CH 10 Gene Expression

CHAPTER 10
Gene Expression*
E ach organism, whether it has 600 genes (Myco- control their synthesis, transport from the cytoplasm
plasma), 6000 genes (budding yeast), or 25,000 genes into the nucleus, activity through posttranslational modi-
(humans), depends on reliable mechanisms to regulate fications or binding to small molecular ligands.
the expression of these genes (ie, turn them on and off). One key level of regulation is transcription initiation,
This is called regulation of gene expression. In simple the first step in production of RNA transcripts. This
organisms, such as bacteria and yeast, environmental chapter examines the basic features of both prokaryotic
signals, such as temperature or nutrient levels, control and eukaryotic transcription units and the transcription
much of gene expression. In multicellular organisms, machinery. Regulatory TFs that control the expression
genetically programmed gene expression controls devel- of groups of genes are discussed in the context of how
opment starting from a fertilized egg. Within these external signals can reprogram patterns of gene expres-
organisms, cells send each other signals that control sion. Finally, the chapter addresses the mechanisms that
gene expression either through direct contact or via couple transcription to the downstream processing of
secreted molecules, such as growth factors and nascent transcripts.
hormones.
Given the vast numbers of genes, even in simple
organisms, regulation of gene expression is complicated.
Transcription Cycle
Control is exerted at multiple steps, including produc- Synthesis of RNA by RNA polymerases is a cyclic
tion of messenger RNA (mRNA), translation, and protein process that can be broken down into three sets of
turnover. This chapter focuses on the first of these regu- events: initiation, elongation, and termination (Fig. 10.1).
latory steps: the transcription mechanisms that lead to Each of these events consists of multiple steps that
the production of mRNA and other RNA transcripts. can be regulated independently. In the first step of the
Proteins called transcription factors (TFs) turn initiation process, RNA polymerase binds to the chro-
genes on or off by binding to DNA regulatory sequences mosome near the beginning of the gene, forming a
associated with sequences encoding the protein or RNA preinitiation complex at a sequence termed a pro-
product of the gene. The paradigm of this level of regula- moter. This binding must be highly specific to
tion is the bacterial repressor that controls expression of
genes required for lactose metabolism in Escherichia
coli. In eukaryotes, TFs are numerous, representing
approximately 6% of human genes. They are also quite
diverse, binding to a wide range of DNA regulatory sites. Initiation Termination
Fortunately, they fall into a limited number of families Elongation
DNA
with similar structures and binding mechanisms. Three
types of eukaryotic DNA-dependent RNA polymerases
RNA
respond to these regulatory proteins and transcribe DNA polymerase RNA
sequence into RNA. Regulation of TFs is achieved by
FIGURE 10.1 THE TRANSCRIPTION CYCLE. The transcription
variations in a limited number of mechanisms that
reaction consists of three basic steps in which the RNA polymerase
initiates transcription at the promoter, elongates the nascent RNA copy
of one of the DNA strands, and terminates transcription recognition of
*This chapter was written by Jeffry L. Corden. the appropriate signals.
165
166 SECTION IV n Central Dogma: From Gene to Protein
distinguish promoter from nonpromoter DNA. Next, a A. Procaryotic transcription unit

conformational change in the polymerasepromoter DNA I Z Y A
complex separates the DNA strands. This open

Transcription
complex allows RNA polymerase access to single- mRNA i z y a
stranded nucleotide bases that serve as the template to 5' 3'
start the transcript. After formation of a phosphodiester

bond between the first two complementary ribonucleo- B. Eukaryotic transcription unit
tides, the polymerase translocates one base and repeats -globin transcription unit
on genome
the process of phosphodiester bond formation, resulting
in elongation of the nascent RNA. The elongation reac- DNA
tion cycle continues at an average rate of approximately Transcription
20 to 30 nucleotides per second until the complete gene Pre-mRNA
5' 3'
has been transcribed. However, the rate of elongation Exon Intron Exon Intron Exon
is not uniform, as RNA polymerase pauses at certain
Splicing
sequences. The final step in the transcription cycle,
termination, occurs when the polymerase reaches a Mature human-
signal on DNA that causes an extended pause in elonga- globin mRNA
tion. Given enough time, the appropriate sequence
Promoter mutations result in lower level of mRNA
context and factors, the nascent transcript dissociates
Nonsense, frameshift, missense mutations
from the elongating RNA polymerase, and the DNA yield unstable or inactive protein
template returns to a base-paired duplex conformation.
Splice-site mutations result in aberrantly spliced mRNA
Ultimately, RNA polymerase dissociates from the tem-
3' processing site mutations result in failure
plate and is free to search for a new promoter. to polyadenylate mRNA
Regulatory molecules target each of the steps in the
FIGURE 10.2 PROKARYOTIC AND EUKARYOTIC TRAN-
transcription cycle. The frequency of initiation from SCRIPTION UNITS. A, The two transcription units required for regula-
different promoters varies as dictated by the need for the tion of lactose metabolism in Escherichia coli. The I gene encodes the
gene product. The initiation reaction is most often regu- lac repressor, while the Z, Y, and A genes encode -galactosidase,
lated, presumably because this prevents synthesis of lactose permease, and thiogalactoside transacetylase. All three genes
transcripts that are not needed. Elongation and termina- are required for the cell to grow on media containing lactose and are
coregulated as the lac operon. B, The nucleotide sequence of one of
tion can also be regulated, as can splicing and further the two DNA strands is transcribed into a complementary pre-
processing of mRNAs and noncoding RNAs (ncRNAs) messenger RNA (mRNA) copy. The pre-mRNA is processed by
(see Chapter 11). In eukaryotes, the sum of these nuclear removing introns and splicing together the protein-coding exons
regulatory steps, together with cytoplasmic regulation of (orange). The DNA sequences required for expression of a functional
mRNA stability and translation efficiency, contributes to -globin protein are indicated in different colors (see key). Mutations
in any of these sequences can lead to decreased -globin
the wide variation in the abundance of various mRNAs expression.
and proteins in particular types of cells.
Transcription Unit transcription or aberrant processing of the newly synthe-

Genetic information in DNA is transcribed in segments sized RNA (see Chapter 11). Thus, the transcription unit
corresponding to one or a few genes. Gene-coding and can be thought of as a linked series of modules, all of
regulatory (cis-acting) DNA sequences that direct the which must be functional for the gene to be transcribed
initiation of transcription, elongation, and termination at the correct level.
are collectively called a transcription unit. Prokaryotic
transcription units, called operons, contain more than Biogenesis of RNA
one gene, often encoding proteins with related physio- Typical cells contain more RNA than genomic DNA. The
logical functions (Fig. 10.2A). DNA sequences flanking population of RNA molecules range in size from several
the operon direct the initiation and termination of tens to several thousand nucleotides. In prokaryotes,
transcription. translation is initiated on newly synthesized mRNA
A simple eukaryotic transcription unit, such as that during transcription. In eukaryotes, RNA is transported
encoding the human hemoglobin -chain, also has flank- from its site of synthesis in the nucleus to the cytoplasm,
ing regulatory sequences, but the region encoding the where most RNA is used to synthesize proteins. Eukary-
polypeptide is interrupted by exons (Fig. 10.2B). Muta- otic cells have four different types of RNA:
tions that reduce -globin levels in patients with 1. Ribosomal RNA (rRNA [see Fig. 11.9]) makes up
-thalassemias can occur either in the coding region, approximately 75% of the total.
resulting in an unstable or truncated polypeptide, or in 2. Small, stable RNAs, such as transfer RNA (tRNA
the adjacent control regions, leading to low levels of [see Fig. 12.4]), small nuclear RNAs (snRNA [see
CHAPTER 10 n Gene Expression 167
Chapter 11]) involved in splicing, and 5S rRNA, make Transfer RNA is synthesized in the nucleus and trans-
up approximately 15% of the total. ported to the cytoplasm, where it is charged with amino
3. mRNA and its precursor heterogeneous nuclear acids prior to participating in protein synthesis (see Fig.
RNA (hnRNA) account for only 10% of the total. 12.5). snRNAs are synthesized and processed in the
4. ncRNAs, including micro RNAs (miRNAs), are nucleus. From there, they migrate to the cytoplasm,
not abundant but regulate a variety of RNA-based where they acquire essential proteins, and then return
processes. to the nucleus to catalyze RNA splicing reactions (see
Transcription of eukaryotic DNA in the nucleus is Fig. 11.11). The postsynthetic processing pathway that
linked to subsequent steps that process the nascent a particular transcript follows is dictated, in part, by
transcript in preparation for its eventual function (see the transcription machinery that is used to initiate and
Chapter 11 for a complete discussion of these steps). elongate the transcript and by certain features of the
Processing of mRNA precursors includes capping and nascent RNA.
methylation of the 5 end of the nascent transcript, splic-
ing to remove introns and modifying the 3 end by RNA Polymerases
cleavage and addition of a stretch of adenosine residues. Cellular RNA polymerases synthesize a strand of nucleic
The finished mRNA is then transported to the cytoplasm, acid in the 5 to 3 direction that is complementary to
where it serves as the template for protein synthesis. one of the chromosomal DNA strands. Even though the
Eukaryotic ribosomal RNA is encoded in tandemly enzymatic reaction is similar to DNA replication (see
repeated genes and each gene is transcribed as a long Fig. 42.1), there are several important differences. First,
precursor molecule, which is cleaved and modified to RNA polymerases synthesize a strand of ribonucleotides.
give the final 28S, 5.8S, and 18S RNAs (Fig. 10.3). These Second, unlike DNA polymerase, RNA polymerases can
RNAs are assembled, together with 5S RNA and approxi- initiate transcription without a primer. Finally, unlike
mately 80 proteins, into ribosomes in the nucleolus. replication, the newly transcribed sequences do not
remain base-paired with the template but are displaced
from the template approximately 10 base pairs (bp) from
the growing end of the nascent RNA. All known RNA
A polymerases share these properties and have similar
Ribosomal DNA repeat
structures, since they arose from a common ancestor
Nontranscribed Transcription unit during evolution.
spacer Bacteria have a single RNA polymerase composed of
Transcription
six polypeptides. Two copies of the subunit and one
45S precursor RNA each of the , , and subunits form a five-subunit core
Cleavage enzyme that synthesizes RNA. The sixth subunit, ,
binds to the core enzyme to form a holoenzyme that
Ribosomal RNAs 18S 5.8S 28S is able to recognize promoter sequences and initiate
5S RNA and transcription.
ribosomal proteins
Most eukaryotes have three different RNA polymer-
Ribosome ases (some species of plants contain four) with the
largest subunits closely related to bacterial and
subunits. RNA polymerases I, II, and III each have 10
B Nascent core subunits, most of which are unique to each enzyme
Nucleolar pre-rRNA Direction of (Fig. 10.4A). RNA polymerases I and III have additional
DNA molecules transcription
subunits similar to RNA polymerase II general TFs dis-
cussed in a following section.
RNA polymerase I concentrates in the nucleolus,
where it synthesizes rRNA. Throughout the nucleoplasm
Transcription unit
Transcription unit RNA polymerase II synthesizes mRNA and several classes
Nontranscribed spacer
of ncRNAs including some snRNAs involved in RNA
FIGURE 10.3 RIBOSOMAL RNA TRANSCRIPTION UNIT. splicing, and long noncoding RNAs (lncRNAs) and
Ribosomal RNA (rRNA) is transcribed from a set of transcription units miRNAs implicated in gene regulation. RNA polymerase
arrayed as tandem copies of the same transcription unit. A, Map III synthesizes tRNA, 5S rRNA, and the 7S RNA of the
showing the arrangement of sequences in a typical ribosomal DNA signal recognition particle (see Fig. 21.5). RNA poly-
repeat. B, Electron micrograph showing two active rRNA transcription
merase IV is present only in plants, where it is involved
units. Note that each transcription unit is transcribed by multiple RNA
polymerases. As the polymerases traverse the gene, the attached in heterochromatin formation and gene silencing.
nascent RNA is extended, giving a tree-like appearance. (B, Courtesy The multiple eukaryotic RNA polymerases apparently
of Yvonne Osheim, University of Virginia, Charlottesville.) originated through duplication of primordial genes,
A E. coli Pol I Pol II Pol III B. Ribbon

1 2 1 2 1 2
'
3 4 3 4 3 4
5 6 5 6 5 6
7
8 9 10 7 8 9 10 7 8 9 10
Tandem repeats of the

consensus aa sequence
TyrSerProThrSerProSer
CTD 90
C. Conserved sequences
N C
Pol I
90
Pol II
CTD
Book icon Book icon
Pol III
E. coli D. Conserved residues (red)
Yeast pol I K KEG L FR KHMMGKRVN

Yeast pol II G KEGR I RGN LMGKRVD
Yeast pol III G KQGR FRGN LS GKRVD
Human pol II G KEGR VRGN LMGKRVD
H. halobium G KEGR FRGS L SGKRVN
E. coli G KQGR FRQN L LGKRVD
FIGURE 10.4 MULTIPLE RNA POLYMERASES. A, Eukaryotic cells have three different polymerases (Pol) that share three common subunits
(numbers 5, 6, and 8) and have a number of other related, but distinct, subunits (indicated by related colors and distinct shading). B, A ribbon
diagram of the structure of RNA polymerase II showing the arrangement of different subunits (colored as in part A). Metal ions are indicated as
red balls. A prominent cleft, large enough to accommodate a DNA template, is formed between the two largest subunits. The model DNA fragment
is shown for size comparison only. C, Conserved amino acid sequences are dispersed throughout the largest subunits. Red indicates sequences
that are conserved among both prokaryotes and eukaryotes. Yellow represents sequences that are conserved among the three different eukaryotic
RNA polymerases. D, Conserved residues are located on the inner surface of the RNA polymerase cleft. E. coli, Escherichia coli; H. halobium,
Halobacterium halobium. (B, For reference, see Protein Data Bank [PDB; www.rcsb.org] file 1I50 and Cramer P, Bushnell DA, Kornberg RD.
Structural basis of transcription: RNA polymerase II at 2.8 angstrom resolution. Science. 2001;292:18631876. D, From Zhang G, Campbell EA,
Minakhin L, et al. Crystal structure of Thermus aquaticus core RNA polymerase at 3.3 resolution. Cell. 1999;98:811824.)
followed by evolution of specialized functions. RNA synthesis. The subunits of both prokaryotic and eukary-
polymerase II is the most versatile, because it must otic enzymes assemble into a roughly spherical structure
transcribe approximately 25,000 different species of with a diameter of approximately 150 and a cleft 25
human mRNAs and perhaps an equal number of ncRNAs. wide, to accommodate the DNA template (Fig. 10.4B).
The relative abundance of individual mRNAs can vary The two largest subunits form the framework of the
widely, often in response to external signals, from just a structure, with two lobes that clamp down on the tem-
few copies to more than 10,000 copies per cell. Thus, plate DNA and form the catalytic core (Fig. 10.4C). The
RNA polymerase II must recognize thousands of differ- most conserved residues are located on the inner sur-
ent promoters and transcribe them with widely varying faces of the enzymes with the site of nucleotide addition
efficiencies. In contrast, RNA polymerase I is specialized on the back wall of the cleft (Fig. 10.4D).
to transcribe more than 100,000 copies of rRNA per cell Transcription does not necessarily require such large
and RNA polymerase III synthesizes several hundred enzymes. Bacteriophages have evolved structurally dis-
species of highly abundant transcripts. tinct, DNA-dependent RNA polymerases that are one-fifth
Specialization has been balanced, however, by the the size of the eukaryotic enzymes yet are able to carry
need to retain the structural elements required for RNA out complete transcription cycles. The complexity of the
eukaryotic enzymes is likely attributable to the need for A. Prokaryotic promoter

10 bp
regulation, with additional subunits acting as sites -35 (6 bp) (1719 bp) -10 (6 bp) +1
DNA 3'
for interaction with regulatory proteins. Domains that 5'
differ among the three types of eukaryotic RNA polymer-

ases are likely to interact with factors that are unique to B. Eukaryotic Pol I promoter 50 bp
a particular class of polymerase. One example of a class-
specific domain is the carboxyl-terminal domain -200 -100 -50 +20
5' DNA 3'
(CTD) of the largest subunit of RNA polymerase II, Upstream element Core element
which is composed of tandem repeats of the consensus
heptapeptide TyrSerProThrSerProSer. The CTD is highly
phosphorylated in vivo, and the timing of CTD phos- C. Eukaryotic Pol II promoter 10 bp
phorylation suggests that this modification may be -37 to -32 -31 to -26 +1 +28 to +34
5' BRE TATA DNA INR DPE 3'
involved in the transition between the initiation and TFIIB TATA Initiator Downstream
elongation steps of transcription. By serving as a scaffold recognition box promoter
element element
binding numerous auxiliary factors, the CTD also couples C C A C G C C TATA A A Py Py A NT AG A C G T G
GGG APy Py G T
transcription with the subsequent processing of the
nascent mRNA as is discussed in a later section.
D. Eukaryotic Pol III E. Eukaryotic Pol III
RNA Polymerase Promoters promoter: promoter:
Initiation of transcription requires loading of RNA poly- tRNA genes 5S rRNA gene 25 bp
+8 +20 +50 +61 +40 +80
merase onto the chromosome at the promoter of a gene 5' DNA 3' 5' DNA 3'
A box B box C box
or operon. A promoter can be loosely defined as a DNA
sequence where RNA polymerase binds, unwinds the FIGURE 10.5 PROKARYOTIC AND EUKARYOTIC PROMOT-
template and initiates transcription. Strong promoters ERS. The prokaryotic (A) and three eukaryotic (BE) RNA polymerases
recognize different promoter sequences. Positions of promoter ele-
drive the expression of genes whose products are
ments are indicated with respect to the start of transcription (+1). For
required in abundance. Weaker promoters regulate the the RNA polymerase II (Pol II) promoter elements, the consensus
expression of rare proteins or RNAs. In multicellular sequences are shown. Not all polymerase II promoters contain all
organisms, a promoter may direct expression at a high these elements. Pol, polymerase; rRNA, ribosomal RNA; TF, transcrip-
level in some cells, at an intermediate level in others, and tion factor; tRNA, transfer RNA.
be repressed in yet others.
Promoters in bacteria are recognized by direct interac-
tions of the RNA polymerase factor with specific DNA site of many genes transcribed by RNA polymerase II
sequences. The most common factor in E. coli ( 70) (Fig. 10.5C). In addition to the TATA box, a less-conserved
recognizes two conserved six-base sequences located 10 promoter element, the initiator, is found in the vicinity
bases (minus 10) and 35 (minus 35) upstream of the of the transcription start site of many genes. Some genes
transcription start site (Fig. 10.5A). Once initiation has transcribed by polymerase II do not contain TATA boxes
occurred, is no longer required and can dissociate from but may contain strong initiator elements. Together,
the core enzyme. Bacterial cells have several distinct these two elements account for the basal promoter activ-
factors, each of which binds the core enzyme and directs ity of most protein-coding genes.
RNA polymerase to a subset of promoters that contain Two types of RNA polymerase III promoters have key
different recognition sequences, thereby promoting elements within the transcribed sequences (Fig. 10.5D
independently regulated transcription of genes with E). tRNA genes contain two 11-bp elements, the A box
diverse functions. and B box, centered approximately 15 bp from the 5
Eukaryotic promoter sequences for RNA polymerases and 3 ends of the coding sequence, respectively. The
I and II are also situated upstream of the transcription 5S-rRNA gene contains a single internal element, the C
start site. RNA polymerase I recognizes a single type of box, located in the center of the coding region. Given
promoter located upstream of each copy of the long the differences in classes of eukaryotic promoters, it is
tandem array of pre-rRNA coding sequences (Figs. 10.3B not surprising that each type of polymerase uses differ-
and 10.5B). The core element of this promoter overlaps ent proteins to recognize the promoter sequences.
the transcription start site, while an upstream control
element located approximately 100 bp from the start site
stimulates transcription.
Transcription Initiation
Comparison of the first eukaryotic protein-coding The loading of RNA polymerase onto double-stranded
gene sequences revealed a conserved consensus genomic DNA at a promoter sequence is best understood
sequenceTATAAAAcalled a TATA box, located in prokaryotes and is discussed first before initiation by
approximately 30 bp upstream of the transcription start eukaryotes. Initiation takes place in a series of defined
A. Closed complex (binding) B. Open complex (melting) C. Transcribing complex
Jaws of
clamp
RNA exit
channel Nucleotide
entry channel
FIGURE 10.6 THREE STEPS IN RNA POLYMERASE INITIATION. A, In the closed complex, the double-stranded promoter DNA is
recognized by factor domains on the surface of the holoenzyme. Double-stranded DNA then transfers into the active site shown here. B, The
open complex forms by unwinding DNA surrounding the transcription start site and positioning the single-stranded template in the active site of
the polymerase. C, The initiation reaction in the context of the transcription cycle.
TABLE 10.1 Summary of Eukaryotic RNA Polymerase II General Transcription Factors

Factor Number of Subunits Subunit M (kD) Functions
TFIIA 3 12, 19, 35 Stabilizes binding of TBP and TFIIB
TFIIB 1 25 Binds TBP, selects start site, and recruits polymerase II
TFIID 12 15250 Interacts with regulatory factors
(TBP) 1 38 Subunit of TFIID; specifically recognizes the TATA box
TFIIE 2 34, 57 Recruits TFIIH
TFIIF 2 30, 74 Binds polymerase II and TFIIB
TFIIH 9 3598 Unwinds promoter DNA; phosphorylates CTD
(C-terminal domain of RNA polymerase II)
Polymerase II 12 10220 Catalyzes RNA synthesis
TOTALS 42 ~1000
TBP, TATA boxbinding protein.
steps (Fig. 10.6). First, RNA polymerase holoenzyme of a stable ternary (three-way) complex containing RNA
binds to the double-stranded promoter, forming what is polymerase, the DNA template, and the nascent RNA.
called the closed complex. Interactions between the
factor and bases in the 10 and 35 elements of the General Eukaryotic Transcription Factors
promoter determine the specificity and strength of this Eukaryotic RNA polymerases require multiple initiation
interaction (Fig. 10.5). The second step in initiation is factors to start transcription. All the RNA polymerases
the formation of an open complex by separation of the use a TATA boxbinding protein, but most of the
two strands of DNA around the transcription start site other initiation factors are unique for each class. On the
producing a 14 base transcription bubble. This unpairing other hand, each RNA polymerase uses the same general
is accompanied by a conformational change in the poly- transcription factors (GTFs) for most promoters.
merase that positions the single-stranded DNA template GTFs are remarkably conserved among eukaryotes. The
in the active site and narrows the DNA-binding cleft, next sections describe transcription initiation by the
effectively closing the polymerase clamp. In the next three forms of eukaryotic RNA polymerase.
step, the DNA template in the active site base-pairs with
the first two ribonucleotides, and the first phosphodies- RNA Polymerase II Factors
ter bond is catalyzed. The process of single nucleotide Initiation of transcription by RNA polymerase II in
addition is repeated until the nascent RNA is eight to vitro depends on the ordered assembly of more than
nine bases long, at which point addition of bases to the 20 GTFs at the promoter (Table 10.1). Assembly of this
growing RNA chain results in the unpairing of the 5 RNA RNA polymerase II preinitiation complex begins
base of the RNA-DNA hybrid, and the nascent RNA with binding of TFIID, a large protein complex (~700
begins to exit through a channel on the surface of the kD) consisting of TATA boxbinding protein (TBP) and
polymerase. The resulting conformational change in TBP-associated factors called TAFIIs (Fig. 10.7A).
polymerase leads to the release of factor and formation TBP alone is sufficient for basal transcription, while
A B
TATA Gene
C
TAFs
II D
TBP
C TBP
II A
C
II B
CTD
Pol II
II F
D. TBP
II E
C
II H
TAFs N
Preinitiation H E
complex B TBP A TF II B
F
Elongation factors
Direction of
transcription
+1
FIGURE 10.7 RNA POLYMERASE II PREINITIATION COMPLEX ON THE ADENOVIRUS-2 MAJOR LATE PROMOTER DNA. A, The
sequential assembly of general transcription factors leads to a preinitiation complex with the promoter region in the closed complex. Helicase
activities present in transcription factor IIH (TFIIH) use the energy of adenosine triphosphate (ATP) to unwind the promoter, leading to formation
of an open complex. B, Binding of the TATA boxbinding protein (TBP) leads to C, a pronounced bend in the DNA. D, TFIIB interacts both
upstream and downstream of the TATA box and directs RNA polymerase to the transcription start site. (BD, For reference, see PDB file 1VOL.
TBP + DNA coordinates courtesy Stephen Burley, Rockefeller University, New York.)
TBP-associated factors (TAFs) apparently serve as pronounced DNA bend is produced at each end of the
targets for further activation of transcription (see sub- TATAAA element by the intercalation of phenylalanine
sequent sections). DNA binding by TBP is provided by side chains (Fig. 10.7C).
a highly conserved C-terminal of 180 amino acids, The TFIID-TATA box complex serves as a binding site
which forms a saddle-shaped monomer with an axis of for additional GTFs and positive and negative regulators.
dyad symmetry (Fig. 10.7B). The underside of the TBP TFIIA binding stabilizes the TBP-DNA interaction and
saddle binds to the minor groove of the TATA prevents the binding of repressors that would otherwise
sequence, which is splayed open in the process. A block further initiation complex formation.
The next step in assembly of the initiation complex +1

A. Pol I rRNA promotors
is adding TFIIB, which binds to one side of TBP, making
contacts with DNA upstream and downstream of the UCE Core element Pre-rRNA gene
TATA box (Fig. 10.7D). Mutations in the yeast gene TBP

TAFs
encoding TFIIB alter mRNA start-site selection, indicat-
ing that TFIIB establishes the spacing between the TATA Pol I
box and the transcription start site. TFIIB interacts UBF UBF
directly with TBP and RNA polymerase II and is essential
for the next steps in initiation complex assembly.
RNA polymerase II joins the preinitiation complex
(Fig. 10.7A) associated with TFIIF. This factor stabilizes
the interaction of RNA polymerase II with TFIIB and
B. Pol III tRNA promotor
TBP. TFIIF also binds to free polymerase and prevents
interactions with nonpromoter DNA sites.
TFIIH and its stimulatory factor TFIIE are the final
TFIIIC
general factors to enter the preinitiation complex. Their
TBP
binding stabilizes contacts between proteins and DNA in B''
BRF
the vicinity of the transcription start site. TFIIH contains Pol III
TFIIIB
eight polypeptides, several of which have functions
outside of transcription initiation. Helicases associated
with TFIIH use energy from adenosine triphosphate C. Pol III 5S-rRNA promotor
(ATP) hydrolysis to unwind a short stretch of promoter
DNA at the transcription start site. This separation of
DNA strands allows RNA polymerase II to recognize the TFIIIC
TBP
template strand, bind the complementary nucleotides, B'' TFIIIA
BRF
and synthesize the first few phosphodiester bonds. Pol III
TFIIIB
TFIIH also contains a protein kinase that phosphory-
lates the CTD. This is Cdk-activating kinase (CAK), itself
FIGURE 10.8 RNA POLYMERASE I AND III PREINITIATION
a Cdk-cyclin complex that phosphorylates and activates COMPLEXES. A, Ribosomal RNA promoters assemble a preinitiation
other cyclin-dependent kinases (see Fig. 40.14). In the complex. (UCE, upstream control element.) This complex consists of
initiation complex, phosphorylation of the CTD releases an upstream binding factor (UBF) and a multisubunit factor that con-
tains TATA boxbinding protein (TBP). Together, these factors recruit
it from interactions with GTFs and mediator (see later RNA polymerase I. BC, Initiation at RNA polymerase III promoters
section) allowing it to leave the promoter and enter requires recognition of sequences within the transcribed sequences.
the transcription elongation phase. Other TFIIH sub These sequences differ for transfer RNA (tRNA) and 5S ribosomal
genes. B, In the case of tRNA genes, only TFIIIC is required for specific
units have been identified as components of the DNA binding. C, For 5S genes, the internal element is recognized by the
repair machinery. Several genes encoding TFIIH sub- specific DNA-binding factor TFIIIA. BRF, TFIIB-related factor.
units are mutated in xeroderma pigmentosa, a human
disease with defects in DNA excision repair. This sug-
gests that TFIIH might link transcription to DNA repair The assembly of RNA Pol III initiation complexes
(see Box 43.1). differs at various promoters. Initiation at tRNA genes
begins with TFIIIC binding to the A and B boxes (Fig.
Initiation by RNA Polymerases I and III 10.8B); TFIIIB then binds upstream of the A box at a
Distinct initiation complexes initiate transcription at sequence determined both by an interaction with TFIIIC
RNA polymerase I and III promoters (Fig. 10.8). RNA and through the DNA-binding capacity of TBP. Once
polymerases I (Pol I) and III (Pol III) contain subunits the TFIIICTFIIIB complex has assembled, RNA Pol III
related to polymerase II (Pol II) GTFs TFIIF and TFIIE. initiates transcription. Multiple rounds of initiation can
Unique TFIIB-related factors provide additional GTF occur on the stable transfer DNA (tDNA)TFIIICTFIIIB
functions for Pol I and Pol III. complex. Transcription of 5S rRNA genes requires an
The Pol I upstream binding factor binds to both the additional factor called TFIIIA that recognizes the C box
upstream control element and part of the core element located near the center of the 5S rRNA coding region.
of the promoter (Fig. 10.8A). A protein complex called TFIIIC then binds with contacts on each side of TFIIIA,
SL1 stabilizes this initial complex. SL1 consists of TBP similar to the A and B boxes contacting tRNA genes.
and TAFs specific to RNA Pol I, including one related to Finally, TFIIIB binds through interactions with TFIIIC
TFIIB. A unique factor Rrn3 binds Pol I and modulates and DNA, and the resulting preinitiation complex is
rRNA transcription in response to nutrient availability. recognized by RNA Pol III.
Summary of the Eukaryotic Basal complex. Once the first few RNA phosphodiester bonds
Transcription Machinery form, the polymerase undergoes a conformational
Despite the evolutionary divergence of the multiple change. Subunits at the outer edge of the cleft close like
eukaryotic RNA polymerases and the specialization of jaws to encircle the DNA template. In this structure, the
each polymerase for a unique set of promoters, the front end of the transcription bubble (an unpaired
fundamental mechanisms of transcription have been segment of the DNA template) is positioned at the back
conserved. This conservation is reflected not only in wall of the cleft, close to the catalytic center. The elonga-
similar sequences of the subunits of the polymerases tion complex is highly efficient and can function
themselves but also in the presence of TBP and TFIIB continuously for the 17 hours required to transcribe
homologs among the GTFs used by each class of poly- the more than 2 million-bp mammalian dystrophin gene
merase. Indeed, Archaea, which have only a single RNA (see Fig. 39.17).
polymerase, contain both TBP and TFIIB suggesting that
initiation mechanisms employing GTFs evolved before Catalytic Cycle
the duplication of the RNA polymerases. The DNA-dependent RNA polymerases catalyze synthesis
Why are so many factors required to make a transcript? of an RNA polymer from ribonucleoside 5-triphosphates
Part of the complexity might be necessary to generate (ATP, guanosine triphosphate [GTP], cytidine triphos-
multiple sites for interaction with regulatory factors that phate [CTP], and uridine triphosphate [UTP]) according
could either activate or repress the assembly or function to the following reaction:
of the preinitiation complex. A second role for the
( NMP )n + NTP ( NMP )n+1 + PPi
complex set of factors could be to target polymerases to
specific sites in the nucleus. Finally, some factors could where (NMP)n is the RNA polymer; NTP is ATP, UTP,
help load elongation, splicing, or termination factors CTP, or GTP; and PPi is pyrophosphate. Polymerase
onto the RNA polymerases. extends the RNA chain in the 5 to 3 direction by adding
ribonucleotide units to the chains 3 OH end. Selection
of the incoming nucleoside triphosphate (NTP) is
Transcription Elongation and Termination directed by the DNA template and takes place at the
The final stage of initiation leads to elongation and move- transcription bubble (Fig. 10.9). The 3 hydroxyl group
ment of the polymerase away from the promoter. This acts as a nucleophile, attacking the -phosphate of the
process of promoter clearance is associated with incoming NTP in a reaction similar to that seen in DNA
structural changes in the polymerase, which prepare it replication (see Fig. 42.1). The chain elongation reaction
for efficient RNA synthesis and render it susceptible to proceeds in vivo at a rate of 30 to 100 nucleotides per
the action of factors that regulate elongation. Such regu- second and is facilitated by a set of flexible protein
latory factors, together with structural features of the modules surrounding the polymerase active site.
nascent transcript, influence elongation and can trigger
the termination of transcription and the dissociation of Pausing, Arrest, and Termination
the ternary elongation complex containing the DNA Following the addition of each nucleotide, RNA poly-
template, nascent RNA, and RNA polymerase. The termi- merase may add an additional nucleotide, pause, move
nation reaction typically occurs at the 3 end of the in reverse, or terminate (Fig. 10.9B). The relative
gene or operon and serves both to recycle RNA poly- probabilities of these alternative reactions depend
merase for additional initiation reactions as well as to on interactions between the transcription complex
ensure that adjacent genes are not inadvertently and the template, the nascent RNA transcript, and regula-
transcribed. tory TFs.
RNA polymerase does not elongate at a constant rate.
Transcription Elongation Complex Instead, it synthesizes RNA in short spurts between
Efficient synthesis of RNA requires balancing two com- pauses. A pause of short duration can be caused by low
peting demands. First, the elongation complex must be NTP concentrations or alternatively by the transient
very stable, because premature dissociation from DNA unpairing of the 3 end of the nascent transcript and
produces defective partial transcripts and requires the template. Longer pauses are provoked by the presence,
polymerase to restart transcription from the promoter. in the nascent RNA, of short (~20 bp) self-complementary
However, the complex must also be bound loosely sequences that can fold to form a stem-loop or hairpin,
enough so that the polymerase can easily translocate or the presence of a weak RNADNA hybrid. The pres-
along the DNA template. ence of an unstable RNADNA hybrid can arise from the
RNA polymerase evolved to meet these needs. The misincorporation of an NTP leading to an unpaired base
cleft formed at the interface between the two largest in the hybrid. In this case, the RNA polymerase can
subunits is open when the polymerase is in the initiation backtrack or slide backward on the template (Fig. 10.9C).
A. RNA polymerase C. Elongating

5'
3'
3'
3' 5'
5'
Backsliding
Nascent
D. Paused
RNA 5'
3'
3'
5'
5'
B. Active site
Backsliding
E. Arrested
5'
Termination 3' 3'

Editing Elongation 5'
RNA 3' OH 5'
transcript 3'
Template
Position 1 1 +1 Next NTP
FIGURE 10.9 TRANSCRIPTION ELONGATION. A, Model of the transcription elongation complex consisting of RNA polymerase, template
DNA, and nascent RNA transcript. RNA polymerases interact with the template upstream and downstream of the transcription bubble. B, The
active site of RNA polymerase positions the growing end of the nascent transcript in the appropriate location for the addition of the next nucleoside
triphosphate (NTP). After each single nucleotide addition, the polymerase may translocate forward and repeat the nucleotide addition (C), slide
backward and pause for a variable time (D), or slide further backward, causing a transcription arrest that is reversed when the polymerase cleaves
the nascent RNA (E).
Backward movement of the transcription bubble is called terminators trigger the release of the transcript
accompanied by a zippering movement of the RNADNA and dissociation of the RNA polymerase. Bacteria have
hybrid in which the nascent RNA in the exit channel two types of terminators. The first are called intrinsic
rehybridizes with upstream template sequences and (or rho-independent) terminators, because they
the 3 end of the transcript unpairs from the hybrid function in the absence of any protein factors (Fig.
and is extruded through the same channel that NTPs use 10.10A). Intrinsic terminators consist of two sequence
to enter the active site. If the polymerase backtracks elements in the RNA: a stable GC-rich hairpin and a run
more than a few nucleotides the complex becomes of about eight consecutive U residues. As the first of
arrested and cannot resume elongation without assis- these elements is synthesized, it forms a hairpin, causing
tance of additional factors. For example, transcription polymerase to pause with less stable U:A bp (with only
elongation factors can bind in the NTP channel of two H bonds [see Fig. 3.14]) in the hybrid. The nascent
arrested complexes and activate the RNA polymerase to transcript is released from this complex, terminating
cleave the backtracked RNA. The new 3 terminal residue transcription. The second type of prokaryotic termina-
is correctly positioned for incorporation of the next tion requires a protein factor called rho (Fig. 10.10B).
complementary NTP (Fig. 10.9CE). This editing process Rho is a hexameric helicase that binds cytosine-rich
increases the fidelity of transcription. Pausing also occurs sequences and uses ATP hydrolysis to translocate along
following transcription of U-rich sequences, and in the nascent transcript in the 5 to 3 direction, essentially
prokaryotes this is often associated with transcription chasing the RNA polymerase. When polymerase pauses,
termination. rho can catch up and use the energy derived from ATP
hydrolysis to pull the RNA out of the transcription elon-
Termination gation complex.
When elongating RNA polymerase reaches the end Eukaryotic RNA polymerases evolved distinct mecha-
of a gene or operon, specific sequences in the RNA nisms for termination. RNA Pol III requires no protein
A. Rho-independent termination B. Rho-dependent termination
CC CCC C
G
C
CG
C
G
G
Rho hexamer binds specific
C C-rich sequences of RNA
G- and C-rich self-

complementary
region forms hairpin
Rho migrates 5' to 3'

to signal release of
G
C C pol on contact
G G
C G
C
G- and C-rich
Hairpin structure
induces release of
paused polymerase Rho's helicase activity
from polyU sequence unwinds RNA/DNA duplex
releasing RNA
C G
C
G CG
C G
U UU U U
U
FIGURE 10.10 PROKARYOTIC TRANSCRIPTION TERMINATION. A, Rho-independent termination is directed by sequences in the nascent
transcript that operate in the absence of any additional factors. B, The bacterial termination factor rho translocates along the nascent RNA and
on reaching the RNA polymerase (pol) causes the disassembly of the elongation complex.
factors but terminates efficiently after transcribing four and eukaryotes, many of the basic principles are
to six consecutive U residues, presumably owing to the same.
instability of the RNADNA hybrid in the enzyme active
site. RNA Pol I terminates in response to a protein factor Regulation of Transcription Initiation in Prokaryotes
that blocks further elongation by binding to a DNA Prokaryotes typically regulate gene expression in
sequence downstream of the termination site, leaving an response to environmental cues such as the presence of
inherently unstable U-rich RNADNA hybrid in the active nutrients in the growth medium (see Fig. 27.11). These
site. The RNA Pol II termination mechanism is more signals are transmitted to the appropriate genes through
complex, requiring a large multiprotein complex that regulatory proteins that bind to specific sequences near
recognizes the poly(A) addition signal sequence in the the genes they control to either activate or repress
nascent transcript (see Fig. 11.3 for pre-mRNA process- transcription. Both of these regulatory mechanisms
ing). Deletion or mutation of the poly(A) signal results come into play in regulation of the E. coli lactose (lac)
in a failure to terminate messages at the appropriate site. operon (Figs. 10.2A and 10.11). The genes expressed
Thus, RNA Pol II termination is coupled to 3-end pro- from this operon are required for cells to metabolize
cessing (see Chapter 11). lactose but are not expressed in the absence of lactose.
Genetic studies in the 1960s showed that the gene
upstream of the lac operon (I in Fig. 10.2A) encodes a
Gene-Specific Transcription Regulation repressor (lac repressor) that blocks expression of the
Transcription initiation is the critical first step in deter- lac operon in the absence of lactose (Fig. 10.11). The lac
mining that each gene is expressed at the appropriate repressor binds to a site called an operator that overlaps
level in each cell. Depending mainly on the sequence of the RNA polymerase binding site in the lac promoter.
the promoter and other regulatory sequences, expres- Lactose binding changes the conformation of the repres-
sion can be constitutive or influenced by regulatory sor, so it dissociates from DNA, allowing RNA polymerase
proteins. This section discusses proteins that regulate to bind the promoter.
transcription of specific genes either positively or Full expression of the lac operon requires the catabo-
negatively. The discussion starts with a prokaryotic lite activator protein (CAP), another allosteric protein
example and then covers a variety of eukaryotic that binds DNA just upstream of the lac promoter. CAP
regulators. Although the details differ in prokaryotes is activated by a conformational change induced when
A. Lac regulation physiology B. Lac regulation

mechanics
Glucose
Lactose
CAP Lac
(inactive) repressor
(inactive)
Bacterial
polymerase
cAMP Lactose
High level of inducer
CAP 35 10 Lac Z
transcription site
Lac
repressor
(active)
Active CAP
Low level of attracts
transcription polymerase
Lac repressor Repressor binding

zone half-sites
CAP-binding zone
Transcription
5' CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT
3' GTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGA
No transcription -35 -10 +1
Lac Lac operator
operator
Polymerase-binding zone
FIGURE 10.11 REGULATION OF THE LACTOSE (LAC) OPERON. A, RNA polymerase (green) binding to the lac promoter is regulated by
the binding of repressor or activator (catabolite activator protein [CAP]). B, Binding sites for CAP and the repressor at the lac operon. The main
repressor-binding site overlaps the promoter and blocks access of RNA polymerase. Additional lac repressor-binding sites are located upstream
and downstream of the promoter. Lac repressor can form a tetramer and thus bind two operators, forming a loop in the lac operon DNA. Inducer
(eg, lactose) binding dramatically alters the conformation of the lac repressor diminishing its affinity for the operator. CAP binds just upstream of
the promoter where it can stabilize the bound RNA polymerase.
it binds cyclic adenosine monophosphate (cAMP), which Gene-specific

the cell produces when the intracellular glucose concen- transcription
factors Enhancer
tration is low. Active CAP bound to its site stabilizes the
otherwise weak interaction of RNA polymerase with the
promoter. The resulting activation allows maximum Coregulators:
Mediator, ATP-dependent
expression of the lac operon in the presence of lactose Promotor nucleosome remodelers,
and the absence of glucose. proximal histone modifiers and
elements negative cofactors
Control of lac gene expression by opposing repres-
sors and activators is an example of regulation at
Mediator
the first step in transcription initiation, binding of
TAFs
RNA polymerase to the promoter. Regulating access
TBP +1
of RNA polymerase to promoters is a common form TF IID
of transcription regulation in both prokaryotes and Pol II
eukaryotes.
FIGURE 10.12 NETWORK OF INTERACTIONS THAT REGU-
Overview of Eukaryotic Gene-Specific Transcription LATE RNA POLYMERASE II. Input comes from transcription factors
bound to promoter proximal elements and enhancers and from
While recruitment of RNA polymerase to the promoter coregulators that modify chromatin.
remains a key step in eukaryotic transcription regulation,
there are additional layers of complexity. First, DNA is
bound by histones and packaged in nucleosomes (see can activate transcription. In many cases these gene-
Fig. 8.1) that can block binding of TFs and RNA poly- specific TFs do not act directly on polymerase but require
merase. Overcoming this generalized repressive effect coregulators that act as a bridge between gene-specific
requires activators that alter chromatin structure allow- factors, the chromatin template and RNA polymerase
ing the recruitment of RNA polymerase. with its associated GTFs (Fig. 10.12).
Another major difference is that eukaryotic TFs bound The following sections explain how detailed mecha-
tens to hundreds of kilobases away from the promoter nistic studies of a small set of model genes provided
A B Transcription factor binding sites
Number of sequence reads

Nucleosome locations
C
Nucleosome-
Nucleosome-
free region
free region
Histone modifications
D
FIGURE 10.13 CHROMATIN IMMUNOPRECIPITATION COUPLED WITH HIGH-THROUGHPUT SEQUENCING (CHIP-SEQ) MAPS
PROTEIN BINDING SITES AND HISTONE MODIFICATIONS. A, Experimental protocol. B, Frequency of DNA reads of DNA associated with
three transcription factors associated with the UCHL5 gene. C, Frequency of DNA reads of DNA associated nucleosomes along two budding
yeast genes. Nucleosomes are spaced regularly along the DEP1 gene but not along the CYS3 gene. D, Histone modifications along an active
and an inactive gene. The thickness of the bar represents the frequency of each modification. (B, From Farnham P. Insights from genomic profiling
of transcription factors. Nat Rev Gen. 2009;10:605616. C, From Barth TK, Imhof A. Fast signals and slow marks: the dynamics of histone
modifications. Trends Biochem Sci. 2010;35:618626. D, Based on data from Jiang C, Pugh F. Nucleosome positioning and gene regulation:
advances through genomics. Nat Rev Gen. 2010;10:161172.)
the concepts for our current understanding of how on DNA and the modifications of these components.
thousands of different proteins combine to regulate This comprehensive view of the distributions of
tens of thousands of different promoters. Genome- transcription components has yielded novel insights
wide studies have refined our understanding of how about the locations of regulatory sequences and the
these regulatory mechanisms function in more global presence of different combinations of histone modifica-
gene regulatory networks. Before addressing specific tions. This information will undoubtedly guide future
mechanisms, we consider techniques for mapping experiments where the regulatory mechanisms are not
regulatory proteins to specific sites in the eukaryotic yet clear.
genome.
Mapping Transcription Components on the Genome Chromatin and Transcription

One of the key advances in transcription research DNA in eukaryotic cells associates with an equal mass of
has been to map transcription regulators and transcripts protein to form chromatin (see Chapter 8). Packaging
on a genome-wide basis. Fig. 10.13 describes one of DNA in arrays of nucleosomes compacts the DNA and
these approaches: chromatin immunoprecipitation restricts access of transcription proteins to the DNA
coupled with high-throughput sequencing (ChIP-seq). template. Understanding how the transcription machin-
This approach yields a genome-wide snapshot of ery interacts with nucleosomes is a key to understanding
the positions of RNA polymerase, TFs, and histones eukaryotic transcription regulation.
Gene activation often involves disruption or displace- ases, while histone deacetylases are part of corepressor
ment of nucleosomes located on specific regulatory complexes.
regions. Before the discussion of specific mechanisms, it The hundreds of chromatin regulatory complexes in
is useful to consider some aspects of nucleosome struc- cells give rise to different chromatin states defined both
ture. The nucleosome consists of DNA wrapped in a by their pattern of histone modification and by
left-handed helix around an octamer of histone subunits their transcription (Fig. 10.13). Silent chromatin is not
(see Fig. 8.1). The histone core makes numerous contacts transcribed and has nucleosomes with H3K9me3 or
with the DNA minor groove and phosphate backbone, H3K27me3 modifications spanning multiple genes in
leading to tight but relatively nonspecific binding. This heterochromatin (see Chapter 8). Active chromatin
aspect of the nucleosome allows for a dynamic associa- often contains nucleosomes with H3K4ac or H3K4me,
tion with DNA, because binding of the histone core to H4K8ac modifications, often in promoterproximal
DNA is nearly as energetically favorable for all sequences. nucleosomes (Fig. 10.13). In stem cells (see Box 41.2),
However, nucleosomes are not positioned uniformly many promoterproximal regions contain both activat-
along the DNA. First, some AT-rich sequences do not ing and repressing marks, so the genes are thought to be
bend in a manner that can form a stable nucleosome. poised to be either activated or repressed as downstream
Such sequences are often found in promoter regions. signals dictate.
Second, nucleosomes are less stable if the histones are Most chromatin regulators are parts of larger com-
modified, for example by acetylation or the inclusion of plexes containing protein modules that recognize
variant histone proteins. The presence of unstable histone modifications such as bromodomains that
nucleosomes enables the transcription machinery to interact with acetylated tails or chromodomains that
access key regulatory sequences. bind methylated tails. For example, the SAGA histone
Nucleosome remodeling complexes can either acetyltransferase complex contains a bromodomain that
expose or shield regulatory elements by altering the anchors the complex to chromatin, facilitating further
location of nucleosomes on the DNA template. These modification of regions that are already acetylated. A
multiprotein remodeling complexes use energy from subunit of TFIID also contains a bromodomain that can
ATP hydrolysis to destabilize interactions between his- facilitate the binding of TFIID to acetylated nucleosomes
tones and DNA thus altering the position of the nucleo- associated with active chromatin. Similarly, a number of
some and remodeling the chromatin. One example is histone methyltransferases contain chromodomains and
the SWI/SNF (yeast mating type switching defective/ are therefore targeted to their substrates by preexisting
sucrose nonfermenting) complex that is recruited to a histone methylation.
specific subset of genes through interactions with tran- The following sections describe examples of how
scription activators. The resulting remodeling of nucleo- TFs, chromatin regulators, and the general transcription
somes in the vicinity of promoters may be required to machinery interact to regulate eukaryotic genes.
form a stable preinitiation complex. Genomic mapping
of histones (Fig. 10.13) shows that most Pol II promoters Gene-Specific Eukaryotic Transcription Factors
are free of nucleosomes. Eukaryotic TFs bind specific DNA sequences associated
with the genes they regulate. This binding leads to activa-
Histone Modifications and Gene Expression tion or repression of transcription in a spatially and
Specific enzymes modify the histone tails with diverse temporally controlled manner. In the simplest cases,
chemical groups, often on lysine residues. Gene regula- the TF interacts directly with RNA Pol II and the GTFs
tory proteins recruit the modifying enzymes to chromatin but in more complex cases, the interaction may involve
generally as part of larger complexes (Table 10.2). Acti- a coactivator or corepressor (see the following section).
vator proteins generally recruit histone acetyltransfer- Current estimates indicate that approximately 6% of
TABLE 10.2 Nucleosome-Modifying Complexes

Name Subunits Catalytic Activity Histone-Interacting Domain Target Histone(s)
SAGA 15 Histone acetylase Bromodomain H3, H2B
NuA4 6 Histone acetylase Chromodomain H4
P300 1 Histone acetylase Bromodomain H2A, H2B, H3, H4
NuRD 9 Histone deacetylase Chromodomain ?
SIR2 3 Histone deacetylase Neither H4
MLL 7 Histone methylase Neither H3 (lysine 4)
the coding capacity of the human genome (more than DNA recognition domains of specific TFs typically
1000 genes) is devoted to TFs that recognize specific interact with only 3 to 6 bp of DNA. Given the size and
DNA sequences. The following sections discuss the complexity of the typical mammalian genome, a
functional organization of these proteins, how they sequence must be approximately 16 bp long to occur by
recognize DNA and how they interact with chromatin chance only once. How then can TFs recognize specific
and the GTFs. genes among the vast number of close but nonidentical
sequences? Two strategies increase the length of the
DNA-Binding Domains specific sequence to be recognized. The protein can
Binding proteins to specific DNA sequences requires either use several recognition elements or dimerize with
recognition of a pattern of bases along the double helix. itself or other DNA-binding proteins. Protein dimers can
The richest source of DNA sequence specificity comes recognize sequences with twofold rotational symmetry.
from the chemical groups exposed in the major groove. DNA-binding proteins can be grouped into families
Most specific DNA-binding proteins probe the major based on the structure of the domains used for DNA
groove of the double helix with a small structural element sequence recognition (Fig. 10.14). These include the
(usually, an -helix) with a shape complementary to the helix-turn-helix (HTH) proteins, homeodomains,
surface topography of a particular DNA sequence. The zinc finger proteins, steroid receptors, leucine
correct DNA sequence is recognized through multiple zipper proteins, and helix-loop-helix proteins.
interactions between amino acid side chains in the rec- Although these families include most known TFs, there
ognition helix and the chemical groups on the DNA remain other, less-common recognition domains. Within
bases in the major groove. Single amino acid changes in a given family, the recognition domain of each TF has an
the recognition helix can change the DNA sequence that amino acid sequence that targets the protein to a particu-
is recognized. Protein-DNA complexes are stabilized by lar DNA sequence. Conversely, different families of TFs
additional contacts between amino acid side chains and can recognize the same regulatory sequence. The follow-
deoxyribose rings and phosphate groups or by bending ing sections discuss several of the more common eukary-
the DNA. otic DNA-binding domains.
A. Homeodomain B. Zinc fingers C. Glucocorticoid receptor
NNTAATGGNN NAGAACANNNTGTTCTN
NNATTACCNN NTCTTGTNNNACAAGAN
NNGCGTGGGCGNN
NNCGCACCCGCNN
D. Basic region zipper E. Factor 1 F. Factor 2 G. Factor 1/2

homodimer homodimer heterodimer
NNTGAGTCANN
N NA C T CAG T N N
FIGURE 10.14 MOLECULAR STRUCTURES OF TRANSCRIPTION FACTOR DNA-BINDING DOMAINS. Recognition of specific DNA
sequences requires interactions between amino acid side chains in the protein and chemical groups on the DNA bases. In each of the examples
shown here, an -helix interacts with specific bases through contacts in the major groove. A, The homeodomain -helix recognizes a specific
6-bp sequence. B, A protein with three zinc fingers recognizes three consecutive 3-bp sequences. C, The glucocorticoid receptor forms a dimer
that recognizes the same 6-bp sequence (a hormone response element) in opposite orientations spaced 3 bp apart. D, A leucine zipper factor
dimerizes to recognize a pair of 4-bp sites with opposite orientation spaced 1 bp apart.
Homeodomain
This motif of 60 amino acids was discovered in Dro- A Activation
sophila proteins that regulate development and is found DNA binding
in many eukaryotic TFs, including more than 150 human
Transcription activation +
genes. Recognition is provided by an HTH motif com- DNA binding + +
posed of two helices, one of which sits in the major
groove of the DNA-binding site contacting a recognition
sequence of 6 bp (Fig. 10.14A). The HTH structure is B Transcription
not a stable domain on its own, but functions as part Factor 1 machinery
of a larger DNA-binding domain, such as the homeodo-
Gene 1
main. A flexible arm interacting with the minor groove
provides the homeodomain with additional binding
affinity.
Factor 2
Zinc Finger Proteins
The zinc finger protein sequence motif (Fig. 10.14B) is Gene 2
found in more than 600 human TFs. Each finger con-
sists of 30 residues with conserved pairs of cysteines and
histidines that bind a single zinc ion. The tip of the finger Swapped
sticks into the DNA major groove, where it contacts domains
three bases. Most zinc finger proteins contain multiple Gene 2
fingers, allowing longer sequences to be recognized to
increase specificity. A related structure is present in the
FIGURE 10.15 TRANSCRIPTION FACTORS CONSIST OF
steroid hormone receptor family, although in this case, DISCRETE, FUNCTIONAL MODULES. A, Domain characterization.
four cysteine residues coordinate the zinc ion and the Although the entire factor is required for activation, the bottom domain
finger is composed of two helices rather than one. is sufficient for DNA binding. B, Domain swapping. The activation
Steroid hormone receptors also contain a dimerization domain of one factor (activating gene 1) can be fused to the DNA-
binding domain of a heterologous factor (activating gene 2). The
domain, allowing recognition of sequences with dyad
resulting chimeric factor will activate only genes containing the recogni-
symmetry (Fig. 10.14C). Artificial zinc fingers can now tion site for the DNA-binding domain (gene 2).
be designed enabling synthetic proteins to recognize any
desired DNA sequence for experimental manipulations.
Acidic activation domains are generally unstructured
Leucine Zipper Proteins segments of polypeptide consisting of multiple acidic
Leucine zipper domains are made up of two motifs: a residues dispersed among a few key hydrophobic resi-
basic region that recognizes a specific DNA sequence dues. Such domains activate transcription when experi-
and a series of leucines spaced 7 residues apart along an mentally grafted to a wide variety of different DNA-binding
-helix (leucine zipper) that mediate dimerization. These domains in a number of different cell types. Other types
motifs form a continuous -helix that can dimerize of activator domains have been characterized as being
through formation of a coiled-coil structure involving rich in proline or glutamine.
paired contacts between hydrophobic leucine zipper The diverse activation domains use several mecha-
domains (Fig. 10.14D; also see Fig. 3.10). Dimers of nisms to activate transcription, the most direct being
leucine zipper proteins recognize short, inverted, repeat recruitment of the basal transcription machinery. For
sequences. The zipper family comprises many members, example, the glutamine-rich activation domain of the SP1
some of which can cross-dimerize and recognize asym- factor (see the next section) interacts with TFIID to
metrical sequences. Another family of factors comprises recruit GTFs to the promoter. In many cases transcrip-
the helix-loop-helix proteins, which have the same type tion activators and repressors do not contact the GTFs or
of basic region but differ in that they have two helical Pol II directly but rather act via interactions with coregu-
dimerization domains separated by a loop region. lator complexes as discussed in a following section.
Transcription Factors as Modular Proteins Transcription Factor Binding to Eukaryotic Promoter

Binding of a TF to DNA per se does not activate transcrip- Proximal and Enhancer Elements
tion. A separate domain provides this function by inter- Experiments analyzing eukaryotic promoter function in
acting directly or indirectly with the basal transcription living cells revealed numerous DNA regulatory sequence
machinery to elevate the rate of transcription (Fig. elements in addition to the basal promoter elements
10.15). The best-characterized activation domain is an recognized by the GTFs. The regulatory sequence
acidic region derived from the herpesvirus VP16 protein. elements fall into two broad categories based on their
A Up to 10 kb Up to +10 kb
A E TATA Exon 1 E Exon 2 E
Expression
CAT
5' 3'
Pre-mRNA
Cohesin
B. Enhanceosome
Enhancer DNA
CAT reporter
gene
+1 Coactivator +1
Promoter
Expression
????? ????? ???? +1 of CAT? TA
+ Enhanceosome TA
complex Exon 1
XXXXX +
XXXXX
XXXXX + FIGURE 10.17 ENHANCER ELEMENTS. A, These clusters of
factor-binding sites can influence expression when located far from the
XXXXX
promoter in either the upstream or downstream position. In addition,
XXXXX +
they work in either orientation with respect to transcription. B, Model
XXXXX enhancer showing the tight packing of several different DNA-binding
XXXXX + proteins. These complexes fold into structures that have been called
CCAAT GCGCG TATA CAT gene
enhanceosomes.
Identified sequence elements
XXX = mutations
required for full transcription. Thymidine kinase expres-
B. Promoter proximal elements of the sion also requires the sequence GGCGCC, which was
human metallothionein gene subsequently shown to serve as the binding site for SP1,
GRE AP2 AP2 MRE MRE AP2 AP1 MRE SP1 TATA a TF involved in expression of a number of so-called
housekeeping genes, whose products are involved in
-300 -250 -200 -150 -100 -50 0
constitutive cellular functions. Other promoter proximal
FIGURE 10.16 RNA POLYMERASE II PROMOTER REGULA- elements are involved in regulated expression, for
TORY ELEMENTS. A, In vivo assays are used to identify key regula- example, in response to cellular stress or exposure to
tory sequences. In the example shown, a promoter is placed in front
of a gene encoding chloramphenicol acetyltransferase (CAT), and the
heavy metals. Most promoters are paired with several
resulting plasmid is transfected into cultured cells. This bacterial different promoter proximal elements. This allows for
enzyme is easily assayed in eukaryotic cells because there is no regulation of transcription levels by varying the relative
corresponding endogenous activity. Targeted clusters of mutations, abundance or activity of the various factors. A good
strategically placed throughout the promoter region, are tested for their example is the human metallothionein gene, whose
effect on expression of the reporter gene. Mutations that reduce
expression define important regulatory elements. B, The region imme-
product protects cells from the toxic effects of metals
diately upstream of the metallothionein gene contains binding sites (Fig. 10.16B). The location of numerous regulatory ele-
for several transcription factors. Each element is named for the factor ments directly upstream of the TATA box suggests that
that binds there: GRE (glucocorticoid response element), MRE (metal a variety of different mechanisms regulate this gene.
response element), and AP1, AP2, and SP1 (which bind protein factors Enhancers are clusters of regulatory DNA sequences
with the same names as the DNA elements).
that resemble promoter proximal elements, but are con-
siderably more complicated and have several distinguish-
distances from the promoter. Promoter proximal ele- ing features. First, an enhancer can increase the rate of
ments are located within a few hundred base pairs initiation from a basal promoter even if it is located up
upstream of the transcription start site. Enhancer to 100 kb away along the chromosome. Second, the
sequences can be located from tens to hundreds of enhancer element will work in either orientation relative
kilobases from the start of transcription. to the promoter (Fig. 10.17A). Third, enhancers can func-
One example of a promoter proximal element is the tion with a heterologous promoter. Figure 10.17B shows
CCAAT box in the promoter of the herpes simplex virus an example of an enhancer sequence with a number of
thymidine kinase gene. This site was identified by a TFs bound, forming a complex called an enhanceosome.
technique called linker-scanning, in which clustered Many genes are associated with multiple enhancers. Each
mutations are introduced at regular intervals in the enhancer usually works in a cell typespecific fashion.
promoter (Fig. 10.16A). In the case of the thymidine An example is a sequence in an intron of the immuno-
kinase promoter, the CCAAT and TATAAA sequences are globulin heavy-chain gene that enhances transcription
in lymphocytes but not in other cells. This regulation of binds cAMP response elements. Many different TFs
enhancer function is accomplished by varying the levels recruit p300 to chromatin to locations generally assumed
of various enhancer-binding TFs in different tissues. In to be enhancers. Histone H3K27 is one of the main
addition, enhancer chromatin structure is characterized targets of p300. This same H3 residue is the target of the
by a nucleosome free region that allows TFs to bind, polycomb repressive complexes (see Chapter 8), sug-
flanked by nucleosomes bearing histone H3K27ac and gesting that p300 plays a role in switching between
H4K3me1 modifications. The following sections discuss active and repressed chromatin states.
how enhancers interact with TFs and coregulators to A third class of chromatin coactivators regulates
increase transcription from promoters. access to DNA by moving, ejecting, or altering the com-
position of nucleosomes. The SWI/SNF complex is an
Coactivators example of a nucleosome remodeler. When recruited to
Coactivators are complexes of regulatory proteins that chromatin by TFs, this complex moves nucleosomes that
do not bind DNA themselves but are recruited by gene- block regulatory or promoter sequences. Coactivators
specific TFs. These complexes contain proteins that often work together to activate genes. Initial binding of
recruit the GTFs, alter chromatin structure and assist in a TF may recruit a chromatin remodeler that exposes a
the early stages of transcription. The most common second TF binding site. This second TF may then recruit
coactivator is the Mediator, a complex of 26 proteins in mediator, thereby recruiting Pol II and the GTFs.
human cells that bridges DNA-bound TFs to Pol II (Fig. Corepressors act in opposition to coactivators by
10.18A). Different Mediator subunits bind particular TFs repressing transcription. The most common form of
and communicate regulatory signals to the initiation repression involves chromatin modifications that block
complex. One example: an interaction of Mediator with TF access (Fig. 10.18C). Histone deacetylase complexes
the Pol II CTD helps stabilize the preinitiation complex. like Sir2 and NuRD (Table 10.2) remove acetyl modifica-
Mediator also stimulates the CTD kinase activity of TFIIH tions leading to chromatin compaction and repression of
thus releasing the CTD from the Mediator (Fig. 10.18A) transcription. Polycomb is another pair of corepressor
Another class of coactivators has histone acetyltrans- complexes that methylates H3K27 leading to inhibi-
ferase activity that modifies histones and other proteins tion of RNA polymerase elongation. Polycomb repres-
(Fig. 10.18B). One example is p300/CBP. This was ini- sive complexes play critical roles in early embryonic
tially identified as a protein interacting with a TF that development.
A B. Histone acetylation activates transcription

General transcription
Mediator factors bind mediator
Transcription
factor
Template DNA TAFs Initiation
TBP
TPIID Coactivator +1
CTD
AC AC AC AC
Pol II Pol II binds AC AC AC AC AC
Unphosphorylated AC
CTD binds mediator
Template DNA
+1
TPIID
Pol II
C. Histone deacetylation represses transcription
Preinitiation complex Transcription factor
TFIIH phosphorylates the CTD Corepressor
allowing Pol II to escape promoter
P P
P P P
TAFs P
Template DNA
TBP
TPIID
AC AC
AC AC AC AC
AC AC
RNA
FIGURE 10.18 TRANSCRIPTION ACTIVATION MECHANISMS. A, General transcription factors and mediator form a scaffold for binding
RNA polymerase II with unphosphorylated C-terminal domain (CTD) to form a preinitiation complex. Phosphorylation of CTD by TFIIH releases
polymerase and starts transcription. B, Histone acetylases in a coactivator loosen chromatin in the vicinity of the promoter, allowing assembly of
preinitiation complexes. C, Recruitment of histone deacetylases in a corepressor represses transcription by compacting the chromatin in the
vicinity of the promoter.
SP
S P SY C-terminal
S Y SP T
domain SP
S P SY
P S Y SP T
SP Preinitiation
S P SY
S Y SP T
Termination
mRNA
P P P Mediator
PP
P SY SP
SP SP T S
S P SY SY
S Y SP T PolyA tail
P
SP
S P SY
S Y SP T
Capping enzyme Initiation
Cap Mediator
disssociation
Elongation
FIGURE 10.19 PHOSPHORYLATION OF THE C-TERMINAL DOMAIN OF RNA POLYMERASE II REGULATES TRANSCRIPTION.
This cycle illustrates how phosphorylation influences each step in mRNA transcription. See the text for details.
Long-Range Regulatory Interactions are phosphorylated at different stages of the transcrip-

Most genes are regulated by enhancers located many tion cycle (Fig. 10.19). TFIIH kinase CDK7 phosphory-
thousands of bases away from their promoter, so some lates serine 5 (Ser5) in the preinitiation complex. This
means of communication between enhancer and pro- releases the Mediator from Pol II and creates a binding
moter is required for gene activation. This is most com- site for the capping enzyme that modifies the 5 end of
monly achieved through direct interaction when the the message (see Fig. 11.2). At most promoters, inhibi-
chromatin fiber forms a loop bringing the enhancer and tory factors pause the early Pol II elongation complex
promoter into close contact. Such interactions between after synthesizing approximately 30 nucleotides. Phos-
enhancers and promoters involve the cohesin complex phorylation of CTD Ser2 by Cdk9 releases the paused
discovered because it regulates separation of sister chro- polymerase and allows elongation to proceed. Signaling
matids during cell division (see Fig. 8.18). The cohesin pathways regulate this process at many genes. Ser2
complex forms a ring around two DNA strands thus phosphorylation also helps recruit the RNA splicing
stabilizing the loop (Fig. 10.17). ChIP-seq screening for machinery to the nascent transcript. At the 3 end of the
cohesin and high levels of Mediator has identified several gene, Ser2 phosphorylation recruits the cleavage and
hundred intergenic regions containing multiple enhanc- polyadenylation machinery leading to formation of the
ers clustered together. These super enhancers direct mature mRNA and termination of elongation.
transcription of genes that specify cell fate and when
associated with oncogenes lead to tumor pathogenesis. Combinatorial Control
The complexity of eukaryotic regulatory systems allows
Post Initiation Regulation of Polymerase for the integration of multiple regulatory signals at indi-
II Transcription vidual genes. Such combinatorial control is seen in a
After formation of a transcription preinitiation complex limited way in prokaryotes. For example, the E. coli lac
several steps lead to promoter clearance, elongation and genes are regulated by both lactose and glucose. Only
termination. The CTD of Pol II not only orchestrates when glucose is low and lactose is present do the activa-
promoter proximal events but is also important for tor (CAP) and repressor (lac repressor) function to maxi-
coupling transcription to splicing of the nascent tran- mize lac expression.
script and to 3-end formation (see Chapter 11). The CTD Regulation of transcription initiation in eukaryotes
(Fig. 10.4C) is comprised of tandem repeats of the repeat is based on similar principles with DNA-binding activa-
of seven amino acids (Y1S2P3T4S5P6S7). The three serines tors and repressors controlling individual genes. Each
eukaryotic gene typically has binding sites for multiple

factors. Integration of the individual binding events can A. De novo synthesis D. Heterodimer formation
take place in several ways. First, there is a degree of Activation
subunit
synergism to the binding of multiple factors. The enhan-
ceosome is an example where binding of proteins that
bend the DNA promotes binding of additional proteins.
DNA-binding
The key characteristic of the enhanceosome complex is subunit
that it stimulates transcription more strongly than the
sum of the individual TFs. Synergy can also result from B. Ligand binding E. Dimer dissociation
multiple interactions between activators bound to DNA
Ligand Inhibitor
at different upstream sites or different enhancers
and targets in coactivators such as the mediator or
nucleosome remodeling complexes. Many of the same
mechanisms also can occur with repressors.
Combinatorial control also can result from the inter-
play between factors that alter chromatin structure. For
example, modification of histone tails by a histone acet- C. Phosphorylation F. Subcellular localization
yltransferase tethered to a DNA-bound TF can loosen Inhibitor
chromatin at a particular site and create binding sites for
additional factors. Subsequent binding of a nucleosome-
remodeling complex can render sequences more acces-
sible to the transcriptional machinery. NUCLEUS
FIGURE 10.20 REGULATION OF TRANSCRIPTION FACTOR

Modulation of Transcription Factor Activity
ACTIVITY. Many strategies have evolved to regulate transcription
Regulation of transcription initiation is fundamentally factors in response to specific signals. A, The availability of a factor
important in controlling gene expression. In many cases, may be controlled by expressing it, de novo, only when it is needed.
the availability of factors that bind to specific sites in B, Factors may be synthesized in an inactive state and depend on a
small molecule (ligand) for activity. C, Transcription factors that are
promoters is the switch that turns a gene on. Various
synthesized in an inactive state can be activated by postsynthetic
strategies control the binding of specific factors to DNA modification, such as phosphorylation. D, Some factors require an
regulatory elements (Fig. 10.20). One of the most appropriate partner for activity. E, Constitutively active factors can be
straightforward is de novo synthesis of the specific factor held in check by associating with inhibitory subunits. F, Active factors
(Fig. 10.20A). This requires an additional level of regula- can be sequestered in the cytoplasm by blocking their transport to the
nucleus.
tion of transcription and translation of the mRNA that
encodes the specific factor. These steps take time, so this
regulatory strategy is used more commonly to regulate (see the examples that follow) employ several different
developmental pathways than situations where rapid levels of regulation.
responses are required.
Several mechanisms are used for rapid regulation of Transcription Factors and
the activity of existing TFs. One mechanism involves the
Signal Transduction
formation of an active factor from two inactive subunits
(Fig. 10.20D). This association can be regulated through One hallmark of eukaryotic gene regulation is the ability
synthesis or by modification of preexisting subunits, of cells to respond to a wide range of external signals.
leading to their association. Binding of small-molecule Cells detect the presence of hormones, growth factors,
ligands is another means of controlling TF activity (Fig. cytokines, cell surface contacts, and many other signals.
10.20B). In this case, the binding of the ligand induces They transmit this information to the nucleus, where
a conformational change that leads to DNA binding changes in expression of specific genes are executed
and transcription activation. Interaction of TFs with (see Fig. 27.4 for the three types of signaling pathways
inhibitory subunits is also used to regulate factor activity to the nucleus). TFs often execute the final step in these
(Fig. 10.20E). The DNA binding or activation potential signal transduction pathways; the following sections
is held in check until the appropriate signal leads to discuss several examples not covered in Chapter 27.
dissociation or destruction of the inhibitory factor. Cova-
lent modificationfor example, by phosphorylationis Steroid Hormone Receptors
also used to convert inactive TFs to a functional form Regulation of gene expression by steroid hormone
(Fig. 10.20C). Finally, the ability of TFs to bind DNA receptors involves both ligand-binding and inhibitory
may be regulated by restricting their localization to the subunits. This family of nuclear receptors includes TFs
cytoplasm (Fig. 10.20F). These regulatory schemes are with a common sequence organization consisting of a
not mutually exclusive, and many regulatory pathways specific DNA-binding domain, a ligand-binding domain
A Steroid B C
7-helix
receptor Receptor
Adenylcyclase
Activated Adaptor
Nuclear G-protein proteins
hormone
receptor
Hsp90 cAMP
Steroid
Kinases
R
R IB
R complex
C C
IB
Active R Inactive
C protein C protein IB
kinase A kinase A NF-B degraded by
CYTOPLASM proteasome
NUCLEUS
CBP
CREB
Polymerase
FIGURE 10.21 TRANSCRIPTION FACTORS AS TARGETS OF SIGNAL TRANSDUCTION PATHWAYS. External signals are transmitted
by a variety of pathways that eventually impinge on transcription factors. A, Steroid hormones diffuse through the cell membrane and bind to the
hormone receptor in the cytoplasm (estrogen) or, more commonly, the nucleus. Hormone binding induces a conformational change that renders
the receptor competent to activate transcription. B, Ligands bound to the extracellular surface of seven-helix receptors initiate a pathway that
leads to the activation of protein kinase A, which then moves to the nucleus, where it phosphorylates transcription factor CREB (cyclic adenosine
monophosphate [cAMP] response elementbinding). (C, catalytic subunit of protein kinase A [PKA]; R, regulatory subunit of PKA that is dissociated
from C by binding cAMP [R is shown smaller than actual size].) C, In a third strategy, constitutively active transcription factors are kept sequestered
in the cytoplasm until a signaling pathway is activated. In this example, the transcription factor nuclear factor B (NF-B) is bound to an inhibitor
called IB (inhibitor of nuclear factor B). Activation of the pathway leads to phosphorylation of IB, which targets the inhibitory subunit for
destruction by the proteasome. The free NF-B is transported to the nucleus, where it activates the transcription of target genes.
that regulates DNA binding, and one or more transcrip- receptor ligand-binding domain in a conformation ready to
tion activation domains. The ligands that regulate these bind the ligand but unable to enter the nucleus. Hormone
factors are small, lipid-soluble hormone molecules that binding to the receptor dissociates Hsp90 and frees the
diffuse through cell membranes and bind directly to the receptors DNA-binding domain. The free ligandbound
TF in the cytoplasm (Fig. 10.21A). Steroid hormones, receptor moves from the cytoplasm to the nucleus, where
retinoids, thyroid hormone, and vitamin D bind to dis- it binds its DNA target and activates transcription.
tinct nuclear receptors, enabling them to recognize
sequences in the promoters of a range of target genes. Cyclic Adenosine Monophosphate Signaling
The specific sites of action in promoter DNA, termed Changes in gene expression often develop in response
hormone response elements, are related to either to the binding of signal molecules to cell surface recep-
AGAACA or AGGTCA (Fig. 10.14C). Specificity of the tors. Binding of ligand induces a structural change in the
response is generated by the spacing and relative ori- receptor that sets off a chain of events leading to changes
entation of the binding sites. Nuclear receptors can in transcription. Protein phosphorylation plays an impor-
bind as homodimers, although some form heterodimers. tant role in this process.
In addition to heterodimerizing with other members of The adenyl cyclase system controls not only metabo-
the nuclear receptor family, interactions with other lism (see Fig. 27.3) but also gene expression (Fig.
types of TFs can link the steroid response to other path- 10.21B). Ligand binding to some seven-helix receptors
ways that signal through cell surface receptors. leads to cAMP synthesis, which, in turn, activates
Heat shock protein 90 (Hsp90) blocks inactive steroid protein kinase A (see Fig. 27.3). The promoters of
hormone receptors from interacting with DNA (Fig. cAMP-regulated genes contain a conserved DNA
10.21A and see Fig. 17.13). This chaperone keeps the sequence element, called a cAMP response element,
that mediates the transcriptional response to cAMP. A A. Cascade

TF, termed cAMP response elementbinding (CREB) External
protein, binds this sequence specifically. CREB protein signal
is a leucine zipper TF that binds DNA as a dimer. The DNA
DNA-binding domain of CREB protein can be exchanged
mRNAs
with other DNA-binding domains without loss of cAMP
responsiveness. This indicates that cAMP does not work Proteins
by altering CREB binding to DNA. Rather cAMP alters the
transcription activation function by stimulating protein
kinase A to phosphorylate a specific residue (serine 133) B. Autoregulatory inhibition
in CREB. Phosphorylation changes the conformation of External
CREB and allows interaction with a protein adaptor that signal
recruits the transcription machinery leading to transcrip-
tion of target genes.
Nuclear Factor B Signaling

The family of NF-B TFs controls immune and inflamma-
tory responses, development, cell growth, and apoptosis. C. Combinatorial activation
The activity of NF-B is normally tightly controlled and External Second external
persistently active NF-B is associated with cancer, signal signal
arthritis, asthma, and heart disease. In most cells, NF-B
is held in an inactive form in the cytoplasm through
interaction with an inhibitor called inhibitor of nuclear
factor B (IB) (see Figs. 9.19 and 10.21C). When B
lymphocytes (see Fig. 28.9) are stimulated to produce
antibody, NF-B binds to an enhancer in the immuno- FIGURE 10.22 GENE REGULATORY CIRCUITS. The complex
globulin -chain gene and activates transcription. The patterns of gene expression observed in multicellular organisms arise
stimulatory signal leading to NF-B activity is transmitted from interactions among thousands of transcription activators and
through a protein kinase cascade that ultimately phos- repressors, as illustrated by three examples. A, Transcription factors
activate the expression of other factors leading to a cascade of
phorylates I-B, signaling its destruction by proteolysis.
changes in gene expression following the initial external signal.
I-B destruction unmasks the NF-B nuclear localization B, Some transcription factors can act as both activators or repressors.
signal, leading to its transport to the nucleus, where it In this example, the external signal leads to expression of a transcrip-
activates transcription of immunoglobulin genes. tion factor that goes on to activate the expression of other genes and
repress its own expression. C, Multiple transcription factors regulate
Transcription Factors in Development most genes, so activation requires more than one external signaltwo
in this example.
The previous discussion focused on how external signals
can lead to changes in gene expression in the nucleus,
which, in turn, changes cellular functions. A critical step TFs to activate their own expression. This positive feed-
in this genetic program is the regulation of one TF by back creates a switch that leads to continued expression
another. Such cascades of TF activity are fundamental to after the initial stimulus is gone. Other developmentally
gene regulation in development. regulated TFs are, in turn, regulated by several different
Early cell divisions in multicellular organisms create factors. This allows combinatorial signals to dictate
different types of daughter cells that express distinct expression (Fig. 10.22C). For example, some TFs activate
sets of genes. In this case, two types of information certain promoters while repressing others. The basis of
govern the expression of a gene. First, the interaction this contradictory property is thought to be the ability
of the cell with its environment sends signals that are of TFs to cooperate with each other when bound at the
transduced to the nucleus and change the pattern of same promoter. This cooperation can be either positive
gene expression. How the nucleus interprets the trans- or negative. This allows the expression of a target gene
duced signals depends on the set of TFs that preexist to be regulated both by external signals (eg, proximity
within it. Thus, in addition to external signals, the of an adjacent cell that expresses a signaling molecule)
history of the cell dictates which genes will respond to and by the preexistence of a given factor in the cell. In
incoming signals. this way, only cells of a given lineage that are located in
The programs of TF interaction during development a certain area of an embryonic segment express the
are complicated, but the underlying principles of these gene. As new TFs involved in development are discov-
pathways are well conserved. Many developmentally ered, the challenge will be to decipher the complicated
regulated TFs are autoregulated (Fig. 10.22), allowing combinatorial interactions among them.
SELECTED READINGS Ong CT, Corces VG. CTCF: an architectural protein bridging genome
topology and function. Nat Rev Genet. 2014;15:234-246.
Corden JL. RNA polymerase II C-terminal domain: Tethering transcrip- Ruthenburg AJ, Li H, Patel DJ, etal. Multivalent engagement of chro-
tion to transcript and template. Chem Rev. 2013;113:8423-8455. matin modifications by linked binding modules. Nat Rev Mol Cell
de Laat W, Duboule D. Topology of mammalian developmental enhanc- Biol. 2007;8:983-994.
ers and their regulatory landscapes. Nature. 2013;502:499-506. Sainsbury S, Bernecky C, Cramer P. Structural basis of transcription
Dekker J, Mirny L. The 3D genome as moderator of chromosomal initiation by RNA polymerase II. Nat Rev Mol Cell Biol. 2015;16:
communication. Cell. 2016;164:1110-1121. 129-143.
Delest A, Sexton T, Cavalli G. Polycomb: a paradigm for genome Spitz F, Furlong EE. Transcription factors: from enhancer binding to
organization from one to three dimensions. Curr Opin Cell Biol. developmental control. Nat Rev Genet. 2012;13:613-626.
2012;24:405-414. Teves SS, Weber CM, Henikoff S. Transcribing through the nucleo-
Hnisz D, Abraham BJ, Lee TI, etal. Super-enhancers in the control of some. Trends Biochem Sci. 2014;39:577-586.
cell identity and disease. Cell. 2013;155:934-947. Vannini A, Cramer P. Conservation between the RNA polymerase I, II,
Landick R. The regulatory roles and mechanism of transcriptional and III transcription initiation machineries. Mol Cell. 2012;45:
pausing. Biochem Soc Trans. 2006;34:1062-1066. 439-446.
Levine M. Transcriptional enhancers in animal development and evolu- Yan J, Enge M, Whitington T, etal. Transcription factor binding in
tion. Curr Biol. 2010;20:R754-R763. human cells occurs in dense clusters formed around cohesin anchor
Murakami K, Calero G, Brown CR, etal. Formation and fate of a sites. Cell. 2013;154:801-813.
complete 31-protein RNA polymerase II transcription preinitiation Zaret KS, Carroll JS. Pioneer transcription factors: establishing
complex. J Biol Chem. 2013a;288:6325-6332. competence for gene expression. Genes Dev. 2011;25:2227-
Murakami K, Elmlund H, Kalisman N, etal. Architecture of an RNA 2241.
polymerase II transcription pre-initiation complex. Science. 2013b; Zhou Q, Li T, Price DH. RNA polymerase II elongation control. Annu
342:1238724. Rev Biochem. 2012;81:119-143.

CH 10 Gene Expression

Uploaded by

Copyright:

Available Formats

CH 10 Gene Expression

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

CH 10 Gene Expression

Uploaded by

Copyright:

Available Formats

CHAPTER 10

distinguish promoter from nonpromoter DNA. Next, a A. Procaryotic transcription unit

complex separates the DNA strands. This open

start the transcript. After formation of a phosphodiester

Transcription Unit transcription or aberrant processing of the newly synthe-

A E. coli Pol I Pol II Pol III B. Ribbon

Tandem repeats of the

E. coli D. Conserved residues (red)

Yeast pol I K KEG L FR KHMMGKRVN

eukaryotic enzymes is likely attributable to the need for A. Prokaryotic promoter

differ among the three types of eukaryotic RNA polymer-

A. Closed complex (binding) B. Open complex (melting) C. Transcribing complex

TABLE 10.1 Summary of Eukaryotic RNA Polymerase II General Transcription Factors

The next step in assembly of the initiation complex +1

TATA box (Fig. 10.7D). Mutations in the yeast gene TBP

A. RNA polymerase C. Elongating

Termination 3' 3'

Position 1 1 +1 Next NTP

A. Rho-independent termination B. Rho-dependent termination

G- and C-rich self-

Rho migrates 5' to 3'

A. Lac regulation physiology B. Lac regulation

Lac repressor Repressor binding

it binds cyclic adenosine monophosphate (cAMP), which Gene-specific

A B Transcription factor binding sites

Number of sequence reads

Mapping Transcription Components on the Genome Chromatin and Transcription

TABLE 10.2 Nucleosome-Modifying Complexes

A. Homeodomain B. Zinc fingers C. Glucocorticoid receptor

D. Basic region zipper E. Factor 1 F. Factor 2 G. Factor 1/2

Transcription Factors as Modular Proteins Transcription Factor Binding to Eukaryotic Promoter

A B. Histone acetylation activates transcription

Capping enzyme Initiation

Long-Range Regulatory Interactions are phosphorylated at different stages of the transcrip-

eukaryotic gene typically has binding sites for multiple

FIGURE 10.20 REGULATION OF TRANSCRIPTION FACTOR

that mediates the transcriptional response to cAMP. A A. Cascade

Nuclear Factor B Signaling

You might also like