3875

The Journal of Experimental Biology 215, 3875-3880

© 2012. Published by The Company of Biologists Ltd
doi:10.1242/jeb.074955

METHODS & TECHNIQUES

Symbiodinium isolation by NaOH treatment
Thamilla Zamoum* and Paola Furla
Université de Nice-Sophia-Antipolis, UFR Sciences, Parc Valrose, 28 avenue Valrose, F-06108 Nice Cedex 2, France
*Author for correspondence (thamilla.zamoum@unice.fr)

SUMMARY
The presence of photosynthetic zooxanthellae (dinoflagellates) in the tissue of many cnidarians is the main reason for their
ecological success (i.e. coral reefs). It could also be the main cause of their demise, as the worldwide bleaching of reef-building
coral is nothing less than the breakdown of this symbiotic association. The stability of this relationship is the principal marker for
the biomonitoring of cnidarian health. We have therefore developed a new, simple method to isolate zooxanthellae in a few steps
using NaOH solution. The protocol was validated in three symbiotic cnidarian species: a sea anemone, a gorgonian and a coral.
Our method allows the isolation of intact and viable zooxanthellae with better yields than classic methods, especially for species
with a calcareous skeleton. Moreover, the isolated zooxanthellae were free of host nucleic contaminants, facilitating subsequent
specific molecular analyses.
Key words: zooxanthella density, symbiosis, cnidarian, nucleic acid amplification.
Received 14 May 2012; Accepted 20 August 2012

INTRODUCTION the white gorgonian E. singularis (Esper 1791) were collected in

Many cnidarian species (sea anemones, gorgonians and corals) form Banyuls (France). Sea anemones and gorgonians were maintained
mutualist associations with photosynthetic dinoflagellates that in aquaria as described elsewhere (Moya et al., 2012). Microcolonies
belong to the genus Symbiodinium and that are commonly called of S. pistillata Esper 1797 collected at the Marine Science Station,
zooxanthellae (Taylor, 1974; Trench, 1987). Most cnidarians Gulf of Aqaba (Jordan) were maintained at the Scientific Center of
contain extremely high densities of zooxanthellae, around 1–5 Monaco as described previously (Furla et al., 2000). Cultured
(⫻106)cellscm–2 of host live surface tissue (Muller-Parker and zooxanthellae (CZ) were maintained in F/2 medium (Guillard and
Davy, 2001). They are located in vacuoles within the host endoderm Ryther, 1962) at pH8.2 and incubated at 26.0±0.1°C under an
cells (Glider et al., 1980). When these symbioses are subjected to irradiance of 100mol photonsm–2s–1 (Sylvania Gro-Lux,
environmental stress, such as an elevated seawater temperature, the Loessnitz, Germany), on a 12h:12h photoperiod. Stock cultures
zooxanthellae are lost from the host tissues, a process known as were transferred monthly.
bleaching (Brown, 1997). The isolation and counting of
zooxanthellae from cnidarian species is a common procedure to Zooxanthella isolation
evaluate the severity of the bleaching. In order to obtain freshly isolated zooxanthellae (FIZ), two extraction
Several techniques have been developed to isolate the symbiotic protocols were tested and compared for the three cnidarian species.
algae from the host. They include stripping coral tissues from the
skeleton with a fine jet of seawater using a WaterPik (Johannes and Initial protocol
Wiebe, 1970), grinding the whole coral (Santiago-Vázquez et al., FIZ extractions from the three species were performed as described
2006) or gorgonian tissue (Forcioli et al., 2011; Pey et al., 2011) in elsewhere (Richier et al., 2003; Forcioli et al., 2011). Anemonia
liquid nitrogen, manual tissue fractionation and potter homogenization viridis tentacles were cut and quickly dried on paper to remove
of sea anemones (Richier et al., 2003). Although effective, these excess seawater. Each tentacle was cut lengthwise and scraped to
techniques could underestimate the zooxanthella biomass and require separate the endodermal cell layer, which contains the
a large investment of time. Also, the intracellular localization of zooxanthellae, from the epidermal tissue. The endodermal fraction
zooxanthellae complicates the molecular analyses of cnidarian species was suspended in extraction buffer (0.05moll–1 phosphate buffer
as it often leads to DNA extracts containing both cnidarian and algal pH7.8, 0.4moll–1 sorbitol) and disrupted by syringe
genomes. We report here a new, fast and efficient method for the homogenization. Zooxanthellae were separated from the
isolation of zooxanthella without host contaminant, validated on three endodermic extract by centrifugation at 3000g for 5min. The pellet
cnidarian species: a sea anemone, Anemonia viridis; a gorgonian, was washed twice with extraction buffer, centrifuged at 12,000g
Eunicella singularis; and a scleractinian coral, Stylophora pistillata. for 3min and then resuspended in extraction buffer. Fragments
from E. singularis and from S. pistillata were weighed and ground
MATERIALS AND METHODS in a mortar with liquid nitrogen. The resulting powder was
Cnidarian collection and maintenance resuspended in the same extraction buffer. Samples were then
Mediterranean sea anemone specimens, A. viridis Forskål 1775, were filtered through a nylon mesh (100m) in order to eliminate as
collected in ‘Baie des Croutons’ (Antibes, France). Fragments of many skeleton residues as possible.

THE JOURNAL OF EXPERIMENTAL BIOLOGY

3876 The Journal of Experimental Biology 215 (22)

Table1. Primer sequences used for PCR and RT-PCR

Primer sequence (5⬘–3⬘)
Organism Gene Forward Reverse Tm (°C) Elongation (s)
Anemonia viridis cop- GCCTGTTGGACACCGATGAT TGCAAGGCTCTCTCCAGTCC 63 30
Anemonia viridis npc1 GCCTGCTGTCAAGGTGTTCTC TGCGGTTACTTTCCTGTCGTC 63 15
Symbiodinium sp. apx CGTCCAGGACCTCGAGAACT TTGAGCTCGCCATCAGAGAA 63 30
cp23s TCAGTACAAATAATATGCTG GGATAACAATTTCACACAGGTTATC-
GCCCCAATTAAACAGT 53 30
ssu GGTTGATCCTGCCAGTAGTCATATGCTTG AGCACTGCGTCACTCCGAATAATTCACCGG 53 60

Improved protocol subunit); and one Symbiodinium chloroplastic gene (cp23s) were
In this protocol, NaOH solution was used to extract FIZ from the amplified. Specific primers were synthesized as described
three cnidarian species. Extracts were obtained by incubating a elsewhere (Ganot et al., 2011; McNally et al., 1994; Santos et al.,
whole A. viridis tentacle, a 1.5cm long fragment of E. singularis 2003). The primer sequences used in this study are listed in Table1.
or a 500mg sample of S. pistillata in 500l of 0.25–10moll–1 NaOH PCR was performed in a total volume of 20l with 10⫻ PCR
solution. The combined effects of the incubation temperature (25 buffer, 0.2mmoll–1 each dNTP, 1.5mmoll–1 MgCl2, 0.2moll–1
or 37°C) and the duration of NaOH treatment (1–4h) were tested each of the two primers and 1U Platinum Taq DNA polymerase
to evaluate the most effective extraction conditions for each species. (Invitrogen). The amplification profile consisted of an initial
All the samples were vigorously shaken every 15min during the denaturation step at 94°C for 5min, followed by 30 cycles of
NaOH treatment. denaturation at 94°C for 30s, annealing for 30s at a temperature
dependent on primer melting temperature (Tm) and extension at
Zooxanthella quantification 72°C for 30s to 1min depending on amplicon length (see Table1).
Zooxanthella density was determined by placing 40l of the A final extension step was carried out at 72°C for 7min. Amplicon
extracts in a Neubauer improved haemocytometer and the counts specificity for either A. viridis or Symbiodinium sp. was tested
were normalized by sample wet mass. Light microscopic respectively against epidermal tissue extracts (tissue without
observations (Leica, Wetzlar, Germany) of extracts obtained from zooxanthellae) or CZ extracts. PCR products were
both isolation protocols were compared. electrophoretically analysed on 1% agarose gel stained with
gelRed (Interchim, Montluçon, France) and compared with a 1.5kb
DNA extraction plus DNA ladder (Invitrogen). PCR and RT-PCR were performed
Zooxanthella extracts were centrifugated at 3000g for 3min at room from at least three independent RNA and DNA extractions,
temperature. The zooxanthella pellets were washed twice with TE respectively.
buffer (0.01moll–1 Tris HCl pH8.0 and 0.001moll–1 EDTA) and
centrifuged at 12,000g. Pellets were kept in lysis buffer (0.02moll–1 Viability assay
EDTA pH8.0, 0.01moll–1 Tris HCl pH7.5, 0.4moll–1 NaCl, 6% FIZ viability was assessed after the initial and improved extraction
sodium dodecyl sulphate, 1lml–1 RNase and 100g of proteinase protocols. All extracts were centrifuged at 5000g for 3min. The
K) at 56°C for 2h. Insoluble material was removed from the extract zooxanthella pellets were washed twice and resuspended in 1ml of
by centrifugation at 12,000g for 5min. Supernatant was transferred F/2 medium. Zooxanthella suspensions were neutralized with
to a fresh tube and DNA was purified by phenol/chloroform/isoamyl 1moll–1 HCl at pH8.5 and incubated at 25°C for 4days. The effect
alcohol extraction and isopropanol precipitation. DNA pellets were of NaOH treatment on CZ was assessed by comparing 1 or 4moll–1
resuspended in TE buffer. DNA was quantified on a 150 ND-1000 NaOH incubation with F/2 incubation (considered as the control)
spectrophotometer (NanoDrop, Wilmington, DE, USA). for 1h at 25°C, followed by centrifugation and a washing step as
described for FIZ. Cell viability was determined by the vital stain
RNA extraction Evans Blue method (Morera and Villanueva, 2009). Cells were
Zooxanthella extracts were centrifuged at 3000g for 3min at 4°C. counted under a phase-contrast microscope using a Neubauer
The resulting zooxanthella pellets were washed twice with RNase- improved haemocytometer. The number of viable cells was
free water and 1ml of TRIzol Reagent (Invitrogen, Carlsbad, CA, expressed as a percentage of the total population (a minimum of
USA) was added; total RNA was extracted following the 300 cells per sample).
manufacturer’s protocol. The RNA pellets were eluted in 30l of
RNase-free water. Statistical analysis
All experiments were performed at least in triplicate. Results are
cDNA synthesis expressed as means ± s.e.m. and normalized according to the wet
Reverse transcription of 1g of total RNA per reaction was carried mass of each fraction. Statistical analyses were performed using
out using SuperScript II reverse transcriptase, following Kruskal–Wallis non-parametric ANOVA followed by Tukey HSD
manufacturer’s procedure (Invitrogen). The obtained cDNA was post hoc tests. Results were considered significant when P<0.05.
used as the template in PCR reactions with the specific primers.
RESULTS
PCR amplification Zooxanthella extraction by the improved protocol on three
Two A. viridis nuclear genes, cop- (coatomer subunit gamma) cnidarian species
and NPC1 (Niemann pick type C1); two Symbiodinium nuclear After NaOH incubation, intact and clean zooxanthellae were
genes, apx (ascorbate peroxidase) and ssu rDNA (small ribosomal successfully isolated from the three species (Fig.1). Variable yields

THE JOURNAL OF EXPERIMENTAL BIOLOGY

 Zooxanthella extraction method 3877

200 A * 800 A
*
*
150
600
100 *
*
50 400
Zooxanthellae (⫻103 cells mg–1 wet mass)

0
0.25 0.5 1 2 4 8 10
200
500 B *
400
* * 0
Initial Improved
300
*
* B

Zooxanthellae (⫻103 cells mg–1 wet mass)

200 400
* *
100 *
0 300
0.25 0.5 1 2 4 8 10

10 C 200
8

6
100
4

2
0
Initial Improved
0
0.25 0.5 1 2 4 8 10
[NaOH] (mol l–1)
15 C

Fig.1. Zooxanthella extraction by the improved protocol from three *

cnidarian species: Anemonia viridis (A), Eunicella singularis (B) and
Stylophora pistillata (C). The samples were incubated in different NaOH 10
concentrations at 25°C (white bars) and 37°C (black bars). Results are
expressed as means ± s.e.m. of nine independent samples. Asterisks
indicate significant differences between the extraction conditions (P<0.05;
Kruskal–Wallis).
50

for FIZ extraction were calculated with respect to NaOH

concentration and temperature incubation. Within the same species,
0
the combined effect of these two parameters led to a variable Initial Improved
success of FIZ extraction and allowed us to determine the optimal
condition. For A. viridis (Fig.1A), the highest zooxanthellae yields Fig.2. Comparison of initial and improved zooxanthella extraction protocols.
were obtained with 1, 2 and 4moll–1 NaOH combined with The amount of zooxanthellae extracted after the initial (black bars) or
incubation at 37°C. For E. singularis (Fig.1B), the number of FIZ improved method (white bars) was compared for A. viridis (A), E. singularis
measured after incubation at 37°C was 3- to 20-fold higher than (B) and S. pistillata (C). In the improved extraction protocol, samples were
after incubation at 25°C, depending on NaOH concentration. The incubated for 4h at 37°C (A. viridis, E. singularis) or 25°C (S. pistillata).
Results are expressed as means ± s.e.m. of three independent samples.
optimal condition was incubation at 37°C in 4moll–1 NaOH
Asterisks indicate significant differences (P<0.05; Kruskal–Wallis).
(P<0.001). For S. pistillata (Fig.1C), no significant effect of the
temperature of incubation was observed on the FIZ yield, whatever
the NaOH concentration. These results are probably related to the Direct comparison of the initial and the improved extraction
thinness and the fragility of S. pistillata tissues, making them more protocols
easily degradable with low NaOH concentration and low We compared the number of FIZ obtained from three cnidarian species
temperature. The effect of treatment time (from 1 to 4h) was then with the initial and the improved protocols (Fig.2). For E. singularis
tested on the extraction yield in A. viridis (data not shown). No and S. pistillata, the improved protocol using NaOH solution was
significant effect of incubation time on the extraction yield was more efficient than the initial protocol; the extraction rates of FIZ
measured. In the light of these results, a 1h incubation was chosen were significantly increased 5- and 1.9-fold, respectively (P<0.05).
for all further analyses. For A. viridis, no significant difference was observed between the

THE JOURNAL OF EXPERIMENTAL BIOLOGY

3878 The Journal of Experimental Biology 215 (22)

A Fig.3. Light microscopy images of zooxanthella

B extracts obtained after the initial or improved
protocol from three cnidarian species: A. viridis
(A,B), E. singularis (C,D) and S. pistillata (E,F). In
the improved extraction protocol, samples were
incubated for 4h at 37°C (A. viridis, E. singularis) or
25°C (S. pistillata). Each square side has a length of
50m.

C D

E F

two extraction methods. However, the standard errors of the mean Fig.5 shows the successful amplification of a specific ssu
for the improved protocol indicate a better reproducibility. Light Symbiodinium sequence of 1800bp and of the Symbiodinium
microscopy pictures of zooxanthella extracts obtained with the chloroplastic gene cp23s, validating the NaOH extraction method
improved extraction protocol showed intact zooxanthellae and very for taxonomy analyses.
low background in the three species, compared with the extracts
obtained from the initial protocol (Fig.3) RNA purification assay after zooxanthella extraction by the
improved protocol
DNA purification assay after zooxanthella extraction by the mRNA isolation and RT-PCR were performed on zooxanthellae
improved protocol extracted by the improved and the initial protocols. Fig.6A shows
After zooxanthella isolation with the initial or the improved protocol an enhanced amplification efficiency of zooxanthella cDNA with
(1 or 4moll–1 NaOH for 1h at 25 or 37°C), genomic DNA was increasing durations of treatment in 4moll–1 NaOH, reaching a level
extracted and the A. viridis (animal) nuclear gene cop- and the equivalent to that obtained with mRNA isolated after the initial
Symbiodinium nuclear gene apx were amplified by PCR. Fig.4A protocol. Contamination with mRNA from animal tissue was weak
shows that only PCR reactions with samples obtained from and decreased with increasing treatment duration, as shown by tissue
incubations at 37°C in 1 or 4moll–1 NaOH amplified a zooxanthella amplifications obtained with cop- (Fig.6B).
DNA amplicon of the expected size (i.e. 100bp), although the
greatest yield was observed with 4moll–1 NaOH. No animal Zooxanthella viability after extraction by the improved
contamination from the host tissue was detected in this condition, protocol
although the animal nuclear gene was still amplified in the other The effect of NaOH treatment on FIZ and CZ viability was assessed
tested conditions (Fig.4B). Thus, incubation at 37°C with 4moll–1 by cell viability assays. During the 48h following the extraction of
NaOH was the optimal condition to amplify zooxanthella DNA free FIZ with 1 or 4moll–1 NaOH, measurements revealed viability rates
from animal DNA contamination. This condition was then tested equivalent to those obtained with FIZ extracted with the initial
to determine the detection limit and the specificity of the assay. protocol (more than 96% viability, Fig.7A). Four days after

THE JOURNAL OF EXPERIMENTAL BIOLOGY

 Zooxanthella extraction method 3879

A 1 2 3 4 5 6 7 A 1 2 3 4 5 6 7
bp
400 bp
300 200
200
100
100

B
B
bp
400 bp
300 200
200
100 100

Fig.4. Optimal zooxanthella extraction conditions from A. viridis by the

improved protocol for genomic DNA isolation and PCR amplification. The
effect of NaOH concentration and incubation temperature on genomic DNA Fig.6. Optimal conditions for zooxanthella extraction from A. viridis by the
amplification efficiency was tested after zooxanthella extraction. improved method for mRNA isolation followed by RT-PCR amplification.
Symbiodinium nuclear gene apx (A) and A. viridis nuclear gene cop- (B) mRNA isolation was performed after zooxanthella extraction by 1, 2 or 4h
were amplified by PCR using the following DNA templates: genomic DNA of incubation with 4moll–1 NaOH at 25°C. RT-PCR amplification was
from cultured zooxanthellae obtained with the initial protocol and used as performed using Symbiodinium nuclear gene apx (A) or A. viridis nuclear
zooxanthella reference (lane 1); genomic DNA from A. viridis epidermis gene cop- (B) primers and the following cDNA templates: cDNA extracted
obtained with the initial protocol and used as animal reference (lane 2); from zooxanthellae obtained with 1, 2 or 4h of NaOH incubation (lanes 1, 2
genomic DNA extracted from zooxanthellae obtained after 1moll–1 NaOH and 3, respectively); cDNA from zooxanthellae obtained using the initial
treatment and incubation at 25°C (lane 3); genomic DNA extracted from method (lane 4); cDNA from A. viridis epidermis extracted with the initial
zooxanthellae obtained after 4moll–1 NaOH treatment and 25°C incubation method and used as the animal reference (lane 5); cDNA extracted from
(lane 4); genomic DNA extracted from zooxanthellae obtained after 1moll–1 cultured zooxanthellae (CZ) with the initial method and used as
NaOH treatment and 37°C incubation (lane 5); genomic DNA extracted zooxanthella reference (lane 6); no DNA template (lane 7).
from zooxanthellae obtained after 4moll–1 NaOH treatment and 37°C
incubation (lane 6); no DNA template (lane 7).

extraction, a loss of viability was measured in FIZ extracted with tissues), E. singularis (proteinaceous and calcareous skeleton) and
both methods. This result validates the NaOH extraction method S. pistillata (calcareous skeleton). We have defined the optimum
for further studies on free-living zooxanthellae. Surprisingly, CZ conditions to extract the highest number of FIZ, which, for the three
treated with 1 or 4moll–1 NaOH lost about 70% viability as early species, was a combination of incubation at 37°C and a NaOH
as 24h after treatment and more than 80% after 4days (Fig.7B). concentration of 1–4moll–1. In addition, compared with initial
methods, our protocol offers advantages in terms of cost, speed and
DISCUSSION effectiveness. Indeed, isolation of zooxanthellae from many samples
By this new NaOH extraction method, we were able to successfully can be processed simultaneously and requires less than 2h.
isolate a large number of intact symbiotic FIZ from three cnidarian Furthermore, as our protocol involves few experimental steps, the
species with different structures, A. viridis (only collagenous variability between samples, mainly due to loss of tissue caused by

A B
1 2 3 4 5 1 2 3 4 5

bp bp
12,000 500
400

2000 300
1650
200
1000

Fig.5. PCR amplification of zooxanthella nuclear and chloroplastic DNA after zooxanthella extraction from A. viridis by the improved protocol. The
experimental conditions of the improved extraction method were 1h treatment in 4moll–1 NaOH at 37°C. PCR was performed using zooxanthella-specific
ssu rDNA primers (A) or chloroplastic cp23s primers (B) and the following DNA templates: genomic DNA from A. viridis epidermis obtained with the initial
protocol and used as animal reference (lane 1); genomic DNA extracted from zooxanthellae obtained with the improved protocol (lane 2); genomic DNA
extracted from zooxanthellae obtained with the initial protocol (lane 3); genomic DNA from cultured zooxanthellae obtained with the initial protocol and used
as zooxanthella reference (lane 4); no DNA template (lane 5).

THE JOURNAL OF EXPERIMENTAL BIOLOGY

3880 The Journal of Experimental Biology 215 (22)
ACKNOWLEDGEMENTS
A We are very grateful to P-L. Merle and P. Lenfant, who collected A. viridis and E.
100 singularis specimens; to the Scientific Center of Monaco for providing S. pistilata
samples; and to F. Priouzeau, J. Catanéo and B. Poderini for CZ and sea
anemone maintenance. We are also grateful to C. Sabourault for technical advice
80 and to D. Forcioli and A. Pey for their precious help in statistical analyses. We
thank S. Barnay-Verdier for her comments on the manuscript.
60
FUNDING
40 This research received no specific grant from any funding agency in the public,
commercial or not-for-profit sectors.

20
REFERENCES
Cell viability (%)

Brown, B. E. (1997). Coral bleaching: causes and consequences. Coral Reefs 16,
0 S129-S138.
Initial 1 mol l–1 4 mol l–1 Forcioli, D., Merle, P.-L., Caligara, C., Ciosi, M., Muti, C., Francour, P., Cerrano, C.
and Allemand, D. (2011). Symbiont diversity is not involved in depth acclimation in
B the Mediterranean sea whip Eunicella singularis. Mar. Ecol. Prog. Ser. 439, 57-71.
Furla, P., Galgani, I., Durand, I. and Allemand, D. (2000). Sources and mechanisms
100 of inorganic carbon transport for coral calcification and photosynthesis. J. Exp. Biol.
203, 3445-3457.
Ganot, P., Moya, A., Magnone, V., Allemand, D., Furla, P. and Sabourault, C.
80 (2011). Adaptations to endosymbiosis in a cnidarian-dinoflagellate association:
differential gene expression and specific gene duplications. PLoS Genet. 7,
e1002187.
60 Glider, W. V., Phipps, D. W., Jr and Pardy, R. L. (1980). Localization of symbiotic
dinoflagellate cells within tentacle tissue of Aiptasia pallida (Coelenterata, Anthozoa).
40 Trans. Am. Microsc. Soc. 99, 426-438.
Guillard, R. R. L. and Ryther, J. H. (1962). Studies of marine planktonic diatoms. I.
Cyclotella nana Hustedt, and Detonula confervacea (Cleve) Gran. Can. J. Microbiol.
20 8, 229-239.
Johannes, R. E. and Wiebe, W. J. (1970). Method for determination of coral tissue
biomass and composition. Limnol. Oceanogr. 15, 822-824.
0 McNally, K. L., Govind, N. S., Thomé, P. E. and Trench, R. K. (1994). Small-subunit
Control 1 mol l–1 4 mol l–1 rDNA sequence analyses and a reconstruction of the inferred phylogeny among
symbiotic dinoflagellates (Pyrrophyta). J. Phycol. 30, 316-329.
Fig.7. Cell viability determined by Evans Blue assay on freshly isolated Morera, C. and Villanueva, M. A. (2009). Heat treatment and viability assessment by
Evans blue in cultured Symbiodinium kawagutii cells. World J. Microbiol. Biotechnol.
zooxanthellae (FIZ) (A) and CZ (B). Zooxanthella viability was measured 25, 1125-1128.
1day (black bars), 2days (grey bars) and 4days (white bars) after their Moya, A., Ganot, P., Furla, P. and Sabourault, C. (2012). The transcriptomic
isolation from A. viridis. FIZ extraction was performed with the improved response to thermal stress is immediate, transient and potentiated by ultraviolet
method (using 1 or 4moll–1 NaOH for 1h at 25°C) and compared with the radiation in the sea anemone Anemonia viridis. Mol. Ecol. 21, 1158-1174.
Muller-Parker, G. and Davy, S. K. (2001). Temperate and tropical algal-sea anemone
viability of zooxanthellae extracted with the initial method. CZ viability was symbioses. Invertebr. Biol. 120, 104-123.
measured after incubation with 1 or 4moll–1 NaOH or in culture medium Pey, A., Zamoum, T., Allemand, D., Furla, P. and Merle, P.-L. (2011). Depth-
(control condition). dependant thermotolerance of the symbiotic Mediterranean gorgonian Eunicella
singularis: evidence from cellular stress markers. J. Exp. Mar. Biol. Ecol. 404, 73-78.
Richier, S., Merle, P.-L., Furla, P., Pigozzi, D., Sola, F. and Allemand, D. (2003).
Characterization of superoxide dismutases in anoxia- and hyperoxia-tolerant
the classic extraction protocols, is strongly reduced. This new symbiotic cnidarians. Biochim. Biophys. Acta 1621, 84-91.
Santiago-Vazquez, L., Ranzer, L. and Kerr, R. (2006). Comparison of two total RNA
method allows a significant increase in extraction yields and enables extraction protocols using the marine gorgonian coral Pseudopterogorgia elizabethae
zooxanthella extracts to be obtained free of animal host tissue, and its symbiont Symbiodinium sp. Electron. J. Biotechnol. 9, doi:10.2225/vol9-
including cnidocytes and spicules. This is a strong asset of our NaOH issue5-fulltext-15.
Santos, S. R., Gutierrez-Rodriguez, C. and Coffroth, M. A. (2003). Phylogenetic
method for molecular analysis of zooxanthellae, as it allows identification of symbiotic dinoflagellates via length heteroplasmy in domain V of
amplification of zooxanthella genomic DNA and cDNA chloroplast large subunit (cp23S)-ribosomal DNA sequences. Mar. Biotechnol. 5,
130-140.
uncontaminated by host animal DNA, a feat not ensured by the other Taylor, D. L. (1974). Symbiotic marine algae: taxonomy and bio-logical fitness. In
extractions techniques. Finally, we showed that the viability of FIZ Symbiosis in the Sea (ed. W. B. Vernberg), pp. 245-262. Columbia, SC: University
of South Carolina Press.
extracted with our protocol is not affected, validating this procedure Trench, R. K. (1987). Dinoflagellates in non-parasitic symbiosis. In The Biology of
of zooxanthella isolation for culture purposes. Dinoflagellates (ed. F. J. R. Taylor), pp. 531-570. Oxford: Blackwell Scientific Press.

THE JOURNAL OF EXPERIMENTAL BIOLOGY