Location via proxy:   [ UP ]  
[Report a bug]   [Manage cookies]                
0% found this document useful (0 votes)
109 views

Bio Project Class 12

The Human Genome Project began in 1990 with the goal of mapping and sequencing the entire human genome. Over 13 years, scientists developed new technologies to rapidly sequence DNA and map the 3 billion chemical bases that make up human DNA across 23 chromosome pairs. The project was completed in 2003, two years ahead of schedule, revealing that the human genome contains approximately 30,000 genes, less than previous estimates, and that 99.9% of bases are identical between all people. The sequence provides insight into human genetic variation and disease.

Uploaded by

Vivek Nirala
Copyright
© © All Rights Reserved
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
109 views

Bio Project Class 12

The Human Genome Project began in 1990 with the goal of mapping and sequencing the entire human genome. Over 13 years, scientists developed new technologies to rapidly sequence DNA and map the 3 billion chemical bases that make up human DNA across 23 chromosome pairs. The project was completed in 2003, two years ahead of schedule, revealing that the human genome contains approximately 30,000 genes, less than previous estimates, and that 99.9% of bases are identical between all people. The sequence provides insight into human genetic variation and disease.

Uploaded by

Vivek Nirala
Copyright
© © All Rights Reserved
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 31

Downloaded from www.studiestoday.

com

The Human Genome Project

Downloaded from www.studiestoday.com


Downloaded from www.studiestoday.com
The Human Genome Project Began in
1990
• The Mission of the HGP: The quest to
understand the human genome and the role it
plays in both health and disease.

“The true payoff from the HGP will be the ability to


better diagnose, treat, and prevent disease.”
--- Francis Collins, Director of the HGP and the National Human
GenomeDownloaded from www.studiestoday.com
Research Institute (NHGRI)
Downloaded from www.studiestoday.com

The genome is our Genetic Blueprint

• Nearly every human cell


contains 23 pairs of
chromosomes
– 1 - 22 and XY or XX
• XY = Male
• XX = Female

• Length of chr 1-22, X, Y


together is ~3.2 billion
bases (about 2 meters
diploid)
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The Genome is
Who We Are on the inside!
• Chromosomes consist Information coded
in DNA
of DNA
– molecular strings of A, C,
G, & T
– base pairs, A-T, C-G
• Genes
– DNA sequences that
encode proteins
– less than 3% of human
genome

Downloaded from www.studiestoday.com


Downloaded from www.studiestoday.com

The Human Genome Project

Until the early 1970’s, DNA was the most difficult


cellular molecule for biochemists to analyze.
DNA is now the easiest molecule to analyze –
we can now isolate a specific region of the
genome, produce a virtually unlimited
number of copies of it, and determine its
nucleotide sequence overnight.

Downloaded from www.studiestoday.com


Molecular Biology Of The Cell. Alberts et al. 491-495
Downloaded from www.studiestoday.com

The Beginning of the Project


• Most the first 10 years of the project were
spent improving the technology to sequence
and analyze DNA.
• Scientists all around the world worked to make
detailed maps of our chromosomes and
sequence model organisms, like worm, fruit fly,
and mouse.

Downloaded from www.studiestoday.com


Downloaded from www.studiestoday.com

The Human Genome Project

At the height of the Human Genome Project,


sequencing factories were generating DNA
sequences at a rate of 1000 nucleotides per
second 24/7.
Technical breakthroughs that allowed the
Human Genome Project to be completed
have had an enormous impact on all of
biology…..

Downloaded from www.studiestoday.com


Molecular Biology Of The Cell. Alberts et al. 491-495
Downloaded from www.studiestoday.com

The Challenges were Overwhelming


• First there was the
Assembly
The DNA sequence is so long that
no technology can read it all at
once, so it was broken into
pieces.
There were millions of clones
(small sequence fragments).
The assembly process included
finding where the pieces
overlapped in order to put the
draft together.
3,200,000 piece puzzle
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com

The Human Genome Project


Goals:
■ identify all the approximate 30,000 genes in human DNA,
■ determine the sequences of the 3 billion chemical base pairs that make up human
DNA,
■ store this information in databases,
■ improve tools for data analysis,
■ transfer related technologies to the private sector, and
■ address the ethical, legal, and social issues (ELSI) that may arise from the project.

Milestones:
■ 1990: Project initiated as joint effort of U.S. Department of Energy and the National
Institutes of Health
■ June 2000: Completion of a working draft of the entire human genome (covers >90%
of the genome to a depth of 3-4x redundant sequence)
■ February 2001: Analyses of the working draft are published
■ April 2003: HGP sequencing is completed and Project is declared finished two years
ahead of schedule

Downloaded from www.studiestoday.com


http://doegenomes.org
http://www.sanger.ac.uk/HGP/overview.shtml
U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
Downloaded from www.studiestoday.com

UCSC put the human genome


sequence on the web July 7, 2000
Cyber geeks
Searched
for hidden
Messages,
and
“GATTACA”

UCSC put the


human genome
sequence on CD in
October 2000, with
varying results
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The Completion of the Human
Genome Sequence
• June 2000 White House
announcement that the majority
of the human genome (80%)
had been sequenced (working
draft).
• Working draft made available
on the web July 2000 at
genome.ucsc.edu.
• Publication of 90 percent of the
sequence in the February 2001
issue of the journal Nature.
• Completion of 99.99% of the
genome as finished sequence on
July 2003.
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
What does the draft human genome
sequence tell us?

By the Numbers
• The human genome contains 3 billion chemical nucleotide bases (A, C, T, and G).
• The average gene consists of 3000 bases, but sizes vary greatly, with the largest
known human gene being dystrophin at 2.5 million bases. Smallest is tRNA gene at
76bp!
• The total number of genes is estimated at around 30,000--much lower than
previous estimates of 80,000 to 140,000.
• Almost all (99.9%) nucleotide bases are exactly the same in all people.
• The functions are unknown for over 50% of discovered genes.

http://doegenomes.org Downloaded from ofwww.studiestoday.com


U.S. Department Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
Downloaded from www.studiestoday.com
What does the draft human
genome sequence tell us?
How It's Arranged
• The human genome's gene-dense "urban centers" are predominantly composed of
the DNA building blocks G and C.

• In contrast, the gene-poor "deserts" are rich in the DNA building blocks A and T.
GC- and AT-rich regions usually can be seen through a microscope as light and dark
bands on chromosomes.

• Genes appear to be concentrated in random areas along the genome, with vast
expanses of noncoding DNA between.

• Stretches of up to 30,000 C and G bases repeating over and over often occur
adjacent to gene-rich areas, forming a barrier between the genes and the "junk
DNA." These CpG islands are believed to help regulate gene activity.

• Chromosome 1 has the most genes (2968), and the Y chromosome has the fewest
(231).
http://doegenomes.org Downloaded from ofwww.studiestoday.com
U.S. Department Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
Downloaded from www.studiestoday.com
The human genome
How It's Arranged
• The human genome's gene-dense "urban
centers" are predominantly composed of
the DNA building blocks G and C.
• In contrast, the gene-poor "deserts" are
rich in the DNA building blocks A and T.
GC- and AT-rich regions usually can be
seen through a microscope as light and
dark bands on chromosomes.
• Genes appear to be concentrated in
random areas along the genome, with vast
expanses of noncoding DNA between.
• Stretches of up to 30,000 C and G bases
repeating over and over often occur
adjacent to gene-rich areas, forming a
barrier between the genes and the "junk
DNA." These CpG islands are believed to
help regulate gene activity.
• Chromosome 1 has the most genes
(2968), and the Y chromosome has the
http://doegenomes.org Downloaded from www.studiestoday.com
fewest (231).
U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
Downloaded from www.studiestoday.com
What does the draft human
genome sequence tell us?
The Wheat from the Chaff

• Less than 2% of the genome codes for proteins.

• Repeated sequences that do not code for proteins ("junk DNA") make up at least
50% of the human genome.

• Repetitive sequences are thought to have no direct functions, but they shed light
on chromosome structure and dynamics. Over time, these repeats reshape the
genome by rearranging it, creating entirely new genes, and modifying and
reshuffling existing genes.

• The human genome has a much greater portion (50%) of repeat sequences than
the mustard weed (11%), the worm (7%), and the fly (3%).

http://doegenomes.org Downloaded from ofwww.studiestoday.com


U.S. Department Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
Downloaded from www.studiestoday.com
What does the draft human
genome sequence tell us?
How the Human Compares with Other Organisms
• Unlike the human's seemingly random distribution of gene-rich areas, many other
organisms' genomes are more uniform, with genes evenly spaced throughout.
• Humans have on average three times as many kinds of proteins as the fly or worm
because of mRNA transcript "alternative splicing" and chemical modifications to the
proteins. This process can yield different protein products from the same gene.
• Humans share most of the same protein families with worms, flies, and plants; but the
number of gene family members has expanded in humans, especially in proteins
involved in development and immunity.
• Although humans appear to have stopped accumulating repeated DNA over 50 million
years ago, there seems to be no such decline in rodents. This may account for some of
the fundamental differences between hominids and rodents, although gene estimates
are similar in these species. Scientists have proposed many theories to explain
evolutionary contrasts between humans and other organisms, including those of life
span, litter sizes, inbreeding, and genetic drift.

http://doegenomes.org Downloaded from ofwww.studiestoday.com


U.S. Department Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
Downloaded from www.studiestoday.com

What does the draft human


genome sequence tell us?
Variations and Mutations
• Scientists have identified about 3 million locations where single-base DNA differences
(SNPs) occur in humans. This information promises to revolutionize the processes of
finding chromosomal locations for disease-associated sequences and tracing human
history.

• The ratio of germline (sperm or egg cell) mutations is 2:1 in males vs females.
Researchers point to several reasons for the higher mutation rate in the male germline,
including the greater number of cell divisions required for sperm formation than for eggs.

http://doegenomes.org Downloaded from ofwww.studiestoday.com


U.S. Department Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
Downloaded from www.studiestoday.com
What does the draft human genome
sequence tell us?
Led to the discovery of whole new classes of
proteins and genes, while revealing that many
proteins have been much more highly
conserved in evolution than had been
suspected.
Provided new tools for determining the functions
of proteins and of individual domains within
proteins, revealing a host of unexpected
relationships between them.

Downloaded from www.studiestoday.com


Molecular Biology Of The Cell. Alberts et al. 491-495
Downloaded from www.studiestoday.com
What does the draft human genome
sequence tell us?
 By making large amounts of protein
available, it has yielded an efficient way to
mass produce protein hormones and
vaccines
 Dissection of regulatory genes has provided
an important tool for unraveling the complex
regulatory networks by which eukaryotic
gene expression is controlled.

Downloaded from www.studiestoday.com


Molecular Biology Of The Cell. Alberts et al. 491-495
Downloaded from www.studiestoday.com

The Project is not Done…


• Next there is the Annotation:
The sequence is like a topographical map, the
annotation would include cities, towns,
schools, libraries and coffee shops!
So, where are the genes?
How do genes work?
And, how do scientists use
this information for scientific
understanding and to
benefit us?
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com

What do genes do anyway?


• We only have ~19,000 genes, so that means that
each gene has to do a lot.
• Genes make proteins that make up nearly all we are
(muscles, hair, eyes).
• Almost everything that happens in our bodies
happens because of proteins (walking, digestion,
fighting disease).
OR
OR

Eye Color and Hair Color


are determined by genes
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
Of Mice and Men:
It’s all in the genes
Humans and Mice have about the same number
of genes. But we are so different from each
other, how is this possible?
Did you say
cheese?

Mmm,
Cheese!

One human gene can make many different


proteins while a mouse gene can only make a
few!
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com

Genes are important


• By selecting different pieces of a gene, your
body can make many kinds of proteins. (This
process is called alternative splicing.)
• If a gene is “expressed” that means it is turned
on and it will make proteins.

Downloaded from www.studiestoday.com


Downloaded from www.studiestoday.com

The UCSC Genome Browser

Downloaded from www.studiestoday.com


Downloaded from www.studiestoday.com
The browser takes you from early
maps of the genome . . .

Downloaded from www.studiestoday.com


Downloaded from www.studiestoday.com

. . . to a multi-resolution view . . .

Downloaded from www.studiestoday.com


Downloaded from www.studiestoday.com
. . . at the gene cluster level . . .

Downloaded from www.studiestoday.com


Downloaded from www.studiestoday.com
. . . the single gene level . . .

Downloaded from www.studiestoday.com


Downloaded from www.studiestoday.com
. . . the single exon level . . .

Downloaded from www.studiestoday.com


Downloaded from www.studiestoday.com

. . . and at the single base level

caggcggactcagtggatctggccagctgtgacttgacaag
caggcggactcagtggatctagccagctgtgacttgacaag
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com

The Continuing Project


• Finding the complete set of genes and annotating
the entire sequence. Annotation is like detailing;
scientists annotate sequence by listing what has
been learn experimentally and computationally
about its function.
• Proteomics is studying the structure and function
of groups of proteins. Proteins are really important,
but we don’t really understand how they work.
• Comparative Genomics is the process of
comparing different genomes in order to better
understand what they do and how they work. Like
comparing humans, chimpanzees, and mice that
are all mammals but all very different.

Downloaded from www.studiestoday.com

You might also like