Han et al.

Stem Cell Research & Therapy (2019) 10:243

https://doi.org/10.1186/s13287-019-1324-8

RESEARCH Open Access

Lactobacillus reuteri extracts promoted

wound healing via PI3K/AKT/β-catenin/
TGFβ1 pathway
Nannan Han1, Lu Jia1, Yingying Su3, Juan Du1, Lijia Guo2, Zhenhua Luo1 and Yi Liu1*

Abstract
Background: The balance of oral microbiomes is crucial to maintain oral health. Microecological imbalance can
impair the function of mesenchymal stem cells (MSCs) and lead to delay wound healing. Probiotics is a promising
prevention approach for the treatment of oral inflammatory diseases caused by a bacterial infection. However, the
effect of probiotics on oral MSCs and wound healing is unclear. In the present study, we used one type of probiotics
Lactobacillus reuteri extracts to determine whether bacterial extracts could regulate the functions of gingiva MSCs
(GMSCs) and promote wound healing.
Methods: Lactobacillus reuteri was prepared with bacterial extracts using ultrasonic crushing apparatus. The effects of
Lactobacillus reuteri extracts on GMSCs were tested using the cell scratch migration, alkaline phosphatase (ALP) activity,
alizarin red staining, cell counting kit-8, real-time PCR, and western blot assays. To investigate the role of Lactobacillus
reuteri extracts in the wound in mice, the wound position of bilateral mesial gingival of the maxillary first molar was
established, the wound area with a size of 1 mm × 2 mm and the full thickness gingiva was removed. Mice with
wound were randomly distributed to two groups: injection of 0.9% NaCl (NS group) or injection of 50 μg/ml bacterial
extracts.
Results: We discovered that 50 μg/ml Lactobacillus reuteri extracts increased the capacities of migration, expression of
stem cell markers, osteogenic differentiation, and proliferation of GMSCs. In addition, local injection of 50 μg/ml
bacterial extracts could promote wound-healing process in mice models. Mechanistically, we found that Lactobacillus
reuteri extracts accelerated the process of wound healing via PI3K/AKT/β-catenin/TGFβ1 pathway.
Conclusions: These data showed that Lactobacillus reuteri extracts could activate the potentials of GMSCs, thus
promote wound healing. Our discovery provided the insight of the underlying mechanism activating functions of
MSCs and identified Lactobacillus reuteri extracts as a potential therapeutic strategy for accelerating oral wound
and potential application in the future dental clinic.
Keywords: Probiotics, Lactobacillus reuteri extracts, Mesenchymal stem cells, Wound healing, PI3K/AKT, β-Catenin,
TGFβ1

* Correspondence: lililiuyi@163.com
1
Laboratory of Tissue Regeneration and Immunology and Department of
Periodontics, Beijing Key Laboratory of Tooth Regeneration and Function
Reconstruction, School of Stomatology, Capital Medical University, Tian Tan
Xi Li No.4, Beijing 100050, People’s Republic of China
Full list of author information is available at the end of the article

© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Han et al. Stem Cell Research & Therapy (2019) 10:243 Page 2 of 11

Background revealed that Lactobacillus reuteri extracts could pro-

Oral wounds are usually caused by surgical removal of mote the migration abilities of GMSCs thus enhancing
the lesion, vulnus, recurrent ulcers, and radiation injury wound healing. Additionally, the local injection of Lacto-
and are characterized by oral mucosal and soft tissue de- bacillus reuteri extracts promoted wound healing
fects, ultimately leading to scar formation and tissue ad- process in mice via the PI3K/AKT/β-catenin/
hesion [1–3]. It is well known that oral wound healing is TGFβ1pathway. Our findings suggest a potential thera-
a complex and delicate process and involved in peutic strategy to restore oral soft tissue wound healing
hemostasis, inflammation, proliferation, and remodeling in the clinic.
[4]. At present, the therapeutic methods of oral wounds
are involved in the transplantation of skin tissue grafts Materials and methods
and microvascular free flap in the clinic; however, these Cell cultures
need plenty of tissues from patients and a large area of Healthy mice gingival tissues were attained from C57BL/
scarring will be stayed in the donor area [5, 6]. In recent 6 mice. Gingival tissues were used solutions of 75% etha-
years, mesenchymal stem cells (MSCs) therapies have nol and phosphate-buffered saline (PBS) to disinfect and
been demonstrated to promote tissue regeneration and wash. A solution of 3 mg/ml collagenase type I (Sigma-
enhance wound healing of skin and mucosa, which de- Aldrich, USA) and 4 mg/ml dispase (Sigma-Aldrich,
pend on multiple differentiation of MSCs or secretion of USA) were utilized to digest the tissues for one hour at
paracrine factors [7, 8]. However, the oral cavity is a 37 °C. Single GMSC suspensions were obtained by cell
complex and complete microecosystem in which a large passage using a 70-μm strainer (Falcon, BD Labware,
number of microorganisms are colonized. Under normal Franklin Lakes, NJ, USA). GMSCs were cultivated in a
physiological conditions, the balance of oral microecol- humidified incubator under 5% CO2 at 37 °C in DMEM
ogy could maintain oral health. Studies showed that alpha modified Eagle’s medium (Invitrogen, USA), re-
once the microecological balance was broken, the me- newal with 20% fetal bovine serum (FBS, Invitrogen),
tabolites of pathogenic bacteria and pathogenic bacteria 100 μg/ml streptomycin, 100 U/ml penicillin, and 2
could impair the function of mesenchymal stem cells mmol/l glutamine (Invitrogen). The culture medium was
(MSCs), thus leading to delayed wound healing [9, 10]. converted every three days.
Probiotics are a group of bacteria that are good for hu-
man health, the World Health Organization defines it as Animals
“a living microorganism that is beneficial to host health Eight-week-old female C57BL/6 mice were attained from
when taken in an appropriate dose.” Probiotics, includ- SPF Biotechnology Company (Beijing, China). Mice were
ing Lactobacillus, Bifidobacterium, Escherichia coli, and raised under the conditions of separate pathogen-free fa-
Enterococcus faecalis, which mainly protect the health of cilities, which temperature was controlled 25 °C and
the body by maintaining the balance of bacteria in the photoperiods were 12:12-h light. Mice were fed with a
host, secreting antimicrobial substances and regulating standard provision of food diet and free water. This
the immune response [11–14]. In recent years, more study agreement was validated following the Animal
and more studies have found that probiotics can not Care and Use Committee of Capital Medical University.
only regulate intestinal flora, but also improve oral flora. All animal researches were abided by the rules approved
Especially probiotics have been confirmed through inter- by the Beijing Stomatological Hospital, Capital Medical
action with oral pathogen to inhibit the growth of patho- University (Ethical Committee Agreement, Beijing Sto-
genic bacteria, thus playing an active role in the matological Hospital Ethics Review No. KQYY-201710-
maintenance of oral health and the prevention oral dis- 001).
eases, such as caries and chronic periodontitis, oral can-
didiasis and halitosis [15–17]. Some studies confirmed Bacterial strains culture and preparation of bacterial
that probiotics could promote skin wound healing on extracts
the back of rats by stimulating inflammatory process Lactobacillus reuteri ATCC 11284 were cultured on agar
[18, 19]. The probiotic Lactobacillus reuteri was previ- plates at 37 °C in an anaerobic chamber with MRS
ously reported to reduce gingival inflammation in (AOBOX, Beijing) for five to seven days. For experi-
humans [20–22], while whether it could also promote ments in vitro on GMSCs, Lactobacillus reuteri cells
wound caused by oral mucosal and soft tissue defects is were scraped and resuspended in 10 ml phosphate-
yet to be testified. Meanwhile, the impact of beneficial buffered solution (PBS), sonicated (30mim, 300 W, 10s
bacteria on MSCs is still unknown. sonication and 10s pause) with ultrasonic crushing ap-
In the present study, we investigated the effect of paratus (JYD-150, China) on an ice bath. The sonicated
Lactobacillus reuteri extracts on the regulation of MSCs preparation was centrifuged at 14,000 rpm for 20 min at
potential and the process of wound healing. Our results 4 °C and discarded the supernatants, the weight of
Han et al. Stem Cell Research & Therapy (2019) 10:243 Page 3 of 11

precipitates was taken and diluted with sterile deionized Table 1 Primers sequences used in the real-time RT-PCR
water (bacterial extracts) [23]. Bacterial extracts were Gene Symbol Primer Sequences (5’-3’)
reached certain concentration and filtered with a 0.22- GAPDH-F GAAGATATGGGCACAGGGGA
μm strainer (Falcon, USA), stored at 20 °C until used. GAPDH-R CAAGAAGATGCGGCTGTCTC
SOX2-F CGGCACAGATGCAACCGAT
Immunofluorescence staining
GMSCs were cultured on twelve-well plates with glass SOX2-R CCGTTCATGTAGGTCTGCG
coverslips at a density of 105 cells/well overnight. Then, OCT4-F AGAGGATCACCTTGGGGTACA
4% paraformaldehyde was used to fix GMSCs and the OCT4-R CGAAGCGACAGATGGTGGTC
diluted primary antibodies were used to seal off cells NANOG-F TCTTCCTGGTCCCCACAGTTT
overnight at 4 °C. The GMSCs were incubated using NANOG-R GCAAGAATAGTTCTCGGGATGAA
rhodamine/FITC-conjugated secondary antibodies (1:
MMP1-F GAGATCATCGGGACAACTCTCCTT
200, Cell Signaling Technology). Then, 4′,6-diamidino-
2-phenylindole (DAPI) (Sigma-Aldrich, USA) was used MMP1-R GTTGGTCCACCTTTCATCTTCATCA
to stain. The images were taken using fluorescence mi- MMP2-F CCTGGACCCTGAAACCGTG
croscopy (OLYMPUS, Japan) at × 200 magnification. MMP2-R TCCCCATCATGGATTCGAGAA
MMP9-F GCGTCGTGATCCCCACTTAC
Flow cytometric analysis MMP9-R CAGGCCGAATAGGAGCGTC
GMSCs were collected and fixed using 80% methanol.
MMP13-F CTTTGGCTTAGAGGTGACTGG
Then primary anti-CD44, anti-CD146 and anti-CD45
MMP13-R AGGCACTCCACATCTTGGTTT
antibodies (1 μg/106 cells, Abcam) were used to incubate
the cells for 30 min at 4 °C. The samples were incubated OCN-F CAGACAAGTCCCACACAGCA
using the secondary antibodies of PE goat anti-mouse OCN-R CTTGGCATCTGTGAGGTCAG
IgG and goat antirabbit IgG (1 μg/106 cells, Cell Signal- OSX-F TCCCTGGATATGACTCATCCCT
ing Technology) for one hour in the dark. Flow cytome- OSX-R CCAAGGAGTAGGTGTGTTGCC
try (FACSCalibur, BD Bioscience) was utilized to test the
RUNX2-F GACTGTGGTTACCGTCATGGC
samples.
RUNX2-R ACTTGGTTTTTCATAACAGCGGA

Cell scratch migration assays

The function of GMSC migration was estimated by the Alkaline phosphatase (ALP) and alizarin red detection
scratch-simulated wound migration assay. Cells were The function of GMSC osteogenesis and mineralization
laid on six-well plates at a density of 2 × 105 cells/well was estimated by alizarin red staining and alkaline phos-
and nearly grown 95% confluence. Cells were cultured phatase activity assays. Cells were cultivated on six-well
after 24 h, a cross-wound was scratched using a 200-μl plates at a density of 2 × 105 cells/well and nearly grown
pipet tip (Axygen® Corning, NY, USA) along the diam- 95% confluence and changed osteogenic-inducing
eter of the plates, and the cells were cultivated in fresh medium using the StemPro osteogenesis differentiation
culture media with proper concentration of bacterial ex- kit (Invitrogen, USA). ALP capacity kit was used to de-
tracts. To observe the extent of wound migration, im- tect ALP activity according to the manufacturer’s proto-
ages were taken using microscopy at baseline (0 h) and col (Sigma-Aldrich, USA). The results were standardized
72 h after scratching. The void area (VA) of the wound on the basis of protein concentration. GMSCs were in-
was measured by Image-Pro (National Institutes of duced after 3 weeks; mineralization capacity was evalu-
Health, USA), and the height and the relative width were ated by Formation of mineralized nodules. GMSCs were
calculated (Area% = VA/height). fixed using 70% ethanol, and 2% Alizarin red work solu-
tion was utilized to stain the cells (Sigma-Aldrich, USA).
Real-time reverse transcriptase-polymerase chain reaction
(real-time RT-PCR) Cell Counting Kit-8 (CCK8) assay
Total RNA was secluded from GMSCs of C57BL/6 by Cell Counting Kit-8 kit (Dojindo, Japan) was used to de-
using Trizol reagents (Invitrogen, USA). Reverse tran- tect GMSC proliferation. Cells were cultivated on a 96-
scribed into cDNA according to the manufacturer’s well plate at a density of 105 cells/well. Fifty micrograms
protocol (Takara, Dalian, China). Then, Real-time RT- per milliliter of Lactobacillus reuteri extracts was used
PCR reactions were performed using the SYBR Premix to treat the GMSCs. GMSCs were incubated in an incu-
Ex Taq™ (Takara, Dalian, China) and an Icycler iQ bator (37 °C, 5% CO2) for 48 h, CCK-8 work solution
Multi-color Real-time RT-PCR Detection System. The was added into the medium according to the manufac-
primers for specific genes are listed in Table 1. turer’s protocol, and then the 96-well plate was
Han et al. Stem Cell Research & Therapy (2019) 10:243 Page 4 of 11

cultivated in the incubator for 1–4 h. The absorbance bacterial extracts (Lactobacillus reuteri group). Each
(OD) value was read at a wavelength of 450 nm. group was injected once every other day. Three mice with-
out injection were as the baseline. The mice were sacri-
Western blot analysis ficed after injection for 3, 5, and 7 days, and the area of
RIPA buffer was used to lyse GMSCs. The details of the wound healing was detected by stereomicroscopy and
method for western blot were depicted as previously measured using ImageJ. After that, the maxillary palates
[24]. The expressions of protein were tested using anti- were fixed in 4% paraformaldehyde for 48 h, and all sam-
PI3K, anti-p-PI3K (1:1000, Cell Signaling Technology), ples were decalcified with buffered 10% EDTA and em-
anti-AKT, anti-p-AKT (1:1000, Cell Signaling Technol- bedded in paraffin. Then, all samples were deparaffinized
ogy), anti-β-catenin, anti-active-β-catenin (1:1000, Cell and stained with hematoxylin and eosin and immunohis-
Signaling Technology), and anti-TGFβ1(1:1000, Abcam). tochemistry staining.
Internal control was using β-actin (1:2000, Abcam) and
HSP90 (1:1000, Abcam) to detect. The secondary anti- Statistics
bodies were obtained from the commercial companies: All statistical computations were tested by SPSS10 soft-
anti-mouse IgG (1:2000, Abcam) and anti-rabbit IgG (1: ware. Statistical significance was identified by the Stu-
5000, Abcam). dent’s t test, Duncan test, or one-way ANOVA, with a
P ≤ 0.05 was regarded as significant.
Wound-healing mouse model
Intraperitoneal injection of 1% chloralhydrate was used Results
to anesthetize mice. A total of 24 wound-healing models The expression of surface markers of GMSCs
were operated in the 12 mice. The wound position of bi- To test whether cells obtained from gingival of C57BL/6
lateral mesial gingival of the maxillary first molar was mice had characteristics of MSC. Immunofluorescence
established; the wound area with a size of 1 mm × 2 mm staining and flow cytometric analysis were used to verify
and the full thickness gingiva was removed. Mice with markers of MSC. The results showed that cells from
wound were randomly distributed to two groups: injection C57BL/6 mice expressed CD44 (positive rate 97.4%,
of 0.9% NaCl (NS group), or injection of 50 μg/ml Fig. 1a–e) and CD146 (positive rate 97.5%, Fig. 1f–j), while

Fig. 1 The expression of surface markers in GMSCs from C57BL/6 mice. a–c: GMSCs were isolated from mice expressed CD44. Scale bar 50 μm. d,
e: Flow cytometric analysis results (CD44 positive rate: 97.4%). f–h GMSCs were from C57BL/6 mice expressed CD146. Scale bar 50 μm. i, j: Flow
cytometric analysis results (CD146 positive rate 97.5%). k–m CD45 were not expressed in GMSCs obtained from mice. Scale bar 50 μm. n, o Flow
cytometric analysis results (positive rate 1.69%). Student’s t test was utilized for analysis in c, f, i, j, k, and l . Error bars represent SD (n = 3). *P ≤ 0.05; **P ≤ 0.01
Han et al. Stem Cell Research & Therapy (2019) 10:243 Page 5 of 11

Fig. 2 Lactobacillus reuteri extracts promoted the functions of GMSCs. a, b The cell scratch migration analysis results screened the optimal concentration of
Lactobacillus reuteri extracts was 50 μg/ml, which promoted the function of GMSCs migration. Scale bar: 100 μm. c–e Real-time PCR results showed that 50 μg/ml
Lactobacillus reuteri extracts upregulated expression of stem cell markers (OCT4, SOX2, NANOG). f ALP activity assay indicated 50 μg/ml Lactobacillus reuteri extracts
increased ALP activity. g Alizarin red staining assay results showed that 50 μg/ml Lactobacillus reuteri extracts promoted GMSCs mineralization. h–j The expression
of the crucial transcription factors for modulating osteogenic differentiation: RUX2, OSX, and OCN were increased after 50 μg/ml Lactobacillus reuteri extracts
treatment. k 50 μg/ml Lactobacillus reuteri extracts promoted GMSCs proliferation by Cell counting kit-8 assay. Statistical significance was tested by Student’s t test.
Error bars represent SD (n = 3). *P ≤ 0.05; **P ≤ 0.01

CD45 (positive rate 1.69%, Fig. 1k–o) was not expressed. further determine the potential of osteogenic, we used
CD73+, CD90+, and CD105+ were important immunophe- real-time RT-PCR to test the expression of the crucial tran-
notype markers in MSCs (Additional file 2). These finding scription factors for modulating osteogenic differentiation:
confirmed that the cells form gingiva of mice were MSC. RUX2, OSX, and OCN; our results testified that 50 μg/ml
Lactobacillus reuteri extracts significantly promoted the
Lactobacillus reuteri extracts promoted the functions of expression of RUX2, OSX, and OCN (Fig. 2h–j). At the
GMSCs same time, the Cell Counting Kit-8 assay results indicated
To verify the effect of Lactobacillus reuteri extracts, cell that 50 μg/ml Lactobacillus reuteri extracts accelerated the
scratch migration assay was used to screen the effective proliferation potential of GMSCs compared to the control
concentration of bacterial extracts, we found that at the group (Fig. 2k). In addition, Oil Red O staining assay re-
concentration of 50 μg/ml enhanced the abilities of sults confirmed that 50 μg/ml Lactobacillus reuteri extracts
GMSCs migration after 72 h (Fig. 2a, b). To further valid- inhibited the adipogenic differentiation of GMSCs (Add-
ate the effects of Lactobacillus reuteri extracts on stem cell itional file 1). These findings confirmed that 50 μg/ml
markers (SOX2, OCT4, NANOG), real-time RT-PCR re- Lactobacillus reuteri extracts markedly promoted the func-
sults discovered that 50 μg/ml Lactobacillus reuteri ex- tion of GMSCs.
tracts increased expression of stem cell markers (Fig. 2c–
e). Next, we used ALP activity assay to test the ALP activity Lactobacillus reuteri extracts enhanced the GMSCs scratch
of GMSCs after 50 μg/ml Lactobacillus reuteri extracts migration via the PI3K/AKT/β-catenin/TGFβ1/pathways
treatment; our results showed that 50 μg/ml Lactobacillus To inspect the underlying molecular mechanisms of Lacto-
reuteri extracts augmented the ALP activity of GMSCs bacillus reuteri extracts which enhanced the GMSC scratch
after osteogenic induction for 5 days (Fig. 2f). Alizarin red migration, we tested the effect of bacterial extracts on
staining assay results confirmed that 50 μg/ml Lactobacil- PI3K/AKT signaling pathways; it has been reported that
lus reuteri extracts definitely enhanced mineralization in phosphorylation of PI3K/AKT leads to increase cells migra-
GMSCs after osteogenic induction for 3 weeks (Fig. 2g). To tion. Then, we used PI3K inhibitor LY294002 to examine
Han et al. Stem Cell Research & Therapy (2019) 10:243 Page 6 of 11

Fig. 3 Lactobacillus reuteri extracts enhanced the GMSCs scratch migration via the PI3K/AKT/β-catenin/TGFβ1 pathways. a, b The cell scratch
migration analysis results indicated LY294002 inhibited GMSCs migration, and 50 μg/ml Lactobacillus reuteri extracts rescued cells migration. Scale
bar 100 μm. c–f Western blot assays results showed that Lactobacillus reuteri extracts enhanced the GMSCs scratch migration via the PI3K/AKT/β-
catenin/TGFβ1 pathway. g–j Real-time PCR results demonstrated that 50 μg/ml Lactobacillus reuteri extracts accelerated the expression of MMP1,
MMP2, MMP9, and MMP13, and GAPDH was as an internal control. Statistical significance was assessed by one-way ANOVA in b. Student’s t-test
was used in g–j. Error bars represent SD (n = 3). *P ≤ 0.05; **P ≤ 0.01

the suppressive potential of PI3K in GMSCs [25–27]. At ratio of active β-catenin after LY294002 pretreatment for 1
first, we found that 50 μg/ml Lactobacillus reuteri extracts h (Fig. 3e). To further clearly elucidate the mechanisms of
promoted GMSCs migration in comparison with the con- Lactobacillus reuteri extracts enhanced the GMSCs scratch
trol group (0 μg/ml). Then, we used PI3K inhibitor migration, we also determined the interaction between
LY294002 and found that the Lactobacillus reuteri pro- TGFβ1 and PI3K/AKT/β-catenin, and our results demon-
moted GMSC migration could be partially inhibited by strated that TGFβ1 was a downstream of PI3K/AKT/β-ca-
PI3K inhibitor LY294002. GMSC migration was increased tenin. The protein expression of TGFβ1 was evaluated by
in LY294002 + 50 μg/ml compared to LY294002 alone, western blot analysis (Fig. 3f). As it is well known that
while LY294002 + 50 μg/ml group was still decreased com- matrix metalloproteinases (MMP’s) is a family of proteolytic
pared to 50 μg/ml Lactobacillus reuteri extracts group enzymes, which mainly was related to tissue refactoring,
(Fig. 3a, b). Next, western blot assay was used to investigate wound healing and inflammation. Therefore, we examined
whether 50 μg/ml Lactobacillus reuteri extracts was effect- the expression of matrix metalloproteinases related to
ive to activate the PI3K/AKT pathway and whether wound healing, Real-time RT-PCR results discovered that
LY294002 inhibited the signaling pathway; western blot MMP1, MMP2, MMP9, and MMP13 expression were in-
assay results confirmed that 50 μg/ml Lactobacillus reuteri creased after Lactobacillus reuteri extract treatment
extracts promoted phosphorylation of PI3K, while (Fig. 3g–j). These results indicated that Lactobacillus reuteri
LY294002 significantly inhibited the expression of phos- extracts enhanced the GMSCs scratch migration partially
phorylated PI3K (Fig. 3c). Then we detected the efficiency dependent on the PI3K/AKT/β-catenin/TGFβ1/MMP-1
of phosphorylated AKT (pAKT) and total AKT, the results pathway.
showed that Lactobacillus reuteri extracts enhanced phos-
phorylated AKT (Fig. 3d). In recent a lot of studies has been Local injection of Lactobacillus reuteri extracts promoted
reported that PI3K/AKT pathway was closely related to β- wound healing process in mice
catenin, western blot analysis results testified that 50 μg/ml To further testify the impact of Lactobacillus reuteri ex-
Lactobacillus reuteri extracts significantly upregulated the tracts on wound healing, wounds were established in
Han et al. Stem Cell Research & Therapy (2019) 10:243 Page 7 of 11

Fig. 4 Local injection of Lactobacillus reuteri extracts promoted wound healing process in mice. a, b Macroscopic observation showed that wound
healing model was established in mice gingiva. c The area of the original wound. e, h, k Local injection of Lactobacillus reuteri extracts enhanced
wound healing process after 3, 5 and 7 days. d, g, j In the NS injection group, the wound healing slowed down obviously. f, i, l Quantitative analysis
of the unhealed area of the wound. Scale bar: 1 mm. Error bars represent SD (n = 6). Yellow dotted line: the original area of the wound. Red dotted
line: the unhealed area of the wound. Error bars represent SD (n = 6). NS, no significant difference. *P ≤ 0.05; **P ≤ 0.01

mice gingiva (Fig. 4a, b) and the area of the original i, l). Especially the wound healing was nearly health
wound was about 2 mm2 (Fig. 4c). Mice with wound normal gingiva after injection of Lactobacillus reuteri
were randomly distributed to two groups: injection of extracts for 7 days.
0.9% NaCl (NS group) or injection of 50 μg/ml bacterial In the end, immunohistochemistry staining assay
extracts (Lactobacillus reuteri group). Each group was was used to test the expression of MMP-1 in gingival
injected once every other day. The mice were sacrificed tissue sections (Fig. 6a–f ). Our results demonstrated
after injection for 3, 5, and 7 days, and the area of wound that MMP-1 expression significantly increased in
healing was detected by stereomicroscopy and measured Lactobacillus reuteri extracts group (Fig. 6b, e), and it
using ImageJ. We found that local injection of Lactoba- was mainly expressed in the cytoplasm of epithelial
cillus reuteri extracts group promoted gingival wound cells. While in the injection of the NS group, the
healing (Fig. 4e, h, k); however, in the NS injection positive expression rate of MMP-1 was lower than
group, the wound healing slowed down obviously the experimental group (Fig. 6a, d). There was a sig-
(Fig. 4d, g, j). There was a significant difference between nificant difference in the test group compared to the
the test group and the NS group (Fig. 4f, i, l), indicating NS group (Fig. 6c, f ). These findings suggest that
that Lactobacillus reuteri extracts enhanced wound heal- Lactobacillus reuteri extracts promoted wound healing
ing in mice. process in gingival tissue in mice.
Histopathological detection was used to further as-
sess the gingival wound healing (Fig. 5a–l). Histo- Discussion
pathological photomicrographs results showed that Probiotics are a group of bacteria that are beneficial
injection of Lactobacillus reuteri extracts group to the human body. In recent years, with the im-
(Fig. 5e, h, k) significantly accelerated wound healing provement of people’s health concern and knowledge
compared to the NS group (Fig. 5d, g, j). The length of probiotics, probiotic therapy has been gradually in-
of the wound in the experimental group was shorter troduced into the field of stomatology. At present,
compared to the NS group. There were significant the research on probiotics is focused on the preven-
statistical differences between the two groups (Fig. 5f, tion and treatment of dental caries, while the effect
Han et al. Stem Cell Research & Therapy (2019) 10:243 Page 8 of 11

Fig. 5 Local injection of Lactobacillus reuteri extracts promoted wound healing process in mice by histopathological analysis. h&e staining results
showed that the length of wound healing in gingiva tissues in the NS group (d, g, j), and the Lactobacillus reuteri extracts group (e, h, k). a–c The
original location of the wound healing model. f, i, l Quantitative analysis of the length of the wound. Yellow dotted line: the original length of
the wound. Black line: the length of the wound. Scale bar: 50 μm. Error bars represent SD (n = 6). *P ≤ 0.05; **P ≤ 0.01

of beneficial bacteria on wound healing and under- capacity. These results suggest the optimal concentra-
lying mechanism, and the function of MSCs in the tion of Lactobacillus reuteri extracts is essential to
oral cavity is still unclear [28, 29]. It has been re- promote GMSCs function, while high dose produces
ported that the lozenges of Lactobacillus reuteri could toxic affection to GMSCs.
stimulate biopsies of the wound in the oral mucosa To further verify the effect of Lactobacillus reuteri
by regulating inflammatory cytokines, while the rele- extracts on the oral wound, we constructed a gingival
vant mechanism of wound healing and the effect of wound in mice. According to macroscopic observa-
probiotics on oral stem cells have not been elucidated tion and histopathological photomicrographs, we dis-
[30]. Wound healing is a complex process involving covered that topical injection of Lactobacillus reuteri
inflammation, proliferation, and remodeling, which extracts markedly accelerated wound healing. Histo-
regulated by a series of biomolecules, cell signaling pathological photomicrographs of the wound healing
pathways, and cell-to-cell interactions. On the basis of model confirmed that fewer inflammatory cells had
these findings, in this study, we investigated the func- been observed in the tissue of the lesion areas in the
tion of Lactobacillus reuteri extracts application as a Lactobacillus reuteri extracts treatment group.
therapeutic method for oral wound healing and the PI-3 K/AKT signal pathway plays an important role
impact on GMSCs function. First, we discovered that in maintaining cell survival and constitutes a signal
50 μg/ml Lactobacillus reuteri extracts promoted the transduction chain that promotes cell growth and in-
migration, expression of stem cell key transcriptional hibits cell apoptosis, thus maintaining the important
factors, osteogenic differentiation, and proliferation functions of cells in the process of stress response
abilities of GMSCs in vitro experiments. In addition, [31–33]. β-Catenin acts a pivotal part in wound re-
we also found that the impact of Lactobacillus reuteri pair of the skin, and it has been confirmed to regu-
extracts on GMSCs is dependent of concentration, late cell motility and adhesion. Several studies have
Lactobacillus reuteri extracts at high concentrations been reported that β-catenin translocation into the
(commonly > 50 μg/ml) can inhibit GMSCs migration nucleus accelerates cell metastasis and promotes
and even lead to apoptosis (> 100 μg/ml, data not both the secretion of TGFβ1 and the activation of
shown); however, under low concentration (≤ 50 μg/ MMP expression [34–36]. TGFβ1 is a group of
ml), bacterial extracts enhance GMSCs migration multifunctional growth factor that acts important
Han et al. Stem Cell Research & Therapy (2019) 10:243 Page 9 of 11

Fig. 6 The expression of MMP-1 in the wound healing model in mice. Immunohistochemistry staining assay results indicated that MMP-1 expression
significantly increased in Lactobacillus reuteri extracts group (b, e), and an injection of NS group, the positive expression rate of MMP-1 was less than the
bacterial extracts group (a, d). c, f Quantitative analysis of MMP1 expression. g Lactobacillus reuteri extracts promoted GMSCs migration via PI3K/AKT/β-
catenin/TGFβ1 pathway, thus accelerating wound healing. On the contrary, the ability of GMSCs migration was inhibited after LY294002 treatment
resulting in delayed wound healing. Red dotted line: the expression of MMP1. Scale bar 20 μm. Error bars represent SD (n = 6). *P ≤ 0.05; **P ≤ 0.01

impacts on wound healing by regulating the capaci- reuteri extracts group. Taken together, our findings
ties of cell migration and proliferation, ECM produc- confirmed that Lactobacillus reuteri extracts can
tion and remodeling, and immune response. TGFβ1 promote wound healing process via the PI3K/AKT/
is an indispensable participant in the wound healing β-catenin/TGFβ1 pathway.
process [37, 38]. MMPs are a kind of zinc metallo- In our study, we have shown that Lactobacillus reu-
proteinases superfamily synthesized and secreted by teri extracts can activate the potentials of GMSCs in
normal tissue cells or tumor cells, which depend on vitro and in vivo experiments, thus promoting wound
the presence of zinc ions to obtain catalytic activity. healing process. However, it must be pointed out that
MMPs play a wide range of roles, which especially Lactobacillus reuteri extracts are a kind of com-
mainly regulate the degradation of extracellular pounds, including plenty of complex components
matrix in wound healing [39–41]. In our study, we such as cell walls, peptidoglycan, and other proteins.
discovered that 50 μg/ml Lactobacillus reuteri ex- The effective ingredient in the mixture is not yet
tracts promoted phosphorylation of PI3K/AKT and known. Therefore, further surveys will be needed to
the expression of active-β-catenin and TGFβ1, while identify the precise and active ingredient from the
the levels of phosphorylation of PI3K/AKT and Lactobacillus reuteri extracts for better treatment of
active-β-catenin and TGFβ1 were decreased after oral wound caused by mucosal and soft tissue
LY294002 treatment. Real-time PCR results also defects.
demonstrated that 50 μg/ml Lactobacillus reuteri ex-
tracts accelerated the expression of MMP1, MMP2, Conclusion
MMP9, and MMP13. Moreover, immunohistochemis- In summary, our findings revealed that Lactobacillus
try staining assay results demonstrated that MMP-1 reuteri extracts could activate the potentials of
expression significantly increased in Lactobacillus GMSCs and enhance the wound healing process by
Han et al. Stem Cell Research & Therapy (2019) 10:243 Page 10 of 11

regulating the PI3K/AKT/β-catenin/TGFβ1 pathway. Author details

1
Our discovery provided the insight of the underlying Laboratory of Tissue Regeneration and Immunology and Department of
Periodontics, Beijing Key Laboratory of Tooth Regeneration and Function
mechanism activating functions of MSCs and identi- Reconstruction, School of Stomatology, Capital Medical University, Tian Tan
fied Lactobacillus reuteri extracts as a potential Xi Li No.4, Beijing 100050, People’s Republic of China. 2Department of
therapeutic strategy for accelerating oral wound in Orthodontics, School of Stomatology, Capital Medical University, Beijing,
China. 3Department of Stomatology, Beijing Tiantan Hospital, Capital Medical
the future dental clinic. University, Beijing, China.

Received: 21 February 2019 Revised: 22 May 2019

Additional files Accepted: 2 July 2019

Additional file 1: Lactobacillus reuteri extracts inhibited the adipogenic

differentiation of GMSCs. A: Oil Red O staining assay results confirmed References
that 50 μg/ml Lactobacillus reuteri extracts inhibited the adipogenic 1. Roh JL, Jang H, Lee J, et al. Promotion of oral surgical wound healing using
differentiation of GMSCs, Quantitative analysis (B). (TIF 17965 kb) autologous mucosal cell sheets. Oral Oncol. 2017;69:84–91.
Additional file 2: The expression of surface markers in GMSCs from 2. Bates D, Kampa P. Cell-based regenerative approaches to the treatment of
C57BL/6 mice. A, B, C: GMSCs were isolated from mice expressed CD73. oral soft tissue defects. Int J Oral Maxillofac Implants. 2013;28:424–31.
Scale bar: 50 µm. D, E: Flow cytometric analysis results (CD73 positive 3. Kasuya A, Tokura Y. Attempts to accelerate wound healing. J Dermatol Sci.
rate: 90.7%). F, G, H: GMSCs were from C57BL/6 mice expressed CD90. 2014;76(3):169–72.
Scale bar: 50 µm. I, J: Flow cytometric analysis results (CD90 positive rate: 4. Lindley LE, Stojadinovic O, Pastar I, et, al. Biology and biomarkers for wound
97.1%). K, L, M: GMSCs were from C57BL/6 mice expressed CD105(CD105 healing. Plast Reconstr Surg 2016;138: 18–28.
positive rate: 87.8%). Scale bar: 50 μm. N, O: Flow cytometric analysis 5. Leavitt T, Hu MS, Marshall CD, et al. Scarless wound healing: finding the
results. Student’s t-test was utilized for analysis in C, F, I, J, K L. Error bars right cells and signals. Cell Tissue Res. 2016;365(3):483–93.
represent SD (n=3). *P≤0.05; **P≤0.01. (TIF 30031 kb) 6. Hefton JM, Madden MR, Finkelstein JL, Shires GT. Grafting of burn patients
with allografts of cultured epidermal cells. Lancet. 1983;2:428–30.
7. Park SR, Kin JW, Jun HS, et al. Stem cell secretome and its effect on cellular
Abbreviations mechanisms relevant to wound healing. Mol Ther. 2018;26(2):606–17.
ALP: Alkaline phosphatase; ARS: Alizarin red staining; 8. Wang PH, Huang BS, Horng HC, et al. Wound healing. J Chin Med Assoc.
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; GMSCs: Gingiva 2018;81(2):94–101.
mesenchymal stem cells; MMPs: Matrix metalloproteinase; NANOG: Nanog 9. Gao L, Xu T, Huang G, et al. Oral microbiomes: more and more importance
homebox; OCT4: Octamer-binding transcription factor 4; PI3K/ in oral cavity and whole body. Protein Cell. 2018;9(5):488–500.
AKT: Phosphatidylinositol 3-kinase and protein kinase B; SOX2: Sex- 10. Su Y, Chen C, Guo L, et al. Ecological balance of oral microbiota is required
determining region Y-box 2; TGFβ1: Transforming growth factor-β1 to maintain oral mesenchymal stem cell homeostasis. Stem Cells. 2018;36(4):
551–61.
11. Shokryazdan P, Faseleh JM, Liang JB, et al. Probiotics: from isolation to
Acknowledgements application. J Am Coll Nutr. 2017;36(8):666–76.
Not applicable. 12. Doron S, Snydman DR. Risk and safety of probiotics. Clin Infect Dis.
2015;60:129–34.
Authors’ contributions 13. Sarao LK, Arora M. Probiotics, prebiotics, and microencapsulation: a review.
YL was responsible for the experimental design, manuscript revision, financial Crit Rev Food Sci Nutr. 2017;57(2):344–71.
support and the manuscript’s approval. The collection, analysis and 14. Butel MJ. Probiotics, gut microbiota and health. Med Mal Infect. 2014;
interpretation of data, and manuscript writing was accomplished by NH. LJ, 44(1):1–8.
YS, JD, LG, and ZL were responsible for the collection, analysis and 15. Janczarek M, Bachanek T, Mazur E, et al. The role of probiotics in prevention
interpretation of data. All authors approved the final manuscript. of oral diseases. Postepy Hig Med Dosw. 2016;70:850–7.
16. Hoare A, Marsh PD, Diaz PI. Ecological therapeutic opportunities for oral
Funding diseases. Microbiol Spectr. 2017;5(4):BAD-0006-2016.
This work was supported by grants from the National Nature Science 17. Seminarion AM, Lopez LJ, Estrugo DA, et al. Probiotics and oral health: a
Foundation of China (81470751 to Y. L, 81600891 to L.G), the Beijing systematic review. Med Oral Patol Oral Cir Bucal. 2017;22:282–8.
Municipal Administration of Hospitals Clinical Medicine Development of 18. Matsubara VH, Bandara HM, Ishikawa KH, et al. The role of probiotic bacteria
Special Funding Support (ZYLX201703 to Y.B), the Beijing Baiqianwan Talents in managing periodontal disease: a systematic review. Expert Rev Anti-Infect
Project (2017A17 to Y.L), Beijing Municipal Science & Technology Ther. 2016;14(7):643–55.
Commission(Z16100000516203 to L.G), Beijing Municipal Administration of 19. Halper J, Leshin LS, Lewis SJ, et al. Wound healing and angiogenic
Hospitals’ Youth Programme (QML20181501 to L.G), and Beijing Dongcheng properties of supernatants from Lactobacillus cultures. Exp Biol Med
Excellent Talent (to L.G). (Maywood). 2003;228(11):1329–37.
20. Gudadappanavar AM, Hombal PR, Timashetti SS, et al. Influence of Lactobacillus
acidophilus and Lactobacillus plantarum on wound healing in male Wistar rats -
Availability of data and materials an experimental study. Int J Appl Basic Med Res. 2017;7(4):233–8.
All data can be acquired from the corresponding author. 21. Kobayashi R, Kobayashi T, Sakai F, et al. Oral administration of Lactobacillus
gasseri SBT2055 is effective in preventing Porphyromonas gingivalis-
Ethics approval and consent to participate accelerated periodontal disease. Sci Rep. 2017;7(1):545.
Animal experiments were approved by the Beijing Stomatological Hospital, 22. Flichy-Fernandez AJ, Ata AJ, Alegre DT, et al. The effect of orally
Capital Medical University (Ethical Committee Agreement, Beijing administered probiotic Lactobacillus reuteri-containing tablets in peri-
Stomatological Hospital Ethics Review No. KQYY-201710-001). implant mucositis: a double-blind randomized controlled trial. J Periodontal
Res. 2015;50(6):775–85.
23. Loomer PM, Sigusch B, Sukhu B, et al. Direct effects of metabolic products
Consent for publication
and sonicated extracts of Porphyromonas gingivalis 2561 on osteogenesis
Not applicable.
in vitro. Infect Immun. 1994;62(4):1289–97.
24. Li X, Guo L, Liu Y, et al. MicroRNA-21 promotes osteogenesis of bone
Competing interests marrow mesenchymal stem cells via the Smad7-Smad1/5/8-Runx2 pathway.
The authors declare that they have no competing interests. Biochem Biophys Res Commun. 2017;49(2):928–33.
Han et al. Stem Cell Research & Therapy (2019) 10:243 Page 11 of 11

25. Imai Y, Yoshimori M, Fukuda M, et al. The PI3K/Akt inhibitor LY294002

reverses BCRP-mediated drug resistance without affecting BCRP
translocation. Oncol Rep. 2012;27(6):1703–9.
26. Lee CM, Fuhrman CB, Planelles V, et al. Phosphatidylinositol 3-kinase
inhibition by LY294002 radiosensitizes human cervical cancer cell lines. Clin
Cancer Res. 2006;12(1):250–6.
27. Henderson V, Smith B, Burton LJ, et al. Snail promotes cell migration
through PI3K/AKT-dependent Rac1 activation as well as PI3K/AKT-
independent pathways during prostate cancer progression. Cell Adhes Migr.
2015;9(4):255–64.
28. Lin TH, Lin CH, Pan TM. The implication of probiotics in the prevention of
dental caries. Appl Microbiol Biotechnol. 2018;102(2):577–86.
29. Stensson M, Koch G, Coric S, et al. Oral administration of Lactobacillus
reuteri during the first year of life reduces caries prevalence in the primary
dentition at 9 years of age. Caries Res. 2014;48(2):111–7.
30. Twetman S, Keller MK, Lee L, et al. Effect of probiotic lozenges containing
Lactobacillus reuteri on oral wound healing: a pilot study. Benef Microbes.
2018;9(5):691–6.
31. Nagae K, Uchi H, Morino KS, et al. Glucagon-like peptide-1 analogue
liraglutide facilitates wound healing by activating PI3K/Akt pathway in
keratinocytes. Diabetes Res Clin Pract. 2018;146:155–61.
32. Ling L, Gu S, Cheng Y, et al. bFGF promotes Sca-1+ cardiac stem cell
migration through activation of the PI3K/Akt pathway. Mol Med Rep. 2018;
17(2):2349–56.
33. Lv C, Yang S, Chen X, et al. MicroRNA-21 promotes bone mesenchymal
stem cells migration in vitro by activating PI3K/Akt/MMPs pathway. J Clin
Neurosci. 2017;46:156–62.
34. Amini NS, Cambridge E, Yu W, et al. β-Catenin-regulated myeloid cell
adhesion and migration determine wound healing. J Clin Invest. 2014;
124(6):2599–610.
35. Lichtman MK, Otero VM, Falanga V. Transforming growth factor beta
(TGF-β) isoforms in wound healing and fibrosis. Wound Repair Regen.
2016;24(2):215–22.
36. Baczynska D, Bombik L, Malicka BM. β-Catenin expression regulates cell
migration of human colonic adenocarcinoma cells through gelsolin.
Anticancer Res. 2016;36(10):5249–56.
37. Wang Y, Tang Z, Xue R, et al. TGF-β1 promoted MMP-2 mediated wound
healing of anterior cruciate ligament fibroblasts through NF-κB. Connect
Tissue Res. 2011;52(3):218–25.
38. Salgado RM, Cruz CO, Elizondo VF, et al. Maltodextrin/ascorbic acid
stimulates wound closure by increasing collagen turnover and TGF-β1
expression in vitro and changing the stage of inflammation from chronic to
acute in vivo. J Tissue Viability. 2017;26(2):131–7.
39. Rohani MG, Parks WC. Matrix remodeling by MMPs during wound repair.
Matrix Biol. 2015;44-46:113–21.
40. Babaei S, Bayat M. Pentoxifylline accelerates wound healing process by
modulating gene expression of MMP-1, MMP-3, and TIMP-1 in
normoglycemic rats. J Investig Surg. 2015;28(4):196–201.
41. Yamano S, Kuo WP, Sukotjo C. Downregulated gene expression of TGF-βs in
diabetic oral wound healing. J Craniomaxillofac Surg. 2013;41(2):42–8.

Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.