-
PurposeAAV vector for U6 driven expression of two gRNAs, and cardiomyocyte specific expression of Cre recombinase.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87682 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 5969
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsCheck for recombination between ITRs and U6 promoters before making AAV
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namegRNA1
-
Insert Size (bp)102
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer CGGCCGCACGCGCCGGTACC
- 3′ sequencing primer CAGAAGAGCTCGCTCTTCCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA2
-
Insert Size (bp)102
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site none (destroyed during cloning)
- 5′ sequencing primer GTGGAATTCCACCTGCTCAG
- 3′ sequencing primer AGGGACTTCGGGCACAATCG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCre
-
Insert Size (bp)1056
- Promoter cTnT
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ACGACTCACTATAGGCTAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-U6gRNA1-U6gRNA2-TnT-Cre was a gift from William Pu (Addgene plasmid # 87682 ; http://n2t.net/addgene:87682 ; RRID:Addgene_87682) -
For your References section:
Analysis of Cardiac Myocyte Maturation Using CASAAV, A Platform for Rapid Dissection of Cardiac Myocyte Gene Function In Vivo. Guo Y, VanDusen NJ, Zhang L, Gu W, Sethi I, Guatimosim S, Ma Q, Jardin BD, Ai Y, Zhang D, Chen B, Guo A, Yuan GC, Song LS, Pu WT. Circ Res. 2017 Mar 29. pii: CIRCRESAHA.116.310283. doi: 10.1161/CIRCRESAHA.116.310283. 10.1161/CIRCRESAHA.116.310283 PubMed 28356340