Bioresource Technology 268 (2018) 415–423

Contents lists available at ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

Intensified bioleaching of chalcopyrite by communities with enriched T

ferrous or sulfur oxidizers
⁎
Liyuan Maa,b, Xingjie Wangc, Xueduan Liud, Shanquan Wangb, Hongmei Wanga,
a
School of Environmental Studies, China University of Geosciences, 430074, China
b
Guangdong Provincial Key Laboratory of Environmental Pollution Control and Remediation Technology, Sun Yat-sen University, 510006, China
c
School of Resource and Environmental Engineering, Wuhan University of Science and Technology, 430081, China
d
School of Minerals Processing and Bioengineering, Central South University, 410083, China

G R A P H I C A L A B S T R A C T

A R T I C LE I N FO A B S T R A C T

Keywords: The chalcopyrite bioleaching by enriched ferrous or sulfur oxidizers was investigated. The bioleaching was also
Chalcopyrite intensified three times by the enriched communities. The results indicated that copper recoveries extracted by
Intensified bioleaching the enriched ferrous and sulfur oxidizers (Fe-O and S-O) were 38.87% and 43.13%, compared with that by the
Sulfur oxidizers original community (35.35%). The positive effects of re-introducing S-enriched community to Fe-O and S-O
Community succession
groups were observed with copper extraction rates up to 41.67% and 46.45%. CCA indicated that the community
dynamics intensified by S-enriched community was closer to that of the no re-inoculated one, but the Fe-en-
riched community drove a great fluctuation. A mechanism model for S-enriched community intensifying chal-
copyrite bioleaching was proposed. More sulfur oxidizers in community slowed down jarosite formation and
maintained lower ORP, which was propitious to chalcopyrite dissolution. Meanwhile, they accelerated S0 de-
composition and decreased pH, which promoted acid leaching of chalcopyrite at a low cost.

1. Introduction chalcopyrite has been widely accepted due to its low investment, mild
reaction and environmental friendly advantages (Pathak et al., 2017).
As the most abundant copper-bearing sulfide mineral, chalcopyrite However, during the bioleaching process, jarosite and sulfur accumu-
(CuFeS2) attracts much attention for copper extraction. Bioleaching of lated on mineral surface, which formed compact passivation layer and

⁎
Corresponding author.
E-mail address: wanghmei04@163.com (H. Wang).

https://doi.org/10.1016/j.biortech.2018.08.019
Received 5 July 2018; Received in revised form 1 August 2018; Accepted 3 August 2018
Available online 07 August 2018
0960-8524/ © 2018 Elsevier Ltd. All rights reserved.
L. Ma et al. Bioresource Technology 268 (2018) 415–423

hampered mineral dissolution (Saavedra et al., 2018). As a result, 2. Materials and methods
practical application of chalcopyrite bioleaching was severely inhibited.
Many efforts have been devoted to improve the efficiency of chal- 2.1. Mineral components and preparation
copyrite bioleaching from mineralogical (Deng et al., 2017; Zhao et al.,
2017) and biological aspects (Latorre et al., 2016; Marín et al., 2017). The chalcopyrite used in the bioleaching experiments was obtained
As the dominators of the bioleaching system, ferrous and sulfur oxidi- from Guangxi province (China). The mineral was ground and sieved to
zers utilized the dissolved iron and sulfur as energy sources, and their screen the samples with particle diameter less than 74 μm. Chemical
cooperation played a crucial role in decomposing the chalcopyrite elemental analysis was carried out by inductively coupled plasma-
(Méndez-García et al., 2015). Optimizing microbial community during atomic emission spectrometry (ICP-AES, PS-6, Baird, USA).
pre-breeding process was an effective way to improve the leaching Mineralogical analysis was carried out by X-ray diffraction (XRD, D/
performance (Hedrich et al., 2016; Kondrat’eva et al., 2012). However, Max 2500, Rigaku, Japan). Before bioleaching experiment, the mineral
as for microbial breeding during industrial process, more attention was sample was washed by 2 M HCl, distilled water and pure ethanol suc-
focused on enlarging cultivation scales, while the community structure cessively, then, it was dried in a vacuum desiccator at room tempera-
and succession were always ignored in each batch culture. It was not ture.
clear how ferrous and sulfur oxidizers selectively co-existed by their
inner synergy during the breeding process. 2.2. Original community and acclimation
Microbial re-inoculation was an effective method for strengthening
the microbial functions. The technology was widely employed in Several bio-samples derived from different habitat, including acid
sewage sludge treatment, soil remediation, fermentation process and mine drainage, leaching heap, coal mine wastewater, and thermal
other bio-treatment systems (Calderón et al., 2017; Callac et al., 2015; spring, were collected from the Dexing copper mine of Jiangxi (China),
Gu et al., 2018). Previous studies have demonstrated that the re-in- Zijinshan copper mine of Fujian (China), Chambishi Copper Mine
oculation enhanced the intrinsic functions of community or removed (Zambia), Chenzhou coal mine of Hunan (China), and Tengchong
the restricted factors as well as changed the original community suc- thermal spring of Yunnan (China). All samples were inoculated into a
cession (Ma et al., 2017b; Weenink et al., 2015). In recent years, re- 9 K basal medium composed of ferrous sulfate, elementary sulfur and
searchers have re-added single strain to the bioleaching microcosm for chalcopyrite in a 3 L beaker under agitation. The 9 K basal medium
improving the bio-oxidation of copper sulfide minerals (Zhang et al., contains of the following ingredients (g/L): (NH4)2SO4 (3), K2HPO4
2015). However, the complicated interspecific relationships within (0.5), KCl (0.1), Ca(NO3)2(0.01), MgSO4·7H2O (0.5). In the process of
community, which significantly affected the bioleaching efficiency, serial subculturing, ferrous sulfate and elementary sulfur was gradually
were always neglected (Hua et al., 2015). The effects of re-inoculation replaced by chalcopyrite. The culture was adapted to chalcopyrite en-
of enriched communities on leaching performance and community vironment for more than 1 year at room temperature (24–30 °C) with
succession were also poorly understood. pH range 1.6–2.5. It was used as the original community (OC) in this
Microbial communities in the extremely acidic, metal-rich en- study.
vironment were relatively simple with low species diversity, and the The strategies for the whole experiment were shown in Graphical
species distribution in different sub-systems was uneven (Mutch et al., Abstract. All of the enrichments for inoculation and re-inoculation were
2010; Xiao et al., 2016). 16S rRNA gene sequencing provided evidence cultured from the original community. The OC was acclimated with
at genus level that Acidithiobacillus showed strong competitive ad- substrate of 44.7 g/L FeSO4·7H2O and 1 g/L S0 or 4.47 g/L FeSO4·7H2O
vantages in many bioleaching locations (Liu et al., 2016). However, and 10 g/L S0 for three artificial batches. The third batches of Fe-en-
Acidithiobacillus ferrooxidans and Acidithiobacillus ferrivorans were iron richment and S-enrichment named Fe-O and S-O, which were finished
and sulfur mixotrophic species (Gu et al., 2018), while Acidithiobacillus at day 0, 9, 12 and 15, were used for bioleaching and intensified bio-
thiooxidans and Acidithiobacillus caldus only utilized sulfur and poly- leaching.
sulfide as their energy substrates (Nuñez et al., 2017). Thus, to better
identify the microbial community functions, it is necessary to 2.3. Bioleaching and intensified bioleaching experiment
strengthen quantitative research at species level. Real-time quantitative
PCR (RT-qPCR) can be used to quantitatively analyze the known species The chalcopyrite bioleaching experiments were conducted on a ro-
in a certain community (Ma et al., 2017b; Zhang et al., 2015). Hence, a tary platform at 175 rpm for 27 days with 2.0% (w/v) pulp density. The
standardized approach combining 16S rRNA sequencing and RT-qPCR solid particles and liquid medium were sterilized by autoclaving (Karan
methods would bring a more precise description of community struc- et al., 1996) at 110 °C for 40 min and 121 °C for 25 min, respectively.
ture and dynamics, giving a clear insight into the shift of a community After cooling down, 200 mL medium was poured into the 500 mL shake
after re-inoculation, and also into the possible mechanism for enhan- flask containing 4 g mineral sample. Three groups with initial cells
cing the bioleaching performance. density of 1.0 × 107 cells/mL and an abiotic control were set as OC, Fe-
In the previous work, six strains isolated from the same habitat have O, S-O and Blank.
been recombined by different initial proportions to access the me- According to the result of pre-experiment of 27 days, the chalco-
chanism of chalcopyrite bioleaching. The results indicated that copper pyrite bioleaching with Fe-O was intensified by re-inoculation three
extraction was more efficient in group with more sulfur oxidizers at times (at 9th, 15th and 21st day) with Fe-O and S-O, respectively,
both 30 and 40 °C, than that with more ferrous oxidizers (Ma et al., which were marked as Fe-Fe-O and Fe-S-O. Similarly, the S-O bio-
2017a). Herein, in order to investigate the application feasibility of re- leaching group was also intensified in the same way and marked as S-
inoculation of sulfur oxidizers, an adapted community from chalco- Fe-O and S-S-O. The re-inoculation for each time intensifying was
pyrite was enriched by adding different amount of FeSO4·7H2O and S0 1.0 × 107 cells/mL. All the treatments were undertaken at 30 °C with
as substrate. The enriched communities after three serial subculturing initial pH 2.0 in triplicate. During the experimental process, distilled
were used for chalcopyrite bioleaching. And the intensified bioleaching water and medium were supplemented periodically to compensate for
was carried out by three times re-introducing of the Fe-enriched or S- the evaporation and sampling loss.
enriched community. The dynamics of the dominant genus and species
in communities were analyzed by 16S rRNA sequencing and RT-qPCR 2.4. Analytical methods
jointly.
2.4.1. Analysis of physicochemical parameters
The supernatant samples were withdrawn every three days for the

416
L. Ma et al. Bioresource Technology 268 (2018) 415–423

measurement of physicochemical parameters. The concentrations of by the program SPSS 17.0 (SPSS Inc., Chicago, USA).
dissolved copper ion and ferrous iron/total iron were analyzed by using
BCO spectrophotometry and byo-phenanthroline spectrophotometry,
respectively. The variations of pH and oxidation-redox potential (ORP) 3. Results and discussion
were measured by a digital pH meter (PHSJ-4A, Shanghai INESA
Scientific Instrument Co., Ltd., China) and a platinum electrode (213- 3.1. The community succession during acclimation process
01, Shanghai INESA Scientific Instrument Co., Ltd., China) with an Ag/
AgCl reference electrode (218, Shanghai INESA Scientific Instrument In total, 367 OTUs were identified in the bioleaching system. The
Co., Ltd., China). community succession during acclimation process was shown in Fig. 1.
DCA provided an overall shift of the enriched microbial communities in
2.4.2. Analysis of community succession three artificial batches (Fig. 1a). Compared with OC, the first batch of
Microorganisms were harvested from 5.0 mL leaching samples as enrichments went to different locations, and then, the distance between
described in the previous work (Ma et al., 2017a). Cells were cen- the second or even the third batches (namely Fe-O and S-O) increased,
trifuged at 12000×g for 10 min for cells collection. Subsequently, total indicating that the composition of Fe-O and S-O were changed from OC
DNA was extracted using the TIANamp® Bacteria DNA kit (Tiangen significantly. Top 34 OTUs (total number of sequences > 100) were
Biotech Co. Ltd., Beijing, China). The quality of DNA was examined selected to show a specific difference among the acclimated samples
with 1.0% (w/v) agarose gel electrophoresis and a NanoDrop® ND-1000 (Fig. 1b). Biological reduplicate samples were clustered together within
spectrophotometer (NanoDrop Technologies, Wilmington, USA). a branch on the similarity tree. The representative OTUs in Fe-enriched
PCR was conducted on Applied Biosystems (ABI) Veriti 96-well Fast groups showed a similar quantitative composition, but the S-enriched
Thermal Cyclers with bacterial primer pair (515F: 5′-GTGCCAGCMGC group fluctuated more obviously, as many OTUs presented different
CGCGGTAA-3′; 806R: 5′-GGACTACHVGGGTWTCTAAT-3′) for V4 re- amount in the enriched samples. In the Fe-enriched groups, the abun-
gion of 16S rRNA gene (Peiffer et al., 2013). Each sample was amplified dances of OTU 89, OTU 88 and OTU 96 were much higher, while OTU
under the following conditions: 94 °C for 5 min, 28 cycles of 94 °C for 93, OTU 89, OTU 94 and OTU 91 were dominant OTUs in the S-en-
45 s, 62 °C for 45 s, and 72 °C for 1 min then 10 min at 72 °C. PCR riched groups. All genus identified in this study (Fig. 1c) were wide-
products were purified using EZNA TM Gel Extraction Kit (Omega Bio- spread in bioleaching environments (Kondrat’eva et al., 2012). The
Tek). The purified PCR products were used for sequencing libraries most abundant OTUs in OC were classified into Sulfobacillus, Leptos-
preparation. The library quality was assessed on the Qubit 2.0 Fluo- pirillum, Acidithiobacillus and Acidiplasma. In the Fe-enriched groups,
rometer (Thermo Scientific). Finally, the library was sequenced on an Sulfobacillus and Acidiplasma were replaced by Acidiphilium. In the S-
Illumina MiSeq platform with the sequencing strategy PE300. RT-qPCR enriched groups, Acidithiobacillus dominated the communities and even
was used for further analysis to identify the dominant species in genus counted 91.97% of the total population in the third batch, while the
Acidithiobacillus. The RT-qPCR was carried out as described in the proportion of Leptospirillum decreased from 42.88% to 7.29% gradually.
previous work (Ma et al., 2017a) and the information of primers was As expected, the acclimation by different amount of FeSO4·7H2O and S0
listed in Table 1. successfully differentiated the community structures.
In addition, more attention was focused on OC and the third batches
2.5. Data analysis of Fe-O and S-O, which were used for chalcopyrite bioleaching and the
intensified bioleaching. As shown in Fig. 2a, 21 OTUs were shared by
The pair-end reads with at least 10 bp overlap and lower than 5% the three groups. Compared with OC containing 54 unique OTUs, the
mismatches were merged using Flash after trimming (Magoč and unique OTUs in Fe-O and S-O were 27 and 44, which were decreased in
Salzberg, 2011). To obtain clean tags, the shorter than 240 bp se- the relative single substrates. It can be explained by the ecological
quences, low quality sequences and chimeras were filtered, trimmed theory that inter-species competition leads to a reduced community
and removed (Edgar et al., 2011). The clean tags were clustered into diversity (Demalach and Kadmon, 2017). Combined with the RT-qPCR
operational taxonomic units (OTUs) by UCLUST at 97% similarity level results, the Fe-O and S-O community structure was clearly shown in
(Edgar, 2010). The taxonomy of OTU representative sequences were Figs. 4a and 5a (day 0). Particularly, according to the known Fe&S
phylogenetically assigned to taxonomic classifications by RDP Classifier metabolizers, the acidophiles were classified into two types (ferrous
(Wang et al., 2007) with a confidence threshold of 50%. Data analyses oxidizer and sulfur oxidizer) to evaluate the community functional
were carried out using the R software (version3.1.12) package Venn potential (Fig. 2b). The relative abundance of ferrous oxidizer in Fe-O
Diagram and Pheatmap (R Team 2008). Detrended correspondence accounted for 84.39% and sulfur oxidizer in S-O accounted for 93.01%.
analysis (DCA) and canonical correspondence analysis (CCA) was con- As expected, the functional potentials of OC, Fe-O and S-O were sig-
ducted by Canoco 4.5. nificantly different (P < 0.05), suggesting that they could be used to
All experiments were performed at least three times. Each data conduct the chalcopyrite bioleaching and intensified bioleaching ex-
point and error bar represented the mean and standard deviation, re- periments.
spectively. Statistical analysis was performed using the Student’s t-test

Table 1
The information of primers used in this study for RT-qPCR.
Species Energy type Primer information

Names Sequences (5′-3′) Amplicon length (bp)

A. ferrooxidans Ferrous /sulfur oxidizer rus-S ACAAGGGATTCGGTCATAGTTT 153

rus-A CCGTCGGATGCCAGGTAAA
A. ferrivorans Ferrous /sulfur oxidizer CspA-S TCCTCAGCCTGCATGCCT 180
CspA-A TGGTACAGTAAAGTGGTTCA
A. thiooxidans Sulfur oxidizer Sqr-S GCTCGGCAGCCTCAATAC 136
Sqr-A GGTCGGACGGTGGTTACTG
A. caldus Sulfur oxidizer soxX1-S CAGTATTCCACCCATCAACG 114
soxX1-A ACTCCACCTGGCAAGACAT

417
L. Ma et al. Bioresource Technology 268 (2018) 415–423

Fig. 1. Microbial community succession during acclimation process (a-DCA results, b-heatmap analysis of top 34 OTUs, c-community structure at genus level).

3.2. Bioleaching of chalcopyrite by Fe-O and S-O indicating the enriched communities worked more efficiently. The
variation of ORP, which was partially correlated to the proportion of
3.2.1. Main biochemical parameters in leachate during the bioleaching Fe3+/Fe2+ species, also indicated the activeness of microbial popula-
process tion during the entire bioleaching process (Panda et al., 2013). The S-O
The mineral properties of the chalcopyrite used in this study were maintained lower ORP at RIC and SIC stages, accompanied by a higher
analyzed by ICP-AES and XRD. The results showed that Fe (28.7%), Cu copper leaching efficiency. This was consistent with the previous results
(33.1%) and S (35.4%) were the major elements and the mineral was that the ORP should be controlled at around 380–580 mV (vs. Ag/AgCl)
mainly composed of chalcopyrite, pyrite and quartz. The bioleaching to achieve a well bioleaching performance (Panda et al., 2013). The pH
procedure was divided into four stages as lag stage (LAG, 0–6th d), of the Fe-O showed a modest increase to 1.91 at LAG stage while it
rapidly increasing stage (RIC, 6–12th d), slowly increasing stage (SIC, decreased to 1.69 in S-O. Subsequently, the pH of the Fe-O also dropped
12–18th d) and stationary stage (STA, 18–27th d) based on copper significantly, indicating that the sulfur oxidizers in Fe-O began to work
concentration (Fig. 3a). efficiently after colonization. After that, the pH showed a similar in-
The final copper concentrations after 27 days in Fe-O and S-O were creasing tendency and again decreased to 1.70 and 1.65 in Fe-O and S-
2573.08 ± 20.70 mg/L and 2855.49 ± 46.99 mg/L, respectively, O. An initial increase of pH in Fe-O might be due to chalcopyrite dis-
about 9.96% and 22.03% higher than OC (2339.93 ± 54.56). The solution by ferrous oxidizers, which consumed the protons (Liu et al.,
ferrous concentration in Fe-O and S-O decreased sharply after day 6 2018). The second increase can be attributed to the iron oxidation by
(Fig. 3b), meanwhile, the ORP increased from ∼350 mV to 631 and enriched ferrous oxidizers, which also can be confirmed by high level
593 mV in Fe-O and S-O at day 18, respectively. The variation of ORP in ORP. Meantime, more sulfur oxidizers in S-O, which generated more
OC followed the same tendency, yet, the changes delayed for 6 days, acid causing pH drops (Ohata et al., 2010), promoted the chalcopyrite

Fig. 2. Microbial community composition after acclimation (a-VENN map of OTU distribution, b-relative abundance of ferrous and sulfur oxidizers, different small
letters on the top of the column indicated significant differences at the level of 0.05).

418
L. Ma et al. Bioresource Technology 268 (2018) 415–423

Fig. 3. Variation (mean ± SD) of biochemical parameters during chalcopyrite bioleaching and intensified bioleaching (a-copper concentration, b-ferrous and total
ion concentration, c-ORP and d-pH). Arrows indicate the time points for intensifying.

bioleaching process. always asynchronous with lower leaching efficiency, was not detected.
In summary, the leaching efficiency of the enriched communities The average proportion of the three biological repeats was used to show
were better than that of the OC, which demonstrated that the mixed the community composition in the name of serial number. The com-
bacteria acclimated with chalcopyrite did not degrade after three en- position and structure of Fe-O and S-O changed obviously during the
riched batches. All the observations of metal concentration, ORP and bioleaching period. As expected, the dominant genus was Acid-
pH variation demonstrated that the activated ferrous and sulfur oxidi- ithiobacillus in both of the two group communities. At species level, A.
zers accelerated the dissolution of chalcopyrite, and more sulfur oxi- ferrooxidans and A. caldus dominated Fe-O communities while A.
dizers in community worked more efficiently to dissolve chalcopyrite as thiooxidans was the most abundant population in S-O. Previous study
acid producer and ORP controller. has demonstrated that as a both ferrous and sulfur oxidizer, A. fer-
rooxidans was a representative mesophilic organism in the extreme
3.2.2. Community succession during the bioleaching process bioleaching system, especially when pH was lower than 2.0
The top 8 taxa were selected to analyze the Fe-O (Fig. 4a) and S-O (Nancharaiah et al., 2016). The reason why A. caldus stood out in Fe-O
(Fig. 5a) community succession. The community of OC, which was and A. thiooxidans dominated in S-O after acclimation was probably

Fig. 4. The microbial community succession during chalcopyrite bioleaching and intensified bioleaching by enriched ferrous oxidizers (a-community structures, b-
CCA results. Hollow spots of 1–11 represent the samples from different groups and different time points).

419
L. Ma et al. Bioresource Technology 268 (2018) 415–423

Fig. 5. The microbial community succession during chalcopyrite bioleaching and intensified bioleaching by enriched sulfur oxidizers (a-community structures, b-
CCA results. Hollow spots of 1–11 represent the samples from different groups and different time points).

related to their specialties. The optimal growth temperature of A. accelerated the mineral dissolution process.
thiooxidans was 30 °C and A. caldus has been confirmed to grow at a
wide range of temperature and pH, even in a highly competitive en- 3.3.2. Community succession during the intensified bioleaching process
vironment (Aston et al., 2010; Wang et al., 2016). The metabolites were The acidophiles performed their ferrous- and sulfur-oxidation abil-
accumulated during the bioleaching process (Latorre et al., 2016), ities by competition and cooperation based on their functional cate-
which resulted in a stable existence of the facultative heterotrophic gories. Cell density of the Fe-O and S-O communities were already
bacteria belonging to Sulfobacillus, especially in S-O. The reasons might higher than 2.0 × 108 cells/mL on day 9, so the re-introduction of
be related to that less jarosite generated in S-O due to lower pH, 1.0 × 107 cells/mL would not affect the leaching performance from the
therefore, relative high abundant metabolites were available in lea- point of view of cells number (Zhang et al., 2015). Therefore, biomass
chate (Leahy and Schwarz, 2009), which were easy to be utilized by was not considered as a main factor in the intensified bioleaching ex-
Sulfobacillus. In addition, it can be inferred that Sulfobacillus may periments. The community succession changed significantly along the
probably work as ferrous oxidizers with the pH range of 1.6–1.7 in S-O, intensified bioleaching process. In general, the dominant species in Fe-
which was well agreed with the previous report that Sulfobacillus had a Fe-O or Fe-S-O were A. ferrooxidans, A. caldus and Leptospirillum
wide pH range for growth (1.5–2.5) and a narrow optimum range (Fig. 4a), compared with A. thiooxidans, A. ferrooxidans, Leptospirillum
(∼1.5) for ferrous oxidation (Plumb et al., 2008). Only at day 24, and Sulfobacillus in the S-Fe-O and S-S-O (Fig. 5a). In-depth look at the
Leptospirillum occupied 22.88% and 13.66% of the communities in Fe-O populations, Leptospirillum contributed to 35.28% and 39.44% in the Fe-
and S-O. It has been reported that as ferrous oxidizers, Leptospirillum Fe-O communities at day 18 and 24, and only in cooperation with A.
had competitive advantages under high ORP and low pH conditions ferrooxidans as a major partner. Similarly, Leptospirillum continuously
compared with A. ferrooxidans (Christel et al., 2018). occupied a certain proportion in the S-Fe-O communities, causing more
jarosite formation and further inhibited chalcopyrite dissolution. Sul-
3.3. Intensified bioleaching of chalcopyrite by Fe-O and S-O fobacillus, which was not present in the communities at day 0, was
found in the follow-up samples albeit in low proportion, accounting for
3.3.1. Main biochemical parameters in leachate during the intensified less than 20%. It was believed that the relative low abundant facultative
bioleaching process heterotrophs like Sulfobacillus in bioleaching system, could utilize ly-
The intensified experiments with the enriched Fe-O and S-O pro- sates and exudates produced from other acidophiles (Hallberg et al.,
moted chalcopyrite dissolution process differentially (Fig. 3). Compared 2006). A. thiooxidans, the absolute dominant species in the series of S-O
with Fe-O (2573.08 ± 20.70 mg/L), the final concentrations of copper experiments throughout the whole bioleaching and intensified bio-
in Fe-Fe-O and Fe-S-O were 2453.77 ± 46.99 and leaching process, played key roles in the sulfur delivery and metabo-
2758.32 ± 39.66 mg/L, respectively. Similarly, the final copper con- lism. The similar result was also demonstrated in pyrite bioleaching
centrations in S-Fe-O and S-S-O were 176.03 and 219.31 mg/L higher, system and chromium bioleaching system, in which A. thiooxidans was
respectively, than that in S-O. The groups intensified by Fe-O showed a also the predominant sulfur-oxidizers (He et al., 2012; Zeng et al.,
higher ORP, while the ORP was at lower level (< 600 mV) until STA 2016). It has been demonstrated that A. thiooxidans resisted to acid
stage in S-O. This proved again that sulfur oxidizers were effective ‘OPR stress by producing a high concentration of glutathione in many en-
controllers’. At the same time, the total iron concentration of S-S-O was vironments (Patricio et al., 2013). Surprisingly, the re-inoculation of S-
much higher than that of Fe-Fe-O, indicating that the abundant ferrous O didn’t yield large amount of A. thiooxidans as a dominant species in
oxidizers in Fe-Fe-O promoted the Fe precipitation on mineral surface. Fe-S-O. A. caldus consistently acted as sulfur oxidizer worked with other
The similar results has also been observed by the XRD analysis in the acidophiles. This can be explained by their strong adaptability and
previous work (Ma et al., 2017a). Fe precipitation was unfavourable for survival competitive ability, which was consist with the previous study
mineral dissolution continuously with a high rate as shown in Fig. 3. In (Wang et al., 2016). In summary, A. caldus in Fe-S-O and A. thiooxidans
addition, the groups intensified by Fe-O led to an increase of pH, while in S-S-O promoted the chalcopyrite dissolution by utilizing sulfur and
the S-O intensifying reduced the pH effectively. Low pH was supportive inorganic sulfur compounds, inhibiting the formation of passivation
for metal dissolution, and acid production by microorganisms was a layer caused by the excess S0. Therefore, more sulfur oxidizers in
positive economic way to meet bioleaching requirements (Shiers et al., community benefit the intensified bioleaching.
2016). Interestingly, compared the whole communities from day 12 to day
As a consequence, re-inoculation of S-O community resulted in more 24, the communities in Fe-S-O and S-S-O were more similar to the no re-
dissolved copper ions, total irons, together with lower ORP and pH. inoculated communities of Fe-O and S-O, than that in Fe-Fe-O and S-Fe-
That was to say, introducing sulfur oxidizers to the bioleaching system O. It suggests that the S-O disturbed the bioleaching process in slight

420
L. Ma et al. Bioresource Technology 268 (2018) 415–423

level, while the Fe-O made a large fluctuation. It has been demonstrated indirect mechanism of chalcopyrite bio-oxidation has been demon-
that community instability can intensify the competition among spe- strated as Eqs. (4) and (5) by Fe3+ and H+ (Rodrı́Guez et al., 2003).
cies, leading to a decline in community function (Calderón et al., 2017). During the dissolution process, the passivation layer formed on the
This was also in accordance with the physiochemical data of bio- mineral surface, which was mainly consisted of jarosite, disulfide
leaching, that re-inoculation of S-O resulted to a better leaching effi- (S22−), polysulfide (Sn2−) and elemental sulfur (S0) (Oliveira et al.,
ciency. 2012).
CCA clearly presented the potential relationship between the com-
2CuFeS2+17/2O2+2H+=2Cu2++2Fe3++H2O+4SO42- (1)
munities and environmental factors (Figs. 4b and 5b). The population
dynamics of Fe series and S series presented a similar variation ten- 2+ 2+ 3+
CuFeS2+3Cu +4Fe =2Cu2S+4Fe (2)
dency. Hollow spots of 5, 8 and 11 refer to the final communities were + 2+ 0
clustered together, indicating that the communities after intensified Cu2S+4H +O2=2Cu +S +2H2O (3)
bioleaching process shared a similar structure. In addition, hollow spots CuFeS2+4Fe 3+
=Cu 2+ 0
+2S +5Fe 2+
(4)
of 3, 4, 9 and 10 were clustered together, confirming that communities
intensified by S-O were closer to the no re-inoculated communities’ CuFeS2+4H++O2=Cu2++2S0+Fe2++2H2O (5)
succession model. Copper concentration presented positive correlation
4Fe2++O2+4H+=4Fe3++2H2O (6)
with ORP (< 600 mV), which was partially related with the ratio of
Fe3+/Fe2+ in solution. In addition, copper concentration was in ne- 3+
As known to all, Fe was generated and precipitated quickly to the
gative correlation with pH, indicating that lower pH was beneficial to mineral surface (Leahy and Schwarz, 2009). Therein lay the extra-
chalcopyrite bioleaching. On one hand, the S-enriched community ef- cellular polymeric substances (EPS), which produced by microorgan-
fectively slowed down the increase rate of ORP (> 600 mV). On the isms and provided suitable environment for jarosite formation (Liu
other hand, they were conducive to acid production, and in turn, pro- et al., 2018). The concentration of total irons in Fe-Fe-O was lower than
moted the process of chalcopyrite bioleaching. The results were coin- that in other groups after the second intensifying owing to the accu-
cided with the previous work in co-culture communities (Ma et al., mulated of jarosite on mineral surface as Eq. (7). Jarosite, which was a
2017a), indicating that the microbial function was obviously enhanced major secondary mineral formed in acid and high redox potential en-
by S-enriched community, but the Fe-enriched community drove a vironment, led to a rapid deterioration of ion diffusion (Saavedra et al.,
great fluctuation in community structure, resulted in a lower increase in 2018). Ferrous oxidizers accelerated the oxidation process as Eq. (6),
copper extraction. especially Leptospirillum in Fe-Fe-O (Christel et al., 2018). In summary,
moderate ferric was in favor of chalcopyrite bioleaching, but excessive
ferric generated in solution may lead to the formation of jarosite on
3.4. A model for intensified bioleaching of chalcopyrite by ferrous and mineral surface, which inhibited the further dissolution of chalcopyrite
sulfur oxidizers severely and irreversibly.

Compared with OC (35.35%), the final copper extractions of Fe-O M++3Fe3++2SO42-+6H2O→MFe3(SO4)2(OH)6+6H+ (M+: H3O+,
and S-O were 38.87% and 43.13% with statistically significant differ- Na+, K+, NH4+ et al) (7)
ences (p < 0.01). The copper extraction efficiencies of two intensified Simultaneously, S0 and SxOyn accumulated on mineral surface,
Fe-O bioleaching were 37.07% and 41.67% in Fe-Fe-O and Fe-S-O, si- forming the compact sulfur membrane (He et al., 2009). At this key
milarly, 45.79% and 46.45% in S-Fe-O and S-S-O. In consequence, time point, sulfur oxidizers in community, especially A. caldus in Fe-S-O
community with more sulfur oxidizers was more competent for bio- and A. thiooxidans in S-S-O, eliminated the membrane efficiently with
leaching and intensified bioleaching. acid production as Eqs. (8) and (9). On one hand, the S0 was released
On basis of the above results, a mechanism model was established to from the mineral surface to avoid the formation of passivation. On the
interpret how the sulfur oxidizers in community promoted the chalco- other hand, lower pH enhanced the acid leaching and yielded more
pyrite bioleaching (Fig. 6). Ferrous and sulfur oxidizers sustained the copper in leachate. Moreover, excessive H+ weakened the jarosite
stable bioleaching cycling performance (Fig. 6, right part). The direct formation as Eq. (7) when pH was lower than 1.6 (Leahy and Schwarz,
mechanism of chalcopyrite bio-oxidation could be described as Eq. (1) 2009). As a result, the bioleaching process went on in a virtuous cycle
(Sand et al., 2001). Cu2S was the main intermediate (Eq. (2)), which for metal dissolution.
was easy to be oxidized to Cu2+ as Eq. (3). At the same time, the

Fig. 6. A mechanism model for sulfur oxidizers intensified the chalcopyrite bioleaching (The serial number ①–⑨ represented the Eqs. (1)–(9)).

421
L. Ma et al. Bioresource Technology 268 (2018) 415–423

2S0+3O2+2H2O=2SO42-+4H+ (8) He, Z., Yin, Z., Wang, X., Zhong, H., Sun, W., 2012. Microbial community changes during
the process of pyrite bioleaching. Hydrometallurgy 125–126, 81–89.
SxOyn+O2+H2O→SO42-+H+ (9) Hedrich, S., Guézennec, A.G., Charron, M., Schippers, A., Joulian, C., 2016. Quantitative
monitoring of microbial species during bioleaching of a copper concentrate. Front.
Previous study have demonstrated that microbial synergistic oxi- Microbiol. 7, 2044.
Hua, Z.S., Han, Y.J., Chen, L.X., Liu, J., Hu, M., Li, S.J., Kuang, J.L., Chain, P.S., Huang,
dation turned out to be a better leaching performance (Latorre et al.,
L.N., Shu, W.S., 2015. Ecological roles of dominant and rare prokaryotes in acid mine
2016). Based on this, more and more evidences have been provided that drainage revealed by metagenomics and metatranscriptomics. ISME J. 9 (6),
sulfur oxidizers showed a clear superiority in many application areas 1280–1294.
(Xiao et al., 2016; Zeng et al., 2016). In bioleaching system, the sulfur Karan, G., Natarajan, K., Modak, J., 1996. Estimation of mineral-adhered biomass of
Thiobacillus ferrooxidans by protein assay—some problems and remedies.
oxidizers exhibited a well performance by inhibiting the formation of Hydrometallurgy 42 (2), 169–175.
passivation layer through two aspects (Fig. 6, left part). One was by Kondrat’eva, T.F., Pivovarova, T.A., Tsaplina, I.A., Fomchenko, N.V., Zhuravleva, A.E.,
slowing down the jarosite formation and maintaining a lower ORP, Murav’ev, M.I., Melamud, V.S., Bulayev, A.G., 2012. Diversity of the communities of
acidophilic chemolithotrophic microorganisms in natural and technogenic ecosys-
which was propitious to bioleaching, the other one was by accelerating tems. Microbiology 81 (1), 1–24.
S0 decomposition and lowering the pH, which promoted the acid Latorre, M., Cortés, M.P., Travisany, D., Di, G.A., Budinich, M., Reyesjara, A., Hödar, C.,
leaching at a low cost. González, M., Parada, P., Bobadillafazzini, R.A., 2016. The bioleaching potential of a
bacterial consortium. Bioresour. Technol. 218, 659–666.
Leahy, M.J., Schwarz, M.P., 2009. Modelling jarosite precipitation in isothermal chal-
4. Conclusions copyrite bioleaching columns. Hydrometallurgy 98 (1–2), 181–191.
Liu, H., Lu, X., Zhang, L., Xiang, W., Zhu, X., Li, J., Wang, X., Lu, J., Wang, R., 2018.
Collaborative effects of Acidithiobacillus ferrooxidans and ferrous ions on the oxi-
Chalcopyrite bioleaching and intensified bioleaching by enriched dation of chalcopyrite. Chem. Geol.
ferrous and sulfur oxidizers were investigated in detail. The enriched Liu, X., Chen, B., Chen, J., Zhang, M., Wen, J., Wang, D., Ruan, R., 2016. Spatial variation
sulfur oxidizers in community yielded more copper dissolution, by of microbial community structure in the Zijinshan commercial copper heap bio-
leaching plant. Miner. Eng. 94, 76–82.
slowing down jarosite formation at lower ORP and accelerating S0 de-
Méndez-García, C., Peláez, A.I., Mesa, V., Sánchez, J., Golyshina, O.V., Ferrer, M., 2015.
composition at lower pH. The widespread sulfur oxidizer of A. thioox- Microbial diversity and metabolic networks in acid mine drainage habitats. Front.
idans showed sustainable competitive advantages in S-enriched com- Microbiol. 6, 475.
munities. The community dynamics of intensified bioleaching by S- Ma, L., Wang, X., Feng, X., Liang, Y., Xiao, Y., Hao, X., Yin, H., Liu, H., Liu, X., 2017a. Co-
culture microorganisms with different initial proportions reveal the mechanism of
enriched community was closer to that of the no re-inoculated one, but chalcopyrite bioleaching coupling with microbial community succession. Bioresour.
the Fe-enriched community drove a great fluctuation resulted in lower Technol. 223, 121–130.
efficiency. It is a feasible way to introduce S-enriched community for Ma, L., Wang, X., Tao, J., Feng, X., Zou, K., Xiao, Y., Liang, Y., Yin, H., Liu, X., 2017b.
Bioleaching of the mixed oxide-sulfide copper ore by artificial indigenous and exo-
improving chalcopyrite bioleaching in industrial application. genous microbial community. Hydrometallurgy 169, 41–46.
Magoč, T., Salzberg, S.L., 2011. FLASH: fast length adjustment of short reads to improve
Acknowledgements genome assemblies. Bioinformatics 27 (21), 2957–2963.
Marín, S., Acosta, M., Galleguillos, P., Chibwana, C., Strauss, H., Demergasso, C., 2017. Is
the growth of microorganisms limited by carbon availability during chalcopyrite
This work was funded by Fundamental Research Funds for the bioleaching? Hydrometallurgy 168, 13–20.
Central Universities, China University of Geosciences (Wuhan) Mutch, L.A., Watling, H.R., Watkin, E.L.J., 2010. Microbial population dynamics of in-
oculated low-grade chalcopyrite bioleaching columns. Hydrometallurgy 104 (3–4),
(CUG170671), the Research Fund Program of Guangdong Provincial 391–398.
Key Laboratory of Environmental Pollution Control and Remediation Nancharaiah, Y.V., Mohan, S.V., Lens, P.N., 2016. Biological and bioelectrochemical re-
Technology (2018K20) and the Research Fund Program of Key covery of critical and scarce metals. Trends. Biotechnol. 34 (2), 137–155.
Nuñez, H., Moyabeltrán, A., Covarrubias, P.C., Issotta, F., Cardenas, J.P., Gonzalez, M.,
Laboratory of Biometallurgy, Ministry of Education, Central South
Atavales, J., Acuña, L.G., Johnson, D.B., Quatrini, R., 2017. Molecular systematics of
University, China (MOEKLB1702). the genus Acidithiobacillus: insights into the phylogenetic structure and diversification
of the taxon. Front. Microbiol. 8, 30.
References Ohata, A., Manabe, M., Parada Valdecantos, P.A., 2010. Sulfur-oxidizing bacteria and
their use in bioleaching processes for sulfured copper minerals, No. 7700343. U. S.
Oliveira, C.D., Lima, G.F.D., Abreu, H.A.D., Duarte, H.A., 2012. Reconstruction of the
Aston, J.E., Apel, W.A., Lee, B.D., Peyton, B.M., 2010. Effects of cell condition, pH, and chalcopyrite surfaces—a DFT study. J. Phys. Chem. C 116 (116), 6357–6366.
temperature on lead, zinc, and copper sorption to Acidithiobacillus caldus strain BC13. Panda, S., Parhi, P., Nayak, B., Pradhan, N., Mohapatra, U., Sukla, L., 2013. Two step
J. Hazard. Mater. 184 (1), 34–41. meso-acidophilic bioleaching of chalcopyrite containing ball mill spillage and re-
Calderón, K., Spor, A., Breuil, M.C., Bru, D., Bizouard, F., Violle, C., Barnard, R.L., moval of the surface passivation layer. Bioresour. Technol. 130, 332–338.
Philippot, L., 2017. Effectiveness of ecological rescue for altered soil microbial Pathak, A., Morrison, L., Healy, M.G., 2017. Catalytic potential of selected metal ions for
communities and functions. ISME J. 11 (1), 272–283. bioleaching, and potential techno-economic and environmental issues: a critical re-
Callac, N., Rouxel, O., Lesongeur, F., Liorzou, C., Bollinger, C., Pignet, P., Chéron, S., view. Bioresour. Technol. 229, 211–221.
Fouquet, Y., Rommevauxjestin, C., Godfroy, A., 2015. Biogeochemical insights into Patricio, M., Sebastián, G., Norimasa, O., Marko, B., Paz, C.M., Cristián, S., Kenji, N.,
microbe-mineral-fluid interactions in hydrothermal chimneys using enrichment cul- Akiyoshi, H., Masaru, T., Tomoyoshi, S., 2013. Metabolomic study of Chilean bio-
ture. Extremophiles 19 (3), 597. mining bacteria Acidithiobacillus ferrooxidans strain Wenelen and Acidithiobacillus
Christel, S., Herold, M., Bellenberg, S., Hajjami, M.E., Buettidinh, A., Pivkin, I.V., Sand, thiooxidans strain Licanantay. Metabolomics 9 (1), 247–257.
W., Wilmes, P., Poetsch, A., Dopson, M., 2018. Multi-omics reveals the lifestyle of the Peiffer, J.A., Spor, A., Koren, O., Jin, Z., Tringe, S.G., Dangl, J.L., Buckler, E.S., Ley, R.E.,
acidophilic, mineral-oxidizing model species Leptospirillum ferriphilumT. Appl. 2013. Diversity and heritability of the maize rhizosphere microbiome under field
Environ. Microbiol. 84 (3), e02091-17. conditions. Proc. Natl. Acad. Sci. USA 110 (16), 6548–6553.
Demalach, N., Kadmon, R., 2017. Light competition explains diversity decline better than Plumb, J.J., Muddle, R., Franzmann, P.D., 2008. Effect of pH on rates of iron and sulfur
niche dimensionality. Funct. Ecol. 31 (9), 1834–1838. oxidation by bioleaching organisms. Miner. Eng. 21 (1), 76–82.
Deng, S., Gu, G., Ji, J., Xu, B., 2017. Bioleaching of two different genetic types of chal- Rodrı́Guez, Y., Ballester, A., Blázquez, M.L., González, F., Muñoz, J.A., 2003. New in-
copyrite and their comparative mineralogical assessment. Anal. Bioanal. Chem. 1–9. formation on the chalcopyrite bioleaching mechanism at low and high temperature.
Edgar, R.C., 2010. Search and clustering orders of magnitude faster than BLAST. Hydrometallurgy 71 (1), 47–56.
Bioinformatics 26 (19), 2460–2461. Saavedra, A., García-Meza, J.V., Cortón, E., González, I., 2018. Understanding galvanic
Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., Knight, R., 2011. UCHIME improves interactions between chalcopyrite and magnetite in acid medium to improve copper
sensitivity and speed of chimera detection. Bioinformatics 27 (16), 2194–2200. (bio)leaching. Electrochim. Acta 265, 569–576.
Gu, T., Rastegar, S.O., Mousavi, S.M., Li, M., Zhou, M., 2018. Advances in bioleaching for Sand, W., Gehrke, T., Jozsa, P., Schippers, A., 2001. (Bio)chemistry of bacterial leaching-
recovery of metals and bioremediation of fuel ash and sewage sludge. Bioresour. direct vs. indirect bioleaching. Hydrometallurgy 59 (2), 159–175.
Technol. 261, 428–448. Shiers, D., Collinson, D., Watling, H., 2016. Life in heaps: a review of microbial responses
Hallberg, K.B., Coupland, K., Kimura, S., Johnson, D.B., 2006. Macroscopic streamer to variable acidity in sulfide mineral bioleaching heaps for metal extraction. Res.
growths in acidic, metal-rich mine waters in north wales consist of novel and re- Microbiol. 167 (7), 576–586.
markably simple bacterial communities. Appl. Environ. Microbiol. 72 (3), Wang, Q., Garrity, G.M., Tiedje, J.M., Cole, J.R., 2007. Naive Bayesian classifier for rapid
2022–2030. assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ.
He, H., Xia, J.L., Yang, Y., Jiang, H., Xiao, C.Q., Zheng, L., Ma, C.Y., Zhao, Y.D., Qiu, G.Z., Microbiol. 73 (16), 5261–5267.
2009. Sulfur speciation on the surface of chalcopyrite leached by Acidianus man- Wang, Z., Li, Y., Lin, J., Pang, X., Liu, X., Liu, B., Wang, R., Zhang, C., Wu, Y., Lin, J.,
zaensis. Hydrometallurgy 99 (1), 45–50. 2016. The two-component system RsrS-RsrR regulates the tetrathionate intermediate

422
L. Ma et al. Bioresource Technology 268 (2018) 415–423

pathway for thiosulfate oxidation in Acidithiobacillus caldus. Front. Microbiol. 7, Zeng, J., Gou, M., Tang, Y.Q., Li, G.Y., Sun, Z.Y., Kida, K., 2016. Effective bioleaching of
1755. chromium in tannery sludge with an enriched sulfur-oxidizing bacterial community.
Weenink, E.F.J., Luimstra, V.M., Schuurmans, J.M., Herk, M.J.V., Visser, P.M., Matthijs, Bioresour. Technol. 218, 859–866.
H.C.P., 2015. Combatting cyanobacteria with hydrogen peroxide: a laboratory study Zhang, L., Mao, F., Li, K., Wang, Y., Chen, X., Zhou, H., 2015. Enhancement in copper
on the consequences for phytoplankton community and diversity. Front. Microbiol. 6, extraction from chalcopyrite by re-inoculation of different acidophilic, moderately
714. thermophilic microorganisms. Hydrometallurgy 156, 142–151.
Xiao, Y., Liu, X., Ma, L., Liang, Y., Niu, J., Gu, Y., Zhang, X., Hao, X., Dong, W., She, S., Zhao, H., Huang, X., Wang, J., Li, Y., Liao, R., Wang, X., Qiu, X., Xiong, Y., Qin, W., Qiu,
2016. Microbial communities from different subsystems in biological heap leaching G., 2017. Comparison of bioleaching and dissolution process of p-type and n-type
system play different roles in iron and sulfur metabolisms. Appl. Microbiol. chalcopyrite. Miner. Eng. 109, 153–161.
Biotechnol. 100 (15), 6871–6880.

423