Accepted: 5 April 2016

DOI: 10.1111/and.12627

ORIGINAL ARTICLE

Sperm mitochondrial DNA deletion in Iranian infertiles with

asthenozoospermia

I. Bahrehmand Namaghi | H. Vaziri

Department of Biology, Faculty of

Sciences, University of Guilan, Rasht, Iran Summary
Asthenozoospermia is an important cause of male infertility. The mutations in sperm
Correspondence
mitochondrial DNA (mtDNA) result in either functionless or malfunctioning some pro-
Dr. Hamidreza Vaziri, Department of Biology,
Faculty of Sciences, University of Guilan, teins, subsequently affecting sperm motility leading to asthenozoospermia. The pur-
Rasht, Iran.
pose of this study was to investigate sperm mtDNA 4,977-­bp deletion in infertile men
Email: vaziri@guilan.ac.ir
with low sperm motility/immotile spermatozoa compared to healthy subjects with
high sperm motility. Semen samples of 256 asthenozoospermic infertiles and 200 con-
trols from northern Iran were collected. After extraction of spermatozoa total DNA,
Gap-­polymerase chain reaction (Gap-­PCR) was performed. The deletion was observed
in 85.93% of patients with asthenozoospermia compared with 14% in controls
[OR = 37.5397, 95% confidence interval = 12.937–108.9276, p < .0001]. It is con-
cluded that there is a strong association between sperm mtDNA 4,977-­bp deletion
and asthenozoospermia-­induced infertility in the population examined. Large-­scale
mtDNA deletions in spermatozoa may induce bioenergetic disorders. Nevertheless, to
validate our results broader research may be needed.

KEYWORDS
asthenozoospermia, gap.PCR, motility, mtDNA, sperm

1 |  INTRODUCTION from mitochondrial respiration (through oxidative phosphorylation)

and glycolysis in various regions of the flagellum. Some studies have
Spermatozoa travel long distances to meet and fertilise the oocyte; indicated a positive correlation between sperm motility and respirato-
sperm motility is, therefore, the prerequisite for normal fertilisation ry chain enzymatic activities, suggesting that functional mitochondrial
(Curi et al., 2003); that is, sperm motility is one of the most important changes might be the cause of asthenozoospermia (Paoli et al., 2011).
determinants of male fertility (Wei & Kao, 2000). Asthenozoospermia, Mitochondria are dynamic, semi-­autonomous organelles that play
one of the common causes of male infertility, is primarily character- a diverse role in cellular physiopathology, bioenergetics, reactive oxy-
ised by reduced sperm motility owing to a variety of factors, including gen species (ROS) genesis/signalling and redox balance, β-­oxidation
ultrastructural abnormalities, functional deficiencies, abnormal semen of free fatty acids, Ca2+ homoeostasis, thermogenesis and essential
liquefaction, antisperm antibodies, deleterious effects of seminal plas- anabolic pathways (cholesterol, fatty acids, urea, haem and bile acids;
ma, varicocele, endocrine abnormality, as well as physical and chemical (Apostolova & Esplugues, 2011). Human mtDNA is a 16,569-­bp
factors (Shen, Wang, Liang, & He, 2013). Sperm motility is therefore double-­stranded circular DNA molecule that encodes two rRNAs, 22
the result of complex molecular events, comprising oxidation of ener- tRNAs, and 13 polypeptides that are essential for mitochondrial respi-
gy substrates, phosphorylation of the proteins involved in signal trans- ration and oxidative phosphorylation. MtDNA is compact (intron-­less)
duction through the plasma membrane and the conversion of chemical and lacks the protection of histones or DNA binding proteins (Shoffner
energy into mechanical energy in the axoneme. ATP acts as a flagellar & Wallace, 1994). It replicates rapidly without efficient proofreading
sperm movement energizer. The generation of ATP can be performed and DNA repair mechanisms (Yakes & Van Houten, 1997). This lack of

Andrologia 2016; 1–6 wileyonlinelibrary.com/and © 2016 Blackwell Verlag GmbH  |  1

  | 
2 Bahrehmand Namaghi and Vaziri

an efficient repair system in mitochondria accelerates the rate of mtD- chemical damage to DNA, such as oxidation or exposure to UV radi-
NA mutation, thought to be 10–100 times more than in nuclear DNA. ation (Wallace, 1992). A number of studies have demonstrated that
Up to now, several single nucleotide polymorphisms (SNPs) in mtDNA mutations (deletions and rearrangements) occur frequently
the mitochondrial genes were found to be associated with diabetes, in spermatozoa with poor motility (Cortopassi & Arnheim, 1990; Kao,
encephalopathy, lactic acidosis, strokelike syndrome, neurological Chao, & Wei, 1998). This may possibly be related to changes in the
disorders and male infertility (Baklouti-­Gargouri et al., 2013). MtDNA microenvironment (e.g. free radical levels, oxygen pressure and tox-
large-­scale deletions result in complete removal or truncation of some ic metabolites of xenobiotics or cigarette smoke) of the germ cells
structural genes and tRNA genes. They result in either functionless during or after spermatogenesis (Wei & Kao, 2000). Hence, our aim
or malfunctioning proteins. The defective protein subunits encoded in this study was to evaluate the role of the 4,977-­bp deletion of
by such mutated mtDNA are assembled with nuclear DNA-­encoded mtDNA of spermatozoa in inducing low sperm mobility/immobility
subunits to yield impaired respiratory enzymes. Spermatozoa contain- in infertile men, compared to healthy subjects (men with high sperm
ing defective mitochondria not only produce ATP less efficiently but motility) and its association with infertility of men in a population in
also generate more ROS and free radicals, which may further damage northern Iran.
mitochondria and mtDNA, ultimately leading to an energy crisis and
decline of motility and fertility (John, Sakkas, & Barratt, 2000; Kao,
Chao, & Wei, 1995; Sharma & Agarwal, 1996; Spiropoulos, Turnbull, 2 | MATERIALS AND METHODS
& Chinnery, 2002). Among mtDNA deletions, a 4,977-­bp deletion has
attracted tremendous interest, because it is the common cause of sev-
2.1 | Subjects
eral sporadic diseases, including Pearson’s syndrome, Kearns-­Sayre
syndrome (KSS) and chronic progressive external ophthalmoplegia A total of 256 patients with clinical asthenozoospermia and 200
(CPEO) (Taylor & Turnbull, 2005 and Wallace et al., 1995). It also accu- healthy fertile men were selected in this study. Semen samples were
mulates in many tissues (such as various post-­mitotic tissues) during divided upon their motility into three groups in healthy subjects and
ageing and has been used as an mtDNA damage biomarker (Meissner six groups in patients (Tables 1 and 2 respectively). In all patients and
et al., 2008). healthy volunteers, an accurate medical history including smoking
The common deletion is a class I deletion, and the major deletion habits, alcohol consumption, men’s occupation and the use of pre-
is flanked by 13-­bp direct repeats at positions 13447–13459 and scription medications was gathered and semen samples were collect-
8470–8482 that it removes genes coding for ATP, COIII, ND3, ND4, ed by masturbation after 3 days of sexual abstinence. This protocol
ND4L and some parts of ND5. The genesis of ROS by spermatozoa was confirmed by the local ethics committee, and written informed
is a normal physiological event; however, an imbalance between ROS consent was given by all individuals.
genesis and scavenging activity is harmful to the spermatozoa and
associated with male infertility (Sharma & Agarwal, 1996). Abnormal
2.2 | Sperm retrieval from semen and
spermatozoa are one of the original sources of endogenous ROS in
DNA extraction
the semen (Aitken, Baker, & Sawyer, 2003), and an excessive mito-
chondrial generation of ROS from defective spermatozoa is known Semen samples were allowed to liquefy at 37°C or room tempera-
to be associated with sperm disorders, particularly sperm motility ture. After allowing at least 25 min for liquefaction to occur, sper-
(Koppers, De Iuliis, Finnie, McLaughlin, & Aitken, 2008). Another matozoa were separated from seminal plasma by centrifugation at
major source of ROS is contaminating leucocytes, mainly neutrophils 664 g for 10–15 min. The pellet was kept and the upper transparent
and macrophages (Fraczek & Kurpisz, 2007); indeed, stimulated neu- phase discarded. Total genomic DNA was extracted from the sper-
trophils are creators of toxic ROS intermediates, exclusively O2− and matozoa using a GPP Solution Kit (Gen Pajoohan Pouya, Tehran, Iran)
H2O2. Environmental factors (high temperatures, electromagnetic according to the manufacturer’s instructions. DNA with an optimal
radiation, pesticides and pollution) and lifestyle factors (alcohol con- density ratio 260/280 of 1.8 or more was used. The extracted DNA
sumption, advanced age, stress, tobacco smoking, obesity and poor was stored at −4°C.
diet) are both exogenous factors that may help to augment concen-
trations of ROS (Wong & Cheng, 2011). ROS can directly damage
T A B L E   1   Percentage of sperm motility and frequency for
spermatozoa by inducing peroxidation of the lipid-­containing sperm
4,977-­bp deleted mtDNA in control groups
plasma membrane, which decreases its integrity, and may also affect
sperm motility by damaging the axonemal structure (Agarwal & Said, Groups N1 N2 N3 Total
2005). Hence, high levels of ROS are significant in sperm motility dis- Percentage 50%–55% 55%–60% 60%–75%
order and the occurrence of asthenozoospermia. Unbalanced apop- of motility
tosis may be another contributing factor. Apoptotic mediators, such No. of 100 56 44 200
as the caspases, have been detected at increased levels in sperma- controls

tozoa characterised by low motility (Weng et al., 2002). Mutations Frequency of (20) 10% (8) 4% (0) 0% (28) 14%
deletion
can result from spontaneous errors of replication or from unrepaired
Bahrehmand Namaghi and Vaziri   |  3

T A B L E   2   Percentage of sperm motility and frequency for 4,977-­bp deleted mtDNA in patient groups

Groups P1 P2 P3 P4 P5 P6 Total

Percentage of motility 0% 0%–5% 5%–10% 10%–15% 15%–20% 20%–35%

No. of patients 40 56 48 40 36 36 256
Frequency of deletion (28) 70% (42) 92.85% (44) 91.66% (36) 90% (32) 88.88% (28) 77.77% (220) 85.93%

T A B L E   3   Oligonucleotide primers used for PCR amplification and PCR products for 4,977-­bp deleted mtDNA and wild-­type mtDNA

The length of
amplified product
Nucleotide location Sequences (5′ → 3′) Primer pair (bp)

Primer T1 (1257–1279) TATACCGCCATCTTCAGCAAAC T1T2 (wild type) 177 bp

Primer T2 (1411–1433) TACTGCTAAATCCACCTTCGAC
PCR product TATACCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAAAGACGTTAGGTCAAGGTGTAGCCC
ATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGTGGATTTAG
CAGTA
Primer D1 (8416–8437) CCTTACACTATTCCTCATCACC D1D2 (Deleted) 127 bp
Primer D2 (13498–13519) TGTGGTCTTTGGAGTAGAAACC
PCR product CCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTACCACCTACCTCCCTCACCA(4977-bp deletion)TTGGCAGCC
TAGCATTAGCAGGAATACCTTTCCTCACAGGTTTCTACTCCAAAGACCACA

The corresponding nucleotide bases of primers on the PCR products are shown in bold font.

2.3 | Polymerase chain reaction 31.15 years for the healthy subjects (range: 22–38). There was no sig-
nificant difference between these groups in age, and healthy subjects
To detect the presence of mtDNA in total genomic DNA extract and the
had normal semen characteristics with high sperm motility and no his-
4,977-­bp deletion, two primer pairs were utilised (CinnaGen, Tehran,
tory of infertility. Semen analyses were carried out for all patients and
Iran). The primer sequences and specifications are listed in Table 3.
control subjects. The percentage of sperm motility for semen sam-
The mtDNA was recognised by amplification of a 177-­bp sequence
ples in every control and patient groups were listed in Tables 1 and
from the extremely conserved its 12S region, and deleted molecules
2 respectively.
were identified by primers flanking the deleted region which produced
The results of molecular analysis revealed two major bands (with
a 127-­bp product if the deletion was present. PCR amplifications were
lengths of 127-­and 177-­bp) on 2% agarose gel (Fig. 1). At first, mtDNA
carried out in 20 μl reaction volumes containing 5 μl extracted DNA
from all samples using the primer pair which allows amplification of
(30 ng genomic DNA), 10 μl PCR buffer 1×, 1 μl (10 pmol) of each pair
12S region of mtDNA was amplified successfully. Bands with lengths
of primer (T1T2 or D1D2) and 3 μl distilled water. The first cycle con-
of 177 bp indicated the presence of mtDNA in DNA extract, and 127-­
sisted of a hot start at 94°C for 5 min, followed by 35 cycles consisting
bp was generated from the 4,977-­bp mtDNA deletion. In this study,
of a denaturation step at 94°C for 45 s, annealing at 60°C for 1 min
220 (86%) patients with asthenozoospermia had the 4,977-­bp dele-
and primer extension at 72°C for 45 s, with a final extension for 5 min
tion in spermatozoal mtDNA, while 28 (14%) of the controls present-
at 72°C. Following amplification, 4 μl of PCR product was mixed with
ed this deletion. Distribution of mtDNA 4,977-­bp deletion in patients
1 μl of 6× loading buffer. The resulting mixture was examined on a 2%
and controls is shown in Fig. 2. A strong association (OR = 37.5397,
agarose gel at 75 V for 50 min in 1× Tris-­borate-­EDTA buffer (TBE)
95% CI = 12.937–108.9276, p < .0001) between mtDNA 4,977-­bp
and visualised on gel documentation system.
deletion and asthenozoospermia-­induced infertility was suggested.
Distribution of the deletion in each patient and control group is shown
2.4 | Statistical analysis in Figs 3 and 4 respectively.

Statistical analysis was performed using the chi-­square test and the
Medcalc statistical software (Version 12.1.4.0; Mariakerke, Belgium).
4 | DISCUSSION
Odds ratios were calculated together with their 95% confidence inter-
vals (CI). A p-­value of <.05 was considered to be statistically significant.
Male infertility may mainly be caused as a consequence of a decline
in sperm counts and a rise in spermatozoa and testicular anomalies.
3 | RESULTS Defective sperm function, including abnormalities of flagellar move-
ment, recognition failure of the zona pellucida by the spermatozoa
Mean ages were 33.24 years (range: 23–42) for infertile patients with and an inability to complete spermatozoon–oocyte fusion, has been
asthenozoospermia (low sperm motility or immotile spermatozoa) and shown to be the most important causes of infertility. Analysis of
  | 
4 Bahrehmand Namaghi and Vaziri

1 2 3 4
M

500 bp

177 bp 200 bp
127 bp F I G U R E   1   Detection of mtDNA
100 bp
deletion. 177-­bp bands indicated the
presence of mtDNA in DNA extract, 127-­
bp bands generated from the 4,977-­bp
deleted mtDNA. Lanes: M, Gene on 100-
bp DNA Marker, lane 1: patient without
the deletion, lanes 2, 3 and 4: patients
with the deletion

100% acid substitution (missense) mutations had been associated with

89.07%
90% 85.93%
ophthalmological and neurological diseases. Two classes of phe-
80% notypes were known: Leber’s hereditary optic neuropathy (LHON)
70% and neurogenic muscle weakness, ataxia and retinitis pigmentosa
60% (NARP) (Wallace, 1992). The 4,977-­bp deletion (common deletion,
50% CD) reported in cancers of breast, endometrium, oesophagus, stom-

40% ach, head and neck, mouth, prostate, colorectum, skin and thyroid
(Yu, 2012).
30%
A study by Kao et al. in 1995 had confirmed that the occurence of
20% 14.06%
10.93% CD in patients with asthenozoospermia and oligospermia was high-
10%
er than normal individuals. In addition, frequency of CD in patients
0%
Patients Controls with primary infertility was more than secondary infertility (Kao et al.,
1998). Spermatozoa of patients with asthenozoospermia and oli-
Wild type Deleted gospermia had a high rate of ROS, lipid peroxidation and contained
a high percentage of immature spermatozoa. Some studies showed
F I G U R E   2   Distribution of 4,977-­bp deletion of spermatozoa of
that the mtDNA mutation is actually present in germ cells and this is
mtDNA in patients and controls. The frequency of mtDNA 4,977-­bp
deletion in patients was more than in healthy subjects presumably linked to the change in their environment (e.g. hormone,
oxygen pressure and ROS genesis) which takes place as part of the
ageing process. This is consistent with their finding that no mtDNA
semen is becoming a more important and informative route among containing the 4,977-­bp deletion was detected in spermatozoa from
diagnostic techniques. Sperm motility has been established as a healthy fertile males (Kao et al., 1995).
good indicator of semen quality, and in most patients with poor Bad habits such as smoking result in depletion of antioxidants lev-
sperm motility, a reduced sperm count or a greater number of els, increased oxidative stress and a remarkable increase in levels of
abnormally shaped spermatozoa in their semen is seen. Defective 8-­hydroxy-­2′-­deoxy guanosine in sperm DNA. This leads to loss of
sperm function has been shown in about 27% of all couples attend- ATP and creation of an energy crisis in spermatozoa through a vicious
ing infertility clinics. The mechanisms by which these large-­scale cycle. This cycle concomitant with an accelerated electron leakage
mtDNA deletions occur in mitochondria remain unclear. In the past from damaged mitochondria had catastrophic consequences. Several
decade, several mechanisms have been proposed, such as illegiti- mechanisms have been proposed for large-­scale deletions, including
mate recombination, slipped-­mispairing, oxidative stress elicited by slipped-­mispairing (Mita, Schmidt, Schon, DiMauro, & Bonilla, 1989),
free radicals and DNA strand break affected by a topoisomerase or illegitimate recombination (Mita et al., 1990 and Shoffner et al.,
DNA recombinase. Wallace has classified mtDNA disease mutations 1989), oxidative reactions elicited by free radicals and DNA strand
into four groups: missense mutations, protein synthesis mutations, break affected by a topoisomerase or DNA recombinase (Mita et al.,
insertion–deletion mutations and copy number mutations. Amino 1989).
Bahrehmand Namaghi and Vaziri   |  5

100%
90%
80%
70%
60%
50%
40%
30%
20%
10%
0%
F I G U R E   3   Percentage of 4,977-­bp 0% 0–5 % 5–10 % 10–15 % 15–20 % 20–35 %
deleted mtDNA compared with wild-­type
mtDNA in patients groups Frequency of deleted mtDNA Frequency of wild-type mtDNA

120% a clear correlation between the common mtDNA deletion and male
100.00% infertility (Cummins, 1998; and St John, Jokhi, & Barratt, 2001). Several
100% 96.00%
90% studies have shown that 4,977-­bp mtDNA deletion associated with
defective sperm function and male infertility (Kumar & Sangeetha,
80%
2009 and Lestienne et al., 1997). We have shown that patients with
low sperm motility or immotile spermatozoa had a higher frequency of
60%
4,977-­bp deletion in sperm mtDNA than in controls with high sperm
40% motility. This deletion in sperm mtDNA is likely to cause infertility in
patients with asthenozoospermia.
20% 10% In conclusion, this study carried out in Rasht, Iran, concentrated on
4% infertile patients with clinical asthenozoospermia and a vigorous associ-
0%
0% ation between sperm mtDNA 4,977-­bp deletion and asthenospermia-­
50–55 % 55–60 % 60–75 %
induced infertility was established. Although some other studies deled
Frequency of deleted mtDNA Frequency of wild-type mtDNA
with the role of mitochondrial abnormalities in male infertility and more
F I G U R E   4   Percentage of 4,977-­bp deleted mtDNA compared specifically that of the mtDNA 4977 bp deletion in patients with asthe-
with wild-­type mtDNA in healthy groups nospermia, which has already been frequently discussed, remains con-
troversial, hence these indicate the potential interest of this study. Our
article is based on the study of a cohort of patients and healthy subjects
In 2013, Gashti et al. investigated sixty patients with clinical var- that is still too small to afford a significant clarification of the results
icocele and ninety healthy donors for the 4,977-­bp deletion in their found in the literatures. The role of genetic composition between the
semen samples. A total of 34 patients (55.66%) had asthenozoosper- studied mtDNA deletion can be considered effective. However, the
mia, 22 (33.66%) had oligo-­asthenozoospermia, and 4 (6.66%) had nor- results may be different by selecting different genetic pools or augment-
mal spermatozoa. CD of sperm mtDNA was observed in 49 (81.66%) ing in population size. Thus, the conclusion was not solid and further
of the patients with clinical varicocele and 14 (15.55%) of the healthy investigations are also needed in order to confirm our results. There
donors. Varicocele with increased ROS production may induce muta- are also some questions need to be answered in ongoing researches:
tions in spermatozoa mtDNA, resulting in male infertility. They con- The mtDNA deletion seems more common in the group of asthe-
cluded that a strong correlation between CD and varicocele-­induced nospermic patients compared to controls but is the deletion really
infertility was confirmed (Gashti, Salehi, Madani, & Dalivandan, 2014). responsible for the fall of ATP production in asthenospermia? Is this
Several other studies have tested the association between large-­ deletion not rather the reflection of a wider disorder of spermatogen-
scale deletions and malfunctioning of human spermatozoa, while esis? Indeed, the role of mtDNA may be insignificant at the end of
they have detected conflicting findings (Chen, Chang, Chen, & Wei, spermatogenesis.
2002; Chen et al., 2011; Gendron, Mallet, Bastien, & Rochette, 2012;
Iwai, Iwamura, Yamashita, Wadano, & Mesaki, 2006; Kamalidehghan,
AC KNOW L ED G EM ENTS
Houshmand, Ismail, Panahi, & Akbari, 2006; Pavicic & Richard, 2009;
Yu, 2012). Some of them observed a negative correlation between We would also like to thank all patients from Alzhara and Razi Hospitals
the level of the 4,977-­bp deletion and sperm motility (Ieremiadou and Jam’s clinic for their kind assistance in the collection of semen
& Rodakis, 2009). On the contrary, other researches have not found samples. This study was partly supported by University of Guilan.
  | 
6 Bahrehmand Namaghi and Vaziri

mitochondrial DNA rearrangements. Molecular Human Reproduction, 3,

REFERENCES
811–814.
Agarwal, A., & Said, T. M. (2005). Oxidative stress, DNA damage and Meissner, C., Bruse, P., Mohamed, S. A., Schulz, A., Warnk, H., Storm, T., &
apoptosis in male infertility: A clinical approach. BJU International, 95, Oehmichen, M. (2008). The 4977 bp deletion of mitochondrial DNA in
503–507. human skeletal muscle, heart and different areas of the brain: A useful
Aitken, R. J., Baker, M. A., & Sawyer, D. (2003). Oxidative stress in the male biomarker or more? Experimental Gerontology, 43, 645–652.
germ line and its role in the aetiology of male infertility and genetic Mita, S., Rizzuto, R., Moraes, C. T., Shanske, S., Arnaudo, E., Fabrizi, G. M., &
disease. Reproductive Biomedicine Online, 7, 65–70. Schon, E. A. (1990). Recombination via flanking direct repeats is a major
Apostolova, N., & Esplugues, J. V. (2011). Mitochondrial DNA replication in cause of large-­scale deletions of human mitochondrial DNA. Nucleic
health and disease. DOI: 10.5772/19162: INTECH Open Access Pub- Acids Research, 18, 561–567.
lisher. Mita, S., Schmidt, B., Schon, E. A., DiMauro, S., & Bonilla, E. (1989). De-
Baklouti-Gargouri, S., Ghorbel, M., Mahmoud, A. B., Mkaouar-Rebai, E., tection of” deleted” mitochondrial genomes in cytochrome-­c oxidase-­
Cherif, M., Chakroun, N., & Ammar-Keskes, L. (2013). Mitochondrial deficient muscle fibers of a patient with Kearns-­Sayre syndrome. PNAS,
DNA mutations and polymorphisms in asthenospermic infertile men. 86, 9509–9513.
Molecular Biology Reports, 40, 4705–4712. Paoli, D., Gallo, M., Rizzo, F., Baldi, E., Francavilla, S., Lenzi, A., & Gan-
Chen, S. S., Chang, L. S., Chen, H. W., & Wei, Y. H. (2002). Polymorphisms of dini, L. (2011). Mitochondrial membrane potential profile and its
glutathione S-­transferase M1 and male infertility in Taiwanese patients correlation with increasing sperm motility. Fertility and Sterility, 95,
with varicocele. Human Reproduction, 17, 718–725. 2315–2319.
Chen, T., He, J., Shen, L., Fang, H., Nie, H., Jin, T., & Chen, G. (2011). The mi- Pavicic, W. H., & Richard, S. M. (2009). Correlation analysis between
tochondrial DNA 4,977-­bp deletion and its implication in copy number mtDNA 4977-­bp deletion and ageing. Mutation Research, 670, 99–
alteration in colorectal cancer. BMC Medical Genetics, 12, 1. 102.
Cortopassi, G. A., & Arnheim, N. (1990). Detection of a specific mitochon- Sharma, R. K., & Agarwal, A. (1996). Role of reactive oxygen species in male
drial DNA deletion in tissues of older humans. Nucleic Acids Research, infertility. Urology, 48, 835–850.
18, 6927–6933. Shen, S., Wang, J., Liang, J., & He, D. (2013). Comparative proteomic study
Cummins, J. (1998). Mitochondrial DNA in mammalian reproduction. Re- between human normal motility sperm and idiopathic asthenozoosper-
views of Reproduction, 3, 172–182. mia. World Journal of Urology, 31, 1395–1401.
Curi, S. M., Ariagno, J. I., Chenlo, P. H., Mendeluk, G. R., Pugliese, M. N., Sar- Shoffner, J. M., Lott, M. T., Voljavec, A. S., Soueidan, S. A., Costigan, D. A.,
di Segovia, L. M., & Blanco, A. M. (2003). Asthenozoospermia: Analysis & Wallace, D. C. (1989). Spontaneous Kearns-­Sayre/chronic external
of a large population. Archives of Andrology, 49, 343–349. ophthalmoplegia plus syndrome associated with a mitochondrial DNA
Fraczek, M., & Kurpisz, M. (2007). Inflammatory mediators exert toxic ef- deletion: A slip-­replication model and metabolic therapy. PNAS, 86,
fects of oxidative stress on human spermatozoa. Journal of Andrology, 7952–7956.
28, 325–333. Shoffner, J. M., & Wallace, D. C. (1994). Oxidative phosphorylation diseases
Gashti, N. G., Salehi, Z., Madani, A. H., & Dalivandan, S. T. (2014). 4977-­bp and mitochondrial DNA mutations: Diagnosis and treatment. Annual
mitochondrial DNA deletion in infertile patients with varicocele. Andro- Review of Nutrition, 14, 535–568.
logia, 46, 258–262. Spiropoulos, J., Turnbull, D. M., & Chinnery, P. F. (2002). Can mitochondrial
Gendron, S. P., Mallet, J. D., Bastien, N., & Rochette, P. J. (2012). Mitochon- DNA mutations cause sperm dysfunction? Molecular Human Reproduc-
drial DNA common deletion in the human eye: A relation with corneal tion, 8, 719–721.
aging. Mechanisms of Ageing and Development, 133, 68–74. St John, J. C., Jokhi, R. P., & Barratt, C. L. (2001). Men with oligoasthe-
Ieremiadou, F., & Rodakis, G. C. (2009). Correlation of the 4977 bp mito- noteratozoospermia harbour higher numbers of multiple mitochon-
chondrial DNA deletion with human sperm dysfunction. BMC Research drial DNA deletions in their spermatozoa, but individual deletions are
Notes, 2, 1–8. not indicative of overall aetiology. Molecular Human Reproduction, 7,
Iwai, K., Iwamura, Y., Yamashita, S., Wadano, Y., & Mesaki, N. (2006). Effect 103–111.
of tea catechins on mitochondrial DNA 4977-­bp deletions in human Taylor, R. W., & Turnbull, D. M. (2005). Mitochondrial DNA mutations in
leucocytes. Mutation Research, 595, 191–195. human disease. Nature Reviews Genetics, 6, 389–402.
John, J. C., Sakkas, D., & Barratt, C. L. (2000). A role for mitochondrial DNA Wallace, D. C. (1992). Diseases of the mitochondrial DNA. Annual Review of
review and sperm survival. Journal of Andrology, 21, 189–199. Biochemistry, 61, 1175–1212.
Kamalidehghan, B., Houshmand, M., Ismail, P., Panahi, M. S. S., & Akbari, Wallace, D. C., Shoffner, J. M., Trounce, I., Brown, M. D., Ballinger, S. W., Cor-
M. H. H. (2006). ΔmtDNA 4977 is more common in non-­tumoral cells ral-Debrinski, M., & Lott, M. T. (1995). Mitochondrial DNA ­mutations in
from gastric cancer sample. Archives of Medical Research, 37, 730– human degenerative diseases and aging. Biochimica et Biophysica Acta,
735. 1271, 141–151.
Kao, S., Chao, H. T., & Wei, Y. H. (1995). Mitochondrial deoxyribonucleic Wei, Y. H., & Kao, S. H. (2000). Mitochondrial DNA mutation and depletion
acid 4977-­bp deletion is associated with diminished fertility and motil- are associated with decline of fertility and motility of human sperm.
ity of human sperm. Biology of Reproduction, 52, 729–736. Zoological Studies-­Taipei, 39, 1–12.
Kao, S. H., Chao, H. T., & Wei, Y. H. (1998). Multiple deletions of mitochon- Weng, S. L., Taylor, S. L., Morshedi, M., Schuffner, A., Duran, E. H., Beebe,
drial DNA are associated with the decline of motility and fertility of S., & Oehninger, S. (2002). Caspase activity and apoptotic markers in
human spermatozoa. Molecular Human Reproduction, 4, 657–666. ejaculated human sperm. Molecular Human Reproduction, 8, 984–991.
Koppers, A. J., De Iuliis, G. N., Finnie, J. M., McLaughlin, E. A., & Aitken, R. Wong, E. W., & Cheng, C. Y. (2011). Impacts of environmental toxicants on
J. (2008). Significance of mitochondrial reactive oxygen species in the male reproductive dysfunction. Trends in Pharmacological Sciences, 32,
generation of oxidative stress in spermatozoa. Journal of Clinical Endo- 290–299.
crinology and Metabolism, 93, 3199–3207. Yakes, F. M., & Van Houten, B. (1997). Mitochondrial DNA damage is more
Kumar, D. P., & Sangeetha, N. (2009). Mitochondrial DNA mutations and extensive and persists longer than nuclear DNA damage in human cells
male infertility. Indian Journal of Human Genetics, 15, 93–97. following oxidative stress. PNAS, 94, 514–519.
Lestienne, P., Reynier, P., Chretien, M.-F., Penisson-Besnier, I., Malthiery, Yu, M. (2012). Somatic mitochondrial DNA mutations in human cancers.
Y., & Rohmer, V. (1997). Oligoasthenospermia associated with multiple Advances in Clinical Chemistry, 57, 100.