OCCURRENCE, QUANTIFICATION, AND GENOTYPING

OF MYCOPLASMA CONJUNCTIVAE IN WILD

CAPRINAE WITH AND WITHOUT INFECTIOUS
KERATOCONJUNCTIVITIS
Author(s): Fabien Mavrot, Edy M. Vilei, Nelson Marreros, Claudio Signer,
Joachim Frey, and Marie-Pierre Ryser-Degiorgis
Source: Journal of Wildlife Diseases, 48(3):619-631.
Published By: Wildlife Disease Association
URL: http://www.bioone.org/doi/full/10.7589/0090-3558-48.3.619

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the

biological, ecological, and environmental sciences. BioOne provides a sustainable online
platform for over 170 journals and books published by nonprofit societies, associations,
museums, institutions, and presses.
Your use of this PDF, the BioOne Web site, and all posted and associated content
indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/
terms_of_use.
Usage of BioOne content is strictly limited to personal, educational, and non-commercial
use. Commercial inquiries or rights and permissions requests should be directed to the
individual publisher as copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit
publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to
critical research.
 Journal of Wildlife Diseases, 48(3), 2012, pp. 619–631
# Wildlife Disease Association 2012

OCCURRENCE, QUANTIFICATION, AND GENOTYPING OF

MYCOPLASMA CONJUNCTIVAE IN WILD CAPRINAE WITH AND
WITHOUT INFECTIOUS KERATOCONJUNCTIVITIS
Fabien Mavrot,1 Edy M. Vilei,2 Nelson Marreros,1 Claudio Signer,3 Joachim Frey,2 and
Marie-Pierre Ryser-Degiorgis1,4
1
Centre for Fish and Wildlife Health, Vetsuisse Faculty, University of Bern, Länggass-Strasse 122, Postfach 8466, CH-
3001 Bern, Switzerland
2
Institute of Veterinary Bacteriology, Vetsuisse Faculty, University of Bern, Länggass-Strasse 122, Postfach 8466, CH-
3001 Bern, Switzerland
3
Hunting and Fishing Services of the Canton of Grisons, Loëstrasse 14, CH-7001 Chur, Switzerland
4
Corresponding author (email: Marie-Pierre.Ryser@vetsuisse.unibe.ch)

ABSTRACT: Mycoplasma conjunctivae, the causative agent of infectious keratoconjunctivitis

(IKC), was recently detected in asymptomatic Alpine ibex (Capra ibex ibex). This suggested that an
external source of infection may not be required for an IKC outbreak in wildlife but might be
initiated by healthy carriers, which contradicted previous serologic investigations in chamois. Our
aims were to 1) assess the prevalence of M. conjunctivae among asymptomatic ibex and Alpine
chamois (Rupicapra rupicapra rupicapra) and its frequency in IKC-affected animals, 2) determine
mycoplasma loads in different disease stages, and 3) characterize the M. conjunctivae strains
involved. Eye swabs from 654 asymptomatic and 204 symptomatic animals were collected in
diverse Swiss regions between 2008 and 2010, and tested by TaqMan real-time PCR. Data analysis
was performed considering various patterns of IKC occurrence in the respective sampling regions.
Strains from 24 animals were compared by cluster analysis. Prevalence of M. conjunctivae was
5.6% (95% confidence interval [CI]: 3.7–8.1%) in asymptomatic ibex and 5.8% (CI: 3.0–9.9%) in
asymptomatic chamois, with significant differences between years and regions in both species.
Detection frequency in symptomatic animals was significantly higher during IKC outbreaks than
in nonepidemic situations (i.e., regular but low incidence or sporadic occurrence). Mycoplasma
load was significantly lower in eyes from healthy carriers and animals with mild signs than from
animals with moderate and severe signs. Although some strains were found in both asymptomatic
and diseased animals of the same species, others apparently differed in their pathogenic potential
depending on the infected species. Overall, we found a widespread occurrence of M. conjunctivae
in wild Caprinae with and without IKC signs. Our results confirm the central role of M.
conjunctivae in outbreaks but suggest that other infectious agents may be involved in IKC cases in
nonepidemic situations. Additionally, presence and severity of signs are related to the quantity of
M. conjunctivae in the eyes rather than to the strain. We propose that individual or environmental
factors influence the clinical expression of the disease and that persistence of M. conjunctivae in
populations of wild Caprinae cannot be excluded.
Key words: Epidemiology, etiology, healthy carrier, infectious keratoconjunctivitis, Myco-
plasma conjunctivae, mycoplasma load, strain, wild Caprinae.

INTRODUCTION to purulent ocular discharge, conjunctivitis,

and corneal lesions ranging from edema to
Mycoplasma conjunctivae is considered keratitis with neovascularization, or even
the primary agent of infectious keratocon- perforation of the cornea with subsequent
junctivitis (IKC) in wild and domestic irreversible blindness (Mayer et al., 1997).
Caprinae (Nicolet and Freundt, 1975; The most common outcome of the disease
Mayer et al., 1996; Hosie, 2007). The is spontaneous remission, but loss of vision
disease has only minor implications in in both eyes, which is not rare in wild
domestic goat (Capra aegagrus hircus) ungulates, highly compromises the chances
and sheep (Ovis aries) but can lead to of survival. Mortality associated with IKC
severe outbreaks in Alpine chamois (Rupi- in chamois and ibex varies depending on
capra rupicapra rupicapra) and Alpine the outbreak but was estimated to reach up
ibex (Capra ibex ibex) populations (Giaco- to 30% in chamois populations (Degiorgis
metti et al., 2002a). Clinical signs are serous et al., 2000b; Tschopp et al., 2005). Because

619
620 JOURNAL OF WILDLIFE DISEASES, VOL. 48, NO. 3, JULY 2012

of the high antibody prevalence, the low outbreaks (Mayer et al., 1996; Grattarola
associated mortality, and the occurrence of et al., 1999; Degiorgis et al., 2000b;
healthy carriers of M. conjunctivae in Tschopp et al., 2005), but sporadic
domestic sheep population, this species is occurrence (Ratti, 1967; Klinger et al.,
considered a reservoir for the agent (Ja- 1969; Bijlenga et al., 1983) and persistence
novsky et al., 2001) and implicated as of localized episodes for years after an
responsible for infections of wild Caprinae outbreak (Costa, 1986; Gauthier 1991)
during the transhumance period in sum- have also been observed.
mer (Giacometti et al., 2002b). Contacts
between sheep and wild ungulates occur on MATERIALS AND METHODS
mountain pastures (Ryser-Degiorgis et al.,
Animals and samples
2002), and transmission of M. conjunctivae
from sheep to wild Caprinae was demon- Samples were collected from chamois and
strated by experimental infection (Giaco- ibex in 18 regions across Switzerland (45u499N
to 47u499N, 5u589E to 10u299E), in the Alps and
metti et al., 1998) and strain analysis in the Jura Mountains, between 2008 and 2010
(Belloy et al., 2003a). (Table 1 and Fig. 1). Regions were defined
Based on a serosurvey, Giacometti et al. based on topographic features (because low
(2002b) postulated that M. conjunctivae is valleys and transport infrastructures tend to
not maintained in chamois populations but separate mountain ungulate populations; Jaeger
et al, 2008; Crestanello et al., 2009) and on
field observations suggested that the role of
knowledge of local biologists and gamekeepers
ibex in the epidemiology of IKC remains on animal movements. Within a region, chamois
uncertain (Tschopp et al., 2005). Previously, and ibex have inter- and intraspecific interac-
we demonstrated the existence of healthy tions, with even more intense contacts within
carriers of M. conjunctivae in free-ranging social groups or subcolonies (Ryser-Degiorgis et
ibex (Ryser-Degiorgis et al., 2009) but al., 2009; Schnidrig-Petrig and Salm, 2009). In
contrast, contacts between individuals from
suspected a number of biases in our different regions are rare, justifying the defini-
estimated prevalences. We also reported a tion of regions as epidemiologic units.
lower mycoplasma load in the eyes of healthy We gathered information about the IKC
carriers than in those of symptomatic ani- situation in wild Caprinae during the study
mals; however, IKC stages were not differ- period by means of a telephone survey among
gamekeepers and hunting authorities in our
entiated, and strains from only three healthy
sampling regions. Each sample was defined as
carriers could be used for genetic comparison collected either in an epidemic situation (an
with those from symptomatic animals. outbreak affecting the whole region and
Our goals were to 1) determine the possibly also the neighboring areas or a locally
prevalence of healthy carriers of M. con- delimited outbreak with at least 10 fatal cases or
junctivae in chamois and ibex populations, 20% estimated morbidity) or in a nonepidemic
situation (no reported case, sporadic occur-
considering potential influencing factors rence, or regular but low incidence with
such as the geographic origin, year and haphazard temporal and geographic distribu-
season of sampling, age, and sex; 2) assess a tion). Sampling was carried out by gamekeep-
possible relationship between mycoplasma ers, hunters, veterinarians, or biologists during
load and severity of signs; and 3) further captures carried out for management or
research (e.g., Marreros et al., 2011; Signer
investigate the association between strains et al., 2011), after hunting/culling, or on animals
of M. conjunctivae and the expression of that were found dead or were shot because of
IKC signs. Additionally, we reexamined the disease signs. Dry conjunctival swabs were
association of M. conjunctivae with IKC in taken from behind the eyelids. Data on species,
wild Caprinae, by estimating the detection age, sex, body condition, geographical origin,
and presence and characteristics of IKC signs
frequency of M. conjunctivae in diseased
were recorded using a questionnaire. Both eyes
animals considering various epidemiologic were described separately with multiple-choice
situations. Previous etiologic studies were answers regarding the presence of ocular
almost exclusively performed during major discharge, corneal opacity, neovascularization,
 MAVROT ET AL.—MYCOPLASMA CONJUNCTIVAE IN WILD CAPRINAE WITH AND WITHOUT OCULAR SIGNS 621

TABLE 1. Distribution of samples of Alpine chamois (Rupicapra rupicapra rupicapra) and Alpine ibex
(Capra ibex ibex) collected in 2008–10 in Switzerland, according to alive/dead status, sex, and age class for
animals with and without signs of infectious keratoconjunctivitis. Kid (,1 yr old), yearling (1 yr old), young
adult (2–3 yr old), prime adult (4–10 yr old), old adult ($11 yr old).

Ibex Chamois

Asymptomatic Symptomatic Asymptomatic Symptomatic

(n5447) (n5115) (n5207) (n589)

Alive 86 21 15 2
Deada 361 94 192 87
Male 240 60 124 34
Female 205 54 80 53
Unknown sex 2 1 3 2
Kid 2 3 12 11
Yearling 26 4 28 8
Young 145 20 48 18
Prime 203 58 90 36
Old 66 30 25 16
Unknown age 5 0 4 0
a
Hunted, culled, shot because of disease, or found dead.

or perforation. Samples were conserved at 4 C 90 chamois). Most samples from dead animals
and sent within 48 hr to the laboratory. were collected during the hunting season in
We obtained samples from 654 animals September–October (334/361 ibex, 92.5%;
without IKC signs (Table 1). Four hundred 161/192 chamois, 83.9%). Captured animals
and two animals were sampled in 2008 (285 were mostly sampled in April–June (73/86
ibex, 117 chamois) and 252 in 2009 (162 ibex, ibex, 84.9%; 13/15 chamois, 86.7%). Thirteen
of the captured ibex were part of a telemetry
study in the Albris region (Signer et al., 2011)
and had already been tested in 2007 (Ryser-
Degiorgis et al., 2009). At that time, 10 of
these 13 ibex were identified as healthy
carriers of M. conjunctivae.
Additionally, samples from 204 animals (115
ibex, 89 chamois) presenting various IKC
stages were collected from 2008 to 2010
(Table 1). Diagnostic testing was possible for
375/408 eyes (206 from ibex, 169 from
chamois). For four animals, only one eye was
sampled. With the exception of 11 cases, all
the IKC animals came from the same regions
as the asymptomatic animals.
Animals of both species were categorized in
FIGURE 1. Map of Switzerland showing the five age classes (Table 1) according to their
regions of origin of Alpine ibex (Capra ibex ibex) dispersal and segregation behavior as well as
and Alpine chamois (Rupicapra rupicapra rupica- aging process (Stringham et al., 1974; Loison
pra) without signs of infectious keratoconjunctivitis et al., 2008; Ryser-Degiorgis et al., 2009;
sampled in 2008–09; 15Jura West, 25Jura east, Schnidrig-Petrig and Salm, 2009). In addition
35Dent-de-Lys, 45Vanil noir, 55Cape-au-Moine, to the calendar seasons, four biologic periods
65Diablerets, 75Oberwallis right riverside, were defined according to social behavior
85Oberwallis left riverside, 95Längenegg, 105Alp- (Bon et al., 2001; Giacometti et al., 2004;
stein, 115Churfirsten, 125Oberalp-Calanda, Schnidrig-Petrig and Salm, 2009), because
135Rheinwald, 145Julier, 155Flüela, 165Brega- variations in the frequency and intensity of
glia, 175Albris, 185Macun. Except for several intraspecific contacts may influence the spread
reintroduced individuals in region 1, ibex occur only of pathogens: rut (ibex: December–January;
in the Alps (regions 3–18), whereas chamois are chamois: November–December), gestation
widely distributed both in the Alps and the Jura (ibex: February–May; chamois: January–
Mountains (regions 1 and 2). April), birth period (ibex: June–July; chamois:
622 JOURNAL OF WILDLIFE DISEASES, VOL. 48, NO. 3, JULY 2012

TABLE 2. Description of primers used for conventional PCR and sequencing of Mycoplasma conjunctivae.

Primer Sequence (59–39) Positiona Reference

Ser_start3 TTTAGTAGACTCCACTTCACC 3731–3751 Belloy et al. (2003b)

Ser_start2 CACTATACTTAACAGATAGTCC 3781–3802 This study
lppTA GGCACTAATAGTGCGTAATTC 5065–5045 This study
lppTA2 TTTGATCTCTCCACCTTCAGC 5113–5093 This study
a
Based on nucleotide sequence with EMBL/GenBank accession number AJ318939, the lppS-lppT operon of M.
conjunctivae type strain HRC/581 (Belloy et al., 2003b).

May–June), and lactation (ibex: August–No- Statistics

vember; chamois: July–October). Statistical tests were performed with NCSS
Disease signs were classified into four 2007 software (NCSS, Kaysville, Utah, USA).
categories, according to a histologic study Significance was set at 0.05 for all tests.
(Mayer et al., 1997) and an experimental Differences in prevalences were tested using
infection (Giacometti et al., 1998) in ibex: Fisher’s exact test (FET). Association of ocular
05asymptomatic (no noticeable change), discharge and bilateral signs with M. conjunc-
15mild signs (subtle to marked ocular dis- tivae infection was assessed using logistic
charge in absence of visible corneal lesions), regression after testing significance at the
25moderate signs (ocular discharge and univariate level (FET, P,0.05). Statistical
corneal opacity), 35severe signs (ocular dis- effect of the parameters was determined by
charge and corneal lesions including neovas- estimating their contribution to total deviance.
cularization up to perforation). All animals Differences in mycoplasma load between
with reported ocular signs 1–3 were consid- groups were tested using the Mann-Whitney-
ered as IKC cases and classified according to Wilcoxon test, considering single eyes and not
the most severely affected eye. Because individuals. P-values were adjusted for an
previous studies (Mayer et al., 1997; Giaco- estimated intereye correlation of 0.8 (Spear-
metti et al., 1998) showed that ocular dis- man’s rho, P,0.001) as described (Rosner,
charge is typical for IKC, 17 ibex and 13 1982).
chamois with ocular lesions but no discharge
were considered as presenting atypical signs.
RESULTS
Laboratory analyses
Prevalence in asymptomatic animals
Conjunctival swabs were lysed and tested
for M. conjunctivae by TaqMan real-time PCR Overall, 5.6% of the asymptomatic ibex
according to previously established protocols (95% confidence interval [CI]: 3.7–8.1%)
(Vilei et al., 2007). Strain analysis was per- and 5.8% of the asymptomatic chamois
formed by conventional PCR and sequencing (95% CI: 3.0–9.9%) were positive for M.
of the lysates from the eyes of 27 animals
conjunctivae (Table 3). Differences in prev-
including seven asymptomatic (six ibex, one
chamois) and 18 symptomatic animals (nine alence between species, genders, and living
ibex, nine chamois) sampled in the same versus dead animals were not significant.
regions and year period, and two of the 13 Four of the 13 recaptured ibex from the
asymptomatic ibex in the Albris colony already telemetry study in Albris were presently
tested in 2007.
healthy carriers of M. conjunctivae. Of those
Mycoplasma DNA amplification from lysates
was performed with a modification of the four animals, three were already positive in
conventional lppS-based PCR (Belloy et al., 2007. None of the 13 animals developed any
2003a), using the primer set Ser_start3/IppTA2 IKC sign from their first capture until
(Table 2). A nested PCR was employed for months after the second capture.
samples with a lower mycoplasma load, using the
primer set Ser_start3/IppTA2 (Table 2). Se- Season: All positive chamois were sam-
quencing and cluster analysis were performed pled in September except for one animal
following existing methods (Belloy et al., 2003a)
and phylogenetic relationship between strains killed in December in Jura West. In ibex,
was assessed using the program Bionumerics 5.1 20/25 (80.0%) healthy carriers were sam-
(Applied Maths, Kortijk, Belgium). pled from September to November, and
 MAVROT ET AL.—MYCOPLASMA CONJUNCTIVAE IN WILD CAPRINAE WITH AND WITHOUT OCULAR SIGNS 623

TABLE 3. Regional prevalences of healthy carriers of Mycoplasma conjunctivae in free-ranging Alpine ibex
(Capra ibex ibex) and Alpine chamois (Rupicapra rupicapra rupicapra) in Switzerland, 2008–09. Regions are
numbered according to Figure 1. Animals sampled during an outbreak of infectious keratoconjunctivitis
(IKC) are shown in parentheses.

Positive/totala
Region
no. Region Ibex Chamois IKC presence

1 Jura west — 1/31 Rare mild cases in 2008

2 Jura east — 1/5 No IKC case ever reported
3 Dent-de-Lys — 0/1 No known IKC case in 2008–09
4 Vanil noir 0/3 0/1 No known IKC case in 2008–09
5 Cape-au-Moine 0/46 0/1 Severe outbreak in fall–winter
2008–09 in ibex, only few mild
cases in chamois
6 Diablerets — 0/6 Severe outbreak in fall–winter
2008–09 in ibex, only few mild
cases in chamois
7 Oberwallis, right riverside 0/1 0/3 Sporadic in both species
8 Oberwallis, left riverside 4/56 (1/1) 1/51 Regular low incidence in both
species, local outbreak in win-
ter 2008–09 in ibex
9 Längenegg — 1/3 Sporadic in chamois
10 Alpstein 0/4 0/6 Sporadic in chamois
11 Churfirsten 0/5 0/14 Sporadic in chamois
12 Oberalp-Calanda 3/40 1/23 (0/11) Severe outbreak in 2007–08 in
chamois, only two mild cases in
ibex
13 Rheinwald 0/2 0/2 (0/2) Outbreaks in chamois in summer
2008 and in fall 2009
14 Julier 5/77 0/16 Seven mild cases in ibex in
summer 2008
15 Flüela 5/39 (5/39) 5/29 (5/29) Multiple outbreaks in 2008–09 in
chamois and ibex
16 Bregaglia — 2/9 (0/2) Local outbreak in summer 2008
in chamois
17 Albris 8/174 0/4 Sporadic in both species
18 Macun — 0/2 Rare cases in ibex in 2008
Total 25/447 (6/40) 12/207 (5/44)
a
Dashes indicate no animals tested.

four (16.0%) were sampled in the spring. was positive to M. conjunctivae. In cham-
There was no significant difference in ois, no differences in prevalence were
prevalence between ibex sampled in found between age categories.
spring, summer, or fall (4.3, 2.3, and
6.6%). One of two ibex sampled during Region: Healthy carriers were found in 5/

winter was positive for M. conjunctivae. In 11 regions (45.0%) for ibex and in 7/18
both species, there were no differences in regions (39.0%) for chamois (Table 3). In
prevalence between biologic periods. these regions, prevalences ranged from
4.6% to 12.8% in ibex and from 2.0% to
Age: In ibex, prevalence of M. conjunc- 33.3% in chamois. Presence of healthy
tivae in yearlings (19.2%) was higher than carriers during both sampling years was
in adults (5.1%, P50.009). There was no detected in 3/5 regions for ibex and only
difference between young, prime, and old 1/7 region for chamois.
adults (4.1, 5.9, and 1.5%, respectively). During our study, an IKC outbreak was
One out of two asymptomatic ibex kids reported from seven sampling regions. A
624 JOURNAL OF WILDLIFE DISEASES, VOL. 48, NO. 3, JULY 2012

2009, P50.208). In the ibex colonies

already studied in 2006–07 (Ryser-Degior-
gis et al., 2009), the overall prevalence was
lower in 2008–09 (5.6%) than in 2006–07
(17.9%, P,0.001). In 5/9 colonies exam-
ined in both periods, there was a decrease
FIGURE 2. Distribution of Alpine ibex (Capra in prevalence of healthy carriers ranging
ibex ibex) and Alpine chamois (Rupicapra rupicapra from 7.1 to 25.0 percentage points. In
rupicapra; numbers and percentages) sampled in contrast, a prevalence increase occurred in
2008–10 in Switzerland and tested for Mycoplasma
conjunctivae, according to the observed signs (atyp-
two colonies (7.5 and 12.8 percentage
ical, mild, moderate, and severe) of infectious points, respectively). Finally, no healthy
keratoconjunctivitis. The eye with the most severe carriers were detected in one colony
signs was considered to classify individuals. (Churfirsten) in both periods.
sporadic occurrence or a low but regular Detection frequency in diseased animals
incidence of cases was observed in eight IKC signs: In our sample set, ibex had
regions, and no cases were noticed in milder signs than chamois (Fig. 2), with
three regions (Table 3). For both species, fewer animals with severe signs (P50.012)
prevalence of healthy carriers in animals
and more animals showing mild signs
sampled at the time of an outbreak was
(P50.002). In both species, detection
higher (ibex: 6/40, 15.0%; chamois: 5/44,
frequency (DF) of M. conjunctivae was
11.4%) than in nonepidemic situations
significantly higher in animals showing
(ibex: 19/407, 4.7%; chamois: 7/163,
bilateral or typical signs but only typical
4.3%). This difference was significant for
signs appeared as a significant predictor of
ibex (P50.017) but not for chamois
an infection in the logistic regression
(P50.138). Interestingly, an asymptomatic
(Table 4). Eight of 11 (72.7%) hunted
chamois was positive for M. conjunctivae
ibex with ocular lesions sampled in
in the region Jura East, which has no
autumn 2008 in Albris, where no IKC
known history of IKC.
outbreak was reported during the study,
Year: Difference between 2008 and 2009 showed atypical lesions, and only 2/11
was significant for chamois (2.6% healthy (one with atypical lesions and one with
carriers in 2008, 9% in 2009, P50.034) mild IKC signs) were weakly positive for
but not for ibex (6.7% in 2008, 3.6% in M. conjunctivae.

TABLE 4. Outcome of the TaqMan PCR diagnostic for Mycoplasma conjunctivae in Alpine ibex (Capra ibex
ibex) and Alpine chamois (Rupicapra rupicapra rupicapra) sampled in Switzerland, 2008–10 depending on
the type of infectious keratoconjunctivitis (IKC) signs (atypical: absence of ocular discharge; typical: presence
of ocular discharge) and the number of eyes showing signs (unilateral or bilateral). The number of animals
positive in both eyes are given in parentheses. Logistic regression indicated that ocular discharge is likely to
predict the TaqMan PCR outcome (ibex: change in deviance DD54.667, P50.031; chamois: DD57.310,
P50.007), in contrast to the number of eyes with IKC signs (ibex: DD53.238, P50.072; chamois:
DD50.919, P50.338).

Atypical IKC signs Typical IKC signs

Species TaqMan Unilateral Bilateral Total Unilateral Bilateral Total

Ibex Negative 5 8 13 11 43 54
Positive 1 (0) 1 (1) 2 (1) 3 (1) 43 (34) 46 (35)
Total 6 9 15 14 86 100
Chamois Negative 4 4 8 2 17 19
Positive 1 (0) 1 (1) 2 (1) 2 (1) 58 (49) 60 (50)
Total 5 5 10 4 75 79
 MAVROT ET AL.—MYCOPLASMA CONJUNCTIVAE IN WILD CAPRINAE WITH AND WITHOUT OCULAR SIGNS 625

FIGURE 3. Detection frequency of Mycoplasma

conjunctivae in Alpine ibex (Capra ibex ibex) and
Alpine chamois (Rupicapra rupicapra rupicapra)
under epidemic and nonepidemic situations in FIGURE 4. Notched box plot showing mycoplas-
Switzerland in 2008–10, depending on the stages of ma loads in Alpine ibex (Capra ibex ibex) and Alpine
infectious keratoconjunctivitis. Stages 1–3 (mild, chamois (Rupicapra rupicapra rupicapra) sampled
moderate, and severe signs) are indicated on the x- in Switzerland in 2008–10 (ibex: panel A; chamois:
axis. Detection frequency is given in percentage of panel B) and line graph showing the median
positives on the y-axis. P-values are given for mycoplasma loads (panel C) depending on the stage
statistically significant differences between epidemic of infectious keratoconjunctivitis. Stages 0–3 (healthy
and nonepidemic situations. carrier, mild, moderate, and severe signs) are
indicated on the x-axis. The mycoplasma load
Epidemiologic situation: Detection frequency represents the amount of Mycoplasma conjunctivae
was higher in epidemic than in non- cells found in the lysate obtained from each eye
epidemic situations. This difference was swab. Significant differences between medians: in
panel A (ibex): 0,1, 2, and 3 (P,0.001), 1,2 and 3
significant in all three IKC stages in ibex
(P50.019 and P50.049); in panel B (chamois): 0,1
(Fig. 3). In epidemic situations, there was (P50.04), 0,2 and 3 (P,0.001), 1,2 and 3,
no significant difference in DF between (P50.009 and P50.018). In panel C, P-values are
species. In nonepidemic situations, DF given for significant differences between the
was higher in chamois than in ibex two species.
(P,0.001), especially in animals with mild
626 JOURNAL OF WILDLIFE DISEASES, VOL. 48, NO. 3, JULY 2012

presented a sequence divergence .5%

from all others except strains A and F,
which differed by only 0.4%. Mixed
infections with two or more strains per
animal were not observed. Four strains (A,
B, D, and G) were found in both species,
and three strains (A, C, and D) were found
in symptomatic and asymptomatic animals.
In Flüela (region 15 in Fig. 1), where
multiple outbreaks in ibex and chamois
occurred during the 2 yr of the study, two
strains (A and B) were found both in 2008
and 2009. However, strain A predominated
(11/14 animals). In Oberalp-Calanda (re-
gion 12), the chamois population under-
FIGURE 5. Phylogenetic relationship of the var-
went a severe epidemic of IKC in 2007–08
iable domain of the lppS gene of seven strains of with hundreds of fatal cases, while only two
Mycoplasma conjunctivae isolated from Alpine ibex cases of mild IKC were observed among
(Capra ibex ibex) and Alpine chamois (Rupicapra ibex. Strain D was isolated from a symp-
rupicapra rupicapra) originating from various Swiss tomatic chamois and an asymptomatic ibex
regions in 2007–09. Distance matrix was calculated
by the Jukes-Cantor algorithm and the cluster
from this region in 2008. Strain G was
analysis tree was built by the UPGMA method. found in four symptomatic ibex and a
The scale bar represents the percentage of symptomatic chamois in la Cape-au-Moine
sequence divergence. Numbers in parentheses (region 5) during an outbreak that severely
following the region names correspond to numbers affected the local ibex population in
in Figure 1.
regions 5 and 6 but caused only few mild
cases of IKC in the sympatric chamois
and moderate signs (P50.012 and
population during the winter of 2008–09.
P50.001, respectively). Mycoplasma con-
Strains E and F were found in asymptom-
junctivae was detected in one chamois
atic ibex captured in 2007 in Albris (region
from Jura East presenting mild IKC signs.
17) but were not identified again in 2008–
Mycoplasma load 09. The ibex with strain E was captured
again in 2009. This time, strain A (also
In both species, mycoplasma load was detected in the neighboring region 15) was
significantly lower in samples from asymp- found in its eyes. This animal did not
tomatic animals than from animals with develop IKC lesions during the months
lesions of any category of IKC. Loads in between the two captures and the months
eyes with mild signs were generally lower following its second capture.
than in eyes with more pronounced IKC
(Fig. 4A, B). Overall, symptomatic ibex DISCUSSION
had a higher load than symptomatic
chamois (P,0.001). This difference was Prevalence in asymptomatic animals
also significant in moderate and severe We have shown that healthy carriers of
stages of the disease (Fig. 4C). M. conjunctivae occur both in ibex and
chamois. Prevalence presented consider-
Strain analysis
able temporal and regional variations but
Seven strains were identified by cluster was low overall (,6% in both species).
analysis in 27 animals from five regions Prevalence in ibex was significantly lower
sampled from 2007 to 2009 (strains A, B, C, than the previously estimated prevalence of
D, E, F, and G; Fig. 5). All strains nearly 20% (Ryser-Degiorgis et al., 2009).
 MAVROT ET AL.—MYCOPLASMA CONJUNCTIVAE IN WILD CAPRINAE WITH AND WITHOUT OCULAR SIGNS 627

This may be explained by the smaller which is concordant with observations

sample size in the former study and the made during earlier outbreaks (Degiorgis
variations that we pointed out in the present et al., 2000b; Tschopp et al., 2005) and DF
work, with regional prevalences of up to obtained with the same diagnostic methods
12.8% in ibex and 22.2% in chamois. In (Vilei et al., 2007). Furthermore, the low
contrast to the former study in ibex, we did DF in animals with atypical signs of IKC
not find any difference in prevalence (i.e., without ocular discharge) confirms
between captured and dead ibex or between that the latter is a cardinal sign of the
seasons and we conclude that the previous disease in wild Caprinae.
findings were due to sampling bias. Fur- In nonepidemic situations, the associa-
thermore, we newly found a significantly tion between ocular lesions and detection of
higher proportion of healthy carriers in M. conjunctivae was less clear. Detection
yearling ibex than in older animals. frequency was particularly low in ibex.
Healthy carriers were detected more Together with the observed cluster of
often in regions undergoing an outbreak atypical cases that were negative for M.
than in regions with only a low but regular conjunctivae in Albris, these results suggest
incidence of IKC cases. This raises the that other infectious agents may be involved
questions of whether 1) positive asymptom- in the development of IKC-like signs in this
atic animals were true healthy carriers, 2) species. A number of bacteria such as
they were in an early stage of the infection Staphylococcus, Branhamella ovis, Morax-
and would have developed signs of the ella ovis, or Chlamydophila spp. have been
disease later, or 3) they had recovered from suspected to cause IKC in small ruminants
the disease but not yet fully cleared the but have not been identified as the cause of
infection, as previously observed (Giaco- IKC outbreaks in wild Caprinae in previous
metti et al., 1998). However, M. conjuncti- studies (Mayer et al., 1996; Giacometti
vae was detected twice in several asymp- et al., 2002a; Holzwarth et al., 2011). Never-
tomatic ibex at a 2-yr interval. These ibex theless, they should be considered as
have been followed since their first capture possible etiologic agents when detection of
in 2007 (Signer et al., 2011) and no IKC M. conjunctivae is unsuccessful. Previous
signs were observed. Strain analysis even studies failed to demonstrate the involve-
indicated clearing of infection and reinfec- ment of viruses in the pathogenesis of IKC
tion with another strain in one of them. It is (Costa, 1986; Mayer et al., 1996); however,
still unclear whether protective immunity the suspected role of herpesvirus in the
can be acquired following a first contact early stage of IKC in reindeer (Tryland
with the agent or whether other mecha- et al., 2009) revives the interest in viruses as
nisms, such as genetic resistance or envi- possible etiologic agents in nonmycoplasma
ronmental factors, are involved in disease IKC of wild Caprinae.
pathogenesis. Importantly, however, these
results indicate that wild Caprinae can go Occurrence of M. conjunctivae in free-ranging
wild Caprinae
through an infection with M. conjunctivae
without developing eye lesions. To our knowledge, ours is the first
report of M. conjunctivae in wild Caprinae
Detection frequency in symptomatic animals
in the Jura Mountains, which have been,
We confirmed that IKC can occur until now, free of IKC outbreaks. Both a
following two main epidemiologic patterns, mild IKC case and healthy carriers of M.
namely epidemic (outbreaks) and none- conjunctivae were detected in this biore-
pidemic (sporadic occurrence or regular gion, indicating pathogen presence in the
cases but at low incidence). In epidemic absence of high morbidity.
situations, we found a clear association Based on serologic surveys, Giacometti
between the pathogen and the disease, et al. (2002b) and Janovsky et al. (2001)
628 JOURNAL OF WILDLIFE DISEASES, VOL. 48, NO. 3, JULY 2012

suggested that IKC is not maintained in Such a relationship has already been de-
wild Caprinae populations and that do- scribed in human and porcine mycoplasma-
mestic sheep constitute a reservoir for the associated diseases (Ritzmann et al., 2009;
agent. This hypothesis relied on the Nilsson et al., 2010) as well as in viral ocular
observation of a low antibody prevalence diseases in humans (Asano et al., 2004), and
in chamois (,8%) and a high prevalence provides further evidence for the etiologic
in sheep (.50%). Likewise, our data in importance of M. conjunctivae in IKC.
wild Caprinae (Ryser-Degiorgis et al., Some of the IKC outbreaks reported in
2009; this study) do not suggest an overall our study affected ibex and chamois in the
high prevalence of M. conjunctivae in the same way, whereas in other outbreaks,
absence of outbreaks. Nevertheless, we only ibex or only chamois underwent
documented a widespread occurrence of severe losses. In both situations, both
M. conjunctivae both in ibex and chamois, species carried the same strains, suggest-
with and without IKC signs, even outside ing possible species-related differences in
the summer grazing season (May–Octo- pathogenic potential of some strains of M.
ber). Moreover, infection with M. con- conjunctivae. Because chamois and ibex
junctivae can persist several months in share habitat and interspecific interactions
ibex (Giacometti et al., 1998; Ryser- commonly occur (Gauthier, 1991; Ryser-
Degiorgis et al., 2009) and IKC outbreaks Degiorgis et al., 2002, 2009), the involve-
apparently last longer in territories shared ment of the less-affected species in disease
by different groups of chamois (Gauthier, propagation during outbreaks must be
1991). It has been demonstrated that considered. Ibex were already proposed
certain pathogens can persist in a popula- as source of infection of M. conjunctivae
tion between epidemic episodes (e.g., during outbreaks affecting chamois
measles virus; Bartlett, 1957), as long as (Tschopp et al., 2005, Ryser-Degiorgis
the number of susceptible individuals does et al., 2009). Our findings suggest that the
not drop under a critical threshold (Dere- relationship could also work the other way
dec and Courchamp, 2003). In smaller around. However, in this study chamois
populations, persistence is also possible, seemed generally more affected by the
even with low incidence, provided that disease. First, in our sample set more
pathogens circulate among moderately chamois presented severe signs than ibex
connected subpopulations and that inter- although sampling effort was similar for all
specific transmission is recurrent (e.g., disease stages in both species. This is
distemper virus; Almberg et al., 2010). consistent with previous observations
Therefore, we believe that an endemic (Gauthier, 1991; Giacometti et al., 1997).
presence of M. conjunctivae in wild Second, we found a lower mycoplasma
mountain ungulates cannot be excluded load in chamois compared to ibex for the
on large territories used by interconnected same IKC stages. Overall, our results
subgroups of wild ungulates, although this suggest that species-related factors deter-
would not rule out sheep as a potential mine the outcome of an infection.
source of infection. The lppS gene is strain-specific (Belloy
et al., 2003a) and it was hypothesized that
Factors influencing the expression of IKC
characteristics of this gene are decisive for
Our results confirm that mycoplasma the virulence of the strain of M. conjunc-
load is significantly lower in healthy carriers tivae (Belloy et al. 2003b). However, in our
than in symptomatic animals (Ryser- study, the same strains were found in IKC
Degiorgis et al., 2009). We further report animals and in conspecific healthy carriers.
that an increase in severity of signs is In addition, one strain that was associated
associated with an increase of the myco- with a severe outbreak was also detected in
plasma load, both in ibex and chamois. the nonepidemic neighboring region. This
 MAVROT ET AL.—MYCOPLASMA CONJUNCTIVAE IN WILD CAPRINAE WITH AND WITHOUT OCULAR SIGNS 629

suggests that the strain alone is insufficient LITERATURE CITED

to explain the expression or absence of ALMBERG, E. S., P. C. CROSS, AND D. W. SMITH. 2010.
signs in individuals or the onset of an Persistence of canine distemper virus in the
outbreak among a population. Involvement Greater Yellowstone ecosystem’s carnivore com-
munity. Ecological Applications 20: 2058–2074.
of population and environmental factors ASANO, S., T. YOSHIKAWA, H. KIMURA, Y. ENOMOTO, M.
such as overcrowding, genetic predisposi- OHASHI, H. TERASAKI, AND Y. NISHIYAMA. 2004.
tion, acquired resistance, sun exposure, or Monitoring herpesviruses DNA in three cases of
altitude have already been proposed as acute retinal necrosis by real-time PCR. Journal
possibly involved in the development of the of Clinical Virology 29: 207–210.
BARTLETT, M. S. 1957. Measles periodicity and
disease (Nicolet, 1985; Costa, 1986; Giaco- community size. Journal of the Royal Statistical
metti et al., 2002a) and should be further Society Series A General 120: 48–70.
considered. BELLOY, L., M. JANOVSKY, E. M. VILEI, P. PILO, M.
GIACOMETTI, AND J. FREY. 2003a. Molecular
Conclusion epidemiology of Mycoplasma conjunctivae in
Caprinae: Transmission across species in natural
We provide further evidence for the outbreaks. Applied and Environmental Microbi-
central role of M. conjunctivae in the ology 69: 1913–1919.
pathogenesis of IKC in wild Caprinae, in ———, E. M. VILEI, M. GIACOMETTI, AND J. FREY.
particular in epidemic situations. We also 2003b. Characterization of LppS, an adhesin of
Mycoplasma conjunctivae. Microbiology 149:
suggest that maintenance of the disease in 185–193.
wild Caprinae populations should be BIJLENGA, G., J. TEKTOFF, Y. RICHARD, L. JOUBERT, J.
considered. Mycoplasma load is associated GASTELLU, M. PRAVE, O. DUMONT, C. FAVIER, AND
with, and possibly determines, the expres- J. OUDAR. 1983. Isolement de cinq souches de
sion and severity of IKC signs, but factors ‘‘Ricksettia’’ des lésions de kérato-conjonctivite
du chamois ou du bouquetin et du mouton
influencing multiplication of M. conjunc- d’alpage. Sciences Vétérinaires Médecine Com-
tivae in the eyes remain to be identified. parée 85: 267–281.
Finally, strains probably represent only one BON, R., C. RIDEAU, J. VILLARET, AND J. JOACHIM.
component of a complex multi-factorial 2001. Segregation is not only a matter of sex in
disease. Alpine ibex, Capra ibex ibex. Animal Behaviour
62: 495–504.
COSTA, R 1986. Contribution à l’étude étiologique de
ACKNOWLEDGMENTS
la kératoconjonctivite du chamois (Rupicapra
Many thanks to the hunting authorities of rupicapra) et du bouquetin (Capra ibex).
the investigated regions for taking part in this Veterinary Thesis, University Claude Bernard
study and to the state gamekeepers, hunters, of Lyon, France, 105 pp.
and collaborators of the Swiss National Park CRESTANELLO, B., E. PECCHIOLI, C. VERNESI, S. MONA,
for collecting samples and taking part to the N. MARTı́NKOVÁ, M. JANIGA, H. C. HAUFFE, AND G.
survey. We acknowledge the collaborators of BERTORELLE. 2009. The genetic impact of translo-
the Centre for Fish and Wildlife Health (M. cations and habitat fragmentation in chamois
Batista Linhares, J. Casaubon, J. Fattebert, G. (Rupicapra spp.) Journal of Heredity 100: 691–708.
Gelormini, H. Greter, A. Michel, S. Röösli, DEGIORGIS, M.-P., E.-M. ABDO, J. NICOLET, J. FREY,
and M. Weber) for their support in the D. MAYER, AND M. GIACOMETTI. 2000a. Immune
laboratory and for computer work. Special responses to Mycoplasma conjunctivae in Alpine
thanks to the colleagues of the Institute of ibex, Alpine chamois, and domestic sheep in
Veterinary Bacteriology (P. Pilo, Y. Schlatter, Switzerland. Journal of Wildlife Diseases 36:
and P. Vanden Bergh) for their help and 265–271.
advice in biomolecular techniques, to C. ———, J. FREY, J. NICOLET, E.-M. ABDO, R. FATZER,
Willisch (FaunAlpin GmbH, Switzerland) for Y. SCHLATTER, S. REIST, M. JANOVSKY, AND M.
information on wild Caprinae biology, to F. GIACOMETTI. 2000b. An outbreak of infectious
Zimmermann (KORA, Switzerland) and M. keratoconjunctivitis in Alpine chamois (Rupicapra
Doherr (Veterinary Public Health Institute, r. rupicapra) in Simmental-Gruyères. Schweizer
University of Bern, Switzerland) for statistical Archiv für Tierheilkunde 142: 520–527.
advice, and to H. Segner for critical reading of DEREDEC, A., AND F. COURCHAMP. 2003. Extinction
the manuscript. This study was funded by the thresholds in host–parasite dynamics. Annales
Swiss Federal Office of the Environment. Zoologici Fennici 40: 115–130.
630 JOURNAL OF WILDLIFE DISEASES, VOL. 48, NO. 3, JULY 2012

GAUTHIER, D. 1991. La kérato-conjonctivite infec- patterns of chamois (Rupicapra rupicapra) off-

tieuse du chamois. Etude épidémiologique dans spring. Canadian Journal of Zoology 86: 588–593.
le Département de la Savoie 1983–1990. Veter- MARREROS, N., D. HÜSSY, S. ALBINI, C. F. FREY, C.
inary Thesis, University Claude Bernard of ABRIL, H.-R. VOGT, N. HOLZWARTH, S. WIRZ-
Lyon, France, 107 pp. DITTUS, M. FRIESS, M. ENGELS, N. BOREL, C. S.
GIACOMETTI, M., M.-P. DEGIORGIS, D. MAYER, M. WILLISCH, C. SIGNER, L. E. HOELZLE, AND M.-P.
KRAWINKLER, AND J. NICOLET. 1997. Epidémiolo- RYSER-DEGIORGIS. 2011. Epizootiologic investiga-
gie des infections à Mycoplasma conjunctivae tions of selected abortive agents in free-ranging
chez le bouquetin, le chamois et le mouton dans Alpine ibex (Capra ibex ibex) in Switzerland.
les Alpes suisses. Bulletin de la Société Neuchâ- Journal of Wildlife Diseases 47: 530–543.
teloise des Sciences Naturelles 120: 27–34. MAYER, D., J. NICOLET, M. GIACOMETTI, M. SCHMITT,
———, J. NICOLET, J. FREY, M. KRAWINKLER, W. T. WAHLI, AND W. MEIER. 1996. Isolation of
MEIER, M. WELLE, K. JOHANSSON, AND M.-P. Mycoplasma conjunctivae from conjunctival
DEGIORGIS. 1998. Susceptibility of Alpine ibex to swabs of Alpine ibex (Capra ibex ibex) affected
conjunctivitis caused by inoculation of a sheep- with infectious keratoconjunctivitis. Journal of
strain of Mycoplasma conjunctivae. Veterinary Veterinary Medicine, Series B 43: 155–161.
Microbiology 61: 279–288. ———, M.-P. DEGIORGIS, W. MEIER, J. NICOLET, AND
———, M. JANOVSKY, L. BELLOY, AND J. FREY. 2002a. M. GIACOMETTI. 1997. Lesions associated with
Infectious keratoconjunctivitis of ibex, chamois infectious keratoconjunctivitis in Alpine ibex.
and other Caprinae. Revue Scientifique et Journal of Wildlife Diseases 33: 413–419.
Technique (International Office of Epizootics) NICOLET, J. 1985. Experiences on keratoconjunctivitis
21: 335–345. in chamois in Switzerland. In Atti Simposio
———, ———, H. JENNY, J. NICOLET, L. BELLOY, E. internazionale sulla cheratocongiuntivie infettiva
GOLDSCHMIDT-CLERMONT, AND J. FREY. 2002b. del camoscio, Vercelli, Italy, T. Balbo, P.
Mycoplasma conjunctivae infection is not main- Lanfranchi, L. Rossi and P. Stero (eds.).
tained in Alpine chamois in eastern Switzerland. Univercittà, Torino, Italy, pp. 53–61.
Journal of Wildlife Diseases 38: 297–304. NICOLET, J. AND E. A. FREUNDT. 1975. Isolation of
GRATTAROLA, C., J. FREY, E. ABDO, R. ORUSA, J. Mycoplasma conjunctivae from chamois and sheep
NICOLET, AND M. GIACOMETTI. 1999. Mycoplasma affected with kerato-conjunctivitis. Zentralblatt für
conjunctivae infections in chamois and ibexes Veterinärmedizin Reihe B 22: 302–307.
affected with infectious keratoconjunctivitis in the NILSSON, A., P. BJORKMAN, C. WELINDER-OLSSON, A.
Italian Alps. Veterinary Record 145: 588–589. WIDELL, AND K. PERSSON. 2010. Clinical severity
HOLZWARTH, N., A. POSPISCHIL, F. MAVROT, E. M. of Mycoplasma pneumoniae (MP) infection is
VILEI, M. HILBE, K. ZLINSZKY, N. REGENSCHEIT, associated with bacterial load in oropharyngeal
M. PEWSNER, R. THOMA, AND N. BOREL. 2011. secretions but not with MP genotype. BMC
Occurrence of Chlamydiaceae, Mycoplasma Infectious Diseases 10: 39.
conjunctivae and pestiviruses in Alpine chamois RATTI, P. 1967. Bericht über den Verlauf der Gems-
(Rupicapra r. rupicapra) of Grisons, Switzer- blindheit im Jahre 1966 in Graubünden. Schwei-
land. Journal of Veterinary Diagnostic Investi- zer Archiv für Tierheilkunde 109: 401–403.
gation 23: 333–337. RITZMANN, M., J. GRIMM, K. HEINRITZI, K. HOELZLE,
HOSIE, B. D. 2007. Infectious keratoconjunctivitis. In AND L. HOELZLE. 2009. Prevalence of Mycoplas-
Disease of sheep, I. D. Aitken (ed.). Blackwell ma suis in slaughter pigs, with correlation of
Publishing, Oxford, UK, pp. 343–345. PCR results to hematological findings. Veteri-
JAEGER, J. A. G., R. BERTILLER, C. SCHWICK, K. nary Microbiology 133: 84–91.
MÜLLER, C. STEINMEIER, K. C. EWALD, AND J. ROSNER, B. 1982. Statistical methods in ophthalmol-
GHAZOUL. 2008. Implementing landscape frag- ogy: An adjustment for the intraclass correlation
mentation as an indicator in the Swiss Monitor- between eyes. Biometrics 38: 105–114.
ing System of Sustainable Development RYSER-DEGIORGIS, M.-P., P. INGOLD, H. TENHU, A. M.
(Monet). Journal of Environmental Management TÉBAR LESS, A. RYSER, AND M. GIACOMETTI. 2002.
88: 737–751. Encounters between Alpine ibex, Alpine cham-
JANOVSKY, M., J. FREY, J. NICOLET, L. BELLOY, E. ois and domestic sheep in the Swiss Alps. Hystrix
GOLDSCHMIDT-CLERMONT, AND M. GIACOMETTI. 13: 1–11.
2001. Mycoplasma conjunctivae infection is self- ———, D. F. BISCHOF, N. MARREROS, C. WILLISCH,
maintained in the Swiss domestic sheep popu- C. SIGNER, F. FILLI, G. BROSI, J. FREY, AND E. M.
lation. Veterinary Microbiology 83: 11–22. VILEI. 2009. Detection of Mycoplasma conjunc-
KLINGER, K., J. NICOLET, AND E. SCHIPPER. 1969. tivae in the eyes of healthy, free-ranging Alpine
Neue Befunde über die Gemsblindheit. Schwei- ibex: Possible involvement of Alpine ibex as
zer Archiv für Tierheilkunde 111: 587–602. carriers for the main causing agent of infectious
LOISON, A., G. DARMON, S. CASSAR, J. JULLIEN, AND D. keratoconjunctivitis in wild Caprinae. Veterinary
MAILLARD. 2008. Age- and sex-specific settlement Microbiology 134: 368–374.
 MAVROT ET AL.—MYCOPLASMA CONJUNCTIVAE IN WILD CAPRINAE WITH AND WITHOUT OCULAR SIGNS 631

SCHNIDRIG-PETRIG, R., AND U. P. SALM. 2009. Die keratoconjunctivitis in semidomesticated rein-

Gemse: Biologie und Jagd. Salm Verlag, Bern, deer. Journal of Clinical Microbiology 47: 3707–
Switzerland, 207 pp. 3713.
SIGNER, C., T. RUF, AND W. ARNOLD. 2011. Hypome- TSCHOPP, R., J. FREY, L. ZIMMERMANN, AND M.
tabolism and basking: The strategies of Alpine GIACOMETTI. 2005. Outbreaks of infectious ker-
ibex to endure harsh over-wintering conditions. atoconjunctivitis in Alpine chamois and ibex in
Functional Ecology 25: 537–547. Switzerland between 2001 and 2003. Veterinary
STRINGHAM, S. F., AND A. B. BUBENIK. 1974. Physical Record 157: 13–18.
condition and survival rates of chamois (Rupi- VILEI, E. M., L. BONVIN-KLOTZ, L. ZIMMERMANN, M.-P.
capra rupicapra L.) as a function of maturity– RYSER-DEGIORGIS, M. GIACOMETTI, AND J. FREY.
sex class ratios in the population. Implications 2007. Validation and diagnostic efficacy of a
for ungulate harvest plans. In Tagungsbericht: TaqMan real-time PCR for the detection of
Internationales Gamswild-Treffen, W. Schroder Mycoplasma conjunctivae in the eyes of infected
(ed.). Institute for Wildforschung und Jagd- Caprinae. Journal of Microbiological Methods
kunde, Oberammergau, Germany, pp. 123–158. 70: 384–386.
TRYLAND, M., C. G. DAS NEVES, M. SUNDE, AND
T. MORK. 2009. Cervid herpesvirus 2, the Submitted for publication 7 April 2011.
primary agent in an outbreak of infectious Accepted 23 December 2011.