Molecular diagnostics

of monogenic diseases

dr Zofia Helszer (zofia.helszer@umed.lodz.pl)

 Genetic disorders

 Chromosomal abnormalities
chromosomes (or parts of chromosomes) are missing or changed

 Single gene disorders

the result of a single mutated gene

 Multifactorial and polygenic (complex) disorders

associated with the effects of multiple genes in combination with lifestyles and environmental factors

 Mitochondrial
a result of dysfunction of the mitochondrial respiratory chain
 Genetic disorders

The theoretical base of molecular testing is the presence of DNA

in nucleus of every cell

The native state of DNA as elucidated by James Watson and Francis Crick in 1953
consist of two complementary chains twisted about each other in the form of double
helix- the „twisted ladder” model. Each chain is composed of four nucleotides, each of which
contains a deoxyribose residue, a phosphate, and a pyrimidine or purine base.
The pyrimidine bases are thymine (T) and cytosine (C); the purine bases are adenine (A) and guanine
(G).The two strands of DNA are joined together by hydrogen bonds existing between the pyrimidine and
purine bases. Adenine is always paired with thymine (AT), and guanine is always paired with cytosine
(GC). This is called complementary base pairing
 Human genome

complete set of human genetic information

(Human Genome Project, April 2003)

Nuclear genome
contains approximately 3 billion of base pairs, which reside in the 23 pairs of
chromosomes within the nucleus of all our cells; about 25,000 genes

Mitochondrial genome (mtDNA)

is the DNA located in mitochondria; consists of a 4-10 double-stranded circular DNA
molecules 16569 bp in length, contains only 37 genes

mtDNA is inherited solely from the mother

dziedziczenia
 The flow of information from

DNA - RNA - PROTEIN

is one of the fundamental principles of molecular biology.
It is referred to as a „central dogma” of molecular biology.
 gene expression

transcription
the information stored in a gene’s DNA
is transferred to RNA in the cell nucleus.
The type of RNA that contains the
information for making a protein is
called messenger RNA (mRNA)
because it carries the information from
the DNA out of the nucleus into the
cytoplasm.
translation
The second step in getting from a gene
to a protein, takes place in the
cytoplasm. The mRNA interacts with a
ribosome, which “reads” the sequence
of mRNA bases. Each sequence of
three bases, called a codon, usually
codes for one particular amino acid.
A type of RNA called transfer RNA
(tRNA) assembles the protein, one
amino acid at a time. Protein synthesis
continues until the ribosome encounters
a „stop” codon
Genetic information is preserved by

DNAreplication
DNA replication

During cell division, the DNA content of the

parent cell is replicated by separation of the two
strands of the double helix and synthesis of two
new complementary strands according to the
stated rules of base pairing
 mutations
A mutation is defined as any change in the nucleotide sequence or arrangement of DNA.

Mutations can be classified into three categories:

genome mutations - mutations that affect the number of chromosomes in the cell
chromosome mutations - alter individual chromosomes
gene mutations - mutations that alter individuals genes

Types of gene mutations:

missense mutations - a single nucleotide substitution in a DNA sequence can alter the code in a triplet of bases
and cause the replacement of one amino acid by another in the gene product. Missense mutation account for
almost half of all mutation reported to cause genetic diseases in humans.
nonsense mutation - a mutation that generates one of the three „stop” codons (UAA, UAG, UGA) can cause
premature cessation of translation. These mutations account for approximately 12% of all disease-causing
mutations.
frameshift mutations -are either deletions or insertions of one or a few nucleotides in the coding region of the gene.
These mutations change the triplet code for all the codons that follow and thus completely alter the sequence of
amino acids.

RNA mutations - RNA splicing mutations

The result of a point mutation is a change or loss of protein function

point mutation
point mutation
point mutation
 Dynamic mutations
are caused by expansion of a trinucleotide repeated sequences in genes.

Dynamic mutation is an unstable heritable element where the probability of expression of a mutant
phenotype is a function of the number of copies of the mutation

This mechanism is linked to more than 40 neurodegenerative and neuromuscular disorders

Very great expansion of sequence of repeated CGG to more than 200 CGG repeats is associated with fragile
sites on the chromosome. When this occurs in a gene on the X chromosome, it is associated with loss of
function of that gene and the fragile X syndrome.

A CTG repeated expansion leads to myotonic dystrophy, which is the most common cause of muscular
dystrophy in adults.

Another category for dynamic mutations results from small expansions, usually more than 35 but fewer than
150, that occur due to amplification of a CAG repeat in the coding region of the gene. This results in five
separate neurodegenerative conditions, including Huntington disease, spinocerebellar ataxia, spinobullar
muscular atrophy (SBMA).

Dynamic mutations are associated with anticipation. The symptoms of the genetic disorder become apparent
at an earlier age with each generation. In most cases, an increase of severity of symptoms is also noted.
 CAG repeats
Nucleotide Sequence (2763 nt):

ATGGAAGTGCAGTTAGGGCTGGGAAGGGTCTACCCTCGGCCGCCGTCCAAGACCTACCGAGGAGCTTTCC

AGAATCTGTTCCAGAGCGTGCGCGAAGTGATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCGC

AGCACCTCCCGGCGCCAGTTTGCTGCTGCTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAAGAGACTAGCCCCAGGCAGCAGCAGCAGCAGCAGGGTGAGG

ATGGTTCTCCCCAAGCCCATCGTAGAGGCCCCACAGGCTACCTGGTCCTGGATGAGGAACAGCAACCTTC

ACAGCCGCAGTCGGCCCTGGAGTGCCACCCCGAGAGAGGTTGCGTCCCAGAGCCTGGAGCCGCCGTGGCC

GCCAGCAAGGGGCTGCCGCAGCAGCTGCCAGCACCTCCGGACGAGGATGACTCAGCTGCCCCATCCACGT

TGTCCCTGCTGGGCCCCACTTTCCCCGGCTTAAGCAGCTGCTCCGCTGACCTTAAAGACATCCTGAGCGA

GGCCAGCACCATGCAACTCCTTCAGCAACAGCAGCAGGAAGCAGTATCCGAAGGCAGCAGCAGCGGGAGA
 genomic polymorphism

Another reason of genetic variation are polymorphisms.

Genetic polymorphism is the occurrence in a population of two or more allele
at a locus in frequencies greater than can be maintained by mutation.
A polymorphism is said to exist if the most common allele at a locus has
a frequency of less than 99%.
Polymorphisms are ubiquitous, particularly in noncoding regions of DNA.
Most polymorphisms produce no clinical phenotype.

Polymorphisms are responsible for many of the normal differences between people such as eye colour, hair colour, and
blood type or prone to heart disease, diabetes, cancer
Although many polymorphisms have no negative effects on a person’s health, some of these variations may influence the
risk of developing certain disorders.
 clinical importance of polymorphisms

Genetic markers can be used to determine:

• likelihood of associated disease genes present within a family or individual
• relationship of individuals to each other
• genetic similarity of blood, semen or tissue to an individual
• mapping a gene to a particular region of chromosome by linkage analysis
• prenatal diagnosis of genetic diseases
• detection of heterozygous carriers of genetic diseases
• evaluation of high- and low-risk persons with predisposition to common adult disorders,
such as coronary heart disease, cancer, and diabetes
• zygosity of twins (monozygotic twins have identical alleles at all loci tested,
dizygotic twins differ from each other at a substantial number of loci)
• paternity testing
• forensic application in identifying remains of crime victims or matching a suspect’s DNA
to the perpetrator’s
• identifying missing person. Genetic markers of the missing person and his or her parents
or other family members can be compared to establish true biologic relationships.
• tissue typing for organ transplantation
Hybridization methods: Microarray chip technology, Southern and Northen
Hybridization,

PCR (polymerase chain reaction)- multipleks-PCR, nested-PCR, Real Time-

PCR….Quantitative PCR: real time QRT-PCR, HRM (High Resolution Melt), MLPA
(Multiplex Ligation-dependent Probe Amplification), RT-MLPA, MS-MLPA

Methods of molecular cytogenetics: FISH(Fluorescence in situ hybridization),

modification of FISH: M-FISH (multicolor FISH), SKY FISH (spectral karyotyping),
PRINS (Primed in situ Labelling , CGH(Comparative Genomic Hybridization), CGH
microarrays, aCGH-array CGH)

methods used in molecular diagnostics

 PCR

The aim is to produce enough of the DNA to be able to sequence and identify it.

A basic PCR set up requires several components and reagents.

These components include:

• DNA template that contains the DNA region (target) to be amplified.

• One or more primers, which are complementary to the DNA regions at the 5‘ and 3‘
ends of the DNA immediately adjacent to the sequence of interest
• DNA polymerase such as Taq polymerase or another DNA polymerase with
a temperature optimum at around 70°C,
• Deoxynucleoside triphosphates (dNTPs), the building blocks from which the DNA
polymerases synthesizes a new DNA strand.
• Buffer solution, providing a suitable chemical environment for optimum activity
and stability of the DNA polymerase.
• Divalent cations, generally Mg2, monovalent cation potassium ions.
 Polymerase Chain Reaction (PCR)

Denaturation - 94-96°C, Primer annealing -50-65°C, Elongation - 72°C

First synthesis cycle result in two copies of target DNA sequence. 20 PCR cycles can amplify the target by a millionfold.
Developed in 1983 by Kary Mullis,. In 1993 Mullis won the Nobel Prize for his work on PCR.
A strip of eight PCR tubes, each
containing a 100 μl reaction mixture
Thermocycler for PCR

PCR
Electrophoresis of PCR products

-allows to determine whether your

product PCR was successful,
-whether the resulting product is
the correct size.
-the size of PCR products is
determined by comparison with a DNA
ladder (a molecular weight marker)
 Multiplex PCR

The use of multiple, unique primer sets within a single PCR mixture to produce
amplicons of varying sizes specific to different DNA sequences.

Simultaneous PCR amplification of nine fragments of DMD gene (Duchene muscular dystrophy)
(pointed with arrows) for seven patients (path 1-7). Lack of band in path 3, 5, 6 i 7 indicate a deletion.
Clinical application of method molecular
biology in genetic diseases testing
(examples)
 Diagnostics monogenic diseases

Traditional Inheritance
• autosomal recessive (cystic fibrosis, galactosemy, homocystinuria)
• autosomal dominant (Huntington disease, Marfan’s syndrome)
• X-linked diseases, recessive (Duchenne muscular dystrophy, FraX)
• X-linked diseases, dominant (Rett’s syndrome)
• Y-linked diseases

Nontraditional Inheritance
• genomic imprinting
• UPD (Uniparental disomy)
• expansion of a trinucleotide repeated sequence
 Cystic Fibrosis refers to the characteristic fibrosis and cysts that form within the pancreas
(CF)

is one of the most frequent genetic disease with autosomal recessive transmision

• incidence (at birth) 1 in 2500.

• about one in 25 people are carriers.
Clinical aspects
• symptoms of CF appear in infancy and childhood
• meconium ileus is a typical finding in newborn babies with CF(5-10%)
• recurrent respiratory infections leading to chronic lung disease (90%)
• endocrine pancreatic insufficiency (85-90%)
• hepatic cirrhosis (1-5%)
• male infertility (congenital bilateral absence or obstruction of the vas deferens (95-98%),
women with CFmay experience complications in pregnancy
• other signs and symptoms: salty-tasting skin, sinus infections, poor growth, poor weight gain, fatty stool
• varying degrees of clinical expression of the disease
• the average age of survival -30-40 years

• CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator (CFTR).
The product of this gene is a chloride ion channel important in creating sweat, digestive juices, and mucus.
 CFTR gene

Locus - The CFTR gene is found in region q31.2 on the long (q) arm of
human chromosome 7
Gene structure - The normal allelic variant for this gene is about 250kb
long and contains 27 exons
Protein size - the CFTR protein is 1480 amino acids long and has
molecular weight of 168 kDa
CF occurs when a genetic mutation stops the production of a protein in
cells of the lung, pancreas and other organs. The absence of the protein
impairs the cells ability to transport chloride ions into and out of the cell.
There are over 1,900 mutations that can produce CF
• point mutation (missens and nonsens) - 57% all mutation
• small deletions or insertions - 25%
• splicing mutation - 17%
The most common mutation - F508 is a deletion of three nucleotides that results in a loss of the
amino acid phenylalanine (F) at the 508th position on the protein.
This mutation accounts for 70 % of CF worldwide and 90 % of cases in the US

CFTR Sequence:

Nucleotide ATC ATC TTT GGT GTT

Amino Acid lle lle Phe Gly Val

506 508 510

Deleted in F508
 Newborn screening for CF

is done in the first 2 or 3 days after birth

The first stage of screening entails measurement of immunoreactive trypsinogen (IRT)
on dried blood spots.
• elevated concentrations of immunoreactive trypsinogen (IRT) indicates
an increased risk of CF
The second stage -sweat test
• elevated serum concentrations of sodium(over 60 mmol/l) and chloride (above
70 mmol / l) in the sweat
The third stage – DNA testing
Early diagnosis and treatment can:
Improve growth
Help keep lungs healthy
Reduce hospital stays
Add years to life
 Diagnostics CF

Identification of mutation in CFTR gene is the only confirmation of clinical diagnosis of cystic fibrosis.

Direct analysis
• identification delF508 (PCR and direct analysis of the products in gels)
• sequencing: F508del, dele2,3(21kb), 3849+10kbC>T, G542X, 1717-1G>A,
N1303K, R553X, W1282X, 2143delT, 2183AA>G, 2184insA, R334W, R347P, G551D,
3272-26A>G, R117H
• diagnostic tests for rapid and simultaneous diagnosis of the most common mutations in
the population (e.g. test INNO-LIPA CF2 / Innogenetics) or StripAssay (Vienna Lab)
• analysis of large deletions in the CFTR gene using MLPA
Localization

Localization of wild probes

(W) and mutant probes (M)
on the strip INNO- LIPA CF
 The INNO-LIPA CF2

Tests are based on the reverse hybridization

principle

1. DNA isolation
2. PCR amplification using biotinylated primers
3. Hybridization of amplification products to test
strips containing allele-specific
oligonucleotide probes immobilized as an
array of paralel lines.
4. Bound biotinylated sequences are detected
using streptavidin-alkaline phosphatase and
color substrates
 Results of test INNO-LIPA CF

1-19 examined patients

20 positive control (∆F508/-)
21 blind control
22 pattern of the test
3,4 mutation ∆F508/-
15 mutation ∆F508/ ∆F508
 Cystic fibrosis

35-year-old, married man, in good general condition, reported to the Genetic Clinic in order to obtain
genetic counseling. Brother of the patient is suffering from cystic fibrosis. The molecular study was
diagnosed with complex heterozygous mutation in the CFTR gene (delF508 and 3849 + 10kbC> T).

In our patient, molecular analysis of CFTR gene was performed using the CF test StripAssay (Vienna
Lab) able to detect the 34 mutations + 1 polymorphism IVS9 / T5 / T7 / T9 (most common in the world's
population).
The analysis showed the presence of a heterozygous mutation 3849 + 10kbC> T.

There was no mutation in the patient's wife, so the offspring will not be suffering from cystic fibrosis
A B

CF StripAssay A/B
 Marfan Syndrome

 frequency: 1:10 000-1:20 000

 autosomal dominant inheritance
 pleiotropy - the genetic effect of a single gene on multiple phenotypic traits
 damage to the system:
- ocular (myopia (100%), dislocation of the lens (60%)
- skeletal (grow to above-average height, disproportionately long slender limbs, weak wrists
and long fingers and toes, abnormal curvature of the spine, abnormal indentation or protrusion
of the sternum, abnormal joint flexibility, a high palate, flat feet, hammer toes, stooped
shoulders, and unexplained stretch marks on the skin.
- circulatory (aortic dilatation(90%), mitral valve prolapse 50%)
- sometimes respiratory system (pulmonary emphysema, spontaneous pneumothorax)
- other features of the syndrome: elongated skull, stretch marks and hernias
- full mental agility
 all defects are associated with excessive elongation of the connective tissue throughout the body
 is caused by mutations in the FBN1 gene on chromosome 15 (15q21.1) which encodes fibrillin-1,
a glycoprotein component of the connective tissue
 a high degree of penetration of the gene (the frequency, with which a specific genotype is expressed by those
individuals that possess it; usually given as a percentage)
 heterogeneous clinical picture (even within the same family);
 about 75% - is inherited from a parent , 25% is a new mutation, risk factor - late age of father

 About 75% of the timAb75% of the time the condition is inherited from a parent while 25%
Marfan syndrome (hypermobility of the joints)
Marfan syndrome
 muscular dystrophy X-linked recessive
Duchenne Muscular Dystrophy(DMD) (OMIM 310200)

• it affects mainly boys, women are carriers

• is the most common childhood form of muscular dystrophy; becoming clinically evident when a child
begins walking
• in 90% of cases, the symptoms appear before the age of 5
• progressive weakness of proximal limb muscles- unsteady, waddling gait, walking on the toes, trouble
climbing stairs, difficulty rising from a lying or sitting position, curvature of the spine (scoliosis).
• by age 10, the child may need braces for walking and by age 12, most patients (90%) are unable to walk
• can also affect muscles in the heart and lungs- serious heart and breathing problem can occur.
• 25% of patients may have intellectual disability
• life span ranges from 15 to 45.
• lack of muscle specific protein – dystrophin
• elevated concentration of creatine kinase in blood serum

Becker Muscular Dystrophy(BMD) (OMIM 300376)

• The incidence of 1:18000
• is a less severe variant of MD, symptoms appear in 8-10 years,develops much more slowly
• is caused by the production of a truncated, but partially functional form of dystrophin.
• survival is usually into old age
In 2/3 of cases of DMD / DMB is transmitted by the mother, 1/3 de novo
location - chromosome Xp21
size - 2.5 Mbp, the biggest human gene, 79 exons
encodes a glycoprotein - dystrophin (DMD)

The following mutations were detected:

• deletions different size -65%(DMD) and 85%BMD ("hot spots": exons 44 - 60 and 3-10)
• duplications - 6%-10%
• point mutations – 20%-35%
• complex rearrangements and deep intronic changes -2% of DMD

Mutations violate reading frame lead to complete loss of protein (DMD)

Mutations do not violate of reading frame lead to altered-size, but still
partly functional protein (BMD)

DMD gene
 Diagnostics of DMD/BMD

Detecting
• deletions and duplications in DMD gene - Southern hybrydisation with cDNAprobes
PCR multiplex (98% of all deletions)
• rare deletions and duplications - MLPA, array CGH
• mutations - SSCP, dHPLC, HRM; sequencing (genomic DNA or cDNA from muscle RNA)

Prenatal diagnosis in families affected by DMD / BMD

- determine the sex of the fetus (amelogenin gene amplification(PCRamel)
- in male fetuses, the search for mutations previously detected in sick family members

Each son born to a woman with a dystrophin mutation on one of her two X chromosomes has a 50
percent chance of inheriting the flawed gene and having DMD.
Each of her daughters has a 50 percent chance of inheriting the mutation and being a carrier.
Carriers may not have any disease symptoms but can have a child with the mutation or the disease.
DMD carriers are at risk for cardiomopathy
)
 Rett syndrome (OMIM #312750)
X-linked diseases, dominant

Is a rare, but severe brain disorder that affects girls

A brain disorder that causes problems with communication, learning, and coordination.
Typical symptomes:
• normal psychomotor development during the first 6-18 months of life
• loss of previously acquired manual skills and ability to speak
• ataxia (the loss of full control of bodily movements)
• low growth, small hands and head (secondary microcephaly)
• gait abnormalities and hand stereotypies (clapping, knocking, insertion into the mouth),
gnashing of teeth
• problem with speaking, communication through: touch, facial expressions, gestures,
pictures and letters
• epileptic seizures (in 80% of cases)
• gastro-intestinal and respiratory problems
• scoliosis
disorder affecting 1:10,000 to 1:23,000 females
 Rett syndrome

• is caused by mutations in the gene MECP2 ((methyl CpG binding

protein 2 ) on the X chromosom, (locus Xq28)
• encodes protein-MECP2, which play a role in normal brain function,
particularly the maintenance of synapses.
• de novo mutation (99%), rare familial occurrence
• point mutation in the MECP2 gene (80% of girls manifesting the classic
form and in approximately 40% of atypical form)
• in about 8% of the classical form and about 3% a typical form is
detected a large deletion of part or all of the gene
• atypical mutations in other regions of the gene, or other genes
mutations (e.g. CDKL5 in atypical form)

Diagnostics - MECP2 gene sequencing

 Rett syndrome

• in classic forms affect only women. For most men, the MECP2 gene mutation is lethal defect
and leads to death on the stage of fetal development

• Rett syndrome is often mistakenly diagnosed as autism, cerebral palsy or general

intellectual development disorders
• Currently, there is no proven method of causal treatment. Thanks to intensive rehabilitation
(care speech therapist and child psychologist, proper diet) 2% - 15% of patients can function
independently
 Dynamic mutations
• Huntington disease, HD
• spinal ataxia – cerebellar, SCA
• spinal and bulbar muscular atrophy,SBMA
• fragile X syndrome, FRA X
• myotonic dystrophy, DM1 i DM2

Dynamic mutations causing a multiplication of the number of microsatellite repeats are the
cause of many degenerative diseases of the central nervous system.
Molecular diagnostics is based on DNA analysis leading to the determination of the number of
repetitions microsatellites in genes associated with the occurrence of various diseases
 FRAX syndrome

X-linked diseases dominant

• is the most common cause of inherited mental retardation

• fragile X syndrome occurs in approximately 1 in 4,000 males and 1 in 8,000 females
• in affected boys delay in language acquisition and/or behavioural problems
• the phenotype includes mild dysmorphic features (a long and narrow face, large
ears, a prominent jaw and forehead, unusually flexible fingers, flat feet,
and in males, enlarged testicles (macroorchidism) after puberty
• disturbances including attention-deficit hyperactivity or autistic-like behaviour
• 50-60% of female carriers will have mild to moderate mental retardation
 FRA X syndrome

Mutations in the FMR1(Fragile X mental retardation) gene cause fragile X syndrome

• is located in Xq27.3
• encodes a protein called fragile X mental retardation 1 protein (FMRP), having a role in the development
of synapses between neurons, responsible for learning and memory
• FRA X is caused in most cases by expansion of a (CGG) trinucleotide repeat in the 5'UTR of the FMR1 gene
and subsequent abnormal methylation of adjacent CpG island leading to the loss of the protein
product FMRP
 FRA X diagnostics

The normal form of the CGG repeats is polymorphic and contains from 6 to about 50
trinucleotide repeats

Alleles in the 59-200 CGG repeat range without abnormal methylation are reffered to as
premutations (Premutation do not cause mental retardation but were shown to be
associated with premature ovarian failure in females and late onset tremor/ataxia
syndrome in males)

The disease causing full mutation is a large expansion exceeding 200 repeats, and
usually accompanied by methylation of the adjacent promotor region which results in
transcriptional silencing of FMR1
 Nontraditional Inheritance

Uniparental disomy - refers to the presence of two copies of a chromosome

(or part of a chromosome) from one parent and none from the other

Genomic imprinting - refers to the differential expression of genetic traits depending on

whether the trait has been inherited from a mother or a father.
People inherit two copies of their genes- one from their mother and one from their father.
Usually both copies of each gene are active („turned on”). In some cases, only one of the two
copies is normally turn on. Which copy is active depends on the parent of origin: some genes
are normally active only when are inherited from a father; other are active only when inherited
from a mother. Methylation of nucleotides enables monoallelic expression of the gene without
altering the genetic sequence. The methyl group attaches to the cytosine in the gene promoter
regions, methylated nucleotide can not join transcription factors

Only a small pecentage of all human genes undergo genomic imprinting (0.1-1%).
 Genomic imprinting

Prader-Willi syndrome and Angelman syndrome imprinting disorders 15 (q11q13) - lack of

imprinting of the father causes Prader-Willi syndrome, and lack of imprinting of the mother
Angelman syndrome
 Prader-Willi Syndrome

Deletion PWS region PWS region

AS gen AS gen

Chromosome 15 Chromosome 15

Expression
Active
Unactive PWS

70% deletion of 15q11-q13 region, paternally-derived

25% maternal uniparental disomy of chromosome 15
5% genomic imprinting
1% balanced translocations
 Prader-Willi Syndrome

Uterus and birth

Reduced fetal movement
Frequent abnormal fetal position

Childhood
Intellectual delay
Scoliosis (often not detected at birth)
Speech delay
Hyperphagia (over-eating) begins between the age of 2 and 8, and continues on throughout adulthood.
Sleep disorders, delayed puberty, short stature, obesity

Adulthood
Infertility (males and females), hypogonadism
Obesity, hypotonia (low muscle tone)

Physical appearance
Small hands and feet with tapering of fingers
Excess fat, especially in the central portion of the body
High, narrow forehead, thin upper lip, downturned mouth, almond-shaped eyes
Wzrost 160 cm, waga 141 kg •Zespół Willy Pradera
 Angelmans Syndrome

• mental retardation and

impaired speech
• jerky movements

PWS region PWS region

(especially hand-flapping)
deletion
AS gene AS gene
• frequent laughter or
smiling
Chromosom 15 Chromosom 15

Expressive:
• epilepsy and an abnormal
active
Angelmans syndrome
EEG tracing
inactive

65 - 75% maternal deletions for chromosome 15q11–q13,

3 - 7% paternal uniparental disomy of chromosome 15
3% imprinting defects
5 - 11% mutations in the UBE3A locus which encodes E6-AP ubiquitin-protein ligase
5 - 11% other mechanism
 Angelman Syndrome

• feeding problems, poor weight gain

• microcephaly and brachycephaly

• facial dysmorphia (deep-set eyes, large mouth with thin upper lip, large jaw, large teeth)
protruding tongue, light skin complexion, blond hair, bright iris

• mental retardation, speech disorders, sleep disorders (sleep apnea)

• epilepsy and an abnormal EEG tracing

• a walking disability (walk on legs wide apart)

• frequent laughter or smiling

Laboratory diagnostics of PWS / AS

Karyotype study
- cytogenetic techniques
Analysis of the SNRPN gene methylation pattern
- methylation tests (PCR)
Deletions
- FISH
- southern hybrydization
Uniparental disomy
- DNA polymorphism analysis (microsatellite analysis)
Mutations
- PCR, sequencing
 Laboratory diagnostics of PWS / AS

Methylation analysis
can detect all three major classes of genetic defects associated with PWS
(deletion, UPD, or imprinting mutations), methylation analysis with either PW71
or SNRPN (small nuclear ribonucleoprotein-associated polypeptide N gene) is an
efficient primary screening test to rule out a diagnosis of PWS.
Only patients with an abnormal methylation result require further diagnostic
investigation by FISH or DNA polymorphism analysis to distinguish among the three
classes
FISH
FISH analyses are required to establish whether deletion is present.
Deletions are detected by two-color FISH, using one or two probes within the typical
deletion boundaries, along with a centromeric probe
Microsatellite analysis
If no evidence of deletion is found by FISH analysis, the microsatellite analysis
is mandatory to establish whether there is UPD15 or biparental inheritance.
UPD analysis requires samples from the proband and both parents.
 The risk in siblings of PWS

1% deletion of PWACR
1% UPD
50% imprinting mutation
1% balanced translocation de novo
25% inherited balanced translocation

The risk in siblings of PWS proband depends on the genetic mechanism that caused the disease.
MULTIFACTORIAL
DISEASES
Maria Malarska MD
Concepts that you should already
know
Genotype
Phenotype
And if not then ...
• Genotype - a set of genes of a given individual conditioning his inherited properties.
This is a paired allele layout. It can be expressed symbolically using the symbols aa, AA
or Aa, where aa and AA are homozygotes for this gene, and Aa means heterozygote.

Phenotype - a set of body traits, including not only morphology, but also, for example,
physiological properties, fertility, behavior, ecology, life cycle, biological changes,
environmental impact on the body. So the genotype in the environment 
Heritability
This is the proportion of phenotypic variation explained by genetic variability in the
population:

Twins
Monozygotic vs. dizygotyczne
adoptions

So, for each phenotype, the interaction of the genotype with the environment
corresponds.
Family aggregation
• The frequency of symptoms in relatives of the 1st degree exceeds those observed in
distant relatives and unrelated persons
Multifactorial features
Only part of the risk of developing the disease is inherited.

The normal phenotypic change remains.

We know over 38 million variable places (SNPs) in the genomes of various people!
Examples of diseases
• cleft lip and palate
• cerebral cleft
• purulence of the pylorus
• ischemic heart disease
• hypertensive
• diabetes
• congenital heart disease
• epilepsy
• schizophrenia
• manic depression psychosis
• congenital dislocation of the hip joint
• peptic ulcer
• allergic diseases
• rheumatoid arthritis
ASSOCIATIONS
Associations
• Non-random coexistence of factors (alleles and genotypes) at the population level
• Typical association studies: a specific variant of a given gene increases / decreases the
risk of X disease
This does not mean that everyone with this variant will fall ill!
This does not mean that you can, by examining this variant
say that someone will fall ill!
This does not mean that the mechanism of the disease is in any way
associated with this gene.

• You should always analyze the association against the general risk in the population,
what are the absolute values
Association on the example of
Ankylosing spondylitis
• HLA-B27 and autoimmune diseases, e.g. ankylosing arthritis

Risk for the entire population ~ 1%

8% risk (HLA +)
The risk of 0.11% (HLA -)

This is one of the strongest known associations! However, this does not mean that all
HLAB27 holders will fall ill!
IMPORTANT

"The risk increases threefold"

From 30% to 90% - important
From 0.1% to 0.3% - ????
http://news.bbc.co.uk/2/hi/uk_news/magazine/7937382.stm
Remember!
• Association is not "gene for..."!

• The risk factor usually has no diagnostic significance

• Depending on the frequency in the population (for rare - less)
• Can be useful in differential diagnosis
• Always analyze the association against the general risk in the population, what are
the absolute values
Bipolar disorder
- Many associations, but none very important

Coronary heart disease

- Several loci significantly increase the risk, including the locus on chr. 9 by 50% in
heterozygotes and twice in homozygotes

Leśniowski-Crohn's disease
- Variants in 3 risk genes (RGM, NKX2-3 and PTPN2) and 7 new genes were detected

Hypertension
- No clear risk factors - many variants with relatively low impact

Rheumatoid arthritis
-The risk factors associated with polymorphisms in several genes have been identified
- Correlation with heart disease and type 1 diabetes
Gene for cancer
• There are many high-profile reports that "the gene has been found on ...", and most are
just associations, just as genetic predisposition tests are based on the association effect
DISEASES AND
INHERITANCE
Cystic fibrosis
• Inherited autosomal recessive, people with abnormal gene alleles on chromosome 7
get sick
• Heterozygotes, that is, people with a single altered allele, do not get sick, but can pass
damaged genes to their offspring. They are therefore referred to as carriers.
Family hypercholesterolemia
• Inherited autosomal dominant, caused by mutations of the LDLR gene in the 19p13.2
locus coding for the LDL receptor protein.
• Children have a 50% chance to inherit the correct version
of the gene.
 Haemophilia
• Inheritance conjugated to the X sex chromosome.
• Recessive diseases most often affect men because they have only one X chromosome,
i.e. hemizygotami and therefore to reveal the disease they need only one allele.
• Symptoms of this type of disease rarely appear in women (XX), which most often
remain carriers.
Hypertension
• Abnormally high blood pressure.
• Hypertension is diagnosed on the basis of a persistently high resting blood pressure.
Traditionally, the National Institute of Clinical Excellence recommends three separate
resting sphygmomanometer measurements at monthly intervals. The American Heart
Association recommends at least three resting measurements on at least two separate
health care visits.
Schizophrenia
• Many genes are known to be involved in schizophrenia, each of small effect and
unknown transmission and expression.
• Estimates of the heritability of schizophrenia is around 80%, which implies that 80% of the
individual differences in risk to schizophrenia is associated with genetics. These
estimates vary because of the difficulty in separating genetic and environmental
influences. The greatest single risk factor for developing schizophrenia is having a first-
degree relative with the disease (risk is 6.5%); more than 40% of monozygotic twins of
those with schizophrenia are also affected. If one parent is affected the risk is about
13% and if both are affected the risk is nearly 50%. Results of candidate gene studies of
schizophrenia have generally failed to find consistent associations