Accepted Manuscript

Title: Bioactive Exopolysaccharides from a S. thermophilus

strain: screening, purification and characterization

Author: Wei Ren Yongjun Xia Guangqiang Wang Hui Zhang

Song Zhu Lianzhong Ai

PII: S0141-8130(16)30086-1
DOI: http://dx.doi.org/doi:10.1016/j.ijbiomac.2016.01.085
Reference: BIOMAC 5775

To appear in: International Journal of Biological Macromolecules

Received date: 7-11-2015

Revised date: 14-1-2016
Accepted date: 22-1-2016

Please cite this article as: Wei Ren, Yongjun Xia, Guangqiang Wang, Hui Zhang,
Song Zhu, Lianzhong Ai, Bioactive Exopolysaccharides from a S.thermophilus
strain: screening, purification and characterization, International Journal of Biological
Macromolecules http://dx.doi.org/10.1016/j.ijbiomac.2016.01.085

This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.
 Bioactive Exopolysaccharides from a S. thermophilus strain:

screening, purification and characterization

Wei Rena, Yongjun Xiaa, Guangqiang Wanga, Hui Zhanga, Song Zhub, Lianzhong Aia*

a
: School of Medical Instrument and Food Engineering, University of Shanghai for

Science and Technology, Shanghai 200093, China

b
: State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi

214122, China

*Corresponding author at: University of Shanghai for Science and Technology,

Shanghai 200093, email: ailianzhong@163.com, Tel: +86 13764645986.

1
 
Abstract:

A lactic acid bacteria strain AR333 with high-production of exopolysaccharides (EPS)

was screened out from 350 bacteria strains isolated from naturally fermented dairy

products. It was identified as Streptococcus thermophilus by morphological

observation, physiological and biochemical characteristics, and 16S rDNA sequence

determination. The EPS from AR333 were purified through DEAE-Sepharose Fast

Flow and Sepharose CL-6B, and the purified fraction was designated as EPS333. In

vitro test showed that EPS333 could stimulate macrophage RAW 264.7 to release NO

significantly (p < 0.05). The further work tried to elucidate the structural features of

EPS333 via FT-IR spectrum, high-performance anion exchange chromatography

(HPAEC) and high-performance size exclusion chromatography (HPSEC). The results

showed that EPS333 was a pure neutral polysaccharide with monosaccharide

composition of galactose and glucose in a molar ratio of 6: 5. A certain amount of

acetyl groups might exist in EPS333 according to the FT-IR spectrum. The molecular

weight (Mw) was estimated to be 332 kDa. Current study suggested that the lactic

bacteria strain AR333 could be a potential source of immunoregulatory

polysaccharide.

Keywords: Exopolysaccharides; Viscosity; Streptococcus thermophilus

2
 
1. Introduction

The exopolysaccharides (EPS) are molecules secreted by microorganism as slime in

the medium or tightly linked to the cell wall as capsular polysaccharide during its

growing and metabolizing [1]. The Generally Recognized as Safe (GRAS) status of

lactic acid bacteria (LAB) in dairy products has been confirmed [2]. The increasing

demand for healthy products is also raising interest in the use of EPS-producing LAB

as natural bio-thickeners, especially when it has potential bioactivities. Streptococcus

thermophilus is a LAB widely used in the manufacture of dairy products; in fact, it is

the most important thermophilic dairy starter [3-5]. A number of S. thermophilus

strains have been reported to synthesize EPS [6-8]. In the study of EPS production by

these bacteria, substantial progress has been made in recent years. For example,

Robitaille et al. [9] mentioned that S. thermophilus EPS involved in the texture of

fermented dairy products, allowing syneresis reduction, firmness enhancement and

mouthfeel improvement of yogurt. Kanmani et al. [10] increased the production of

EPS, which could not only influence the techno-functional properties, but also exert a

probiotic effect. Rodriguez et al. [11] concluded that the EPS-producing S.

thermophilus strains could be used in the novel functional foods concerning human

health. Most studies focused on the EPS benefit to the textural properties of yoghurt,

while few was focused on EPS with immunoregulatory activity [3-13]. As the

bioactive EPS has become a hot topic in these years, researchers are interested in

finding starters with potential bioactivity and reviving the idea of screening.

3
 
The objective of current study is to screen and identify a kind of LAB with high-

production of potential bioactive EPS from naturally fermented dairy products. The

EPS secreted from the selected bacteria were purified and characterized by molecular

weight, FT-IR and monosaccharide composition. The stimulation ability on

macrophage cells was used to evaluate the potential bioactive function of the purified

EPS. This study aimed to explore the valuable LABs and the secretions from

traditional fermented products.

2. Materials and methods

2.1 Samples and culture medium

Samples were isolated from the pickles and natural fermented dairy products from

Jiangsu, Fujian, Shandong and Sinkiang. Medium used for screening was the

improved MRS medium taking lactose instead of glucose. Medium used for EPS

production was the reconstituted skim milk (15% skim milk powder).

2.2 Isolation of the lactic acid bacteria

Pickle brine or supernatants from samples were diluted serially, 0.1 mL of the diluted

samples were spread onto plates with medium for isolation, respectively. After

incubation for 3 days at 37 °C, the colonies on the plates were selected according to

the scale of clarity zone, the selected colonies were then purified according to the

Streak plate method [14], respectively. The purified isolates were inoculated on MRS

medium and incubated at 37 °C for another 2 days. The resulted colonies were coved

4
 
with a drop of H2O2 to study the property of catalase. Optical microscope was used to

study the cell morphology after Gram staining.

2.3 Screening of EPS producing strains

The EPS producing LAB strains were screened out by the colony thread-drawing

method [15]. The colony was picked with aseptic toothpick as the EPS-producing

strain had long ropy thread-drawing between the colony and the toothpick [16]. The

selected EPS producing strains were inoculated in the reconstituted skim milk (15%

skim milk powder) at a concentration of 3% (v/v) and corresponding optimum

temperature, respectively. The supernatant was obtained following the method

described by Ai et al. [17] with slight modifications. Culture medium was heated in

boiling water for 10 min to inactivate enzymes, then cooled to room temperature,

centrifuged (20 min, 10,000 g, 4 °C) to remove cells and coagulated proteins. The

supernatant was further subjected to deproteinization by trichloroacetic acid (TCA)

[17].

The yield of EPS was determined by the phenol-sulfuric acid method using glucose as

standard after concentrated the protein-free supernatant to a certain volume [18]. The

viscosity of the supernatant was measured using Discovery Hybrid Rheometer (TA

Instruments, Eschborn, Germany) at a shearing rate of 10 s-1 under the procedure of

flow peak at 25 °C.

5
 
2.4 Identification of screened strains

2.4.1 Physiological and biochemical identification

The screened strain was identified by physiological and biochemical experiments

according to the Bergey’s Manual of Systematic Bacteriology [19]. The identification

was confirmed by comparing the results of morphological shape, Gram staining,

growing tests at different temperature and pH, catalase tests and carbon resource

utilization tests.

2.4.2 16S rDNA sequence identification

The extraction of DNA was carried out by a DNA extraction kit (TIAN GEN Co.,

Beijing, China) to study the identity of the selected EPS-producing S. thermophilus

strains. PCR amplification of the 16s rRNA gene was performed with 2 primers (16s

27F: GAGAGTTTGATCCTGGCTCAG and 16s 1492R:

CGGCTACCTTGTTACGACTT). The PCR product was sent to China General

Microbiological Culture Collection Center. The identification result was confirmed by

comparing with DNA sequences held in the National Center for Biotechnology

Information (NCBI) database using the Basic Local Alignment Search Tool (BLAST,

http://www.ncbi.nlm.nih.gov/BLAST).

2.5 Extraction and purification of EPS

2.5.1 Extraction of EPS

6
 
EPS were precipitated from the supernatant by adding 2.5 volumes of cold ethanol.

The resulted precipitates were centrifuged, re-dissolved in the deionized water and

dialyzed (Mw cut-off: 10kDa) against water for three days. The retentate was

centrifuged again to remove the insoluble mass. The supernatant was lyophilized and

white crude EPS powder was obtained.

2.5.2 Purification of EPS

The EPS were firstly fractionated on a DEAE-Sepharose Fast Flow (Qingpu Co.,

Shanghai, China) column (Φ 5.0 cm × 30 cm) using 0.05 M Tris-HCl buffer (pH 7.8)

as eluent, followed by a linear gradient of NaCl solution (0-2 M) at a flow rate of 6.0

mL/min. The eluted process was monitored by using the phenol-sulphuric acid

method [18]. The fraction was further loaded onto a Sepharose CL-6B gel column (Φ

1.6 cm × 80 cm) and eluted with 0.05 M Tris-HCl buffer (pH 7.8) with 0.1 M NaCl at

a flow rate of 1 mL/min. A purified fraction was obtained for the further work.

2.6 Determination of NO production in macrophages RAW 264.7

The NO production test was used following the method described by Yao et al. [20]

with slight modifications. Macrophages RAW 264.7 were resuspended in RPMI 1640

medium (5 x 105 cells/mL) containing various concentrations of polysaccharides (50-

1000 µg/mL). Negative control group only used the culture medium without

polysaccharide. Positive control group was 1 µg/mL lipopolysaccharide (LPS) which

has been reported to induce NO production by macrophages [21]. Cells were

7
 
incubated at 37 °C in 5% CO2 for 24 h; then 50 µL supernatant was pipetted from the

medium and added into the 96-well plate. An equal volume of Griess reagent (50 µL)

was added and mixed with the supernatant, incubating for 15 min at room temperature.

The absorbance at 543 nm was measured in an enzyme-linked immune sorbent assay

(ELISA) reader (Bio-Tek MQX200, USA) and NO production of test sample was

calculated with reference to a standard curve obtained with NaNO2 (6.25-100 µM).

2.7 Molecular weight analysis

The Mw of EPS were determined by HPSEC system equipped with a Waters 2410

refractive index detector and Waters UltrahydrogelTM linear column (Φ 7.8 × 300 mm,

10 µm). The EPS were dissolved in 0.1 mol/L NaNO3 and filtered through a 0.22 µm

filter prior to injection. The mobile phase was 0.1 mol/L NaNO3, and the separation

was carried out at 0.9 mL/min at a certain column temperature of 45 °C. Dextrans of

known Mw (Mw 2,700 Da, Mw 9,750 Da, Mw 36,800 Da and Mw 135,350 Da) were

used to calibrate the Mw of sample.

2.8 FT-IR spectra of EPS

The IR spectra of polysaccharide were determined using a Fourier transform-infrared

spectrophotometer (Nexus 5DXC FT-IR, Thermo Nicolet, America) at a range of 400-

4000 cm-1. Before testing, the sample was ground with spectroscopic grade KBr

powder and then pressed into a 2 mm pellet for FT-IR measurement.

8
 
2.9 Monosaccharide composition analysis of EPS

Monosaccharaides were determined by HPAEC (Dionex Corporation, USA) equipped

with a CarboPac PA20 column and pulsed amperometric detector (PAD). Various

commercially available sugars were used as standards for detection of sugar

composition of the EPS. Before testing, the EPS were hydrolyzed with 2 M

trifluoroacetic acid (TFA) at 110 °C for 2 h. 200 µl methyl alcohol was added into the

hydrolyzed solution after cooling, dried with N2 to remove TFA. This process

repeated three times. The hydrolyzates were dissolved in deionized water again,

diluted with water to 10.0 mL, and filtered through a 0.45 µm filter before injection.

2.10 Statistical analysis

All the data were calculated with three replications and shown in mean ± standard

deviation (SD), within significance p<0.05 after subjecting to an analysis of variance

(ANOVA) by Origin V8.0 (Origin Lab Corp., Northampton, MA, USA).

3. Results and discussion

3.1 Isolation of EPS-producing strains

3.1.1 Primary screen by means of the colony thread-drawing method

After Gram staining, microscopic examination and catalase test, 200 LAB strains

were screened out from the fermented food. The possible EPS-producing strains were

further identified via their mucoid or ropy appearance. When picked the colony with

an aseptic toothpick, the EPS-producing strain has long ropy thread-drawing between

9
 
the colony and the toothpick. In this way, 28 possible EPS-producing LAB strains

were taken out.

3.1.2 Determination of EPS yield

EPS production by LAB is both strain-dependent and growth-rate-associated. It is also

affected by the mediums and growth conditions, such as temperature, pH,

carbon/nitrogen ratio, carbon source, and concentration [22, 23]. In order to minimize

these effects, the selected 28 possible EPS-producing LAB strains were cultured and

fermented using the same medium (15% skim milk powder) and at the same growth

conditions, respectively. The EPS yields of different LAB strains are measured and

shown in Table 1. Seven strains (AR33, AR93, AR113, AR163, AR307, AR330 and

AR333) with relative higher EPS yield were screened out.

3.1.3 Viscosity of supernatant fermented by strains producing polysaccharide

As biological macromolecules, EPS in water solution possess excellent water binding

capacity and enhancing viscosity property. The more EPS secreted, the slimier the

fermented solution will be [24]. The viscosity of the fermentation broth fermented by

7 EPS-producing strains (AR33, AR93, AR113, AR163, AR307, AR330 and AR333,

respectively) were measured and shown in Table 2. From the result, the viscosity of

supernatant fermented by AR333 was significant higher than others (p≤0.05).

Combining with the results of EPS yield test, AR333 was screened out as a high EPS-

producing strain.

10
 
3.2 Identification of EPS-producing strain AR333

Strain AR333 was identified according to physiological and biochemical tests and 16S

rDNA sequence analysis. Results of the physiological and biochemical tests are

shown in Table 3. Strain AR333 was found to be a sporogenous, gram positive,

catalase- and oxidase-negative bacteria. It could grow well in high pH medium (pH

9.6), at relative high temperature (45-50 °C), or by exposed in the air. However, low

pH medium (pH 4.5) or high concentration of NaCl solution (6.5%) was not suitable

for the growth of strain AR333. Strain AR333 could ferment glucose to produce acid

but no gas. The gluconolactone fermentation test showed negative result for

producing gas. The carbohydrates fermentation test results showed that AR333 could

use several kinds of carbohydrates e.g., D-glucose, sucrose and lactose, as carbon

source to produce acid. All of these results revealed that strain AR333 belonged to S.

thermophilus based on the Bergey's Manual of Systematic Bacteriology [19].

The 16S rDNA of strain AR333 were sequenced by China General Microbiological

Culture Collection Center. The nucleotide sequence was used to analyze sequence

similarity through BLAST program (http://www.ncbi.nlm.nih.gov/blast). Strain

AR333 had 99% 16S rDNA similarity with the closest relative S. thermophilus MN-

BM-A02. Above all, strain AR333 was identified as a S. thermophilus strain.

3.3 Purification of EPS

11
 
The EPS secreted from AR333 was firstly fractionated by DEAE-Sepharose Fast Flow

column, only one neutral fraction (65% of recovery) was obtained as shown in Fig.

1(a). This result indicated that EPS from AR333 had no acidic or other ionic fractions.

The neutral polysaccharide was then loaded onto a Sepharose CL-6B column for the

further purification. Only one single symmetrical peak (Fig. 1(b)) was detected and

collected together to obtain a main fraction, designated as EPS333.

3.4 Effect of EPS333 on NO production in macrophages RAW264.7

Macrophages play an important role in the inflammatory response. Nitric oxide (NO)

is one of the cytokines released by stimulating agents and is related to immunological

functions of macrophages [26]. Therefore, macrophage derived NO synthesis could

contribute to the immune response in vivo [27-29]. In this study, the macrophages

RAW 264.7 activated by EPS333 according to the NO production were evaluated, and

the results are shown in Fig. 2. No significant increase of NO level was observed at

the low concentration of samples (50 μg/mL and 100 μg/mL, p ≤ 0.05) by compared

with the negative control. However, the NO production increased significantly when

the concentration of EPS333 reached 500 μg/mL. The NO level was even higher than

the positive control (1 μg/mL of LPS) when the concentration was 1000 μg/mL. The

results indicated that high concentration of EPS333 (≥500 μg/mL) could enhance the

NO production in macrophages RAW 264.7 significantly, which suggested that

EPS333 could be a potential immunostimulant in dairy products. According to

previous reports, Sato et al. [30] found that EPS may enhance immunological

12
 
functions. Karaca et al. [31] demonstrated that some polysaccharides had been

demonstrated to enhance the production of NO from macrophages. Marcial et al. [32]

also showed that the EPS1190 naturally produced by S. thermophilus CRL1190

played an important role in protecting the gastrointestinal system by stimulating

epithelial cells regeneration and immunological defense mechanisms.

3.5 Mw of EPS333

The chromatography from HPSEC of EPS333 is shown in Fig. 3. The single

symmetrical peak further proved its homogeneity. The Mw was calculated to be 332

kDa according to the known Mw standards. It has been reported that Mw of EPS from

some S. thermophilus strains was influenced by the composition of milk-based

medium and growth conditions [8, 33]. The Mw of EPS333 were in agreement with

the previous reports, i.e. Mw of EPS varying from 104 - 6x106 Da [34]. Meanwhile,

no peak was detected from the UV detector at 220, 260, 280 nm, indicating that the

EPS333 did not have protein or nucleic acid.

3.6 Infrared spectra of EPS333

FT-IR has been reported to be a useful tool for monitoring the structural features of

biopolymers [35]. The overall appearance of the FT-IR spectra of EPS333 (Fig. 4)

were typical of those from carbohydrates. The polysaccharides contained a significant

number of hydroxyl groups, which exhibited an intensive broad stretching peak at

around 3408 cm−1 [36]. The C-H stretching peak at 2935 cm−1 corresponded to the

13
 
methyl and methylene groups. There was no peak around 1700-1775 cm−1, suggesting

that neither glucuronic acid nor diacyl ester was present in the EPS333. However, the

strong absorption at 1645 cm−1 corresponding to the amide >C=O stretching

suggested the presence of the C=O group [37]. This result indicated that the neutral

fraction of EPS333 might contain a certain amount of acetyl groups. The broad

absorptions in the fingerprint region (1000-1200 cm−1) were assigned to be the C-O-C,

C-O stretching, suggesting the presence of carbohydrates [38]. The strongest

absorption band at 1078 cm−1 was indicative that the sample was a polysaccharide.

Based on the descriptions as aforementioned, the major functional groups such as

carboxyl and hydroxyl groups were identified in the FT-IR spectrum of EPS333.

3.7 Monosaccharide composition

The monosaccharide composition of EPS333 was determined by HPAEC, and various

commercially available monosaccharides were used as standards. The result showed

that EPS333 was composed of galactose and glucose in a molar ratio of 6: 5. It was in

accordance with the results from Marshall et al. who reported that S. thermophilus

EPS were heterosaccharide polymers, and primarily consisted of galactose, glucose,

and rhamnose monomers [39].

4 Conclusions

In this work, a LAB strain AR333 was screened out from traditional fermented

products and identified as S. thermophiles. The EPS yield of AR333 was in high level

14
 
among all the S. thermophilus strains which had been reported to produce EPS from

50 to 350 mg/L [25]. The EPS from AR333 was also identified to be able to stimulate

NO release on macrophage RAW264.7 in vitro, suggesting that the EPS could be a

suitable immunostimulant for human health. This study demonstrated that AR333 was

a high EPS-producing LAB and could be applied as a starter to produce functional

secretions in the production of dairy products. Further work will focus on: (1) the

structural and functional properties of EPS333 and its effects on the dairy products; (2)

exploring more valuable LABs and corresponding secretions from the traditional

fermented products.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (No.

31371809), New Century Excellent Talents Project of Ministry of Education of China

(No. NCET-13-0901), International Cooperation Project of Shanghai Science and

Technology Commission (No. 14390711700) and the Hujiang Foundation of China

(No. D15012).

References

[1] I.W. Sutherland, Trends in biotechnology, 16 (1998) 41-46.

[2] J. Cerning, FEMS microbiology reviews, 87 (1990) 113-130.

[3] P. Hols, F. Hancy, L. Fontaine, B. Grossiord, D. Prozzi, N. Leblond-Bourget, B.

Decaris, A. Bolotin, C. Delorme, S.D. Ehrlich, FEMS microbiology reviews, 29 (2005)

15
 
435-463.

[4] C. Delorme, International journal of food microbiology, 126 (2008) 274-277.

[5] R. Iyer, S. Tomar, T.U. Maheswari, R. Singh, International Dairy Journal, 20 (2010)

133-141.

[6] J.R. Broadbent, D.J. McMahon, D. Welker, C. Oberg, S. Moineau, Journal of dairy

science, 86 (2003) 407-423.

[7] L. De Vuyst, M. Zamfir, F. Mozzi, T. Adriany, V. Marshall, B. Degeest, F.

Vaningelgem, International Dairy Journal, 13 (2003) 707-717.

[8] F. Vaningelgem, M. Zamfir, F. Mozzi, T. Adriany, M. Vancanneyt, J. Swings, L. De

Vuyst, Applied and environmental microbiology, 70 (2004) 900-912.

[9] G. Robitaille, S. Moineau, D. St-Gelais, C. Vadeboncoeur, M. Britten, Journal of

dairy science, 90 (2007) 4051-4057.

[10] P. Kanmani, R. Satish Kumar, N. Yuvaraj, K. Paari, V. Pattukumar, V. Arul,

Critical reviews in food science and nutrition, 53 (2013) 641-658.

[11] N. Rodríguez, J. Salgado, S. Cortés, J. Domínguez, Letters in applied

microbiology, 51 (2010) 226-233.

[12] F. Bourgoin, A. Pluvinet, B. Gintz, B. Decaris, G. Guedon, Gene, 233 (1999)

151-161.

[13] E.J. Faber, P. Zoon, J.P. Kamerling, J.F. Vliegenthart, Carbohydrate research, 310

(1998) 269-276.

[14] J.W. Gooch, Polyimide Fiber, Springer, New York, 2011.

[15] W. Li, M. Mutuvulla, X. Chen, M. Jiang, M. Dong, European Food Research and

16
 
Technology, 235 (2012) 497-505.

[16] R. Bennama, M. Fernández, V. Ladero, M.A. Alvarez, N. Rechidi-Sidhoum, A.

Bensoltane, European Food Research and Technology, 234 (2012) 119-125.

[17] L. Ai, H. Zhang, B. Guo, W. Chen, Z. Wu, Y. Wu, Carbohydrate Polymers, 74

(2008) 353-357.

[18] M. Dubois, K.A. Gilles, J.K. Hamilton, P. Rebers, F. Smith, Analytical chemistry,

28 (1956) 350-356.

[19] K. Kersters, M. Vancanneyt, Bergey's manual of systematic bacteriology,

Springer, London, 2005.

[20] Y. Yao, Z. Shi, G. Ren, International journal of molecular sciences, 15 (2014)

19307-19318.

[21] M. Miwa, D.J. Stuehr, M.A. Marletta, J.S. Wishnok, S.R. Tannenbaum,

Carcinogenesis, 8 (1987) 955-958.

[22] B. Degeest, F. Vaningelgem, L. De Vuyst, International Dairy Journal, 11 (2001)

747-757.

[23] B. Zisu, N. Shah, Journal of dairy science, 86 (2003) 3405-3415.

[24] J. Cerning, Le lait, 75 (1995) 463-472.

[25] J. Han, H. Xie, J. Zhao, Food Science and Technology, 6 (2007) 70-71.

[26] G.Y. Kim, G.S. Choi, S.H. Lee, Y.M. Park, Journal of ethnopharmacology, 95

(2004) 69-76.

[27] J.N. Uemura, H. Kitazawa, Y. Kawai, T. Itoh, M. Oda, T. Saito, Food

microbiology, 20 (2003) 267-273.

17
 
[28] P. R. Madiedo, J. Hugenholtz, P. Zoon, International Dairy Journal, 12 (2002)

163-171.

[29] H. Kitazawa, Y. Ishii, J. Uemura, Y. Kawai, T. Saito, T. Kaneko, K. Noda, T. Itoh,

Food microbiology, 17 (2000) 109-118.

[30] T. Sato, J. Nishimura-Uemura, T. Shimosato, Y. Kawai, H. Kitazawa, T. Saito,

Journal of Food Protection, 67 (2004) 1719-1724.

[31] K. Karaca, J. Sharma, R. Nordgren, International journal of

immunopharmacology, 17 (1995) 183-188.

[32] G. Marcial, J. Messing, B. Menchicchi, F.M. Goycoolea, G. Faller, F. Valdez

Graciela, A. Hensel, International journal of biological macromolecules, 62 (2013)

217-224.

[33] C. Shene, N. Canquil, S. Bravo, M. Rubilar, International journal of food

microbiology, 124 (2008) 279-284.

[34] L.D. Vuyst, F. D. Vin, F. Vaningelgem, B. Degeest, International Dairy Journal,

11 (2001) 687-707.

[35] R.H. Wilson, B.J. Goodfellow, P.S. Belton, Food Hydrocolloids, 2 (1998) 169-

178.

[36] K.J. Howe, K.P. Ishida, M.M. Clark, Desalination,147 (2002) 251-255.

[37] K. Haxaire, Y. Marechal, M. Milas, M. Rinaudo, Biopolymers, 72 (2003) 10-20.

[38] P.J. Bremer, G.G. Geesey, Biofouling, 3 (1991) 89-100.

[39] V.M. Marshall, A.P. Laws, Y. Gu, F. Levander, P. Radstrom, L.D. Vuyst, B.

Degeest, H. Dunn, M. Elvin, Letters in applied microbiology, 32 (2001) 433-437.

18
 
Figure Captions

Fig. 1. Elution profile of EPS on DEAE-Sepharose Fast Flow and Sepharose CL-6B

column. (a): Elution profile of EPS on DEAE-Sepharose Fast Flow column; eluted

solution: 0.05 M Tris-HCl buffer; pH 7.8; 6.0 mL/min; (b): Elution profile of EPS on

CL-6B column; eluted solution: 0.05 M Tris-HCl buffer (pH 7.8) with 0.1 M NaCl

buffer; pH 7.8; 1.0 mL/min

Fig. 2. Concentration of NO in supernatant of EPS333-treated macrophages RAW

264.7. Macrophages RAW 264.7 were stimulated with indicated concentrations of

EPS for 24 h. The results were reported as the mean ± SD with three independent

experiments. *p < 0.05 compared with negative control (PBS)

Fig. 3. High-performance size-exclusion chromatogram of EPS333. The mobile phase

was 0.1 M NaNO3 solution, flow rate was 0.9 mL/min and column temprature was set

at 45 °C. The sample signals were detected by the reflective index (RI) detector.

Fig. 4. FT-IR spectrum of EPS333.

19
 
 a 3 6
b
EPS
A490nm
2.5 5

2 4
OD490

1.5 3

NaCl(Mol/L)
1 2

0.5 1

0 0
0 20 40 60
Fraction number
 

Figure 1

20
 
Figure 2

21
 
Figure 3 

22
 
Figure 4 

23
 
 Table 1. Results of strains producing polysaccharide in supernatant
Strains EPS yield (mg/L)a Strains EPS yield (mg/L)

AR 32 44.27 AR 147 168.71

AR 33 194.04 AR 152 99.81

AR 34 177.57 AR 156 157.15

AR 54 154.93 AR 163 193.27

AR 56 154.93 AR 171 170.93

AR 74 175.33 AR 178 75.84

AR 87 95.13 AR 181 166.93

AR 89 157.51 AR 245 170.93

AR 92 188.50 AR 249 118.04

AR 93 206.37 AR 307 190.50

AR 94 184.71 AR 330 189.61

AR 102 146.07 AR 331 51.37

AR 103 121.50 AR 332 166.04

AR 113 191.82 AR 333 234.15

a
: The yield of EPS was determined by the phenol-sulfuric acid method using glucose

as standard.

24
 
 Table 2. Viscosity of supernatant fermented by different stains
Supernatant Viscosity (×10-3 Pa · s )

Fermented by germfree water 1.18715

Fermented by AR33 1.21310

Fermented by AR93 1.26974

Fermented by AR113 1.35574

Fermented by AR163 1.45824

Fermented by AR307 1.62971

Fermented by AR330 1.58607

Fermented by AR333 2.18827

25
 
 Table 3. Physiological and biochemical experiment resultsa

Experiment Result Experimentb Result Experimentb Result

Gram staining + Melezitose - Synanthrin -

Morphological
Globular L-xylose - D- glucose +
shape
Sporing - D-galactose - D-fructose -

Catalase tests - D-arabinose - D-mannose -

Oxidase tests - L-arabinose - D-ribose -

Grow in the air + L-sorbic acid - L-rhamnose -

Grow in 50℃ + Sucrose + D-xylose -

Grow in 45℃ + Cellobiose - Sorbitol -

Grow in 15℃ - Melibiose - Mannitol -

Grow in 6.5% of
- Maltose - Gluconic acid -
NaCl
Grow in pH 9.6 + Lactose + Polychrom -

Grow in pH 4.5 - Trehalose - Saligenin -

Glucose
fermentation gas - Raffinose - Amygdalin -
experiment
Gluconolactone
fermentation gas - Melezitose - Synanthrin -
experiment
a
: Positive result (+); negative result (-)

b
: Carbohydrates produce acid test

26