Fowler JS, Wang GJ, Ding YS, Gatley SJ. Role of dopamine in the therapeutic and reinforcing effects of methylphenidate in humans: results from imaging studies. Eur Neuropsychopharmacol 2002;2:557–66. [7] Swanson JM, Volkow ND. Serum and brain concentrations of methylphenidate: implications for use and abuse. Neurosci Biobehav Rev 2003;27:615–21. [8] Volkow ND, Ding YS, Fowler JS, Wang GJ, Logan J, Gatley JS, et al. Is methylphenidate like cocaine? Studies on their pharmacokinetics and distribution in the human brain. Arch Gen Psychiatry 1995;52:456–63. [9] Yano M, Steiner H. Methylphenidate and cocaine: the same effects on gene regulations. Trends Pharmacol Sci 2007;11:588–96. [10] Volkow ND, Wang G, Fowler JS, Logan J, Gerasimo VM, Maynard L, et al. Therapeutic doses of oral methylphenidate significantly increase extracellular dopamine in the human brain. J Neurosci 2001;21:RC121. [11] Gatley SJ, Volkow ND, Gifford AN, Fowler JS, Dewey SL, Ding YS, et al. Dopaminetransporter occupancy after intravenous doses of cocaine and methylphenidate in mice and humans. Psychopharmacology (Berl) 1999;146:93–100. [12] Kollins SH, MacDonald EK, Rush CR. Assessing the abuse potential of methylphenidate in nonhuman and human subjects. A review. Pharmacol Biochem Behav 2001;68:611–27. [13] Volkow ND, Swanson JM. Variables that affect the clinical use and abuse of methylphenidate in the treatment of ADHD. Am J Psychiatry 2003;160:1909–18. [14] Pierce RC, Kalivas PW. A circuitry model of the expression of behavioral sensitization to amphetamine-like psychostimulants. Brain Res Rev 1997;25:192–216. [15] Kalivas PW, O’brien C. Drug addiction as a pathology of staged neuroplasticity. Neuropsychopharmacology 2008;33:166–80. [16] Gaytan O, al-Rahim S, Swann A, Dafny N. Sensitization to locomotor effects of methylphenidate in the rat. Life Sci 1997;61:101–7. [17] Yang P, Beasley A, Eckermann K, Swann A, Dafny N. Valproate prevents the induction of sensitization to methylphenidate (Ritalin) in rats. Brain Res 2000;887:276–84. [18] Yang PB, Swann AC, Dafny N. Chronic administration of methylphenidate produces neurophysiological and behavioral sensitization. Brain Res 2007;1145:66–80. [19] Robinson TE, Berridge KC. Review. The incentive sensitization theory of addiction: some current issues. Philos Trans R Soc Lond B: Biol Sci 2008;363:3137–46. [20] Vanderschuren LJ, Kalivas PW. Alterations in dopaminergic and glutamatergic transmission in the induction and expression of behavioral sensitization: a critical review of preclinical studies. Psychopharmacology (Berl) 2000;51: 99–120. [21] Kalivas PW, Stewart J. Dopamine transmission in the initiation and expression of drug- and stress-induced sensitization of motor activity. Brain Res Brain Res Rev 1991;16:223–44. [22] Hu M, Becker JB. Effects of sex and estrogen on behavioral sensitization to cocaine in rats. J Neurosci 2003;23:693–9. [23] Segarra AC, Rivera AJL, Febo M, Escobar NL, Delmestre RM, Ramos AP. Estradiol: a key biological substrate mediating the response to cocaine in female rats. Horm Behav 2009;58:33–43. 186 L. Freese et al. / Behavioural Brain Research 231 (2012) 181–186 [24] Dafny N, Yang PB. The role of age, genotype, sex, and route of acute and chronic administration of methylphenidate: a review of its locomotor effects. Brain Res Bull 2006;68:393–405. [25] Souza MF, Toniazo VM, Frazzon AP, Barros HM. Influence of progesterone on GAD65 and GAD67 mRNA expression in the dorsolateral striatum and prefrontal cortex of female rats repeatedly treated with cocaine. Braz J Med Biol Res 2009;42:1068–75. [26] Caruncho HJ, Liste I, Rozas G, López-Martín E, Guerra MJ, Labandeira-García JL. Time course of striatal, pallidal and thalamic alpha 1, alpha 2 and beta 2/3 GABAA receptor subunit changes induced by unilateral 6-OHDA lesion of the nigrostriatal pathway. Brain Res Mol Brain Res 1997;48:243–50. [27] Kuczenski R, Segal DS. Locomotor effects of acute and repeated threshold doses of amphetamine and methylphenidate: relative roles of dopamine and norepinephrine. J Pharmacol Exp Ther 2001;296:876–83. [28] Leonard BE, Mccartan D, White J, King DJ. Methylphenidate: a review of its neuropharmacological, neuropsychological and adverse clinical effects. Hum Psychopharmacol 2004;19:151–80. [29] Marcondes FK, Bianchi FJ, Tanno AP. Determination of the estrous cycle phases of rats: some helpful considerations. Braz J Biol 2002;62(4A): 609–14. [30] Peris J, Decambre N, Coleman-Hardee ML, Simpkins JW. Estradiol enhances behavioral sensitization to cocaine and amphetamine-stimulated striatal [3H]dopamine release. Brain Res 1991;566:255–64. [31] Zhou W, Cunningham KA, Thomas ML. Estrogen regulation of gene expression in the brain: a possible mechanism altering the response to psychostimulants in female rats. Brain Res Mol Brain 2002;100:75–83. [32] Lynch WJ. Sex differences in vulnerability to drug self-administration. Exp Clin Psychopharmacol 2006;14:34–41. [33] Greenfield SF, Back SE, Lawson K, Brady KT. Substance abuse in women. Psychiatr Clin N Am 2010;32:339–55. [34] Wolf ME. The role of excitatory amino acids in behavioral sensitization to psychomotor stimulants. Prog Neurobiol 1998;54:679–720. [35] Agmo A, Belzung C, Giordano M. Interactions between dopamine and GABA in the control of ambulatory activity. J Neural Transm 1996;103: 925–34. [36] Lindefors N, Hurd YL, O’Connor WT, Brene S, Persson H, Ungerstedt U. Amphetamine regulation of acetylcholine and gamma-aminobutyric acid in nucleus accumbens. Neuroscience 1992;48:439–48. [37] Jayaram P, Steketee JD. Effects of cocaine-induced behavioral sensitization on GABA transmission within rat medial prefrontal cortex. Eur J Neurosci 2005;21:2035–9. [38] Soghomonian JJ, Martin DL. Two isoforms of glutamate decarboxylase: why. Trends Pharmacol Sci 1998;19:500–5. [39] Tian N, Petersen C, Kash S, Baekkeskov S, Copenhagen D, Nicoll R. The role of the synthetic enzyme GAD65 in the control of neuronal gamma-aminobutyric acid release. Proc Natl Acad Sci U S A 1999;96:12911–6. [40] Sorg BA, Guminski BJ, Hooks MS, Kalivas PW. Cocaine alters glutamic acid decarboxylase differentially in the nucleus accumbens core and shell. Brain Res Mol Brain Res 1995;29:381–6. [41] Dixon CI, Morris HV, Breen G, Desrivieres S, Jugurnauth S, Steiner RC. Cocaine effects on mouse incentive-learning and human addiction are linked to alpha2 subunit-containing GABAA receptors. Proc Natl Acad Sci U S A 2010;107:2289–94. [42] Zhang X, Lee TH, Xiong X, Chen Q, Davidson C, Wetsel WC, et al. Methamphetamine induces long-term changes in GABAA receptor alpha2 subunit and GAD67 methylphenidate enantiomers: does chirality matter. Biochem Biophys Res Commun 2008;28:S54–61. [43] Nelson PT, Keller JN. RNA in brain disease: no longer just the messenger in the middle. J Neuropathol Exp Neurol 2007;66:461–8. [44] McEwen BS. Invited review: estrogens effects on the brain: multiple sites and molecular mechanisms. J Appl Physiol 2001;91:2785–801. [45] Porter TG, Martin DL. Evidence for feedback regulation of glutamate decarboxylase by gamma-aminobutyric acid. J Neurochem 1984;43:1464–7. [46] Robinson TE, Berridge KC. Mechanisms of action of addictive stimuli: incentivesensitization and addiction. Addiction 2001;96:103–14.