Slc17a7-IRES2-Cre targeting vector
(Plasmid
#61574)
-
PurposeTarget the Cre recombinase gene to the stop codon of the mouse Slc17a7 (VGlut1) gene
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneminimal cloning vector
- Backbone size w/o insert (bp) 2657
- Total vector size (bp) 18244
-
Modifications to backboneMCS region was modified
-
Vector typeMouse Targeting, Cre/Lox
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSlc17a7-IRES2-Cre
-
SpeciesM. musculus (mouse); P1 Bacteriophage
-
Insert Size (bp)15587
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCCGTCAGGATGGCCTTCTG
- 3′ sequencing primer TTCACACCGCATAGGGTCAT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Zeng lab recommends amplifying this plasmid in 15 microg/ml kanamycin to reduce recombination. Addgene is not able to supply the plasmid under these selection conditions and the stab you receive will be under Amp selection. We recommend using the low conc. Kan selection and checking your plasmid prep for recombination.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Slc17a7-IRES2-Cre targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 61574 ; http://n2t.net/addgene:61574 ; RRID:Addgene_61574) -
For your References section:
Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Madisen L, Garner AR, Shimaoka D, Chuong AS, Klapoetke NC, Li L, van der Bourg A, Niino Y, Egolf L, Monetti C, Gu H, Mills M, Cheng A, Tasic B, Nguyen TN, Sunkin SM, Benucci A, Nagy A, Miyawaki A, Helmchen F, Empson RM, Knopfel T, Boyden ES, Reid RC, Carandini M, Zeng H. Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022. 10.1016/j.neuron.2015.02.022 PubMed 25741722
Map uploaded by the depositor.
