Neotrehalosadiamine Via An Autoinduction

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 279, No. 5, Issue of January 30, pp.
3885–3892, 2004
© 2004 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.
RNA Polymerase Mutation Activates the Production of a Dormant

Antibiotic 3,3ⴕ-Neotrehalosadiamine via an Autoinduction
Mechanism in Bacillus subtilis*
Received for publication, September 8, 2003, and in revised form, November 11, 2003
Published, JBC Papers in Press, November 11, 2003, DOI 10.1074/jbc.M309925200
Takashi Inaoka‡, Kosaku Takahashi‡, Hiroshi Yada§, Mitsuru Yoshida§, and Kozo Ochi‡¶
From the ‡Microbial Function Laboratory and §Molecular Elucidation Laboratory, National Food Research Institute,
Tsukuba, Ibaraki 305-8642, Japan
Bacillus and Streptomyces species possess the ability mutations are found within the rpoB gene that encodes the ␤
to produce a variety of commercially important metab- subunit of RNAP (3– 6). E. coli Rif r rpoB mutations that sup-
olites and extracellular enzymes. We previously demon- press the auxotrophy due to lack of stringent response were
strated that antibiotic production in Streptomyces coeli-
Downloaded from www.jbc.org at MAHIDOL UNIV, FAC SCIENCE on April 10, 2008
demonstrated to affect the transcription of stringently con-
color A3(2) and Streptomyces lividans can be enhanced trolled genes by destabilizing the RNAP-stable RNA promoter
by RNA polymerase (RNAP) mutations selected for the complex (7). Recently, we successfully activated the secondary
rifampicin-resistant (Rif r) phenotype. Here, we have metabolism (antibiotic production) by introducing certain Rif r
shown that the introduction of a certain Rif r rpoB mu- rpoB mutations in Streptomyces coelicolor A3(2) and Strepto-
tation into a B. subtilis strain resulted in cells that over- myces lividans (8 –11). On the basis of those findings, we pro-
produce an aminosugar antibiotic 3,3ⴕ-neotrehalosadia-
posed that improvement of RNAP by introduction of a Rif r
mine (NTD), the production of which is dormant in the
mutation can be useful to elicit bacterial ability by altering the
wild-type strain. Mutational and recombinant gene ex-
gene expression in a variety of microorganisms.
pression analyses have revealed a polycistronic gene
ntdABC (formally yhjLKJ) and a monocistronic gene The members of the genus Bacillus produce several antibi-
ntdR (formally yhjM) as the NTD biosynthesis operon otics to inhibit growth of the competing organisms in nature.
and a positive regulator for ntdABC, respectively. Anal- Neotrehalosadiamine (3,3⬘-diamino-3,3⬘-dideoxy-␣,␤-trehalose;
ysis of transcriptional fusions to a lacZ reporter re- NTD), which is an aminosugar antibiotic produced by Bacillus
vealed that NTD acts as an autoinducer for its own bio- pumilus (12) and Bacillus circulans (13), inhibits growth of
synthesis genes via NtdR protein. Our results also Staphylococcus aureus and Klebsiella pneumoniae (but not
showed that the Rif r rpoB mutation causes an increase Escherichia coli), although the inhibitory mechanism is not yet
in the activity of ␴A-dependent promoters including nt- elucidated. Unlike B. pumilus and B. circulans, Bacillus sub-
dABC promoter. Therefore, we propose that unlike the tilis normally does not produce this antibiotic. However, we
wild-type RNAP, the mutant RNAP efficiently recog- found that one of the Rif r mutations isolated here activates the
nized the ␴A-dependent promoters, resulting in the dra- dormant ability to produce NTD in B. subtilis. In this paper,
matic activation of the NTD biosynthesis pathway by an the mechanism by which production of this antibiotic is acti-
autoinduction mechanism. vated by the Rif r mutation is discussed.
EXPERIMENTAL PROCEDURES
The ability of bacteria to survive in a wide range of adverse Bacterial Strains, Plasmids, and Culture Conditions—Strains of
environmental conditions depends on diverse molecular mech- B. subtilis and plasmids used are listed in Table I. Oligonucleotides used
anisms that adjust gene expression pattern in response to in this study are listed in Table II. All of the B. subtilis strains are derived
changing environment. DNA-dependent RNA polymerase from strain 61884 (trpC2 aspB66) (14). A mutant TI91 is a bacilysin
nonproducer strain (15). Strains UOT1285EN1 (amyE::rrnE-bgaB) and
(RNAP),1 which is composed of an essential catalytic core en-
MF1 (rpoChis6 neo) were provided by F. Kawamura and M. Fujita,
zyme (␣2␤␤⬘␻) and one of the sigma (␴) factors, is the central respectively. Plasmid pUB18 was provided by F. Kawamura. B. subtilis
enzyme for expression of genomic information in all organisms. strains were grown aerobically in S7N medium or L medium as
Rifampicin (Rif) inhibits transcription initiation by blocking described previously (15).
the ␤ subunit of bacterial RNAP (1, 2). Many Rif-resistant To monitor the promoter activities of ntdABC and ntdR, each up-
(Rif r) mutants have been isolated and characterized in various stream region (490 bp from the translational start codon) was amplified
by PCR with the primer pairs PntdA-F and PntdA-R for ntdABC pro-
bacteria, notably Escherichia coli. To our knowledge, most Rif r
moter and PntdR-F and PntdR-R for ntdR promoter. The amplified
fragment was cloned into pCR2.1 and fully sequenced to confirm the
correct sequence. Each EcoRI fragment containing the upstream region
* This work was supported by a grant from the Organized Research of ntdABC or ntdR was inserted into the EcoRI site of pDL2 (16),
Combination System of the Science and Technology Agency of Japan. resulting in plasmids pDL2-PntdA and pDL2-PntdR, respectively.
The costs of publication of this article were defrayed in part by the For overexpression of NTD biosynthesis operon in B. subtilis, the
payment of page charges. This article must therefore be hereby marked
430-bp fragment encoding N-terminal part of NtdA was synthesized by
“advertisement” in accordance with 18 U.S.C. Section 1734 solely to
PCR with primers ntdA-F and ntdA-R and cloned at the EcoRV site of
indicate this fact.
¶ To whom correspondence should be addressed: National Food Re- pHASH120 by a TA cloning method as described by Ohashi et al. (17),
search Institute, 2-1-12 Kannondai, Tsukuba, Ibaraki 305-8642, Japan. resulting in pHASH120-ntdA. Similarly, for overexpression of ntdBC
Tel.: 81-29-838-8125; Fax: 81-29-838-7996; E-mail:kochi@affrc.go.jp. (but not ntdA) in B. subtilis, the 240-bp fragment encoding the N-
1
The abbreviations used are: RNAP, RNA polymerase; Rif, rifampi- terminal part of NtdB was amplified by PCR with primers ntdB-F and
cin; NTD, 3,3⬘-neotrehalosadiamine; Erm, erythromycin; IPTG, isopro- ntdB-R and cloned into pHASH120, resulting in pHASH120-ntdB. To
pyl-␤-D-thiogalactopyranoside; ESI-MS, electrospray ionization mass express the NTD biosynthesis operon in E. coli, the full length of the
spectrometry; HR-ESI-MS, high resolution ESI-MS. ntdABC coding region (3.2 kb) was amplified by PCR with the primers
This paper is available on line at http://www.jbc.org 3885

3886 Activation of B. subtilis Neotrehalosadiamine Biosynthesis
TABLE I
Bacterial strains and plasmids used in this study
Strains and plasmids Genotype or description Construction or source
B. subtilis
61884 trpC2 aspB66 Ochi and Ohsawa (14)
84R2 trpC2 aspB66 rpoB2 This study
TI91R5 trpC2 aspB66 rpoB5 ⌬ywfB::pMutinT3 (Ermr) 84R5 3 TI91a
Y8–19 trpC2 aspB66 rpoB5 ntdA::Tn10 (Spcr) This study
T5–31 trpC2 aspB66 rpoB5 ntdB::Tn10 (Spcr) This study
E2–10 trpC2 aspB66 rpoB5 ntdC::Tn10 (Spcr) This study
TI122 trpC2 aspB66 amyE::(PntdA-lacZ, Cmr) pDL2-PntdA 3 61884
TI122R5 trpC2 aspB66 rpoB5 amyE::(PntdA-lacZ, Cmr) 84R5 3 TI122
TI123 trpC2 aspB66 amyE::(PntdR-lacZ, Cmr) pDL2-PntdR 3 61884
TI123R5 trpC2 aspB66 rpoB5 amyE::(PntdR-lacZ, Cmr) 84R5 3 TI123
TI125R5 trpC2 aspB66 rpoB5 ntdR::pMutinT3(Pspac-ntdR) pMutinT3-ntdR 3 61884
TI127 trpC2 aspB66 ntdR::neo amyE::(PntdA-lacZ, Cmr) pUC18-ntdR::neo 3 TI122
TI127R5 trpC2 aspB66 rpoB5 ntdR::neo amyE::(PntdA-lacZ, Cmr) 84R5 3 TI127
TI130R5 trpC2 aspB66 rpoB5 ntdA::Tn10 amyE::(PntdA-lacZ, Cmr) Y8–19 3 TI122R5
TI131R5 trpC2 aspB66 rpoB5 ntdB::Tn10 amyE:: (PntdA-lacZ, Cmr) T5–31 3 TI122R5
TI132R5 trpC2 aspB66 rpoB5 ntdC::Tn10 amyE:: (PntdA-lacZ, Cmr) E2–10 3 TI122R5
TI139 trpC2 aspB66 ntdA::pHASH120(PS10-ntdABC) pHASH120-ntdA 3 61884
TI148R5 trpC2 aspB66 rpoB5 ntdA::Tn10 pHASH120-ntdB 3 Y8–19
ntdB::pHASH120(PS10-ntdBC)
TI149 trpC2 aspB66 amyE::(PrrnE-bgaB Cmr) UOT1285EN1 3 61884
TI149R5 trpC2 aspB66 rpoB5 amyE::(PrrnE-bgaB Cmr) 84R5 3 TI149
TI150 trpC2 aspB66 rpoChis6 Nmr MF1 3 61884
TI150R5 trpC2 aspB66 rpoB5 rpoChis6 Nmr 84R5 3 TI150
TI151R5 trpC2 aspB66 rpoB5 ntdR::neo amyE::(PntdR-lacZ, Cmr) TI127 3 TI123R5
Plasmids
pDL2-PntdA pDL2 containing the 490 bp of ntdABC upstream region This study
pDL2-PntdR pDL2 containing the 490 bp of ntdR upstream region This study
pMutinT3- ntdR pMutinT3 containing 5’-region of ntdR This study
pHASH120-ntdA pHASH120 containing 5’-region of ntdA This study
pHASH120-ntdB pHASH120 containing 5’-region of ntdB This study
pUC18-ntdR::neo pUC18 containing ntdR::neo This study
pUC18-ntdABC pUC18 containing complete ntdABC This study
pUB18-ntdR pUB18 containing complete ntdR This study
pQE80L-ntdR pQE80L containing complete ntdR This study
a
The latter was transformed with chromosomal DNA or plasmid of the former.
TABLE II
Oligonucleotides used in this study
Purpose Primer Oligonucleotide sequence (5⬘ 3 3⬘)
Transcriptional fusion analysis PntdA-F ATCCCATTCATTTTCTAAAGTC

PntdA-R GAACAGTACCTCCAATGATTTTA
PntdR-F TAATAGCATCGGTTCCACTG
PntdR-R TTCCCTTCCTTAAAAAAGTTGTT
Forced expression of ntdABC ntdA-F ATGCAAAAACAGGTTAAGATTTC
ntdA-R ATAACTTCATCCCCTGGGTT
Forced expression of ntdBC ntdB-F ATGTTATTAAGCAAGAAATCGGAG
ntdB-R CTAAATTTTCCTCGTCCC
Expression of ntdABC in E. coli ntdA-F2 cgaattcATTGGAGGTACTGTTCATGCAa
ntdC-R cggatccTAGTTGACTGCTGAAACAGACATa
IPTG-dependent induction of ntdR ntdR-F agaagctttAAGGAAGGGAAAATATGCCTa
ntdR-R ggaggatccCCATTCATTTTCTAAAGTCCCa
Insertional mutation of ntdR ⌬ntdR-F CGAACTTGACTACACTCCCA
⌬ntdR-R TCCATTCGCTTCTATGATGT
Purification of His6-tagged NtdR ntdR-F2 ggatccATGCCTACAATTGATGAAATa
ntdR-R2 gtcgacTTACGTTGATTCTCTCTTATAATAAGa
a
These primers have the EcoRI, BamHI, HindIII, or SalI site as indicated by underlines.
ntdA-F2 and ntdC-R. The EcoRI-BamHI fragment was cloned into the For disruption of the ntdR gene, the partial internal coding region of
corresponding region of pUC18, generating pUC18-ntdABC. A part of ntdR gene (510 bp) was amplified by PCR with the primers ⌬ntdR-F
the fragment containing PCR errors was replaced with the other cor- and ⌬ntdR-R and cloned into plasmid pCR2.1 (Invitrogen). The EcoRI
responding fragment. fragment containing the partial ntdR gene was subcloned into pUC18
To generate pMutinT3-ntdR, the DNA fragment containing a Shine- (Takara), resulting in pUC18-ntdR. A 1.3-kb SmaI fragment containing
Dalgarno sequence, and the N-terminal coding region was amplified by the neo gene derived from pBEST501 (19) was inserted at the EcoRV
PCR with the primers ntdR-F and ntdR-R. A HindIII-BamHI fragment site within the ntdR gene in pUC18-ntdR, creating pUC18-ntdR::neo.
was cloned into pMutinT3 (18), resulting in a plasmid pMutinT3-ntdR. To determine the transcriptional start point of ntdR, the PCR frag-
Activation of B. subtilis Neotrehalosadiamine Biosynthesis 3887
ment synthesized with PntdR-F and ntdR-R2 was cloned into pCR2.1
and fully sequenced. An EcoRI-SalI fragment was subcloned into plas-
mid pUB18, which is plasmid pUB110 (20) containing multicloning
sites derived from pUC18, generating pUB18-ntdR.
For the expression of His-tagged NtdR, the PCR fragment synthe-
sized with ntdR-F2 and ntdR-R2 was cloned into pCR2.1 and fully
sequenced. A BamHI-SalI fragment containing the full length of the
ntdR coding region was inserted into the expression vector pQE80L
(Qiagen), generating pQE80L-NtdR. E. coli harboring the resultant
plasmid can express His6-tagged NtdR protein, which is extended with FIG. 1. Antibiotic production by parental (61884) and Rif r mu-
Met-Arg-Gly-Ser-His6-Gly-Ser at the N terminus. tant (84R5) strains of B. subtilis. Antibiotic activity was determined
For the selection of B. subtilis transformants, Rif (2 ␮g/ml), erythro- by the paper disk-agar diffusion assay. Strains 61884 and 84R5 (rpoB5)
mycin (Erm; 0.5 ␮g/ml), spectinomycin (100 ␮g/ml), neomycin (3 ␮g/ml), were grown in S7N medium supplemented with amino acids as required
and chloramphenicol (5 ␮g/ml) were used. For the selection of E. coli (50 ␮g/ml of tryptophan and 20 mM aspartate) at 37 °C for the indicated
transformants, ampicillin (100 ␮g/ml) was used. times.
NTD Production—B. subtilis cells were precultured in S7N medium
at 37 °C for 12 h with vigorous shaking. The cultures were then diluted incubated at 37 °C for 30 min. After ethanol precipitation, primer
50-fold in a fresh S7N medium and cultivated for the indicated time extension and sequencing reactions with the corresponding primer were
under the same conditions. The growth of E. coli was monitored in M9 run on polyacrylamide gel. Analysis was done using DNA sequencing
medium supplemented with 0.1% yeast extract. Isopropyl-␤-D-thioga- system LIC-4200L(S)-2 (LI-COR).
lactopyranoside (IPTG; final concentration 10 mM) was added to the Purification of His6-tagged Protein—E. coli BL21(DE3) harboring
growth medium when the culture reached A650 ⫽ 0.5. Antibiotic activity pQE80L-NtdR was grown aerobically to A650 ⫽ 0.6 at 37 °C in L me-
was determined by the paper disk-agar diffusion assay using S. aureus dium supplemented with 1% glucose. IPTG was then added to a final
209P as the test organism. The culture supernatants (50 ␮l) obtained concentration of 2 mM, and the culture was further incubated for 4 h. E.
after centrifugation were applied onto a paper disk (diameter 8.0 mm; coli cells were harvested and disrupted by sonication. The cell lysate
Advantec), and the paper disk was placed on a half-strength Mueller was centrifuged (8,000 ⫻ g for 10 min) to remove insoluble material.
Hinton agar (Difco) plate inoculated with S. aureus 209P. The soluble His6-tagged protein was purified using the TALON purifi-
Isolation and Purification of NTD—The culture supernatant (400 ml) cation kit (Clontech) as described in the manufacturer’s manual. The
of strain TI91R5 prepared after 24-h cultivation was adsorbed on a purified protein was dialyzed against 20 mM potassium phosphate
column of Dowex 50W ⫻ 8 (NH⫹ 4 form). The column was eluted with 250 buffer (pH 7.5). The RNAP holoenzyme containing His6-tagged ␤⬘ sub-
ml of 50 mM ammonium acetate and 100 ml of 1 M NH4OH solutions, unit was purified as described by Fujita and Sadaie (23).
successively. The second eluate was concentrated in vacuo, subjected to Electrophoretic Mobility Shift Assay—DIG Gel Shift Kit (Roche Ap-
a SiO2 gel column chromatography, and then eluted with 300 ml of 65% plied Science) was used for the gel retardation assay. The internal
CH3CN solution. The active fractions were collected and evaporated to region (100 bp) between ntdA and ntdR was amplified with primers
yield a brown material. This material was chromatographed using a PntdR-R and PntdA-R (see Table II) and used for the labeling reaction.
column packed with Sephadex LH-20 resin in 50% CH3OH to obtain a The 100-fold diluted probe was incubated at 25 °C for 15 min with or
brown solid (140 mg). The brown solid (20 mg) was further purified by without His6-tagged NtdR, varying amounts of NTD, trehalose, and
high pressure liquid chromatography (Capcell pack NH2, 4.6 ⫻ 150 mm; neotrehalose in 15 ␮l of binding buffer (20 mM Hepes (pH 7.6), 30 mM
Shiseido) using 90% CH3CN as a mobile phase at a flow rate of 1 ml/min KCl, 1 mM EDTA, 10 mM (NH4)2SO4, 1 mM dithiothreitol, 0.2% Tween
and monitored by refractive index. The resulting compound (purity 20, and poly(dA-dT)). DNA and DNA-protein complexes were separated
⬎95%) was analyzed by mass spectrometry and 13C NMR spectrometry. on 7% nondenaturing PAGE, transferred onto a membrane (Hybond-
High resolution electrospray ionization mass spectrometry (HR-ESI- N⫹; Amersham Biosciences), and detected as described in the manufac-
MS) was performed on a Brucker Daltonics ApexII 70e mass spectrom- turer’s manual.
eter. 13C NMR spectra were recorded on a Brucker DRX600 spectrom-
eter operating at 150.09 MHz. RESULTS
Transposon Mutagenesis—For transposon mutagenesis, the temper-
A Rif r RNAP Mutation Activates Neotrehalosadiamine Pro-
ature-sensitive mini-Tn10-containing vector pIC333 was used as de-
scribed by Steinmetz and Richter (21). We selected colonies that were duction—To investigate the effect of rpoB mutation in B. sub-
resistant to spectinomycin but sensitive to Erm and then tested for tilis, we isolated a number of spontaneous Rif r mutants on L
their ability to produce NTD by cultivating the isolates for 24 h in S7N agar plate containing 100 ␮g/ml Rif. Of these isolates, 40
medium. The mutants resistant to both spectinomycin and Erm were strains were tested for their ability to produce antibiotic. As a
not subjected to the NTD production test. NTD-nonproducing mutants result, a total of 16 mutants were found to produce a signifi-
were selected for further analysis.
cantly increased amount of antibiotic. Antibiotic production by
Assay for ␤-Galactosidase Activity—Strains were grown aerobically
in S7N medium, and samples were withdrawn every 1 h during 10-h the mutant 84R5 is shown in Fig. 1 as an example. Nucleotide
cultivation. ␤-Galactosidase activity was measured as described previ- sequence analysis revealed that all the mutants with enhanced
ously (22). Thermostable ␤-galactosidase (BgaB) activity was also meas- antibiotic production had an identical mutation at Ser-487
ured by the same method, except that the samples were incubated at (corresponding to Ser-531 in E. coli) to Leu (rpoB5) in RNAP
62 °C. ␤-subunit. The other mutants were found to have a substitu-
Primer Extension—Strain 84R5 for ntdABC or 61884 harboring
tion mutation of His-482 (corresponding to His-526 in E. coli) to
pUB18-ntdR for ntdR was grown in S7N medium and harvested at t0
(the time points of transition from exponential to stationary phase) or t4 Arg (rpoB2), Tyr (rpoB6), or Pro (rpoB32) (Table III). Since all
(4 h after t0), with corresponding A650 of 1.5 and 8.0, respectively. The of the rpoB5-back-cross transformants tested produced antibi-
total cellular RNAs were prepared using the Isogen reagent (Nippon otic as much as 84R5, rpoB5 mutation was responsible for the
Gene). To remove the contaminated DNA, the prepared RNAs were observed activation of antibiotic production.
treated with 10 units of DNase I (amplification grade; Invitrogen) at When B. subtilis strain 61884 is grown in S7N medium, cells
25 °C for 15 min. DNase I was inactivated by the addition of EDTA and
produce the dipeptide antibiotic bacilysin after 8 h of cultiva-
heat treatment at 65 °C for 10 min. After ethanol precipitation, a total
of 50 ␮g of RNA was incubated with 1 pmol of an infrared dye-labeled tion (15). A mutant TI91, which does not produce bacilysin,
primer, IRD800-ntdA (5⬘-IRD800-TTGTTTCCACCGCTCGTTTAC-3⬘) cannot accumulate antibiotic activity against S. aureus (15).
(Aloka) for ntdABC or IRD800-ntdR (5⬘-IRD800-TCCGAGCTAAATA- Surprisingly, the introduction of the rpoB5 mutation into the
ATTGGGAGTG-3⬘) for ntdR, at 80 °C for 15 min. After annealing, 5 ␮l mutant TI91, designated TI91R5, activated the antibiotic pro-
of 0.1 M dithiothreitol, 10 ␮l of 5-fold First-Strand buffer (250 mM duction (data not shown). Moreover, the rpoB5 mutation did
Tris-HCl (pH 8.3), 375 mM KCl, and 15 mM MgCl2) and 5 ␮l of dNTP mix
not influence the expression of the bacilysin biosynthesis
(10 mM each of dATP, dGTP, dCTP, and dTTP) were added. To 50 ␮l of
this reaction mixture, 200 units of SuperScript II (Invitrogen) was operon (data not shown). Consequently, the rpoB5 mutation
added followed by incubation at 42 °C for 1 h. Subsequently, 1 ␮l of was thought to activate a novel gene(s) for antibiotic production
RNase mixture (Ambion) was added to the reaction mixture and further in B. subtilis. Therefore, we isolated the antimicrobial sub-
TABLE III
Mutations found in rpoB gene in Rif r mutants
Homologous rpoB
Strain Relevant genotype Nucleotide substitution Amino acid substitution Rif resistancea Antibiotic productionb
positions
E. coli S. coelicolor ␮g/ml

61884 wt(rpoB⫹) ⬍0.1 ⫺
84R5 rpoB5 1460C3 T 487S3L 531S 442N ⬎100 ⫹⫹
84R2 rpoB2 1445A3G 482H3R 526H 437H ⬎100 ⫺
84R6 rpoB6 1444C3 T 482H3Y 526H 437H ⬎100 ⫺
84R32 rpoB32 1445A3C 482H3P 526H 437H ⬎100 ⫺
a
Determined after 12 h of incubation on L agar plate.
b
Antibiotic production was determined after 24 h of cultivation in S7N medium as described in the legend to Fig. 1. ⫺, no inhibition zone; ⫹⫹,
inhibition zone of 25 mm.
TABLE IV
Chemical properties of the isolated compound and NTD
Isolated compound NTDa
Appearance White amorphous powder White amorphous powder

Elemental analysis NDb C42.54, H7.43, N8.60
Electron impact mass ND 340 关M兴⫹
spectrometry (m/z)
ESI-MS (m/z) 363 关M⫹Na兴⫹
HR-ESI-MS (m/z) 363.1368
Calculated for C12H24N2O9Na 363.1374
Ninhydrin Positive Positive
13C NMR in ␦ ppm (in D2O) 54.1, 58.1, 61.1, 61.3, 70.1, 70.1, 71.8, 72.2, 54.7, 58.6, 61.7, 61.8, 70.6, 70.7, 72.2, 72.9,
74.8, 77.4, 92.3, 97.2 75.6, 77.8, 93.0, 98.3
a
The data on the physico-chemical property are from Tsuno et al. (12).
b
ND, not determined.
stance produced by TI91R5 (see “Experimental Procedures”). tion of NtdR protein on NTD production, we constructed the
The purified antimicrobial substance was positive for ninhy- ntdR interruption mutant (TI125R5) carrying IPTG-inducible
drin reaction and adsorbed in a cation exchange column chro- spac promoter-dependent ntdR (Fig. 2). Strain TI125R5 did not
matography. No UV maximum was observed in the aqueous accumulate NTD without the ntdR induction (in the absence of
solution. HR-ESI-MS and 13C NMR spectral data demon- IPTG). On the other hand, the NTD production in TI125R5 was
strated that this antimicrobial substance is identical to NTD induced when IPTG was added into the culture broth. These
which was previously isolated from B. pumilus (12) and results suggest that NtdR protein takes part in the regulatory
B. circulans (13). The chemical properties are summarized in mechanism for NTD production.
Table IV. NTD production of strain 84R5 reached as high as The ntdABC Operon Encodes a Complete Set of Genes for
500 –1000 ␮g/ml after 24 h of cultivation, whereas the parental NTD Biosynthesis—We also investigated whether or not the
rpoB⫹ strain produced less than the detectable level (⬍1 ␮g/ml) ntdABC operon was the structural gene for NTD biosynthesis.
(data not shown). The ntdABC operon was cloned into a high copy number plas-
Identification of the Genes Involved in NTD Production—To mid, pUC18, and expressed in E. coli BL21(DE3) under the
identify the genes involved in NTD synthesis, we performed control of lac promoter (see “Experimental Procedures”). An
transposon mutagenesis of strain 84R5 using the mini-Tn10 E. coli strain harboring pUC18-ntdABC displayed a prolonged
delivery vector pIC333 (21). Of the 1,800 mutant isolates with growth lag phase compared with the vector control (Fig. 3A),
mini-Tn10 insertion tested for NTD production, we found three although no growth inhibition was observed when a high con-
mutants were unable to produce NTD. These three mutants centration (1,000 ␮g/ml) of NTD was added exogenously. TLC
were all found to have a Tn10-insertional mutation within the analysis revealed that a ninhydrin-positive spot with a corre-
polycistronic operon yhjLKJ (we renamed ntdABC in this sponding retention factor of NTD was detected in the culture
study) (Fig. 2). Even when the ntdA downstream genes (ntdB broth of cells expressing ntdABC (Fig. 3B). Moreover, the peak
and ntdC) was expressed from a powerful S10 promoter origi- at m/z 363 that represents the mass of NTD [M ⫹ Na]⫹ was
nating from the large S10 ribosomal gene cluster in strain also detected in the culture broth, as determined by ESI-MS
Y8 –19 (rpoB5 ntdA::Tn10), NTD production was no longer spectrometry analysis (Fig. 3C). In contrast, no peak was de-
detected, indicating that blocking the NTD synthesis by Tn10 tected at m/z 363 when a sample from the cells harboring the
insertion was not simply due to polar effect on ntdB and ntdC vector control was analyzed (data not shown). The amount of
(Fig. 2). The gene products of ntdA, ntdB, and ntdC were NTD produced by the ntdABC-harboring E. coli was ⬃5 ␮g/ml.
putatively identified to be pyridoxal phosphate-dependent ami- These results strongly indicate that ntdABC operon contains a
notransferase, hydrolase, and NADH-dependent dehydrogen- complete set of genes required for NTD biosynthesis. This is
ase, respectively. To confirm whether NTD synthesis is depend- another instance of “exogenous” antibiotic production in E. coli,
ent upon ntdABC transcription, we replaced its promoter in following the previous report on erythromycin production in
rpoB⫹ strain 61884 with a S10 promoter. The resulting recom- E. coli (24).
binant TI139 carrying S10 promoter-dependent ntdABC pro- Transcriptional Analysis of NTD Biosynthesis Gene and Its
duced NTD just as strain 84R5 (Fig. 2), suggesting that the Regulator—The pDL2-derivative plasmids allow the creation of
activation of NTD production by rpoB5 mutation resulted from the promoter-lacZ fusion at the amyE locus via a double cross-
the activation of ntdABC promoter. over event (16). To monitor the transcription of ntdABC and
The ntdR gene (formerly yhjM), which locates inversely in ntdR, we constructed a strain carrying ntdABC-lacZ or ntdR-
the upstream region of ntdABC operon, encodes a putative LacI lacZ transcriptional fusion. The transcription level of ntdABC
family transcriptional regulator. To elucidate the possible func- in rpoB5 mutant was 20 –50-fold higher than that in the rpoB⫹
FIG. 2. The B. subtilis mutant con-

structions and the corresponding
phenotypes for NTD production.
Genes are shown as thick arrows. Pspac,
PS10, and stem-loop structure indicate
IPTG-dependent spac promoter, S10 pro-
moter, and the transcriptional termina-
tor, respectively.
FIG. 4. Transcriptional analysis of ntdABC operon and ntdR
FIG. 3. NTD production in E. coli transformed with the plas- gene in B. subtilis wild-type and mutant (rpoB5) strains. The
mid carrying the ntdABC gene. A, E. coli strain BL21(DE3) harbor- transcription of ntdABC and ntdR were analyzed using transcriptional
ing pUC18 (open circles) or pUC18-ntdABC (closed circles) were grown lacZ fusion constructs with ntdABC (A) and ntdR (B). A, strains TI122
in M9 medium supplemented with 0.1% yeast extract. IPTG was added (squares), TI122R5 (circles), and TI127R5 (triangles) were grown in S7N
into the culture when cells reached A650 ⫽ 0.5, as indicated by the medium supplemented with the required amino acids (50 ␮g/ml Trp and
arrows. After a 4-h incubation, cells were removed by centrifugation, 20 mM of Asp). Culture samples were withdrawn at the indicated times,
and the supernatants were subjected to silica gel TLC analysis (B). The and the ␤-galactosidase activity was measured. B, strains TI123
area corresponding to the retention factor of NTD was scraped and then (squares), TI123R5 (circles), and TI151R5 (triangles) were grown as in
eluted with water. The eluted sample was analyzed by ESI-MS (C). A. C, nucleotide sequence of the intergenic region between ntdR and
ntdABC. The transcriptional start points for the ntdABC and ntdR are
indicated as bending arrows. The ⫺10 and ⫺35 hexamers and ribosome
strain throughout the growth (Fig. 4A). No change in transcrip- binding site (RBS) are shown by capital boldface letters with underline.
The inverted repeat structure is represented by arrows facing
tion level was observed for the other rpoB mutations, namely
one another.
rpoB2, rpoB6, and rpoB32 (data not shown). The disruption of
the ntdR gene almost completely shut off the ntdABC tran-
scription in the rpoB5 mutant (Fig. 4A). In contrast, it resulted 4B), although the rpoB5 mutation caused a transcriptional
in an increase in its own promoter activity (Fig. 4B). These burst of ntdABC throughout whole growth phase of the rpoB5
results indicate that NtdR protein apparently acts positively on mutant (Fig. 4A). To confirm the results from the lacZ fusion
the ntdABC transcription and negatively on its own transcrip- analysis, we conducted Northern blot experiments using probes
tion. However, no significant difference in the ntdR expression for ntdA and ntdR. The ntdABC transcript (⬃3.2 kb) was de-
was observed between rpoB⫹ strain and rpoB5 mutant (Fig. tected in rpoB5 mutant 84R5 but not in rpoB⫹ strain 61884
FIG. 5. Effect of the NTD addition

on ntdABC transcription. A, strains
TI122 (rpoB⫹), TI122R5 (rpoB5), TI127R5
(rpoB5 ntdR::neo), TI130R5 (rpoB5 ntdA::
Tn10), TI131R5 (rpoB5 ntdB::Tn10), and
TI132R5 (rpoB5 ntdC::Tn10) were grown
for 10 h in S7N medium containing vary-
ing concentrations of NTD (purity ⬎95%),
and ␤-galactosidase activity was meas-
ured. The average values for five separate
experiments are shown with their S.D.
values. B, gel mobility shift analysis of
the ntdR-ntdABC intergenic region with
His-tagged NtdR and NTD. DIG-labeled
DNA fragment of the ntdR-ntdABC inter-
genic region was incubated with or with-
out His-tagged NtdR, NTD, trehalose (T),
or neotrehalose (NT).
(data not shown). Consistent with the results from lacZ fusion multicopy number plasmid pUB18-ntdR, because the ntdR ex-
analysis, there was no significant difference in the amount of pression was too low to detect the transcriptional start site. An
ntdR transcript (⬃1.0 kb) between the 84R5 and 61884 strains intensive signal was detected at the A residue 81 bases up-
(data not shown). Thus, the ntdABC transcription was dramat- stream of its translational start codon, although no obvious
ically activated by the rpoB5 mutation without increasing the consensus sequence was found (Fig. 4C).
expression of the positive transcriptional regulator ntdR. We Recently, Bandow et al. (25) reported that the addition of Rif
therefore deduced that a specific co-factor is required (or plays to the exponentially growing B. subtilis cells induces ␴B and ␴D
a role) for the transcriptional activation of the ntdABC by regulons, eliciting the cell’s tolerance to moderate concentra-
NtdR protein. tions of Rif. To test whether these regulon genes were involved
To investigate the regulation of ntdABC transcription by in the NTD production, we grew the rpoB⫹ strain TI122 in S7N
NtdR protein, we first determined the transcriptional start medium containing varying concentrations (10 –100 ␮g/ml) of
sites for ntdABC operon and ntdR gene. For ntdABC primer Rif. However, we found that Rif had no effect on the activation
extension, total RNA of the 84R5 cells was isolated at t0 (the of ntdABC transcription. Moreover, the disruption of these
time point of transition from exponential to stationary phase) alternative ␴ factors, ␴B and ␴D, did not affect NTD production
and t4 (representing the stationary phase) and used for primer in the rpoB5 mutant (data not shown).
extension experiments. Transcription of ntdABC was initiated NTD Functions as an Autoinducer for Its Own Biosynthe-
at the G residue 42 bases upstream of the translational start sis—It was observed that the insertional mutation of ntdA,
codon (Fig. 4C). The most probable ⫺10 and ⫺35 promoter ntdB, or ntdC abolishes their own gene expression in rpoB5
sequences, as recognized by housekeeping ␴ factor (␴A), were mutant (Fig. 5A), suggesting that the transcription of ntdABC
found in the upstream region of the transcriptional start site. can be controlled by an autoregulation mechanism. Further-
Interestingly, the A-T-rich inverted repeat structure was found more, the addition of purified NTD into the culture of these
in this region, overlapped with the ⫺10 hexamer and the tran- mutants actually induced the ntdABC transcription in a dose-
scriptional start point, suggesting that this inverted repeat dependent manner (Fig. 5A). Even in the rpoB⫹ strain, ntdABC
may be a regulatory element for ntdABC transcription. For transcription was activated by the addition of NTD, although
ntdR primer extension, we used strain 61884, harboring a the effect in the rpoB⫹ cells was lower than that in the rpoB5
cells. No such effect was observed in the ntdR-disrupted mu-
tant. In contrast, the addition of trehalose or neotrehalose (also
known as ␣,␤-trehalose) (500 ␮g/ml) instead of NTD failed to
activate the promoter for the NTD biosynthesis gene (data
not shown).
Accordingly, we examined the ability of NtdR protein to
interact with the internal region between the ntdABC operon
and ntdR gene in the presence or absence of NTD. The 100 bp
of DNA fragment containing the deduced regulatory element as
mentioned above was used to investigate possible interaction
with His6-tagged NtdR. A gel mobility shift assay revealed that
NtdR protein apparently bound to this region even in the
absence of NTD (Fig. 5B, lane 2). A complex (NtdR-NTD-DNA)
mobilizing more slowly than the NtdR-DNA complex was de-
tected in dose-dependent manner when NTD was added (lanes
4 –7). The addition of trehalose or neotrehalose instead of NTD
did not affect the mobility of NtdR-DNA complex (lanes 8 and
9). Thus, it is concluded that NTD (but not trehalose and
neotrehalose) probably acts as an autoinducer for its own bio-
synthesis operon by directly interacting with NtdR protein.
Mutant RNAP Enhances the Activity of Promoters Recog-
nized by ␴A—Our results as described above suggest that rpoB5
mutation may render RNAP more potent for recognition of the
ntdABC promoter. To assess this hypothesis, we first compared FIG. 6. Effect of rpoB mutations on the ␴A-dependent pro-
the amount of ␴A binding to core RNAP in rpoB⫹ and rpoB5 moter activity. A, Western blot analysis of the RNAP component.
TI150 (wild type; WT) and TI150R5 (rpoB5) were grown in S7N medium
strains, since ntdABC promoter was recognized by ␴A (see Fig. until A650 ⫽ 0.5 (midexponential phase). Each His6-tagged RNAP ho-
4C). For isolation of RNAP holoenzyme, a strain carrying a loenzyme was isolated and quantified by antibodies for core RNAP or
His6-tagged ␤⬘ subunit of RNAP was used. Western blot anal- ␴A. B, effect of rpoB mutations on the promoter activity of ntdABC.
ysis showed that the amount of ␴A co-eluted with core RNAP in Strains TI127 (rpoB⫹ ntdR::neo), TI127R5 (rpoB5 ntdR::neo), TI127R2
(rpoB2 ntdR::neo), TI127R6 (rpoB6 ntdR::neo), and TI127R32 (rpoB32
rpoB5 strain was virtually the same as that in the rpoB⫹ strain
ntdR::neo) were grown for 10 h (early stationary phase) in S7N medium,
(Fig. 6A). A similar result was obtained when whole-cell lysates and ␤-galactosidase activity was measured for each of the strains. C,
were fractionated by gel filtration (data not shown). Next, we effect of rpoB mutations on the promoter activity of rrnE. Strains TI149
measured the basal promoter activity (without autoinduction) (rpoB⫹), TI149R5 (rpoB5), TI149R2 (rpoB2), TI149R6 (rpoB6), and
of the NTD biosynthesis operon in rpoB⫹ and rpoB5 strains. To TI149R32 (rpoB32) were grown in S7N until A650 ⫽ 0.5, and ␤-galac-
tosidase activity was determined. The average values for five separate
avoid the effect of autoinduction by endogenous NTD, we used experiments are shown with their S.D. values.
the ntdR-disrupted mutants. The basal promoter strength of
ntdABC in rpoB5 mutant was 2.5-fold higher than that in the
wild-type strain (Fig. 6B), despite no observed increase in the products, either or both proteins might be involved in the
␴A level associated with core RNAP (see above). The basal formation of ␣,␤-linkage of sugar moieties. Since the addition of
promoter strength was not affected when other rpoB mutants trehalose (␣,␣-linkage) or neotrehalose (␣,␤-linkage) at a con-
(rpoB2, rpoB6, and rpoB32) were used, indicating that the centration of 1,000 ␮g/ml did not increase the productivity of
observed increase in promoter strength is specific to the rpoB5 NTD regardless of the co-existence or absence of exogenously
mutation. Likewise, the activities of stable RNA promoter rec- added NTD (data not shown), amination of sugar moieties may
ognized by ␴A (examined for rrnA, rrnB, rrnD, rrnE, rrnI, rrnJ, proceed prior to the formation of ␣,␤-linkage. Thus, the seem-
and rrnO) in the rpoB5 strain were also found to be about 2-fold ingly simple biosynthetic process of NTD may offer a good
higher than that in the wild-type strain. The result for rrnE is system to elucidate the regulation of bacterial secondary
presented in Fig. 6C as an example. These results suggest that metabolism.
rpoB5 mutation results in an increase in the ␴A-dependent Another point of interest is that NTD acts as an autoinducer
promoter activity without facilitating the ␴A-binding to core for its own biosynthetic process. The mechanism of autoinduc-
RNAP. Thus, it is thought that the rpoB5 mutation renders tion has been extensively studied in several bacteria in relation
RNAP highly potent to enhance the transcription from the to quorum-sensing systems that are important for various
␴A-dependent promoters, including the ntdABC promoter, physiological processes, such as acquisition of competence,
eventually leading to the dramatic induction of NTD biosyn- sporulation, motility, biofilm formation, bioluminescence, and
thesis operon via the autoinduction system. virulence (26 –28). In Gram-positive bacteria, most of these
signaling molecules are peptides or modified peptides including
DISCUSSION subtilin (29) and nisin (30). In the model for the autoinduction
We have previously reported that antibiotic production by of subtilin and nisin production, these antibiotics induce the
Streptomyces spp. is dramatically activated by introducing cer- transcription of their own biosynthesis genes via a two-compo-
tain mutations into rpoB that confer resistance to Rif (8 –11). In nent signal transduction system. In contrast, it is noteworthy
the present study, we showed that the introduction of Rif r rpoB that NTD bound directly to the positive regulator NtdR in vitro
mutation into a B. subtilis strain activates the dormant ability (Fig. 5B) and induced the transcription of NTD biosynthesis
for NTD synthesis. We also successfully identified the genes operon in vivo (Fig. 5A). As shown in Fig. 5B, NtdR apparently
required for NTD synthesis and for transcriptional activation. bound to the ntdABC promoter region that contains an A-T-
Of these genes, it is highly likely that the ntdA gene product rich inverted repeat sequence overlapped with the ⫺10 hex-
encoding a putative aminotransferase took part in amination of amer of its promoter and its transcriptional start point (Fig.
sugar moieties at positions 3 and 3⬘. Although it is difficult at 4C). Although we have no experimental evidence at this stage,
present to speculate upon the role of ntdB and ntdC gene it is likely that this inverted repeat structure is a regulatory
element for ntdABC transcription. In our model, the NtdR is of current interest not only in basic microbiology but also in
protein dramatically stimulates the ntdABC transcription industrial microbiology. This is because it provides a powerful
when its promoter region is occupied by NTD-bound NtdR tool for the screening of novel compounds and for strain im-
protein. In line with this notion, NTD-unbound NtdR protein provement to overproduce useful compounds. Recently, rpoB
results in a failure to express ntdABC. For further understand- mutations (including S487L mutation corresponding to rpoB5)
ing the function of this intriguing protein, elucidation of the have been demonstrated to be effective for overproduction of
ternary structure by x-ray analysis may be helpful. extracellular enzymes such as amylase and protease by several
One of the most important regulations for gene expression Bacillus species.3 The present study, together with our previ-
(including that for antibiotic production) in bacteria is strin- ous works (8, 9), may be helpful in constructing the strategies
gent control that enables cells to adapt to nutrient-limiting applicable to industrial microbiology.
conditions (31). The effector molecule (called bacterial alar-
Acknowledgments—We thank Shin-ichi Eto, Jun-ichi Yasuda, and
mone) of the stringent control is a hyperphosphorylated
Chie Kobayashi for performing several experiments, Fujio Kawamura
guanosine nucleotide, ppGpp, which binds to the ␤ and ␤⬘ (Rikkyo University, Tokyo, Japan) for providing the antibodies and
subunits of core RNAP. Alarmone takes part in the global strain 1285EN1, and Masaya Fujita (Harvard University) for providing
control of gene expression in bacteria (32, 33). In E. coli, it was strain MF1.
shown that certain Rif r mutants behave like “stringent” REFERENCES
RNAPs even in the absence of the stringent response (7). Sim- 1. Wehrli, W., Knusel, F., Schmid, K., and Staehelin, M. (1968) Proc. Natl. Acad.
ilarly, in S. coelicolor A3(2) and S. lividans, alteration at His- Sci. U. S. A. 61, 667– 673
2. Campbell, E. A., Korzheva, N., Mustaev, A., Murakami, K., Nair, S., Goldfarb,
437 (corresponding to His-482 in B. subtilis) to Arg or Tyr can A., and Darst, S. A. (2001) Cell 104, 901–912
suppress the deficiency of antibiotic production resulting from 3. Ezekiel, D. H., and Hutchins, J. E. (1968) Nature 220, 276 –277
4. Wehrli, W., Knusel, F., and Staehelin, M. (1968) Biochem. Biophys. Res.
the lack of ppGpp due to relA or relC mutation (9 –11). These Commun. 32, 284 –288
results suggest that the mutant RNAPs functionally mimic 5. Ingham, C. J., and Furneaux, P. A. (2000) Microbiology 146, 3041–3049
“stringent” RNAP, leading to the activation of a stringent re- 6. Nicholson, W. L., and Maughan, H. (2002) J. Bacteriol. 184, 4936 – 4940
7. Zhou, Y. N., and Jin, D. J. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 2908 –2913
sponse-dependent antibiotic biosynthesis pathway (10, 11). Al- 8. Hu, H., and Ochi, K. (2001) Appl. Environ. Microbiol. 67, 1885–1892
though rpoB5 mutation also effectively activated NTD produc- 9. Hu, H., Zhang, Q., and Ochi, K. (2002) J. Bacteriol. 184, 3984 –3991
10. Lai, C., Xu, J., Tozawa, Y., Okamoto-Hosoya, Y., Yao, X., and Ochi, K. (2002)
tion, the activation mechanism for NTD production in B. Microbiology 148, 3365–3373
subtilis appears quite different from that in Streptomyces spp. 11. Xu, J., Tozawa, Y., Lai, C., Hayashi, H., and Ochi, K. (2002) Mol. Genet.
in the following ways. (i) Unlike the case for NTD production, Genomics 268, 179 –189
12. Tsuno, T., Ikeda, C., Numata, K., Tomita, K., Konishi, M., and Kawaguchi, H.
rpoB5 mutation did not enhance the bacilysin biosynthesis (1986) J. Antibiot. (Tokyo) 39, 1001–1003
pathway (see “Results”), which is controlled in the stringent 13. Numata, K., Satoh, F., Hatori, M., Miyaki, T., and Kawaguchi, H. (1986) J.
response-dependent manner (15); (ii) the rpoB mutations alter- Antibiot. (Tokyo) 39, 1346 –1348
14. Ochi, K., and Ohsawa, S. (1984) J. Gen. Microbiol. 130, 2473–2482
ing His-437 to Arg or Tyr (corresponding to rpoB2 or rpoB6 in 15. Inaoka, T., Takahashi, K., Ohnishi-Kameyama, M., Yoshida, M., and Ochi, K.
B. subtilis) effectively activated antibiotic production in S. livi- (2003) J. Biol. Chem. 278, 2169 –2176
16. Fukuchi, K., Kasahara, Y., Asai, K., Kobayashi, K., Moriya, S., and Oga-
dans (9), whereas these mutations were ineffective in B. sub- sawara, N. (2000) Microbiology 146, 1573–1583
tilis NTD production (Table I); (iii) unlike bacilysin production, 17. Ohashi, Y., Ohshima, H., Tsuge, K., and Itaya, M. (2003) FEMS Microbiol.
NTD production was not enhanced by provoking the stringent Lett. 221, 125–130
18. Moriya, S., Tsujikawa, E., Hassan, A. K., Asai, K., Kodama, T., and Oga-
response upon amino acid shift-down (data not shown). It is sawara, N. (1998) Mol. Microbiol. 29, 179 –187
also notable that, unlike the case of Streptomyces spp. (9, 11), 19. Itaya, M., Kondo, K., and Tanaka, T. (1989) Nucleic Acids Res. 17, 4410
20. Gruss, A., and Ehrlich, S. D. (1989) Microbiol. Rev. 53, 231–241
any Rif r rpoB mutations (including rpoB5) we tested so far 21. Steinmetz, M., and Richter, R. (1994) J. Bacteriol. 176, 1761–1763
were ineffective to suppress the ppGpp-deficient phenotype on 22. Inaoka, T., and Ochi, K. (2002) J. Bacteriol. 184, 3923–3930
23. Fujita, M., and Sadaie, Y. (1998) Gene (Amst.) 221, 185–190
bacilysin production.2 Thus, we propose that activation of NTD 24. Pfeifer, B. A., Admiraal, S. J., Gramajo, H., Cane, D. E., and Khosla, C. (2001)
production by rpoB5 mutation emerges from events independ- Science 291, 1790 –1792
ent of the stringent response, by which bacterial secondary 25. Bandow, J. E., Brotz, H., and Hecker, M. (2002) J. Bacteriol. 184, 459 – 467
26. Kaiser, D., and Losick, R. (1993) Cell 73, 873– 885
metabolism is often controlled. This suggestion is supported by 27. Kleerebezem, M., and Quadri, L. E. (2001) Peptides 22, 1579 –1596
the fact that rpoB5 mutation caused an increase in the pro- 28. Fuqua, C., Parsek, M. R., and Greenberg, E. P. (2001) Annu. Rev. Genet. 35,
moter activity of stable RNA genes as exemplified for rrnE (Fig. 439 – 468
29. Stein, T., Borchert, S., Kiesau, P., Heinzmann, S., Kloss, S., Klein, C., Helfrich,
6B), the expression of which is normally reduced by stringent M., and Entian, K. D. (2002) Mol. Microbiol. 44, 403– 416
response. It is conceivable that the RNAP of B. subtilis rpoB5 30. Kuipers, O. P., Beerthuyzen, M. M., de Ruyter, P. G., Luesink, E. J., and de
Vos, W. M. (1995) J. Biol. Chem. 270, 27299 –27304
mutant acquired a superior ability (apparently by alteration of 31. Cashel, M., Gentry, D. R., Hernandez, V. J., and Vinella, D. (1996) in Esche-
its ternary structure) to efficiently transcribe ␴A-dependent richia coli and Salmonella: Cellular and Molecular Biology (Neidhardt,
promoters. For a precise understanding of the mechanism of F. C., Curtiss, R., III, Ingraham, J. L., Lin, E. C. C., Low, K. B., Magasanik,
B., Reznikoff, W. S., Riley, M., Schaechter, M., and Umbarger, E., eds) Vol.
gene activation by rpoB5 mutation, it may be useful to per- 1, 2nd Ed., pp. 1458 –1496, American Society for Microbiology Press, Wash-
form comparative studies between B. subtilis and B. pumilus ington, D. C.
32. Chang, D. E., Smalley, D. J., and Conway, T. (2002) Mol. Microbiol. 45,
(or B. circulans) that are capable of producing NTD (12, 13). 289 –306
How to activate dormant antibiotic biosynthetic gene cluster 33. Eymann, C., Homuth, G., Scharf, C., and Hecker, M. (2002) J. Bacteriol. 184,
2500 –2520
2 3
J. Yasuda, T. Inaoka, and K. Ochi, unpublished results. S. T. Jørgensen, personal communication.

Neotrehalosadiamine Via An Autoinduction

Uploaded by

Copyright:

Available Formats

Neotrehalosadiamine Via An Autoinduction

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Neotrehalosadiamine Via An Autoinduction

Uploaded by

Copyright:

Available Formats

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 279, No. 5, Issue of January 30, pp.

RNA Polymerase Mutation Activates the Production of a Dormant

This paper is available on line at http://www.jbc.org 3885

Transcriptional fusion analysis PntdA-F ATCCCATTCATTTTCTAAAGTC

E. coli S. coelicolor ␮g/ml

Appearance White amorphous powder White amorphous powder

FIG. 2. The B. subtilis mutant con-

FIG. 5. Effect of the NTD addition

You might also like