Hindawi

BioMed Research International

Volume 2019, Article ID 6395840, 9 pages
https://doi.org/10.1155/2019/6395840

Research Article
Fungal Keratitis: Epidemiology, Rapid Detection, and
Antifungal Susceptibilities of Fusarium and Aspergillus
Isolates from Corneal Scrapings

Palanisamy Manikandan ,1,2,3 Ahmed Abdel-hadi ,1,4

Yendrembam Randhir Babu Singh,5 Rajaraman Revathi,2
Raghavan Anita,2 Saeed Banawas ,1 Abdul Aziz Bin Dukhyil,1
Bader Alshehri,1 Coimbatore Subramanian Shobana,6
Kanesan Panneer Selvam,7 and Venkatapathy Narendran2
1
Department of Medical Laboratory Sciences, College of Applied Medical Sciences, Majmaah University, Al Majmaah, Saudi Arabia
2
Aravind Eye Hospital and Postgraduate Institute of Ophthalmology, Coimbatore, India
3
Greenlink Analytical and Research Laboratory India Private Limited, Coimbatore, India
4
Botany and Microbiology Department, Faculty of Science, Al-Azhar University, Assiut Branch, Egypt
5
Microbial Resources Division, Institute of Bioresources and Sustainable Development, Takyel, Imphal, Manipur, India
6
Department of Microbiology, PSG College of Arts and Science, Coimbatore, India
7
Department of Microbiology, M.R Government Arts College, Mannargudi, Tamilnadu, India

Correspondence should be addressed to Palanisamy Manikandan; manikandanpalanisamy@gmail.com

Received 31 October 2018; Accepted 10 December 2018; Published 20 January 2019

Academic Editor: Macit Ilkit

Copyright © 2019 Palanisamy Manikandan et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Fungal aetiology of keratitis/corneal ulcer is considered to be one of the leading causes of ocular morbidity, particularly in
developing countries including India. More importantly, Fusarium and Aspergillus are reported commonly implicating corneal
ulcer and against this background the present work was undertaken so as to understand the current epidemiological trend of the
two fungal keratitis. During the project period, a total of 500 corneal scrapings were collected from suspected mycotic keratitis
patients, of which 411 (82.2%) were culture positive for bacteria, fungi, and parasites. Among fungal aetiologies, Fusarium (216,
52.5% of 411) and Aspergillus (68, 16.5% of 411) were predominantly determined. While the study revealed a male preponderance with
both the fungal keratitis , it further brought out that polyene compounds (natamycin and amphotericin B) and azoles were active,
respectively, against Fusarium spp. and Aspergillus spp. Additionally, 94.1% of culture proven Fusarium keratitis and, respectively,
100% and 63.6% of A. flavus and A. fumigatus were confirmed by multiplex PCR. The sensitivity of the PCR employed in the present
study was noted to be 10 fg/𝜇l, 1 pg/𝜇l, and 300 pg/𝜇l of DNA, respectively, for Fusarium, A. flavus, and A. fumigatus. Alarming fact
was that Fusarium and Aspergillus regionally remained to be the common cause of mycotic keratitis and the Fusarium isolates had
a higher antifungal resistance than Aspergillus strains against most of the test drugs.

1. Introduction prevalence rate varies from one country to the other and
also from one population to another within the same country
Blindness due to corneal infections is a serious problem [3, 4]. In South India, the dominance of fungal keratitis,
next to cataract [1] and fungal infections of the cornea have particularly of Fusarium and Aspergillus, is prevalent more
emerged as a major eye disease globally. The corneal infection than a decade and have been documented in many literatures
of fungal etiology is very common and comprising at least [5–8]. Species of Fusarium and Aspergillus are widespread
50% of all culture positive cases in India [2]. However, the in nature being causative agents of important diseases of
2 BioMed Research International

major crops as well as immunocompromised humans [9] 2.2. Collection of Specimens. Corneal scraping was performed
and have been considered as important pathogens in eye under aseptic condition by an ophthalmologist using a
infections, especially keratitis [2, 10]. In India, Fusarium and sterile Kimura’s spatula and a portion was inoculated on 5%
Aspergillus species are being isolated from corneal ulcers in sheep blood agar (SBA), chocolate agar (CA), and potato
large numbers [6, 8, 11–14], irrespective of the geographical dextrose agar (PDA). Additionally, the remaining specimen
location. was smeared on two clear glass slides to observe the presence
The importance of fungal keratitis gained momentum of fungal filaments microscopically using 10% KOH wet
in 2005 following the outbreak of fungal keratitis among mount and Gram staining. Corneal scrapings that revealed
contact lens wearers in many developed countries [15, 16]. The fungal filaments in direct microscopy were considered for the
fact that the outcome of fungal keratitis is worse than that study. Repeat corneal scraping was done to collect specimen
of bacterial keratitis must be underscored [17] due to poor for PCR assay. The collected specimens were placed in 400 𝜇l
response to the therapy as well as the limited availability of of lysis buffer (0.5M Tris HCL, 0.5M EDTA, 3% SDS, 1% 𝛽-
antifungal agents [18]. The diagnosis and treatment of fungal mercaptoethanol) and were stored at −20∘ C until further
keratitis is one of the most difficult problems encountered processing.
by ophthalmologists. Further, the prognoses of the fungal
keratitis worsen with inadvertent antifungal agents and recal- 2.3. Identification of Fusarium spp. and Aspergillus spp. by
citrant course of the disease [2]. Although voriconazole and Culture Method. All fungal isolates were identified based on
other triazoles have broad-spectrum activity against causative the standard culture techniques followed by microscopy after
fungal isolates, clinically no single drug was found to be lacto-phenol cotton blue staining. The identified isolates were
effective against fungal keratitis. Also, Fusarium spp. are preserved in 0.85% saline at 4∘ C.
completely tolerant to itraconazole and caspofungin [19].
Accurate identification of the aetiological agent of fun- 2.4. Determination of Minimum Inhibitory Concentration
gal keratitis is of great importance in order to administer (MIC). The MICs of seven different antifungal agents,
appropriate treatment [10, 20]. Though conventional culture namely, amphotericin B (Himedia, Mumbai, India), itra-
methods are often useful, it takes more time for sufficient conazole (Sigma-Aldrich, St. Louis, MO, USA), natamycin
growth and subsequent identification of the causative agent (Sigma-Aldrich, St. Louis, MO, USA), voriconazole (Aurolab,
[2]. The use of molecular techniques offers a significant Madurai, India), ketoconazole (Himedia, Mumbai, India),
reduction in time required for precise diagnosis of such infec- econazole (Aurolab, Madurai, India) and clotrimazole (Auro-
tions [20, 21]. Also, the scarcity of region-specific antifungal lab, Madurai, India) were determined in accordance with
susceptibility data, the limited availability of commercially the guidelines of Clinical and Laboratory Standards Institute
available antifungal drugs, and the lack of response lead to (CLSI) [22]. The MIC values were defined as the lowest con-
corneal blindness in a high number of infected patients. centrations of antimicrobials that inhibit the visible growth of
Therefore, due to the magnitude of the fungal keratitis in an isolate. The MIC50 and MIC90 values were defined as the
Tamilnadu, India, a survey of local antifungal susceptibility MICs required to inhibit the growth of 50% and 90% of the
pattern, and exploring a suitable, rapid diagnostic method is isolates from a given species, respectively [23].
of paramount importance. A. flavus ATCC 204304 was included as a quality control
Hence, the present study was designed for the rapid strain in all the batches of MIC analysis. The antifungal
detection fungal pathogens causing keratitis by multiplex agents were prepared in order to achieve the dilution ranges
polymerase chain reaction (PCR) and also to evaluate the in the order of 8 𝜇g/ml - 0.015 𝜇g/ml (amphotericin B,
efficacy of multiplex PCR against routine culture method. econazole, voriconazole, and clotrimazole), 32 𝜇g/ml - 0.06
Further, the study also presents data on regional prevalence 𝜇g/ml (itraconazole), 16 𝜇g/ml - 0.03 𝜇g/ml (ketoconazole),
of fungal keratitis and minimum inhibitory concentration [4] and 128 𝜇g/ml - 0.25 𝜇g/ml (natamycin).
values of routinely used antifungal agents against Fusarium
and Aspergillus isolated from corneal ulcers. The paper not 2.5. DNA Extraction. DNA was extracted from infected
only provides information on the current incidence of Fusar- corneal tissue scrapings using Qiagen DNA extraction kit
ium/Aspergillus keratitis but also gives valuable information (Hilden, Germany), as per the manufacturer instructions.
on drug susceptibilities so as to help the ophthalmologists The concentration of extracted DNA was determined by
to initiate appropriate antifungal regimen against fungal nanophotometer (Implen, Munich, Germany). The DNA was
keratitis. stored at −20∘ C (Sanyo, Osaka, Japan) until further use.

2. Materials and Methods 2.6. Polymerase Chain Reaction. The extracted DNA was
initially subjected to the first round of PCR using universal
2.1. Patients. A total of 500 (including repeat specimens) fungal primers (ITS1 and ITS4, internal transcribed spacer
corneal scraping specimens were collected between June 2010 region). The first round amplicons were subsequently sub-
and January 2011 from clinically suspected patients with jected for multiplex PCR using Fusarium and Aspergillus
mycotic keratitis who attended Cornea services at Aravind specific primers [24].
Eye Hospital, Coimbatore, after obtaining ethical clear- For each reaction in the first round PCR, a cocktail
ance (Institutional Review Board, Aravind Medical Research comprising 10 𝜇l of DNA extract with 5 𝜇l of 10 × PCR buffer
Foundation, Madurai, India). (mixed with 1.5 mM magnesium chloride), 1 𝜇l of dNTPs mix
BioMed Research International 3

(200 𝜇M each dNTPs), 20 pm/𝜇l of each primer, and 0.5 U concentration of ≥ 1 𝜇g/ml. More interestingly, natamycin
of Taq DNA polymerase amounting to a total volume of 50 𝜇l acted against 65% (130, n = 200) of the Fusarium isolates
was prepared. The ITS primers (Sigma, St Louis, MO, USA) at a concentration of 16 𝜇g/ml while majority of Aspergillus
used were 5󸀠 -TCCGTAGGTGAACCTGCGG-3󸀠 (F) and 5󸀠 - spp. were inhibited at ≥ 32 𝜇g/ml. A notable observation
TCCTCCGCTTATTGATATGC-3󸀠 (R). The reaction was run was with itraconazole activity, where 92.5% (185, n = 200)
in gradient thermocycler (Eppendorf, Hamburg Germany) Fusarium spp. were susceptible only at a concentration of ≥
involving initial denaturation at 95∘ C for 5 min, followed by 32 𝜇g/ml while 100% (n = 67) of the Aspergillus isolates were
34 cycles in series of denaturation at 95∘ C for 30s, annealing completely inhibited at ≤ 1 𝜇g/ml. Similar MIC patterns were
at 54∘ C for 1 min, and extension at 72∘ C for 1 min, with a final observed with econazole, clotrimazole, and ketoconazole
step of extension at 72∘ C for 6 min and final holding at 4∘ C. where Fusarium isolates had higher MICs compared to
Multiplex PCR cocktail was prepared as described above. Aspergillus spp.
The specific primers (Sigma, St Louis, MO, USA) used for
identification of Fusarium spp., A. flavus, and A. fumigatus 3.2. PCR Study. A total of 473 corneal scrapings which were
were CAACTCCCAAACCCCTGTGA (F) & GCGACGAT- culture positive for Fusarium spp. (205), A. flavus (46), A.
TACCAGTAACGA (R), CCGCCGGAGACACCACGAAC fumigatus (11), A. terreus (4), A. tamarii (1), Bipolaris spp.
(F) & TGGGCAGCAATGACGCTCGG (R), and TTGT- (22), Exserohilum spp. (10), Curvularia spp. (12), Cladospo-
GTGTTGGGCCCCCGTC (F) & AAAGTTGGGTGTCG- rium spp. (4), Aureobasidium spp. (3), Exophiala spp. (2),
GCTGGCG (R), respectively. The amplicons were subjected Lasiodiplodia sp. (1), Pseudallescheria sp. (1), Alternaria sp.
to agarose gel electrophoresis in 1.5% agarose (Sigma, St. (1), Scedosporium spp. (2), UID (20), and UIH (36) were
Louis, MO, USA) for 20-25 min at 80V (GeneI, Bangalore, included for PCR. Additionally, 86 culture negative corneal
India) along with 100 bp (Sigma, St. Louis, MO, USA) scrapings along with 2 mixed infections and 4 bacterial
molecular marker. The DNA bands were visualized, analyzed, positive specimens were also included for PCR analysis.
and documented using gel documentation system (Vilber All the primers specifically amplified the target region.
Lourmat, France). The specific primers of ITS 1 & 4 (1st round), Fusarium spp., A.
flavus, and A. fumigatus after PCR and upon electrophoresis
3. Results produced amplicons of approximately 600 bp, 400 bp, 250 bp,
and 150 bp, respectively (Figure 1(a)). In addition, other
Of the 500 corneal scrapings collected during the study fungal culture positive corneal scrapings such as Bipolaris,
period, the culture revealed that 411 (82.2% of 500) were Curvularia, Exserohilum, etc. could not be amplified in 2nd
positive for fungi, bacterial, and mixed etiologies (Table 1). round multiplex PCR (Figure 1(b)). All the PCR positive
Of 402 ocular specimens (97.8% of 411), 6 (1.4% of 411) and 3 specimens (Fusarium, A. flavus, A. fumigatus) were further
(0.72% of 411) were identified to be due to fungal, bacterial, confirmed with culture identification to ensure the specificity.
and mixture of bacterial and fungal causes, respectively.
Further, 10% KOH and Gram staining revealed that 96.1%
3.3. Sensitivity of the PCR. To determine the minimum
(449 of 467) and 94.7% (473 of 499) correlated with culture
amount of fungal DNA that could be detected by the estab-
findings in the detection of fungi from corneal scrapings.
lished PCR assay, variable quantities (ranging from 10 ng/𝜇l
Number of Fusarium (n=216) keratitis cases occurred more
to 300 fg/𝜇l) of Fusarium and Aspergillus genomic DNA were
in males (134, 62%) than among females (82, 38%). The age
used as DNA template (Figure 2(a)) and it was found that the
group affected with Fusarium keratitis ranged from 21 to 70
best optimized PCR conditions could amplify Fusarium DNA
years and particularly, 66 patients (30.5% of 216) belonged to
as less as 10 fg /𝜇l (Figure 2(b)). Similarly, A. flavus DNA could
41-50 years and 50 (23.1% of 216) belonged to 51-60 years.
be amplified as low as 1 pg/𝜇l. However, the PCR was noted
Similarly, Aspergillus keratitis was confirmed predomi-
to be less sensitive towards the detection of A. fumigatus
nantly among males (55.8% of 68). The age group affected
DNA as it required a minimum DNA concentration of at least
with Aspergillus keratitis ranged from 31 to 50 years (31, 45.5%
300 pg/𝜇l for amplification and detection (Figure 3).
of 68). A. flavus (48, 11.6% of 411) was the predominant species
among the identified Aspergillus identified during the study
period. Bipolaris spp. (22, 5.3% of 411), Curvularia spp. (12, 3.4. PCR-First Round of Amplification with ITS Primers.
2.9% of 411), and Exserohilum spp. (11, 2.6% of 411) were the In the 1st round of PCR amplification, using the universal
other fungi isolated during the study period. fungal primers (ITS1 and ITS4), PCR products (550-600 bp)
were generated from 347 (73.3%) corneal specimens. Of
3.1. Minimum Inhibitory Concentration (MIC). In this study, 347, 337 (97.1%) specimens were already confirmed to be
a total of 200 Fusarium and 67 Aspergillus isolates (47 A. fungal culture positive. An increase in the total number of
flavus, 11 A. fumigatus, 5 A. terreus, 3 A. niger, and 1 A. positive cases through the applications of PCR under the
tamarii) were included to determine the minimum inhibitory project indicated the obvious and inevitable requirement of
concentrations / MIC50 and MIC90 of routine antifungal such techniques in routine diagnostic procedures. Also, the
drugs. Overall, the isolates of Fusarium spp. required higher accuracy of the PCR detection was superior as most (16%,
concentrations (Tables 2 and 3) of specific antifungal drug 76 of 473) of the PCR negative cases (ITS1 and ITS4) were
than Aspergillus spp. in order to be inhibited. Most of the also negative for conventional culture primarily. However, the
Aspergillus isolates were inhibited by amphotericin-B at a DNA from 50 (10.5% of 473) corneal scrapings which were
4 BioMed Research International

Table 1: Microbial etiologies of corneal ulcer isolates during the study period.

Fungi Incidence Percentage (n = 411)

Fusarium spp. 216 52.5
A. flavus 48 11.6
A. fumigatus 11 2.6
A. terreus 5 1.2
A. niger 3 0.7
A. tamarii 1 0.2
Bipolaris spp. 22 5.3
Curvularia spp. 12 2.9
Exserohilum spp. 11 2.6
Cladosporium spp. 4 0.9
Aureobasidium spp. 3 0.7
Exophiala spp. 2 0.4
Lasiodiplodia spp. 1 0.2
Pseudallescheria sp. 1 0.2
C. albicans 1 0.2
Alternaria sp. 1 0.2
Scedosporium spp. 1 0.2
S. apiospermum 1 0.2
Unidentified dematiaceous fungi (UID) 21 5.1
Unidentified hyaline fungi(UIH) 37 9
Bacteria
S. aureus 1 0.2
Pseudomonas spp. 1 0.2
Nocardia spp. 1 0.2
CoNS 1 0.2
S. viridans 1 0.2
Citrobacter spp. 1 0.2
Mixed infection
CoNS + Fusarium spp. 1 0.2
S. pneumoniae + Bipolaris spp. 1 0.2
Citrobacter spp. + Bipolaris spp. 1 0.2
Total 411 100
CoNS: coagulase negative Staphylococcus spp.

(a) (b)

Figure 1: First and second round of PCR amplifications (a) Uniplex PCR with ITS1 & ITS4 primers: Lane 1 - 100 bp ladder, lane 2 - Fusarium
sp. (∼600 bp), lane 3 - A. flavus, lane 4 - A. fumigatus, lane 5 - Bipolaris spp., lane 6 - Exerohilum sp., lane 7 - Alternaria sp., lane 8 - Curvularia
sp. (b) Multiplex PCR with species specific primers: Lane 1 - 100 bp marker, Lane 2 - Fusarium sp., Lane 3 - A. flavus, Lane 4 - A. fumigatus,
Lane 5 - Bipolaris sp., Lane 6 - Exerohilum sp., Lane 7 - Alternaria sp., Lane 8 - Curvularia sp. Lane 9 - UID, Lane 10 - UID.
BioMed Research International 5

Table 2: Minimum inhibitory concentration (𝜇g/ml) of antifungal agents against Fusarium spp. (n=200).

Amphotericin B
MIC range ≤0.5 𝜇g/ml ≥1 𝜇g/ml MIC50 MIC90
8 – 0.125 77 (38.5%) 123 (61.5%) 1 1
Natamycin
MIC range ≤8 𝜇g/ml ≥16 𝜇g/ml MIC50 MIC90
64 – 2 70 (35%) 130 (65%) 16 32
Itraconazole
MIC range ≤16 𝜇g/ml ≥32 𝜇g/ml MIC50 MIC90
32 – 4 15 (7.5%) 185 (92.5%) 32 32
Voriconazole
MIC range ≤4 𝜇g/ml ≥8 𝜇g/ml MIC50 MIC90
8–1 101 (50.5%) 99 (49.5%) 4 8
Econazole
MIC range ≤4 𝜇g/ml ≥8 𝜇g/ml MIC50 MIC90
8–2 38 (19%) 162 (81%) 8 8
Clotrimazole
MIC range ≤4 𝜇g/ml ≥8 𝜇g/ml MIC50 MIC90
8 – 0.5 145 (72.5%) 55 (27.5%) 4 8
Ketoconazole
MIC range ≤8 𝜇g/ml ≥16 𝜇g/ml MIC50 MIC90
16 – 2 35 (17.5%) 165 (82.5%) 16 16

(a) (b)

Figure 2: Determination of PCR sensitivity and specificity (a) A. flavus: Lane 1 - 100 bp marker, lane 2 - negative control, Lane 3 - 10 ng, Lane
4 - 1 ng, Lane 5 - 100 pg, lane 6 - 10 pg, lane 7 - 1 pg, lane 8 - 100 fg, lane 9 - 10 fg, lane 10 - 1 fg. (b) Fusarium sp.: Lane 1 - 100 bp marker, lane
2 - negative control, Lane 3 - 10 ng, Lane 4 - 1 ng, Lane 5 - 100 pg, lane 6 - 10 pg, lane 7 - 1 pg, lane 8 - 100 fg, lane 9 - 10 fg, lane 10 - 1 fg.

Figure 3: PCR sensitivity for A. fumigatus. Lane 1 - 100 bp marker, lane 2 - negative control, lane 3 - 30 ng, lane 4 - 3 ng, lane 5 - 300 pg, lane
6 - 30 pg, lane 7 - 3 pg, lane 8 - 300 fg, lane 9 - 30 fg, lane 10 - 3 fg.
6 BioMed Research International

Table 3: Minimum inhibitory concentration (𝜇g/ml) of antifungal agents against Aspergillus spp.

Amphotericin B
Isolates MIC range ≤0.5 𝜇g/ml ≥1 𝜇g/ml MIC50 MIC90
A. flavus (n = 47) 8 – 0.25 21 (44.7%) 26 (53.4%) 1 2
A. fumigatus (n = 11) 4 – 0.25 5 (45.4%) 6(54.5%) 1 4
A. terreus (n = 5) 2 – 0.5 2 (40%) 3 (60%) 1 2
A. niger (n = 3) 0.5 – 0.25 3 (100%) - 0.5 0.5
A. tamarii (n = 1) NA 1 (100%) - NA NA
Natamycin
Isolates MIC range ≤16 𝜇g/ml ≥32 𝜇g/ml MIC50 MIC90
A. flavus (n = 47) 64 – 16 18 (38.2%) 29 (61.7%) 32 64
A. fumigatus (n = 11) 64 – 16 7 (63.6%) 4 (36.3%) 16 32
A. terreus (n = 5) 32 – 16 1 (20%) 4 (80%) 32 32
A. niger (n = 3) 32 – 8 2 (66.7%) 1 (33.4%) 16 32
A. tamarii (n = 1) NA - 1 (100%) NA NA
Itraconazole
Isolates MIC range ≤0.25 𝜇g/ml ≥0.5 𝜇g/ml MIC50 MIC90
A. flavus (n = 47) 1 – 0.25 25 (53.1%) 22 (46.8%) 0.25 0.5
A. fumigatus (n = 11) 0.5 – 0.25 5 (45.4%) 6 (54.5%) 0.5 0.5
A. terreus (n = 5) NA - 5 (100%) 0.5 0.5
A. niger (n = 3) 0.5 – 0.25 2 (66.7%) 1 (33.4%) 0.25 0.5
A. tamarii (n = 1) NA 1 (100%) - NA NA
Voriconazole
Isolates MIC range ≤0.5 𝜇g/ml ≥1 𝜇g/ml MIC50 MIC90
A. flavus (n = 47) 4 – 0.25 37 (78.7%) 10 (21.2%) 0.5 1
A. fumigatus (n = 11) 4 – 0.25 6 (54.5%) 5 (45.4%) 0.5 1
A. terreus (n = 5) 1 – 0.5 3 (60%) 2 (40%) 0.5 1
A. niger (n = 3) 1 – 0.25 2 (66.7%) 1 (33.4%) 0.5 1
A. tamarii (n = 1) NA - 1 (100%) NA NA
Econazole
Isolates MIC range ≤0.5 𝜇g/ml ≥1 𝜇g/ml MIC50 MIC90
A. flavus (n = 47) 2 – 0.25 37 (78.7%) 10 (21.2%) 0.5 1
A. fumigatus (n = 11) 1 – 0.25 5 (45.4%) 6 (54.5%) 1 1
A. terreus (n = 5) 1 – 0.5 2 (40%) 3 (60%) 0.5 1
A. niger (n = 3) 2 – 0.25 1 (33.4%) 2 (66.7%) 2 2
A. tamarii (n = 1) NA - 1 (100%) NA NA
Clotrimazole
Isolates MIC range ≤0.5 𝜇g/ml ≥1 𝜇g/ml MIC50 MIC90
A. flavus (n = 47) 1 – 0.125 31 (65.9%) 16 (34%) 0.5 1
A. fumigatus (n = 11) 1 – 0.125 8 (72.7%) 3 (27.2%) 0.5 1
A. terreus (n = 5) 1 – 0.5 1 (20%) 4 (80%) 1 1
A. niger (n = 3) 1 – 0.5 1 (33.4%) 2 (66.7%) 1 1
A. tamarii (n = 1) NA 1 (100%) - NA NA
Ketoconazole
Isolates MIC range ≤0.5 𝜇g/ml ≥1 𝜇g/ml MIC50 MIC90
A. flavus (n = 47) 8 – 0.5 14 (29.7%) 33 (70.2%) 1 4
A. fumigatus (n = 11) 4 – 0.125 4 (36.3%) 7 (63.6%) 1 2
A. terreus (n = 5) 4–1 - 5 (100%) 2 4
A. niger (n = 3) 4 – 0.5 1 (33.4%) 2 (66.7%) 1 4
A. tamarii (n = 1) NA - 1 (100%) NA NA
NA: not applicable.
BioMed Research International 7

actually identified to be culture positive failed to amplify ITS was found to be consistent with our previous findings [23].
1 & 4 by PCR. However, Aspergillus spp. had been the dominant aetiology
in fungal keratitis followed by Fusarium spp. in parts of
northern [26] and eastern India [4]. In addition, the fungal
3.5. PCR-Second Round of Amplification with Fungal Species
keratitis aetiology greatly varied from country to country
Specific Primers. The findings upon second round of ampli-
[10]. Candida spp. with incidence rates of 60.6% and 32.7%
fication using exclusive primers for each genus/species were
were observed in London [33] and Melbourne [18], respec-
diverse. Of the 205 corneal scrapings that were positive
tively. Acremonium spp. (40%) were the most predominant
for Fusarium spp. culture, only 193 (94.1% of 205) were
fungal isolate in Paraguay [34]. Antifungal susceptibility test-
reconfirmed as Fusarium spp. (Figure 1(b)). Similarly, 46
ing and MIC determination procedures have very significant
(100%) A. flavus and 7 (63.6% of 11) A. fumigatus were con-
role in terms of successful management of fungal keratitis
firmed with PCR. No amplification of other fungal DNA was
patients. However, the limited availability of commercial
observed for which specific primers were not used (but their
antifungal agents especially in the form of eye drops made
DNA could be amplified in the first round using universal
the therapy more complicated [10]. In this study, Fusarium
fungal primers for ITS). More remarkably, of the 86 culture
spp. required higher concentration of antifungal agents to
negative corneal scrapings, 9 (10.4% of 86) of them showed
inhibit the growth when compared to Aspergillus spp. except
positive for Fusarium spp. in PCR which indicated that
for amphotericin B and natamycin. In a similar investigation,
the PCR primers could identify even those specimens/cases
amphotericin-B and natamycin were reported with signifi-
which were reported to be negative in culture and that the
cant activity against Fusarium spp. [35]. Exactly, 90% of the
primers could amplify minimum quantity of Fusarium DNA
Fusarium spp. were sensitive at 1 𝜇g/ml while 90% of A. flavus,
in culture negative cases also.
A. fumigatus, A. terreus, and A. niger were sensitive at 2, 4,
2, and 0.5 𝜇g/ml, respectively [36]. However, an assessment
4. Discussion by Lalitha et al. [19] and Isabel et al. [35] reported MIC90 at
4 𝜇g/ml and 4.62 𝜇g/ml, respectively, against Fusarium spp.
Rapid identification of fungal pathogens and instilling of with amphotericin-B. The MIC90 of Aspergillus spp. observed
appropriate antifungal agents are key factors of a successful in the present study was similar to the study by Lalitha
fungal keratitis management and the present study focused et al. [19]. Natamycin, though the drug of choice against
on the two features with special reference to Fusarium spp. filamentous fungi [37], because of its poor penetration, is
and Aspergillus spp. The study included only fungal positive effective only in nonsevere superficial keratitis [13]. Fusarium
specimens identified through direct microscopy to evaluate spp. were more sensitive to natamycin than Aspergillus spp.
the PCR specificity of rapid detection. The incidences of In this study, 90% of the Fusarium and Aspergillus strains
fungal keratitis reported were highly variable across the were inhibited at 32 𝜇g/ml and 64 𝜇g/ml, respectively, and
Indian states: southern and western India with 36.7% [8] and the findings were similar to the previous assessments [19].
36.3% [8, 25], northern (7.3%), northeastern (25.6%), and The resistant pattern of Fusarium spp. against itraconazole
eastern India (26.4%) [26–28]. The present study revealed a in this study was clearly evident from other reports [19, 35]
direct microscopic sensitivity of 10% KOH and gram staining though the MIC values showed variations. On the contrary,
96.1% and 94.7%, respectively, from corneal scrapings and Aspergillus was significantly sensitive against itraconazole
were in accordance with Bibhudutta et al., 2011 [28]. Similarly, with consistent findings to our previous work [23] as well as
Bharathi et al. [8] reported 99.23% and 88.73% sensitivity in with other investigators [19, 38]. Similar to itraconazole, other
KOH wet mount and Gram staining, respectively. In another agents such as voriconazole, econazole, clotrimazole, and
study, giemsa stain (75%) and Gram stain (55.5%) were used ketoconazole were relatively effective against Aspergillus spp.
for the detection of fungal filaments [29]. Likewise, higher drug concentrations were required to inhibit
Similar to other studies [8, 30], male patients (60.5%) Fusarium spp. indicating that the tested azole drugs were
were dominant with Fusarium and Aspergillus keratitis, than ineffective. Eduardo et al. 2008 [39] and Lalitha et al. 2007 [19]
females (39.4%). Gonzales et al. [31] and Srinivasan et al. [6] reported MIC90 of voriconazole as 4 𝜇g/ml and the similar
reported the ratio of male to female with corneal ulcer as 1.6 range was found in the present study (8 𝜇g/ml). Eduardo
to 1. Fusarium and Aspergillus keratitis were majorly (94%) et al. concluded that F. solani tends to be more resistant
confirmed in middle aged (21-70 years) individuals with a to certain azoles [39]. However, in case of Aspergillus spp.,
focused predominance in 41-50 years (28.8%). highest MIC was noted against voriconazole (1 𝜇g/ml), which
Middle age group was noted to be highly vulnerable for was similar to the data published previously [19, 23]. In case
fungal keratitis in Madurai [6] region with 31-60 and Nepal of ketoconazole, the MIC90 and MIC50 of Fusarium spp. were
[32] with 21 -50 years. In this study, male patients were at noted as 16 𝜇g/ml, while among Aspergillus spp. A. flavus, A.
a higher risk (55.8%) for Aspergillus keratitis, though our terreus and A. niger had a highest MIC90 of 4 𝜇g/ml. Isabel
previous assessment [23] brought out 60% with 1.5:1 male to et al. 1997 [35] reported higher MIC90 (>51.20 mg/l) against
female ratio. In this study, Fusarium spp. (52.5%) followed Fusarium. On the contrary, Theresa et al. 2006 [36] reported
by Aspergillus spp. (16.5%) were predominantly responsible higher MIC percentile value of ketoconazole in A. niger and
for mycotic keratitis. Similar findings were observed in other A. terreus when compared to other filamentous fungi. In
parts of Southern India [6, 8] western India [25, 30], and general, the isolates of Fusarium spp. showed more resistance
eastern India [28]. Also, the prevalence of Aspergillus keratitis than Aspergillus spp. Most of the Fusarium isolates required
8 BioMed Research International

higher concentration of drugs to get inhibited. Further, most Data Availability

of the Aspergillus isolates were sensitive to amphotericin-B.
All the test PCR primers (ITS 1 & 4) amplified the The data used to support the findings of this study are
target region of Fusarium spp., A. flavus, and A. fumigatus included within the article.
representing 600 bp, 400 bp, 250 bp, and 150 bp, respectively,
after fractionation and were confirmed with suitable positive Conflicts of Interest
(fungal culture positive corneal scraping with Bipolaris spp.,
Curvularia spp., Exserohilum spp., etc.) and negative controls. The authors declare that there are no conflicts of interest
The PCR identified Fusarium, A. flavus, and A. fumigatus regarding the publication of this paper.
were subsequently determined to be culture positive. Though
a prompt identification of fungal causative agent is the
most important task behind every successful management
Acknowledgments
of mycotic keratitis, the issue never has been completely This study was supported by the Indian Council of Medical
redressed. The impediments of rapid identification could be Research (IRIS ID: 2008-03140), New Delhi, India. The
possibly due to the less than a minimum quantity of the authors of this study were also supported by the Deanship of
samples and cross contamination of conjunctival flora. There- Scientific Research at Majmaah University, Kingdom of Saudi
fore, studies on rapid identification of fungi directly from Arabia, under Project No. 38/128.
corneal scrapings are very limited. Hence, the present study
evaluated direct identification of major fungal agents such
as Fusarium and Aspergillus directly from corneal scraping References
using multiplex PCR. The specificity of the PCR primers was [1] J. P. Whitcher, M. Srinivasan, and M. P. Upadhyay, “Corneal
determined by evaluation of positive control using known blindness: a global perspective,” Bulletin of the World Health
fungal isolates and negative control (bacterial DNA) and Organization, vol. 79, no. 3, pp. 214–221, 2001.
subsequent observation of culture positive cases. PCR con- [2] P. A. Thomas, “Current perspectives on ophthalmic mycoses,”
firmed positivity for all the positive control specimens while Clinical Microbiology Reviews, vol. 16, no. 4, pp. 730–797, 2003.
no bands in negative controls. The specimens positive for
[3] G. T. H. Smith and H. R. Taylor, “Epidemiology of corneal
Fusarium spp. and Aspergillus spp. in PCR analyses were also blindness in developing countries,” Journal of Refractive Surgery,
identified to be culture positive in respective microbiological vol. 7, no. 6, pp. 436–439, 1991.
media.
[4] S. K. Basak, A. Mohanta, and A. Bhowmick, “Epidemio-
Ferrer et al. 2001 [21] reported high specificity of PCR logical and microbiological diagnosis of suppurative keratitis
upon amplification of ITS of the fungal genome isolated from in Gangetic West Bengal, Eastern India,” Indian Journal of
ocular infection when DNA isolated from human leukocytes Ophthalmology, vol. 53, no. 1, pp. 17–22, 2005.
and bacterial DNA were used as a negative control. Zunaina et [5] S. Savitri, M. Srinivasan, and G. Celine, “The Current Status Of
al. 2008 [40] used 18S rRNA segment for direct identification Fusarium Species In Mycotic Keratitis In South India,” Indian
of fungal pathogens from corneal scrapings, in which the Journal of Medical Microbiology, vol. 11, no. 2, pp. 140–147, 1993.
specificity (94.7%) was confirmed by sequencing of amplified [6] M. Srinivasan, C. A. Gonzales, and C. George, “Epidemiology
DNA fragment. The PCR sensitivity of the present study for and aetiological diagnosis of corneal ulceration in Madurai,
Fusarium spp., A. flavus, and A. fumigatus was 10 fg, 1 pg, and South India,” British Journal of Ophthalmology, vol. 81, no. 11,
300 pg/micro liter of DNA, respectively. Other investigators pp. 965–971, 1997.
reported the sensitivity of A. versicolor genome with 100 [7] R. Vasudevan and M. Jeya, “Prevalence of bacterial and fungal
fg [40]. In a significant difference from our findings, A. keratitis in and around Chidambaram,” Journal of TNOA, pp.
fumigatus sensitivity was also reported up to 1 fg upon semi- 44-25, 2006.
nested PCR [21]. A positive PCR detection of the fungal [8] M. J. Bharathi, R. Ramakrishnan, S. Vasu, R. Meenakshi, and R.
pathogens was reported by Emma et al. 2000 [41] from a Palaniappan, “Epidemiological characteristics and laboratory
single patient which was culture negative. However, in the diagnosis of fungal keratitis. A three-year study,” Indian Journal
present study, PCR detected and amplified fungal DNA from of Ophthalmology, vol. 51, no. 4, pp. 315–321, 2003.
10 patients. Ferrer et al. 2011 [42] asserted that fungal PCR [9] A. J. De Lucca, “Harmful fungi in both agriculture and
must be added as the screening diagnosis since PCR not only medicine,” Revista Iberoamericana de Micologı́a, vol. 24, no. 1,
proved to be an effective rapid method for the diagnosis of pp. 3–13, 2007.
fungal keratitis but was also sensitive compared to staining [10] P. Manikandan, I. Dóczi, S. Kocsubé, J. Varga, T. Német, and
and culture methods of investigation. To the best of the Z. Antal, Aspergillus in the genomic era, J. Varga and R. Samson,
literature survey, the present study was the first attempt to Eds., Wageningen Academic Publishers, The Netherlands, 2008.
identify the species of Fusarium and Aspergillus directly from [11] M. J. Bharathi, R. Ramakrishnan, S. Vasu, and R. Meenakshi
corneal scrapings of culture proven fungal keratitis cases. Palaniappan, “Aetiological diagnosis of microbial keratitis in
The outcomes of the preliminary assessment were highly South India - a study of 1618 cases,” Indian Journal of Medical
specific and sensitive in detecting Fusarium and Aspergillus. Microbiology, vol. 20, no. 1, pp. 19–24, 2002.
An extended scientific evaluation and optimization is being [12] I. Dóczi, T. Gyetvai, L. Kredics, and E. Nagy, “Involvement of
suggested as to apply PCR in vitro assays for a routine as well Fusarium spp. in fungal keratitis,” Clinical Microbiology and
as rapid diagnostic applications. Infection, vol. 10, no. 9, pp. 773–776, 2004.
BioMed Research International 9

[13] M. Srinivasan, “Fungal keratitis,” Current Opinion in Ophthal- [30] S. Deorukhkar, R. Katiyar, and S. Saini, “Epidemiological
mology, vol. 15, no. 4, pp. 321–327, 2004. features and laboratory results of bacterial and fungal keratitis:
[14] M. J. Bharathi, R. Ramakrishnan, R. Meenakshi, S. Mittal, C. A five-year study at a rural tertiary-care hospital in western
Shivakumar, and M. Srinivasan, “Microbiological diagnosis of Maharashtra, India,” Singapore Medical Journal, vol. 53, no. 4,
infective keratitis: Comparative evaluation of direct microscopy pp. 264–267, 2012.
and culture results,” British Journal of Ophthalmology, vol. 90, [31] C. A. Gonzales, M. Srinivasan, J. P. Whitcher, and G. Smolin,
no. 10, pp. 1271–1276, 2006. “Incidence of corneal ulceration in Madurai district, South
[15] D. C. Chang, G. B. Grant, K. O’Donnell et al., “Multistate India,” Ophthalmic Epidemiology, vol. 3, no. 3, pp. 159–166, 1996.
outbreak of Fusarium keratitis associated with use of a contact [32] M. P. Upadhyay, P. C. D. Karmacharya, S. Koirala et al., “Epi-
lens solution,” The Journal of the American Medical Association, demiologic characteristics, predisposing factors, and etiologic
vol. 296, no. 8, pp. 953–963, 2006. diagnosis of corneal ulceration in Nepal,” American Journal of
[16] W.-B. Khor, T. Aung, S.-M. Saw et al., “An outbreak of Fusarium Ophthalmology, vol. 111, no. 1, pp. 92–99, 1991.
keratitis associated with contact lens wear in Singapore,” Journal [33] D. J. Galarreta, S. J. Tuft, A. Ramsay, and J. K. G. Dart, “Fungal
of the American Medical Association, vol. 295, no. 24, pp. 2867– keratitis in London: Microbiological and clinical evaluation,”
2873, 2006. Cornea, vol. 26, no. 9, pp. 1082–1086, 2007.
[17] T. J. Liesegang and R. K. Forster, “Spectrum of microbial [34] F. Laspina, M. Samudio, and D. Cibils, “Epidemiological char-
keratitis in South Florida,” American Journal of Ophthalmology, acteristics of microbiological results on patients with infectious
vol. 90, no. 1, pp. 38–47, 1980. corneal ulcers: a 13-year survey in Paraguay,” Graefe’s Archive for
[18] P. Bhartiya, M. Daniell, M. Constantinou, F. M. A. Islam, Clinical and Experimental Ophthalmology, vol. 242, no. 3, pp.
and H. R. Taylor, “Fungal keratitis in Melbourne,” Clinical & 204–209, 2004.
Experimental Ophthalmology, vol. 35, no. 2, pp. 124–130, 2007. [35] I. Pujol, J. Guarro, J. Gené, and J. Sala, “In-vitro antifungal
[19] P. Lalitha, B. L. Shapiro, M. Srinivasan et al., “Antimicrobial susceptibility of clinical and environmental Fusarium spp.
susceptibility of Fusarium, Aspergillus, and other filamentous strains,” Journal of Antimicrobial Chemotherapy, vol. 39, no. 2,
fungi isolated from keratitis,” JAMA Ophtalmology, vol. 125, no. pp. 163–167, 1997.
6, pp. 789–793, 2007. [36] K. L. Therese, R. Bagyalakshmi, H. N. Madhavan, and P. Deepa,
[20] P. Manikandan, H. F. Vismer, L. Kredics et al., “Corneal ulcer “In-vitro susceptibility testing by agar dilution method to deter-
due to Neocosmospora vasinfecta in an immunocompetent mine the minimum inhibitory concentrations of amphotericin
patient,” Medical Mycology, vol. 46, no. 3, pp. 279–284, 2008. B, fluconazole and ketoconazole against ocular fungal isolates,”
[21] C. Ferrer, F. Colom, S. Frasés, E. Mulet, J. L. Abad, and J. L. Alió, Indian Journal of Medical Microbiology, vol. 24, no. 4, pp. 273–
“Detection and identification of fungal pathogens by PCR and 279, 2006.
by ITS2 and 5.8S ribosomal DNA typing in ocular infections,” [37] D. M. O’Day, “Selection of appropriate antifungal therapy,”
Journal of Clinical Microbiology, vol. 39, no. 8, pp. 2873–2879, Cornea, vol. 6, no. 4, pp. 238–245, 1987.
2001. [38] S. Arikan, M. Lozano-Chiu, V. Paetznick, S. Nangia, and J.
[22] CLSI, “Reference Method for Broth Dilution Antifungal H. Rex, “Microdilution susceptibility testing of amphotericin
Susceptibility Testing of Filamentous Fungi; Approved B, itraconazole, and voriconazole against clinical isolates of
Standard—Second Edition. CLSI document M38-A2. Wayne, Aspergillus and Fusarium species,” Journal of Clinical Microbi-
PA: Clinical and Laboratory Standards Institute, 2008”. ology, vol. 37, no. 12, pp. 3946–3951, 1999.
[23] P. Manikandan, J. Varga, S. Kocsubé et al., “Epidemiology of [39] E. C. Alfonso, “Genotypic identification of Fusarium species
Aspergillus keratitis at a tertiary care eye hospital in South India from ocular sources: comparison to morphologic classification
and antifungal susceptibilities of the causative agents,” Mycoses, and antifungal sensitivity testing (an AOS thesis),” Transactions
vol. 56, no. 1, pp. 26–33, 2013. of the American Ophthalmological Society, vol. 106, pp. 227–239,
[24] A. Kamel, N. Ibrahim, A. Mohmed, S. Mohmed, and A. 2008.
Joseph, “PCR identification of Fusarium genus based on nuclear [40] Z. Embong, W. H. Wan Hitam, C. Y. Yean et al., “Specific
ribosomal-DNA sequence data,” African Journal of Biotechnol- detection of fungal pathogens by 18S rRNA gene PCR in
ogy, vol. 2, no. 4, pp. 82–85, 2003. microbial keratitis,” BMC Ophthalmology, vol. 8, 2008.
[25] S. D. Deshpande and G. V. Koppikar, “A study of mycotic ker- [41] E. E. M. Jaeger, N. M. Carroll, S. Choudhury et al., “Rapid detec-
atitis in Mumbai,” Indian Journal of Pathology and Microbiology, tion and identification of Candida, Aspergillus, and Fusarium
vol. 42, no. 1, pp. 81–87, 1999. species in ocular samples using nested PCR,” Journal of Clinical
[26] J. Chander and A. Sharma, “Prevalence of fungal corneal ulcers Microbiology, vol. 38, no. 8, pp. 2902–2908, 2000.
in Northern India,” Infection, vol. 22, no. 3, pp. 207–209, 1994. [42] C. Ferrer and J. L. Alió, “Evaluation of molecular diagnosis in
[27] S. Saha, D. Banerjee, A. Khetan, and J. Sengupta, “Epidemio- fungal keratitis. Ten years of experience,” Journal of Ophthalmic
logical profile of fungal keratitis in urban population of West Inflammation and Infection, vol. 1, no. 1, pp. 15–22, 2011.
Bengal, India,” in Oman J Ophthalmol, vol. 2, pp. 114–118, 3
edition, 2009.
[28] B. Rautaraya, S. Sharma, S. Kar, S. Das, and S. K. Sahu,
“Diagnosis and treatment outcome of mycotic keratitis at a
tertiary eye care center in eastern india,” BMC Ophthalmology,
vol. 11, no. 1, article 39, 2011.
[29] S. H. Khairallah, K. A. Byrne, and K. F. Tabbara, “Fungal
keratitis in Saudi Arabia,” Documenta Ophthalmologica, vol. 79,
no. 3, pp. 269–276, 1992.
 International Journal of Journal of

Peptides Nucleic Acids

The Scientific International Journal of International Journal of

World Journal
Hindawi Publishing Corporation
Cell Biology
Hindawi Hindawi
Microbiology
Hindawi Hindawi
http://www.hindawi.com
www.hindawi.com Volume 2018
2013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Anatomy Biochemistry
Research International Research International
Hindawi Hindawi
www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Submit your manuscripts at

www.hindawi.com

Advances in Genetics
Bioinformatics
Hindawi
Research International
Hindawi
www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Advances in

Virolog y Zoology Stem Cells

International Journal of
International Journal of BioMed
Genomics
Hindawi Hindawi Hindawi
International
Hindawi
Research International
Hindawi
www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Neuroscience
Journal

Enzyme Journal of Journal of

Research
Hindawi
Parasitology Research
Hindawi Hindawi
Marine Biology
Hindawi
Archaea
Hindawi
www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018