See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/41122190

Effect of heat stress on the porcine small intestine: A morphological and gene
expression study

Article  in  Comparative biochemistry and physiology. Part A, Molecular & integrative physiology · May 2010
DOI: 10.1016/j.cbpa.2010.01.008 · Source: PubMed

CITATIONS READS

101 811

9 authors, including:

Peng Yin Fenghua Liu

China Agricultural University College of Animal Science and Technology, Beijing University of Agriculture, Beijin…
30 PUBLICATIONS   494 CITATIONS    73 PUBLICATIONS   1,060 CITATIONS   

SEE PROFILE SEE PROFILE

Jianqin Xu
China Agricultural University
43 PUBLICATIONS   798 CITATIONS   

SEE PROFILE

All content following this page was uploaded by Fenghua Liu on 24 April 2019.

The user has requested enhancement of the downloaded file.

This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
 Author's personal copy

Comparative Biochemistry and Physiology, Part A 156 (2010) 119–128

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A

j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p a

Effect of heat stress on the porcine small intestine: A morphological and gene
expression study
Jin Yu a, Peng Yin b, Fenghua Liu a,c,⁎, Guilin Cheng a,c, Kaijun Guo a, An Lu a, Xiaoyu Zhu b,
Weili Luan a, Jianqin Xu b,⁎
a
Department of Animal Science and Technology, Beijing University of Agriculture, Beijing 102206, PR China
b
College of Veterinary Medicine, China Agricultural University, Beijing 100193, PR China
c
Beijing Key Laboratory of TCVM, Beijing University of Agriculture, Beijing 102206, PR China

a r t i c l e i n f o a b s t r a c t

Article history: With the presence of global warming, the occurrence of extreme heat is becoming more common, especially during
Received 26 November 2009 the summer, increasing pig susceptibility to severe heat stress. The aim of the current study was to investigate
Received in revised form 13 January 2010 changes in morphology and gene expression in the pig small intestine in response to heat stress. Forty eight Chinese
Accepted 14 January 2010
experimental mini pigs (Sus scrofa) were subjected to 40 °C for 5 h each day for 10 successive days. Pigs were
Available online 22 January 2010
euthanized at 1, 3, 6, and 10 days after heat treatment and sections of the small intestine epithelial tissue were
excised for morphological examination and microarray analyses. After heat treatment, the pig rectal temperature, the
Keywords:
Heat stress
body surface temperature and serum cortisol levels were all significantly increased. The duodenum and jejunum
Morphology displayed significant damage, most severe after 3 days of treatment. Microarray analysis found 93 genes to be up-
Gene expression regulated and 110 genes to be down-regulated in response to heat stress. Subsequent bioinformatic analysis
Electron microscope (including gene ontology and KEGG pathway analysis) revealed the genes altered in response to heat stress related to
Microarray unfolded protein, regulation of translation initiation, regulation of cell proliferation, cell migration and antioxidant
Small intestine regulation. Heat stress caused significant damage to the pig small intestine and altered gene expression in the pig
Pig jejunum. The results of the bioinformatic analysis from the present study will be beneficial to further investigate the
underlying mechanisms involved in heat stress-induced damage in the pig small intestine.
Crown Copyright © 2010 Published by Elsevier Inc. All rights reserved.

1. Introduction To investigate the effect of heat stress on the porcine small intestine,
the current study placed Chinese mini pigs in an artificial climate
With the presence of global warming, heat stress is now a primary chamber for 10 days, simulating the surge in the heat experienced
factor influencing animal health and growth, especially during the during summer. Morphological changes in the porcine small intestine
summer months (Leon et al., 2005). Across the United States heat stress were examined by light and electron microscopes. Gene expression
is estimated to be responsible for a loss of between $1.69 and $2.36 billion profiling by DNA microarray has recently been established, enabling the
to livestock industries (St-Pierre et al., 2003). The gastrointestinal (GI) comparison of thousands of genes simultaneously (Trevino et al., 2007).
tract of the pig possesses a large surface area, providing a regulatory This method was employed to ascertain whole gene expression profiles
barrier to which the pig is exposed to a large assortment of nutrients, of the pig small intestine using an Affymetrix DNA microarray. We
microbes and exogenous toxins. The intestine permits the exchange of executed a gene ontology analysis (including molecular function,
beneficial nutrients into the systemic circulation, while simultaneously biological processes, cellular components and KEGG pathway) on
preventing penetration of pathogenic organisms and toxic compounds genes displaying a differential expression between treatments, provid-
(Cario et al., 2002; Hirata et al., 2007). Thus, maintaining the integrity of ing insight into the potential mechanisms underlying heat stress-
the epithelium lining the gastrointestinal tract is of great importance, induced injury in the pig small intestine.
ensuring its absorptive and protective functions are not compromised
(Leon et al., 2005). Extreme heat stress can damage the pig gastrointes-
tinal tract epithelium resulting in low animal yield and performance, as 2. Materials and methods
well as increasing morbidity and mortality (Liu et al., 2009).
2.1. Animals

⁎ Corresponding authors. Liu is to be contacted at No. 7, Beinong Road, Beijing, 102206,

PR China. Tel./fax: +86 10 80794699. Xu, No. 2, Yuanmingyuan West Road, Beijing,
All experimental protocols were approved by the Committee for
100193, PR China. Tel.: +86 10 62733017; fax: +86 10 62734111. the Care and Use of Experimental Animals at Beijing University of
E-mail addresses: liufenghua1209@126.com (F. Liu), jianqinxucau@126.com (J. Xu). Agriculture.

1095-6433/$ – see front matter. Crown Copyright © 2010 Published by Elsevier Inc. All rights reserved.
doi:10.1016/j.cbpa.2010.01.008
 Author's personal copy

120 J. Yu et al. / Comparative Biochemistry and Physiology, Part A 156 (2010) 119–128

Forty eight male, two-month old Chinese mini pigs (body mass 7.6 ± Table 1
0.5 kg) were purchased from the Changping Experimental Pig Farm, The villus height and crypt depth of the pig small intestine.

Chinese Agricultural University. Pigs were randomly assigned to either Day Villus height(μm) Crypt depth (μm)
control or heat treated groups (24 pigs per treatment group) accounting
Control Heat treatment Control Heat treatment
for body weight and litter origin. The two groups were raised in an
Duodenum 1 328.0 ± 16.2 299.1 ± 16.4* 206.8 ± 18.6 208.0 ± 23.7
artificial climate chamber (light, 7:00–19:00 h, humidity 60%) with free
3 331.1 ± 14.7 295.7 ± 15.7* 213.0 ± 17.3 192.8 ± 16.3
access to food and water. Routine immunizations were performed. 6 329.2 ± 16.8 297.5 ± 9.7* 203.2 ± 17.2 193.2 ± 19.2
10 327.0 ± 17.5 317.5 ± 17.1 211.5 ± 20.5 208.8 ± 15.1
2.2. Treatments and sampling Jejunum 1 331.7 ± 13.4 261.3 ± 17.5** 208.2 ± 17.0 174.6 ± 12.1**
3 337.0 ± 18.6 261.8 ± 14.3*** 203.4 ± 15.6 165.2 ± 16.3**
6 332.0 ± 13.5 297.3 ± 13.6** 212.7 ± 20.2 186.0 ± 20.6
Both control and heat treated groups were initially housed for five 10 333.4 ± 20.3 317.2 ± 16.8 209.6 ± 14.5 196.0 ± 18.8
days at 23 °C. Animals in the heat treated group were then subjected to Ileum 1 298.8 ± 22.7 289.0 ± 19.4 202.3 ± 18.4 182.7 ± 18.5
40 °C for 5 h, from 04:00 to 09:00 h, before the temperature was 3 305.7 ± 17.1 276.4 ± 16.0** 204.5 ± 15.8 180.7 ± 19.1
lowered back to 26 °C. Heat-treated animals underwent this protocol 6 301.2 ± 15.8 296.2 ± 20.3 205.8 ± 21.5 178.2 ± 20.4
10 308.5 ± 18.3. 292.0 ± 14.2 201.0 ± 20.4 203.0 ± 17.2
for ten consecutive days, while control animals were maintained at
23 °C only. Rectal and body surface temperatures were detected before Notice: Different from control,*P < 0.05, **P < 0.01, ***P < 0.001. Values are means ± SE,
and after each exposure using infrared and contact thermometers n = 6.

(Fluke 561, USA). Six pigs were randomly selected from each group at
1, 3, 6 and 10 days. Pigs were electrically stunned using a head-only
electric stun tong (Xingye Butchery Machinery Co. Ltd, Changde, procedure was performed based on manufacturer's instructions
Hunan Province, PR China) and subsequently exsanguinated. Blood (Promega, USA); in brief, 70 °C for 5 min followed by 42 °C for 2 h.
samples were collected and centrifuged at 3000 g for 10 min, and the The RT products (cDNA) were then stored at − 20 °C for PCR.
sera stored at − 20 °C until required. Sections of the duodenum,
jejunum and ileum were rapidly excised and washed with physiolog- 2.5. DNA microarray
ical saline. All intestinal segments were divided into three parts: 1) a
1 cm length section was fixed in 10% neutral formalin for paraffin 2.5.1. RNA extraction and target labeling
embedding; 2) a 1 mm2 sample was fixed in 4% glutaraldehyde for Total RNA was isolated from the pig jejunum by TRIzol reagent
electron microscopy; 3) a 3 cm length section was minced and (Invitrogen Life Technologies, P/N 15596-018) and an RNeasy Mini Kit
separated into three sample tubes, snap frozen in liquid nitrogen and (QIAGEN, P/N 74104) according to the manufacturer's instructions. RNA
stored at −80 °C until required. integrity of each sample was documented using a RNA 6000 LabChip Kit
and an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA,
2.3. Morphological examination and serum cortisol analysis USA). RNA was only processed when it had a 28 S/18 S rRNA ratio of
≥1.8. RNA was purified using a QIAGEN RNeasy® Mini Kit (#74106,
Formalin-fixed samples were embedded in paraffin and sectioned QIAGEN) and amplified using a Low RNA Input Linear Amplification kit
in transverse (5 μm thick). After deparaffinization and dehydration, (#5184-3523, Agilent, USA). Each RNA sample was annealed with a
the sections of the duodenum, jejunum and ileum were stained with primer containing polydT and T7 polymerase promoters. Reverse
hematoxylin and eosin. The structure of the mucosa was observed transcriptase produced single and double-stranded cDNAs. T7 RNA
using a BH2 Olympus microscope (Olympus, Tokyo, Japan) and polymerase then created cRNA from the double-stranded cDNA by
analyzed using an image analysis system (Olympus 6.0, Tokyo, Japan). incorporating cyanine-3-labeled cytidine 5-triphosphate. The quality of
Using 40× magnification, the labeled cRNA was again verified and the absolute concentration
Villi height and crypt depth of at least five well-oriented villi were determined by spectrophotometry (ND1000, Nanodrop).
measured and recorded. Intestinal epithelial cells were examined by
electron microscopy. Small pieces of the intestine were fixed for 1 h in 2.5.2. Hybridization, scanning and feature extraction
4% glutaraldehyde in 0.1-M cacodylate buffer (pH 7.4). Tissue sections The cRNA was hybridized to arrays; equal amounts of cRNA were
were then washed in the same buffer and fixed for 1 h in cold 1% hybridized using a Gene Expression Hybridization Kit (#5188-5242,
osmium tetroxide in cacodylate buffer. After dehydration in graded Agilent, USA). Hybridization was performed at 60 °C for 17 h on
ethanol solutions, the preparations were embedded in Araldite (EPON Affymetrix Whole Porcine Genome Arrays (#ATH1-121501, Affymetrix,
812, Emicron, Shanghai, China). Ultra-thin sections were stained with
saturated uranyl acetate in 50% ethanol and lead citrate, and
examined by transmission electron microscopy (JEM, 1230, JEOL,
Tokyo, Japan). Serum cortisol concentration was determined using an
I125 cortisol radioimmunoassay kit, according to the manufacturer's
instructions (Beijing Chemclin Biotech Co., Ltd, China).

2.4. Total RNA isolation and reverse transcription (RT)

Total RNA was isolated from the pig small intestine using a phenol
and guanidine isothiocyanate-based TRIzol reagent (Invitrogen, USA.)
according to the manufacturer's instructions. The concentration and
purity of isolated RNA was assessed by a spectrophotometry
(SmartSpec plus, BIO-RAD, USA) based on the OD260/OD280 ratio.
Total RNA was reverse transcribed as follows: 2.0 μg RNA isolated
from each tissue sample was added to 25 μL reaction solution
Fig. 1. Pig rectal temperature before (B) and after (A) heat treatment (5 h at 40 °C). Pig
containing 2.0 μL oligo-dT18, 5.0 μL dNTPs, 1.0 μL RNase inhibitor, rectal temperature was significantly elevated following heat treatment (P < 0.05).
1.0 μL M-MLV transcriptase, 5.0 μL M-MLV RT reaction buffer Values represent the mean ± SE, n = 6 pigs for each group. *P < 0.05 before versus after
(Promega, USA) and RNase-free water. The reverse-transcription heat stress.
 Author's personal copy

J. Yu et al. / Comparative Biochemistry and Physiology, Part A 156 (2010) 119–128 121

Fig. 2. Pig body surface temperature before (B) and after (A) heat stress. Body surface temperature was significantly increased after heat treatment (40 °C for 5 h). Values represent
the mean ± SE, n = 6 pigs for each group. *P < 0.05 before versus after heat stress.

USA). Arrays were washed using a Gene Expression Wash Buffer Kit Scanner (Affymetrix® GeneChip® Scanner 3000, USA) and the data
(#5188-5327, Agilent) before the stabilization and drying solution was compiled with the Affymetrix Feature Extraction Software (Affymetrix
applied (#5185-5979, Agilent). Arrays were scanned on a Microarray GeneChip Operating Software Version 1.4). The processes involving
initial RNA amplification through to the final output data were all
performed by a private contractor (CapitalBio Co., Ltd, China).

2.5.3. Microarray data analysis

Array normalization and error detection analysis were carried out
using Affymetrix GeneChip Operating Software Version 1.4 (Affymetrix).
First, values of poor intensity and low dependability were removed using
a “filter on flags” feature, where standardized software algorithms
determined which spots were “present”, “marginal”, or “absent.” Spots
were considered “present” only where the output was uniform, not
saturated, and significant above background. Spots that satisfied the
main requirements but were calculated to be outliers relative to the
typical values for the other genes were considered “marginal.” Filters
were set to retain only the values that were found to be present or
marginal for further analysis. Data were normalized by the algorithms
supplied with the feature extraction software. After normalization, one
final quality-control filter was applied, where genes showing excessive
biological variability were discarded. Bioinformatic analysis including
Fig. 3. Heat-induced changes in serum corticosterone levels. Cortisol levels of heat-
stressed animals were significantly higher than control animals on the 1st, 3rd, 6th and
molecular function, biological processes, cellular components and KEGG
10th day after initial heat stress. Values represent the mean ± SE, n = 6 pigs for each pathway were conducted using a Molecule Annotation System (http://
group. *P < 0.05 heat-stressed versus control. bioinfo.capitalbio.com/mas/).
 Author's personal copy

122 J. Yu et al. / Comparative Biochemistry and Physiology, Part A 156 (2010) 119–128

Fig. 4. Photomicrographs of hematoxylin- and eosin-stained sections of the pig small intestine from heat treated and control animals after 3 days of treatment (200× magnification). A and B)
Control and heat treated duodenums, respectively; C and D) control and heat treated jejunums respectively; E and F) control and heat treated ileums, respectively. Severe damage to the intestinal
villi is apparent, with desquamation at the tips of the intestinal villi and exposure of the lamina propria. Abnormal microstructures are indicated with arrowheads. Scale bar 100 μm.

2.6. Validation of HSP90, HSP70, HSP27, EGF and EGFR mRNA in the pig and then the melting curve from 55 to 95 °C at 0.2 °C/s was monitored
jejunum by real-time PCR continuously by measuring fluorescence. Expression levels were
determined using the threshold cycle (CT) method as described by
Expression of HSP70, HSP90, HSP27, EGF and EGFR were quantita- the manufacturer of the detection system. This method was applied to
tively determined using real-time PCR. Quantitative PCR analysis was each gene by calculating the expression 2− ΔΔCT, where ΔΔCT is the
carried out using the DNA Engine Mx3000P® fluorescence detection sum of: [CTgene − CTβ-actin](Heat-stressed) − [CTgene − CTβ-actin](Control).
system against a double-stranded DNA-specific fluorescent dye
(Stratagene, USA) according to optimized PCR protocols. β-actin
was amplified in parallel with the target genes providing a control. 2.7. Statistical analysis
The cDNA was subjected to real-time RT-PCR using the primer pairs
listed in Table 1. The PCR reaction system (20 μL) contained 10 μL of All results are presented as the mean ± SD. Statistical analysis was
SYBR Green qPCR mix, 0.3 μL of reference dye, 1 μL of each primer performed by independent-sample T-tests using SPSS 12.0. A P-value
(both 10 μmol/L), and 1 μL of cDNA template. Cycling conditions were of < 0.05 was considered significant. Microarray analysis was
94 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 56 °C for 30 s conducted using a Molecule Annotation System (http://bioinfo.
and 72 °C for 40 s. Dissociation began with a step of 95 °C for 1 min, capitalbio.com/mas/).
 Author's personal copy

J. Yu et al. / Comparative Biochemistry and Physiology, Part A 156 (2010) 119–128 123

Table 2
List of the differentially expressed genes.

Probe set ID Fold change Representative public ID Gene title

Ssc.15939.1.A1_x_at 90.24 AF248302.1 Clone PVA3A Ig heavy chain variable VDJ region
Ssc.22483.1.A1_at 44.96 CF795103 Transcribed locus
Ssc.15988.1.S1_at 6.41 NM_213818.1 Elafin family member protein
Ssc.11197.1.S1_at 5.22 CK461732 Heat shock protein 27 kDa
Ssc.12191.3.A1_at 5.04 BQ604703 90-kDa heat shock protein (hsp90)
RPTR-Ssc-ECOLOXL_at 4.41 RPTR-Ssc-ECOLOXL –
Ssc.22953.1.A1_at 4.25 BX671488 –
Ssc.114.1.S1_at 4.15 X68213.1 Heat shock protein 72 (pot.) mRNA
Ssc.12191.2.A1_at 4.12 BQ600020 90-kDa heat shock protein (hsp90)
Ssc.18563.1.A1_at 4.01 U15459.1 Clone pvg7a Ig heavy chain variable VDJ region
Ssc.4617.1.S1_at 3.72 NM_214394.1 Vitamin D3 25-hydroxylase
Ssc.268.1.S1_at 3.48 NM_214075.1 25-hydroxyvitamin D3-24-hydroxylase
Ssc.428.10.A1_at 3.43 AB087975.1 T-cell receptor alpha chain mRNA C-region, 3′ end of cds
Ssc.5145.1.S1_a_at 3.26 NM_213766.1 Heat shock protein 70.2
Ssc.13780.11.S1_x_at 2.63 AB105382.1 MHC class I PD7 mRNA, partial 3′ UTR
Ssc.14511.1.S1_at 2.49 Y15010.1 CMP-N-acetylneuraminate monooxygenase
Ssc.15947.1.A1_at 2.44 AF248278.1 Clone 6 immunoglobulin heavy chain
Ssc.26799.1.S1_at 2.39 CN166265 Clone Clu_10353.scr.msk.p1.Contig1, mRNA sequence
Ssc.496.1.S1_at 2.39 AJ236927.1 Hypothetical protein (5′; clone 2C2)
Ssc.286.1.S1_s_at 2.38 NM_213817.1 Inflammatory response protein 6
Ssc.23513.1.S1_at 2.37 BP168084 MRNA, clone:THY010204E06, expressed in thymus
Ssc.23287.1.A1_at 2.35 BX672495 –
Ssc.23986.1.S1_at 2.35 CK451737 MRNA, clone:SPL010080F09, expressed in spleen
Ssc.15885.1.S1_at 2.34 NM_213804.1 RNA helicase
Ssc.18554.1.S1_x_at 2.30 AB105380.1 SLA-1 mRNA for MHC class I antigen, partial cds, allele:SLA-1*02
Ssc.13769.1.S1_at 2.27 M81327.1 Lactoferrin
Ssc.16335.1.S2_at 2.26 X62984.1 Lipoprotein lipase
Ssc.12072.1.S1_a_at 2.25 BI181608 MRNA, clone:UTR010033A11, expressed in uterus
Ssc.3968.1.S1_at 2.23 NM_213947.1 Epididymal secretory protein E4
RPTR-Ssc-ECOLOXL_x_at 2.21 RPTR-Ssc-ECOLOXL –
Ssc.17799.1.A1_at 2.12 AB087930.1 TCR-a mRNA for T-cell receptor alpha chain, partial cds, clone:PPA151
Ssc.27304.1.S1_at 2.11 BI327092 Thymosin beta-4 (LOC733606), mRNA
Ssc.18773.1.A1_at 2.09 CF363138 Clone rski0137_l13.y1.abd, mRNA sequence
Ssc.21.1.S1_s_at 2.06 AF319661.1 RNA helicase
Ssc.21283.1.S1_at 2.01 BI118474 MRNA, clone:LVRM10044E04, expressed in liver
Ssc.24.1.S1_at 2.01 NM_001001535.1 Muscle-specific intermediate filament desmin
Ssc.10974.1.S1_at − 2.00 NM_213931.1 Arachidonate 12-lipoxygenase
Ssc.16234.1.A1_at − 2.01 CB472702 Haptocorrin
Ssc.26113.2.S1_at − 2.07 BX914409 MRNA, clone:LNG010058C07, expressed in lung
Ssc.315.1.S1_at − 2.09 NM_214108.1 Dipeptidase
Ssc.206.1.S1_at − 2.11 NM_214420.1 Cytochrome P450 2C49
Ssc.29175.1.A1_at − 2.13 CO951217 MHC class I PD7 mRNA, partial 3′ UTR
Ssc.18553.1.S1_at − 2.13 AB105383.1 SLA-2 mRNA for MHC class I antigen, partial cds, allele:SLA-2*03
Ssc.16051.1.S1_at − 2.16 AJ681165 Cellular disintegrin precursor
Ssc.10654.1.A1_at − 2.20 BQ597543 MRNA, clone:PBL010089E08, expressed in peripheral blood mononuclear cell
Ssc.203.1.S1_at − 2.21 NM_214422.1 cytochrome P450 3A39
Ssc.22959.1.S1_at − 2.21 BX676168 MRNA, clone:LVR010098C08, expressed in liver
Ssc.26321.1.S1_s_at − 2.23 U35733.1 Cytochrome P450 2C34 /// cytochrome P450 2C35 /// cytochrome P450 2C36 /// cytochrome P450 2C49
Ssc.10015.1.A1_at − 2.27 CK465404 Vascular endothelial growth factor
RPTR-Ssc-AF292560-1_s_at − 2.30 RPTR-Ssc-AF292560-1 –
Ssc.17770.1.S1_at − 2.30 AF334739.1 Clone 2-4 immunoglobulin kappa light chain VJ region
Ssc.710.1.S1_at − 2.32 M31496.1 Secretin
Ssc.11267.1.S1_at − 2.33 NM_214413.1 Cytochrome P450 2B22
Ssc.15949.1.A1_at − 2.35 AF248274.1 Clone 2 immunoglobulin heavy chain
Ssc.11791.1.S1_at − 2.38 NM_213967.1 Scavenger receptor class B member 1
Ssc.14073.2.S1_at − 2.39 AJ683636 MRNA, clone:LVRM10122H12, expressed in liver
Ssc.26326.1.A1_at − 2.44 AB052266.1 Cytochrome P450 3A46
Ssc.714.1.S1_at − 2.45 NM_214235.1 Motilin
Ssc.14551.1.S1_at − 2.52 NM_213906.1 Amelogenin 173A
Ssc.11171.1.S1_at − 2.73 CN167008 MRNA, clone:THY010088A06, expressed in thymus
Ssc.15996.1.S1_at − 2.87 AJ399510.1 Apolipoprotein B (apoB gene), editing region
Ssc.55.1.S1_at − 3.01 NM_214007.1 Epidermal growth factor receptor
Ssc.15949.1.S1_at − 3.20 AF248274.1 Clone 2 immunoglobulin heavy chain
Ssc.87.1.S1_at − 3.37 NM_214020.1 Epidermal growth factor
Ssc.14073.1.S1_at − 3.38 CN159960 MRNA, clone:LVRM10122H12, expressed in liver
Ssc.29911.1.A1_at − 3.43 CO939399 MRNA, clone:TCH010025F03, expressed in trachea
Ssc.16213.1.S1_x_at − 3.45 L36579.1 MHC class II SLA-DRB2-2D mRNA, exon 2
Ssc.5204.1.S1_at − 3.46 CK463412 Clone rnco1933b_j2.y1.abd, mRNA sequence
Ssc.645.1.S1_at − 3.47 NM_213859.1 Stefin A1
Ssc.18948.1.S1_at − 4.06 CB475095 Serum amyloid A2 (LOC733603), mRNA
Ssc.15995.2.S1_at − 4.68 AF233358.1 Slow delayed rectifier K+ channel
Ssc.16212.1.S1_x_at − 5.14 L36575.1 MHC class II SLA-DRB2-2D mRNA, exon 2 /// MHC class II SLA-DRB2-2A mRNA, exon 2
Ssc.16203.1.S1_x_at − 8.70 Z81295.1 Hn-RNA, clone h5155
Ssc.16169.1.S1_x_at − 9.74 CB338040 –
Ssc.27875.1.A1_at − 29.12 CO988835 Transcribed locus
 Author's personal copy

124 J. Yu et al. / Comparative Biochemistry and Physiology, Part A 156 (2010) 119–128

Fig. 5. Morphological alterations in the ultrastructure of the porcine jejunal epithelium following 3 days of heat treatment (50,000× magnification). A and B) control jejunum; C and
D) heat treated jejunum. Microvillus height was significantly shorter in the heat treated jejunum compared with the control (2013 ± 18 nm versus 2232 ± 30 nm, respectively).
Three days of heat treatment caused the internal cristae of mitochondria to become swollen and shortened, increased the number of mitochondria and secondary lysosomes present,
as well as alter tight junction morphology (indicated by arrows).

3. Results 3.2. Morphological analysis

3.1. Rectal temperature, body surface temperature and serum cortisol Heat treatment clearly caused marked damage to the pig small
concentration intestine, found to be most severe in the jejunum after 3 days of heat
treatment. Desquamation of mucosal epithelium was exhibited at the
Pig rectal and body surface temperatures were significantly tips of the intestinal villi, exposing the lamina propria (Fig. 4). Villi
elevated after 5 h of chronic heat exposure (Figs. 1 and 2). Serum height and crypt depth was shorter in the heat treatment group
cortisol concentration of heat treated pigs was also significantly compared to control animals (Table 2), most evident in the jejunum
higher than that of the control group (Fig. 3). after 3 days of heat treatment.
 Author's personal copy

J. Yu et al. / Comparative Biochemistry and Physiology, Part A 156 (2010) 119–128 125

Table 3 Table 5
Primers used for real-time PCR. Biological process analysis result of the differentially expressed genes.

Description Accession Primer sequence Product Biological process Total P-value Q value
number (bp)
GO:0006986 response to unfolded protein 5 0.000000 0.000000
β-actin NM_031144 Forward: TTGTCCCTGTATGCCTCTGG 218 GO:0030334 regulation of cell migration 1 0.000000 0.000000
Reverse: ATGTCACGCACGATTTCCC GO:0006457 protein folding 5 0.000000 0.000000
HSP70 M29506 Forward: GTGGCTCTACCCGCATCCC 114 GO:0006413 translational initiation 1 5.85E-4 3.6E-4
Reverse: GCACAGCAGCACCATAGGC GO:0006118 electron transport 8 0.005031 0.002991
HSP90 NM_213973 Forward: CGCTGAGAAAGTGACCGTTATC 126 GO:0006879 iron ion homeostasis 1 0.014016 0.008035
Reverse: ACCTTTGTTCCACGACCCATAG GO:0006826 iron ion transport 1 0.020764 0.011876
HSP27 NM_001007518 Forward: AGGAGCGGCAGGATGAG 101 GO:0007173 epidermal growth factor receptor signal.. 2 0.020980 0.011971
Reverse: GGACAGGGAGGAGGAGAC GO:0006824 cobalt ion transport 1 0.039577 0.022423
EGF NM_214020 Forward : CAGTAACCTGGGAATGTGGC 231 GO:0046327 glycerol biosynthesis from pyruvate 1 0.040751 0.023034
Reverse : GGGCTGTATGGGCAAAGTAT GO:0050730 regulation of peptidyl-tyrosine phospho.. 2 0.080068 0.045047
EGFR NM_214007 Forward : GCCTTAGCCGTCTTATCCAA 299 GO:0048595 eye morphogenesis (sensu Mammalia) 1 0.135553 0.075778
Reverse : TGGGCACAGATGACTTTGGT GO:0050679 positive regulation of epithelial cell .. 1 0.149207 0.083314
GO:0009168 purine ribonucleoside 1 0.156470 0.087219
monophosphate bio..
GO:0030324 lung development 1 0.195823 0.108404
GO:0006813 potassium ion transport 1 0.219127 0.121097
GO:0046685 response to arsenic 2 0.354286 0.194676
Ultrastructure examination of the pig jejuna epithelium on day 3 GO:0045187 regulation of circadian sleep/wake cycl.. 2 0.355078 0.194889
revealed that microvilli height in heat-stressed pigs was significantly GO:0008293 torso signaling pathway 2 0.410344 0.222943
shorter than the control (2232 nm ± 30 versus 2013 ± 28 nm, GO:0007098 centrosome cycle 2 0.413952 0.224650
GO:0008595 determination of anterior/posterior axi.. 2 0.431667 0.234001
P < 0.05). Jejunal epithelium exhibited an increased number of
GO:0046777 protein amino acid autophosphorylation 1 0.433061 0.234494
mitochondria with shortened internal cristae, increased organelle GO:0009408 response to heat 3 0.453834 0.245055
debris within the lysosomes, and enterocyte tight junction morphol- GO:0048754 branching morphogenesis of a tube 1 0.471393 0.254110
ogy was found to be altered (Fig. 5). GO:0030855 epithelial cell differentiation 1 0.487382 0.262437
GO:0007465 R7 cell fate commitment 2 0.548343 0.294277
GO:0008284 positive regulation of cell proliferati.. 2 0.566955 0.303760
3.3. Microarray and bioinformatic analysis GO:0042462 eye photoreceptor cell development 1 0.575281 0.307708
GO:0006811 ion transport 3 0.580626 0.308711
Gene expression profiling in the pig jejunum at day 3 was GO:0006983 ER overload response 1 0.580990 0.308711
performed using cDNA microarrays. 93 genes were found to be GO:0018108 peptidyl-tyrosine phosphorylation 1 0.585094 0.310550
GO:0007229 integrin-mediated signaling pathway 1 0.637633 0.330093
significantly up-regulated and 110 genes down-regulated (T-test GO:0007498 mesoderm development 1 0.642068 0.332033
P < 0.01 and fold change ≥ 2.0) in the heat treated group compared to GO:0009615 response to virus 1 0.662201 0.334293
the control. Some of the significant genes are listed in Table 3. GO:0007169 transmembrane receptor protein tyrosine 1 0.719917 0.334293
To further characterize the types of genes altered in response to GO:0045103 intermediate filament-based process 1 0.727416 0.334293
GO:0016042 lipid catabolism 1 0.793788 0.364448
heat stress, the 203 genes that were significantly altered in response
GO:0051084 posttranslational protein folding 1 0.807103 0.366878
to heat stress (P < 0.01) were classified into gene ontology (GO) slim GO:0051085 chaperone cofactor-dependent protein fo.. 1 0.807103 0.366878
terms. GO slim assigns high level terms from each of the three major GO:0001525 angiogenesis 1 0.844462 0.379772
gene ontologies: molecular function, biological processes and cellular GO:0008360 regulation of cell shape 2 0.853074 0.383288
components. GO:0048514 blood vessel morphogenesis 1 0.879798 0.383943
GO:0006094 gluconeogenesis 1 0.889246 0.383943
Molecular function analysis (Table 4) showed GO 0003779 (actin
GO:0001568 blood vessel development 1 0.905634 0.383943
binding), GO 0004497 (monooxygenase activity), GO 0003743 GO:0006163 purine nucleotide metabolism 1 0.917381 0.383943
GO:0007010 cytoskeleton organization and biogenesi.. 1 0.921234 0.383943
GO:0007283 spermatogenesis 2 0.923033 0.383943
GO:0007015 actin filament organization 2 0.929363 0.383943
GO:0015671 oxygen transport 1 0.972912 0.383943
Table 4
GO:0009117 nucleotide metabolism 1 0.975677 0.383943
Molecular function analysis result of the differentially expressed genes.
GO:0019882 antigen processing and presentation 4 0.979551 0.383943
Molecular function Total P-value Q value GO:0016477 cell migration 1 0.990376 0.383943
GO:0006468 protein amino acid phosphorylation 1 0.990849 0.383943
GO:0003779 actin binding 1 1.6E-5 1.0E-5 GO:0002474 antigen processing and presentation of .. 1 0.991021 0.383943
GO:0004497 monooxygenase activity 6 2.0E-5 1.2E-5 GO:0019886 antigen processing and presentation of .. 1 0.994540 0.383943
GO:0003743 translation initiation factor activity 1 3.12E-4 1.94E-4 GO:0019884 antigen processing and presentation of .. 1 0.994894 0.383943
GO:0030338 CMP-N-acetylneuraminate 1 0.001223 7.49E-4 GO:0006916 anti-apoptosis 1 0.996809 0.383943
monooxygenase a.. GO:0008283 cell proliferation 2 0.996921 0.383943
GO:0005506 iron ion binding 9 0.003643 0.002207 GO:0007517 muscle development 1 0.996928 0.383943
GO:0016712 oxidoreductase activity, acting on pair.. 6 0.006979 0.004098 GO:0006461 protein complex assembly 2 0.997131 0.383943
GO:0048503 GPI anchor binding 1 0.008528 0.004987 GO:0007155 cell adhesion 1 0.997700 0.383943
GO:0008199 ferric iron binding 1 0.010594 0.006184 GO:0006629 lipid metabolism 2 0.998455 0.383943
GO:0020037 heme binding 6 0.010996 0.006364 GO:0006955 immune response 3 0.999731 0.383943
GO:0004465 lipoprotein lipase activity 1 0.013369 0.007678 GO:0048002 antigen processing and presentation of .. 1 0.999958 0.383943
GO:0015087 cobalt ion transporter activity 1 0.024175 0.013770 GO:0006952 defense response 3 0.999970 0.383943
GO:0004000 adenosine deaminase activity 1 0.031314 0.017815 GO:0007166 cell surface receptor linked signal tra.. 1 0.999976 0.383943
GO:0050897 cobalt ion binding 1 0.032498 0.018467 GO:0000074 regulation of progression through cell .. 2 0.999987 0.383943
GO:0019239 deaminase activity 1 0.038400 0.021795 GO:0000902 cell morphogenesis 1 0.999997 0.383943
GO:0005249 voltage-gated potassium 1 0.039577 0.022423 GO:0006950 response to stress 3 1.000000 0.383943
channel activit.. GO:0007165 signal transduction 1 1.000000 0.383943
GO:0004613 phosphoenolpyruvate 1 0.040751 0.023034 GO:0006810 transport 3 1.000000 0.383943
carboxykinase (GTP).. GO:0007275 development 1 1.000000 0.383943
GO:0004611 phosphoenolpyruvate 1 0.044267 0.024978 GO:0030154 cell differentiation 1 1.000000 0.383943
carboxykinase activ..
GO:0005006 epidermal growth factor receptor activi.. 1 0.046603 0.026265
 Author's personal copy

126 J. Yu et al. / Comparative Biochemistry and Physiology, Part A 156 (2010) 119–128

Table 6 4. Discussion
Cellular component analysis result of the differentially expressed genes.

Cellular component Total P-value Q value 4.1. Assessment of heat stress

GO:0043292 contractile fiber 2 0.0 0.0
GO:0005626 insoluble fraction 2 0.0 0.0 In mammals, rectal temperature is used as the best assessment of
GO:0005625 soluble fraction 1 0.0 0.0 heat stress (Srikandakumar et al., 2003; Sinha, 2008). Glucocorticoids
GO:0005634 nucleus 3 0.0 0.0 are critical for environmental adaptation, with increased levels of
GO:0005886 plasma membrane 3 0.0 0.0
serum cortisol revealing the occurrence of a stress response (Elez
GO:0030018 Z disc 2 0.0 0.0
GO:0030018 Z disc 2 0.0 0.0 et al., 2000; Mahmoud et al., 2004; Pace et al., 2008). In the present
GO:0016599 caveolar membrane 1 0.15647 0.087219 study, pig rectal temperature and serum cortisol levels were
GO:0000299 integral to membrane of membrane fracti.. 1 0.157502 0.087643 significantly increased after 5 h of heat stress, consistent with
GO:0030139 endocytic vesicle 1 0.191872 0.106400 previous reports (Figs. 1 and 2). Pig body surface temperature was
GO:0042627 chylomicron 1 0.360593 0.197692
also found to be significantly elevated after 5 h of heat stress which is
GO:0005792 microsome 5 0.365918 0.200044
GO:0016323 basolateral plasma membrane 1 0.524407 0.281745 rarely reported in heat stress studies (Fig. 3). It is now well
GO:0005788 endoplasmic reticulum lumen 1 0.578923 0.308711 documented that a strong correlation exists between peripheral
GO:0016282 eukaryotic 43S preinitiation complex 1 0.623782 0.324663 blood flow and body surface temperature (Hardy and Soderstrom,
GO:0042612 MHC class I protein complex 3 0.695154 0.334293
1938). Heat stress causes an increase in peripheral blood flow,
GO:0030424 axon 1 0.710077 0.334293
GO:0005887 integral to plasma membrane 2 0.711398 0.334293 allowing increased heat dissipation at the skin, observed by an
GO:0005813 centrosome 2 0.711859 0.334293 elevated body surface temperature (Marai et al., 2007).
GO:0005737 cytoplasm 7 0.723935 0.334293
GO:0005882 intermediate filament 1 0.799071 0.366526 4.2. Heat stress causes marked injury to the pig small intestine
GO:0005856 cytoskeleton 3 0.811586 0.366878
GO:0031965 nuclear membrane 1 0.834532 0.376006
GO:0005783 endoplasmic reticulum 6 0.920480 0.383943 When pigs are exposed to environmental temperatures greater
GO:0005769 early endosome 1 0.933790 0.383943 than their thermoneutral temperature, compensatory mechanisms
GO:0042613 MHC class II protein complex 1 0.977664 0.383943 are activated to protect vital organs and dissipate internal heat at the
GO:0005771 multivesicular body 1 0.993076 0.383943
body surface, while reducing blood flow to the GI tract (Kregel et al.,
GO:0005768 endosome 1 0.998888 0.383943
GO:0005794 Golgi apparatus 1 0.999398 0.383943
1988; Rowell, 1974). However, shunting of blood flow from the GI
GO:0005615 extracellular space 6 0.999960 0.383943 tract to the periphery can result in intestinal cellular hypoxia (Hall
GO:0009897 external side of plasma membrane 1 0.999975 0.383943 et al., 2001), ATP depletion, acidosis and cellular dysfunction,
GO:0005840 ribosome 1 0.999979 0.383943 resulting in necrosis and shedding of intestinal epithelial cells (Gisolfi,
GO:0005829 cytosol 4 0.999998 0.383943
2000). In our morphological study, we found that heat treatment
GO:0005622 intracellular 2 1.000000 0.383943
GO:0005576 extracellular region 2 1.000000 0.383943 caused marked damage to the tips of the intestinal villi, inducing
GO:0016020 membrane 13 1.000000 0.383943 epithelial cell shedding, exposing the intestinal mucosa lamina
GO:0005739 mitochondrion 3 1.000000 0.383943 propria, as well as shortening villus height and crypt depth in the
GO:0016021 integral to membrane 6 1.000000 0.383943
small intestine. Intestinal damage was found to be most severe in the
jejunum after 3 days of heat treatment (Fig. 4). Ultrastructure
examination revealed that the jejunum microvillus height was
(translation initiation factor activity), GO 0030338 (CMP-N-acetyl- shorter, mitochondria were swollen, the number of lysosomes was
neuraminate monooxygenase), GO 0005506 (iron ion binding), GO increased and the enterocyte tight junction structure was altered after
0016712 (oxidoreductase activity), and GO 0048503 (GPI anchor 3 days of heat treatment (Fig. 5). Mitochondrial swelling is a hallmark
binding). of mitochondrial damage, potentially caused by an increase in reactive
Biological processes analysis (Table 5) showed GO 0006986 oxygen species stimulated in response to heat stress (Heise et al.,
(response to unfolded protein), GO 0030334 (regulation of cell 2003; Hua et al., 2007). The increased number of lysosomes may
migration), GO 0006457 (protein folding), GO 0006413 (translational indicate an increase in the amount of denatured protein and damaged
initiation), and GO 0006118 (electron transport). organelles (Sonna et al., 2002).
Cellular component analysis (Table 6) showed GO 0043292
(contractile fiber), GO 0005626 (insoluble fraction), GO 0005625 4.3. Heat stress significantly alters the gene expression profile of the pig
(soluble fraction), GO 0005634 (nucleus), GO 0005886 (plasma jejunum
membrane), and GO 0030018 (Z disc).
To define the biological pathways associated with heat stress in the Heat stress triggers a complex cellular response including altering
pig jejunum, analysis of microarray data was conducted by a Molecule gene expression (Sonna et al., 2002; Kültz, 2005). To gain insight into
Annotation System (http://bioinfo.capitalbio.com/mas/). A KEGG the molecular mechanisms by which heat stress exerts its complex
pathway analysis revealed linoleic acid metabolism, MAPK signaling, biological effects, we performed microarray analysis to assess changes
metabolism of xenobiotics by cytochrome P450, arachidonic acid in gene expression levels in response to heat stress. The results of
metabolism, as well as changes in gap junction and focal adhesion microarray found 93 genes to be up-regulated and 110 genes down-
molecules were all involved in response to heat stress (Table 7, regulated in the pig jejunum after 3 days of heat stress (Table 3). To
P < 0.01). further characterize the types of genes altered, we classified the 203
genes into gene ontology (GO) slim terms (Tables 4, 5 and 6). Gene
3.4. Real-time PCR ontology analysis revealed that heat stress alters genes regulating
unfolded proteins, the initiation of translation, cell proliferation and
HSP70, HSP90 and HSP27 mRNA expression was significantly up- cell migration in the pig jejunum. Under conditions of heat stress,
regulated, while EGF and EGFR mRNA expression was significantly denaturation and misaggregation of protein is rapidly increased,
down-regulated in the pig jejunum after heat exposure. Heat-induced which triggers an unfolded protein response. This response charac-
changes in gene expression closely correlated with the corresponding teristically includes an increase in HSP expression (Sonna et al., 2002;
microarray data, although the exact fold change differed between the Keller et al., 2008; Young et al., 2009). The current study determined
two assays (Fig. 6). HSP70, HSP90 and HSP27 expression were all significantly up-
 Author's personal copy

J. Yu et al. / Comparative Biochemistry and Physiology, Part A 156 (2010) 119–128 127

Table 7
Pathway analysis result of the differentially expressed genes.

KEGG Total P-value Q value gene Input symbol Experiment 1

Linoleic acid metabolism 4 7.8E-5 1.17E-4 CYP3A39 Ssc.203.1.S1_at − 2.21

CYP2C49 Ssc.206.1.S1_at; − 2.23
Ssc.26321.1.S1_s_at
ALOX15 Ssc.10974.1.S1_at − 2.0
MAPK signaling pathway 4 2.98E-4 1.63E-4 EGFR Ssc.55.1.S1_at − 3.01
Hsp27 Ssc.11197.1.S1_at 5.22
HSP70.2 Ssc.5145.1.S1_a_at 3.26
EGF Ssc.87.1.S1_at − 3.37
Metabolism of xenobiotics by cytochrome P450 4 6.02E-4 2.01E-4 CYP2B22 Ssc.11267.1.S1_at − 2.33
CYP3A39 Ssc.203.1.S1_at − 2.21
CYP2C49 Ssc.206.1.S1_at; − 2.23
Ssc.26321.1.S1_s_at
Arachidonic acid metabolism 4 0.002249 5.39E-4 CYP2B22 Ssc.11267.1.S1_at − 2.33
CYP2C49 Ssc.206.1.S1_at; − 2.23
Ssc.26321.1.S1_s_at
ALOX15 Ssc.10974.1.S1_at − 2.0
Gap junction 2 0.002606 5.39E-4 EGFR Ssc.55.1.S1_at − 3.01
EGF Ssc.87.1.S1_at − 3.37
Focal adhesion 3 0.004329 7.64E-4 EGFR Ssc.55.1.S1_at − 3.01
VEGFA Ssc.10015.1.A1_at − 2.27
EGF Ssc.87.1.S1_at − 3.37
Antigen processing and presentation 3 0.014765 0.002272 HSP90 Ssc.12191.3.A1_at; 5.04
Ssc.12191.2.A1_at
HSP70.2 Ssc.5145.1.S1_a_at 3.26
Regulation of actin cytoskeleton 2 0.026589 0.00371 EGFR Ssc.55.1.S1_at − 3.01
EGF Ssc.87.1.S1_at − 3.37
Gamma-hexachlorocyclohexane degradation 1 0.040242 0.005249 CYP3A39 Ssc.203.1.S1_at − 2.21
Alzheimer's disease 1 0.053302 0.006663 LPL Ssc.16335.1.S2_at 2.26
Glycerolipid metabolism 1 0.066189 0.007637 LPL Ssc.16335.1.S2_at 2.26
mTOR signaling pathway 1 0.066189 0.007637 VEGFA Ssc.10015.1.A1_at − 2.27
Cell communication 1 0.066189 0.007637 LOC396725 Ssc.24.1.S1_at 2.01
VEGF signaling pathway 1 0.091454 0.009799 Hsp27 Ssc.11197.1.S1_at 5.22
Adherens junction 1 0.103836 0.010742 EGFR Ssc.55.1.S1_at − 3.01
Cytokine–cytokine receptor interaction 2 0.180692 0.017773 EGFR Ssc.55.1.S1_at − 3.01
EGF Ssc.87.1.S1_at − 3.37
Calcium signaling pathway 1 0.338208 0.031707 EGFR Ssc.55.1.S1_at − 3.01
Neuroactive ligand-receptor interaction 1 0.587815 0.053438 MLN Ssc.714.1.S1_at − 2.45

regulated after heat stress, consistent with previous reports. Altering isms: 1) alter the level of transcription factors; 2) adjust the activity of
gene expression is an integral part of the cellular response to heat transcription factors; and 3) change the cellular location of transcrip-
stress as this regulates protein translation, and hence cellular tion factors (Sonna et al., 2002; Hahn et al., 2004). In the current
function. Heat stress can affect gene transcription via three mechan- study, genes relating to the regulation of translation were found to be
significantly altered following heat treatment, in agreement with
previous reports. We recently reported that heat stress-induced
damage to the pig small intestine epithelial tissue was rapidly
repaired within the following few days following heat stress (Liu
et al., 2009). The regeneration of the damaged intestine epithelium
encourages crypt cell proliferation and migration (Kaushik and Kaur,
2005). Consistent with rapid cellular regeneration, the current study
found that the expression of genes related to the regulation of cell
proliferation and migration was significantly altered after heat stress.
Furthermore, the changes in gene expression following heat stress
provided significant insight into the potential biological pathways
activated or inhibited in response to heat stress (Table 7) in the pig
small intestine. Pathway analysis of genes altered following heat
treatment revealed linoleic acid metabolism, MAPK signaling, metab-
olism of xenobiotics by cytochrome P450 and arachidonic acid
metabolism to be involved in the response to heat stress.
Linoleic and arachidonic acid are essential for tissue growth and
development, and play a critical role in intestinal epithelial cell
differentiation and tumor development (Hui et al., 1999; Kawajiri
et al., 2002). Metabolism of arachidonic and linoleic acid via
prostaglandin H synthases and lipoxygenases generate an array of
lipid compounds which serve as potent mediators of several
physiological and pathophysiological processes (Zeldin, 2001). Our
results found heat stress to stimulate genes regulating arachidonic
Fig. 6. mRNA expression of HSP90, HSP70, HSP27, EGF and EGFR in the pig jejunum acid metabolism, potentially in response to oxidative stress in order to
using real-time PCR. alleviate the stress response.
 Author's personal copy

128 J. Yu et al. / Comparative Biochemistry and Physiology, Part A 156 (2010) 119–128

Mitogen-activated protein kinase (MAPK) signaling pathways are Hardy, J.D., Soderstrom, G.F., 1938. Heat loss from the nude body and peripheral blood
flow at temperatures of 22 °C to 35 °C: two figures. J. Nutr. 16, 493–510.
important downstream targets of activated growth factor receptors Heise, K., Puntarulo, S., Pörtner, H.O., Abele, D., 2003. Production of reactive oxygen
(such as EGFR and PDGFR) involved in mediating the intracellular species by isolated mitochondria of the Antarctic bivalve Laternula elliptica (King
response to extracellular stimuli. In mammals, three primary MAPKs and Broderip) under heat stress. Comp. Biochem. Physiol. C Toxicol. Pharmacol.
134, 79–90.
exist including extracellular signal-regulated protein kinase (ERK), c-Jun Hirata, Y., Broquet, A.H., Menchen, L., Kagnoff, M.F., 2007. Activation of innate immune
NH2-terminal kinase (JNK), and p38 MAPK (Anderson, 2006). MAPKs defense mechanisms by signaling through RIG-I/IPS-1 in intestinal epithelial cells.
are activated in response to extracellular stresses including UV radiation, J. Immunol. 179, 5425–5432.
Hua, G., Zhang, Q., Fan, Z., 2007. Heat shock protein 75 (TRAP1) antagonizes reactive
osmotic shock, heat shock and lipopolysaccharides, in addition to oxygen species generation and protects cells from granzyme M-mediated
activation by endogenous factors including growth cytokines, autacoids apoptosis. J. Biol. Chem. 282, 20553–20560.
and neurotransmitters (Muthusamy and Piva, 2010). MAPK signaling Hui, R., Kameda, H., Risinger, J.I., Angerman-Stewart, J., Han, B., Barrett, J.C., Eling, T.E.,
Glasgow, W.C., 1999. The linoleic acid metabolite, 13-HpODE augments the
regulates a wide range of intracellular activity, including gene
phosphorylation of EGF receptor and SHP-2 leading to their increased association.
expression, cell differentiation, cell proliferation, cell survival and Prostaglandins Leukot. Essent. Fatty Acids 61, 137–143.
apoptosis (Sompallae et al., 2008). We previously reported that heat Kaushik, S., Kaur, J., 2005. Effect of chronic cold stress on intestinal epithelial cell
stress significantly injured the pig small intestine epithelial tissue, and proliferation and inflammation in rats. Stress 8, 191–197.
Kawajiri, H., Hsi, L.C., Kamitani, H., Ikawa, H., Geller, M., Ward, T., Eling, T.E., Glasgow, W.C.,
this tissue was rapidly repaired within a few days. Based on our gene 2002. Arachidonic and linoleic acid metabolism in mouse intestinal tissue: evidence
expression analysis, we suggest that heat stress-induced alterations in for novel lipoxygenase activity. Arch. Biochem. Biophys. 398, 51–60.
MAPK signaling may regulate the repair and regeneration of the Keller, J.M., Escara-Wilke, J.F., Keller, E.T., 2008. Heat stress-induced heat shock protein
70 expression is dependent on ERK activation in zebrafish (Danio rerio) cells. Comp.
damaged intestinal epithelium by encouraging crypt cell proliferation Biochem. Physiol. A Mol. Integr. Physiol. 150, 307–314.
and migration. Kregel, K.C., Wall, P.T., Gisolfi, C.V., 1988. Peripheral vascular responses to hyperthermia
In conclusion, the present study investigated the effect of heat in the rat. J. Appl. Physiol. 64, 2582–2588.
Kültz, D., 2005. Molecular and evolutionary basis of the cellular stress response. Annu.
stress on morphology and gene expression in the porcine small Rev. Physiol. 67, 225–257.
intestine. Heat stress was found to cause significant morphological Leon, L.R., DuBose, D.A., Mason, C.W., 2005. Heat stress induces a biphasic
damage to the epithelium of the pig small intestine. Gene expression thermoregulatory response in mice. Am. J. Physiol. 288, R197–R204.
Liu, F., Yin, J., Du, M., Yan, P., Xu, J., Zhu, X., Yu, J., 2009. Heat-stress-induced damage to
profiling analysis revealed 203 genes to be differentially expressed in porcine small intestinal epithelium associated with downregulation of epithelial
response to heat stress. Subsequent bioinformatic analysis of the growth factor signaling. J. Anim. Sci. 87, 1941–1949.
differentially expressed genes provides significant insight into the Mahmoud, K.Z., Edens, F.W., Eisen, E.J., Havenstein, G.B., 2004. Ascorbic acid decreases
heat shock protein 70 and plasma corticosterone response in broilers (Gallus gallus
potential mechanisms underlying heat stress-induced damage as well
domesticus) subjected to cyclic heat stress. Comp. Biochem. Physiol. B Biochem.
as repair/regeneration in porcine small intestines. Mol. Biol. 137, 35–42.
Marai, I.F.M., El-Darawany, A.A., Fadiel, A., Abdel-Hafez, M.A.M., 2007. Physiological
traits as affected by heat stress in sheep. A review. Small Rumin. Res. 71, 1–12.
Acknowledgments Muthusamy, V., Piva, T.J., 2010. The UV response of the skin: a review of the MAPK,
NFkappaB and TNFalpha signal transduction pathways. Arch. Dermatol. Res. 302
We are thankful for the help from the members of CAU-BUA TCVM (1), 5–17.
Pace, T.W., Gaylord, R.I., Jarvis, E., Girotti, M., Spencer, R.L., 2008. Differential
teaching and research team. This work was supported by grants from glucocorticoid effects on stress-induced gene expression in the paraventricular
the National Natural Science Foundation of China (No. 30771566), nucleus of the hypothalamus and ACTH secretion in the rat. Stress 12, 400–411.
the Beijing Education Committee Programs of Academic Innovation Rowell, L.B., 1974. Human cardiovascular adjustments to exercise and thermal stress.
Physiol. Rev. 54, 75–159.
Team, Beijing Natural Science Foundation (No. 6082007) and the Sinha, R.K., 2008. Serotonin synthesis inhibition by pre-treatment of p-CPA alters sleep-
National Eleventh Five-Year Scientific and Technological Support Plan electrophysiology in an animal model of acute and chronic heat stress. J. Therm.
(No. 2008BADB4B01, 2008BADB4B07). Biol. 33, 261–273.
Sompallae, R., Stavropoulou, V., Houde, M., Masucci, M.G., 2008. The MAPK Signaling
Cascade is a central hub in the regulation of cell cycle, apoptosis and cytoskeleton
References remodeling by tripeptidyl-peptidase II. Gene Regul. Syst. Biol. 2, 253–265.
Sonna, L.A., Fujita, J., Gaffin, S.L., Lilly, C.M., 2002. Invited review: effects of heat and cold
Anderson, D.H., 2006. Role of lipids in the MAPK signaling pathway. Prog. Lipid Res. 45, stress on mammalian gene expression. J. Appl. Physiol. 92, 1725–1742.
102–119. Srikandakumar, A., Johnson, E.H., Mahgoub, O., 2003. Effect of heat stress on respiratory
Cario, E., Gerken, G., Podolsky, D.K., 2002. "For whom the bell tolls!" — innate defense rate, rectal temperature and blood chemistry in Omani and Australian Merino
mechanisms and survival strategies of the intestinal epithelium against lumenal sheep. Small Rumin. Res. 49, 193–198.
pathogens. Z. Gastroenterol. 40, 983–990. St-Pierre, N.R., Cobanov, B., Schnitkey, G., 2003. Economic losses from heat stress by US
Elez, D., Vidovic, S., Matic, G., 2000. The influence of hyperthermic stress on the redox livestock industries. J. Dairy Sci. 86, E52–E77.
state of glucocorticoid receptor. Stress 3, 247–255. Trevino, V., Falciani, F., Barrera-Saldana, H.A., 2007. DNA microarrays: a powerful
Gisolfi, C.V., 2000. Is the GI system built for exercise? News Physiol. Sci. 15, 114–119. genomic tool for biomedical and clinical research. Mol. Med. 13, 527–541.
Hahn, J.S., Hu, Z., Thiele, D.J., Iyer, V.R., 2004. Genome-wide analysis of the biology of Young, J.T., Gauley, J., Heikkila, J.J., 2009. Simultaneous exposure of Xenopus A6 kidney
stress responses through heat shock transcription factor. Mol. Cell. Biol. 24, epithelial cells to concurrent mild sodium arsenite and heat stress results in enhanced
5249–5256. hsp30 and hsp70 gene expression and the acquisition of thermotolerance. Comp.
Hall, D.M., Buettner, G.R., Oberley, L.W., Xu, L., Matthes, R.D., Gisolfi, C.V., 2001. Biochem. Physiol. A Mol. Integr. Physiol. 153 (433), 417–424.
Mechanisms of circulatory and intestinal barrier dysfunction during whole body Zeldin, D.C., 2001. Epoxygenase pathways of arachidonic acid metabolism. J. Biol. Chem.
hyperthermia. Am. J. Physiol. 280, H509–H521. 276, 36059–36062.

View publication stats