Hisano 2019

Published Online: 30 May, 2019 | Supp Info: http://doi.org/10.1084/jem.
20181895
Downloaded from jem.rupress.org on August 27, 2019
ARTICLE
Lysolipid receptor cross-talk regulates lymphatic

endothelial junctions in lymph nodes
Yu Hisano1, Mari Kono2*, Andreane Cartier1*, Eric Engelbrecht1, Kuniyuki Kano3, Kouki Kawakami3, Yanbao Xiong4, Wenji Piao4, Sylvain Galvani1,
Keisuke Yanagida1, Andrew Kuo1, Yuki Ono3, Satoru Ishida3, Junken Aoki3, Richard L. Proia2, Jonathan S. Bromberg4, Asuka Inoue3, and Timothy Hla1
Sphingosine 1-phosphate (S1P) and lysophosphatidic acid (LPA) activate G protein–coupled receptors (GPCRs) to regulate
biological processes. Using a genome-wide CRISPR/dCas9–based GPCR signaling screen, LPAR1 was identified as an inducer of
S1PR1/β-arrestin coupling while suppressing Gαi signaling. S1pr1 and Lpar1-positive lymphatic endothelial cells (LECs) of
lymph nodes exhibit constitutive S1PR1/β-arrestin signaling, which was suppressed by LPAR1 antagonism. Pharmacological
inhibition or genetic loss of function of Lpar1 reduced the frequency of punctate junctions at sinus-lining LECs. Ligand activation
of transfected LPAR1 in endothelial cells remodeled junctions from continuous to punctate structures and increased
transendothelial permeability. In addition, LPAR1 antagonism in mice increased lymph node retention of adoptively
transferred lymphocytes. These data suggest that cross-talk between LPAR1 and S1PR1 promotes the porous junctional
architecture of sinus-lining LECs, which enables efficient lymphocyte trafficking. Heterotypic inter-GPCR coupling may
regulate complex cellular phenotypes in physiological milieu containing many GPCR ligands.
Introduction
Membrane phospholipids are rapidly metabolized by lipases and Both S1P and LPA were originally identified as bioactive lipid
synthases to maintain the integrity of biological membranes mediators due to their ability to modulate cytoskeletal dynamics,
(Shimizu, 2009). Lysophospholipids, metabolic intermediates of neurite retraction, cell migration, cell proliferation, and intra-
membrane phospholipids, have unique geometry and biophysi- cellular ion fluxes (Moolenaar and Hla, 2012). Such activity
cal properties that facilitate membrane topology, vesicle bud- depends on the ability of S1P and LPA to regulate Rho family
ding, and fusion (Holthuis and Menon, 2014). However, GTPases (Hall, 2012). After the discovery of the GPCRs for S1P
lysophospholipids evolved as extracellular lipid mediators in and LPA, genetic loss-of-function studies in mice have identified
vertebrates (Hla, 2005). The best characterized are sphingosine their essential roles in embryonic development and physiologi-
1-phosphate (S1P) and lysophosphatidic acid (LPA), structurally cal processes of multiple organ systems (Chun et al., 2010). For
related lysophospholipids that were originally identified as ma- example, both lysophospholipids were shown to be critical for
jor regulators of cellular cytoskeletal dynamics (Blaho and Hla, early vascular development, since mice that lack autotaxin
2011; Moolenaar and Hla, 2012; Mutoh et al., 2012). S1P is syn- (Enpp2) as well as sphingosine kinases (Sphk1 and Sphk2) were
thesized largely in the intracellular environment and secreted embryonic lethal at early stages of gestation (Mizugishi et al.,
via specific transporters SPNS2 and MFSD2B (Hisano et al., 2011; 2005; Tanaka et al., 2006; van Meeteren et al., 2006). Similarly,
Proia and Hla, 2015; Vu et al., 2017; Kobayashi et al., 2018). Ex- compound S1P and LPA receptor KOs also exhibit severe vas-
tracellular chaperone-bound S1P activates five G protein– cular development defects (Kono et al., 2004; Sumida et al.,
coupled receptors (GPCRs) in the endothelial differentiation gene 2010). Similar studies have implicated the critical roles of S1P
subfamily that are widely expressed (Proia and Hla, 2015). On and LPA signaling in neuronal and immune systems (Skoura and
the other hand, LPA, which is synthesized in the extracellular Hla, 2009). A key question that is raised by such findings is
environment by autotaxin-mediated hydrolysis of lysophospha- whether S1P and LPA are redundant in their biological functions.
tidyl choline, activates six GPCRs in the endothelial differentia- Data available so far suggest that while some redundant func-
tion gene and purinergic subfamilies (Aikawa et al., 2015). tions are mediated by both lysophospholipids, some unique
.............................................................................................................................................................................
1Vascular Biology Program, Boston Children’s Hospital, Department of Surgery, Harvard Medical School, Boston, MA; 2Genetics of Development and Disease Branch,
National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD; 3Graduate School of Pharmaceutical Sciences, Tohoku
University, Sendai, Japan; 4Department of Surgery, University of Maryland School of Medicine, Baltimore, MD.
*M. Kono and A. Cartier contributed equally to this paper; Correspondence to Timothy Hla: timothy.hla@childrens.harvard.edu.
© 2019 Hisano et al. This article is distributed under the terms of an Attribution–Noncommercial–Share Alike–No Mirror Sites license for the first six months after the
publication date (see http://www.rupress.org/terms/). After six months it is available under a Creative Commons License (Attribution–Noncommercial–Share Alike 4.0
International license, as described at https://creativecommons.org/licenses/by-nc-sa/4.0/).
Rockefeller University Press https://doi.org/10.1084/jem.20181895 1582

J. Exp. Med. 2019 Vol. 216 No. 7 1582–1598
functions do exist. For example, naive T cell egress from sec- sites via MS2 bacteriophage coat proteins and mutated,
ondary lymphoid organs is largely dependent on S1P signaling nuclease-deficient dCas9. This screening system was validated
via lymphocyte S1PR1 (Cyster and Schwab, 2012), whereas both by the SAM sgRNA targeting SPNS2, an S1P transporter that
S1P and LPA induce fibrotic responses in the lung (Shea and functions upstream of S1P receptors (Kawahara et al., 2009;
Tager, 2012) and regulate cardiac development in zebrafish Hisano et al., 2012, 2013). The designed SPNS2 SAM sgRNA in-
(Nakanaga et al., 2014). Whether S1P and LPA signaling mech- duced an 180-fold increase in its mRNA expression and strongly
anisms regulate each other (i.e., cross-talk mechanisms) is activated the S1PR1-TANGO signal (Fig. S1, A and B).
not known. To carry out unbiased search for S1PR1-signaling modulators,
The S1PR1 receptor signals primarily via the Gi family of the SAM sgRNA library was introduced into the S1PR1-TANGO
heterotrimeric G proteins (Lee et al., 1999). However, its acti- system, in which β-arrestin2 coupling of S1PR1 can be monitored
vity is antagonized by β-arrestin–mediated receptor down- as nuclear expression of Venus fluorescent protein. Venus-
regulation, which involves GRK2-dependent phosphorylation, positive cells (S1PR1/β-arrestin2 signaling positive) were sor-
β-arrestin binding, and dynamin-regulated endocytosis (Oo ted and expanded twice, and genomic DNAs were purified and
et al., 2007, 2011; Arnon et al., 2011; Willinger et al., 2014). In sequenced by Illumina next-generation sequencing (NGS; Fig. 1
addition, direct binding to the membrane-bound C-type lectin A). Bioinformatic analysis indicated that some SAM sgRNA se-
CD69 also induces receptor down-regulation (Shiow et al., 2006; quences are highly enriched in the Venus-positive cells after
Bankovich et al., 2010). Further, extracellular presence of ApoM- sorting (Fig. 1 B), suggesting that target genes of these sgRNAs
containing high density lipoprotein, which chaperones S1P, encode proteins that enable S1PR1 coupling to β-arrestin. The
permits sustained plasma membrane signaling without inducing LPAR1 gene was identified as one of the top hits (Fig. 1 C). Top 10
efficient endocytosis (Swendeman et al., 2017). We hypothesized candidates were examined individually by specific SAM sgRNAs
that novel factors modulate its signaling and residency in the that were enriched after sorting Venus-positive cells. The SAM
plasma membrane to mediate its multiple biological functions. In sgRNA specific for LPAR1 induced its expression and turned on
this report, we searched for novel regulators of S1PR1 coupling to Venus expression, thus confirming the results from the genome-
the β-arrestin pathway. Specifically, we used the TANGO sys- wide sgRNA screen that identified LPAR1 as a modulator of
tem, which uses tobacco etch virus (TEV) protease/β-arrestin S1PR1 coupling to β-arrestin (Fig. S1, C and D).
fusion protein and S1PR1-TEV site tetracycline transcriptional
activator as a readout (Barnea et al., 2008). Coupled with the LPAR1 activation induces β-arrestin recruitment to S1PR1
single guide RNA (sgRNA) library-directed, CRISPR/dCas9-in- To further investigate the mechanisms involved in the regu-
duced endogenous genes (Shalem et al., 2015), we screened for lation of S1PR1 signaling by LPAR1, we used the NanoBiT
novel modulators of S1PR1. Surprisingly, the top hit from this system (Dixon et al., 2016). This system is based on the
unbiased, whole-genome screen was LPAR1. We validated this structural complementation of NanoLuc luciferase and allows
interaction in a luciferase complementation system that quan- one to monitor the protein–protein interactions in real time.
tifies GPCR coupling to β-arrestin. Our results suggest that NanoLuc luciferase is split into a small subunit (SmBiT; 11
LPAR1’s interaction with S1PR1 attenuates S1P signaling in en- amino acids) and a large subunit (LgBiT; 18 kD) that are fused
dothelial cells, modulates lymphatic sinus adherens junctions, with S1PR1 and β-arrestin1 with mutations in AP-2/clathrin-
and provides a permissive niche for lymphocyte trafficking. binding motif (to reduce endocytosis), respectively (Fig. 2 A).
S1P dose-dependently stimulated β-arrestin1 recruitment to
S1PR1 in HEK293A cells transfected with S1PR1-SmBiT and
Results LgBiT-β-arrestin1. However, the S1P ligand–binding mutant,
Unbiased, genome-wide search for S1PR1 modulators S1PR1 (R120A), did not recruit β-arrestin upon treatment with
S1PR1 signaling can be readily monitored by the TANGO system, S1P (Fig. 2 B). LPA treatment did not induce β-arrestin1 re-
which records ligand-activated β-arrestin coupling to the GPCR, cruitment to S1PR1, consistent with the fact that LPA is not a
leading to nuclear fluorescent protein expression in vitro and high-affinity ligand for S1PR1 (Lee et al., 1998a; Liu et al.,
in vivo (Kono et al., 2014). Since the receptor/β-arrestin signal is 1999). However, in cells coexpressing LPAR1 and S1PR1-
cumulative due to the stability of the nuclear fluorescent pro- SmBiT, LPA treatment induced β-arrestin1 recruitment to
tein, we adapted this system to U2OS osteosarcoma cells that are S1PR1 with a 50% effective concentration of ∼10−7 M, a
adaptable to high-throughput screening. Previous work has physiologically relevant concentration of LPA (Fig. 2 C).
shown that direct activators of S1PR1, such as CD69, regulate The effect of LPA was completely blocked by Ki16425, an LPAR1
receptor signaling and function (Shiow et al., 2006; Bankovich antagonist (Ohta et al., 2003), indicating that the β-arrestin1 cou-
et al., 2010). To search for other endogenous modulators of pling of S1PR1 is dependent on LPAR1 activation by the ligand
S1PR1 signaling, we turned to the synergistic activation mediator (Fig. 2 D). W146, an S1PR1 antagonist, inhibited S1P-mediated
(SAM) system that uses CRISPR/dCas9-based, sgRNA-dependent β-arrestin1 recruitment to S1PR1 but failed to inhibit LPA/LPAR1–
transcriptional activation of endogenous genes (Konermann mediated β-arrestin1 coupling of S1PR1 (Fig. 2, D and E), suggesting
et al., 2015). that S1PR1 activation with S1P is not necessary for the LPA/
The SAM system turns on endogenous gene expression by LPAR1–mediated stimulation of S1PR1 coupling to β-arrestin1. Fur-
sgRNA-dependent recruitment of multiple transcriptional acti- thermore, the S1PR1 ligand–binding mutant (R120A) behaved simi-
vators (VP64, p65, and HSF1) upstream of transcription start larly to wild-type S1PR1 by allowing LPAR1-induced β-arrestin1
Hisano et al. Journal of Experimental Medicine 1583

LPA/S1P cross-talk sculpts lymphatic junctions https://doi.org/10.1084/jem.20181895
Figure 1. Unbiased whole genome-wide search for S1PR1 modulators. (A) Schematic of the S1PR1 modulator screening system. Four lentiviral vectors
were transduced into a U2OS cell line to enable gene activation by SAM and monitor S1PR1 activation by the TANGO system. The cells introduced with a SAM
sgRNA library were starved with 0.5% charcoal–treated FBS, and then the Venus-positive population was sorted, and NGS analysis was performed to identify
the enriched SAM sgRNA sequences. (B) Scatterplot showing enrichment of sgRNAs after sorting. Most sgRNAs are equally distributed in the presort sample
(closed gray circles), while after sorting, a small fraction of sgRNAs (2,770 out of 70,290 sgRNAs) were enriched (open blue circles). The y axis shows the
number of NGS reads of sgRNAs. (C) Identification of top candidate genes using the MAGeCK method (Li et al., 2014). The names of top 10 candidate genes are
indicated. TRE, tetracycline-responsive element; NLS, nuclear localization signal.
coupling (Fig. 2 F). Simultaneous administration of both LPA and S1P cells (Fig. 3 B), indicating that heterotrimeric G protein coupling is
induced an additive effect on S1PR1 coupling to β-arrestin (Fig. S2). not required for inter-GPCR β-arrestin coupling.
These experiments confirm that LPAR1 activation induced inter-
GPCR coupling of β-arrestin to S1PR1 independently of acti- The LPAR1 C-terminal domain is necessary for the β-arrestin
vated S1PR1-induced β-arrestin recruitment. coupling of S1PR1
β-Arrestin primarily interacts with the intracellular C-terminal
G proteins are not required for LPA/LPAR1–induced S1PR1/ tail region of GPCRs, even though the third intracellular loop
β-arrestin coupling may also be involved (Ranjan et al., 2017). The LPAR1ΔC mutant,
LPAR1 couples to three families of G protein α subunits (Gαi, which lacks the C-terminal domain, did not recruit β-arrestin1 in
Gα12/13, and Gαq/11), while S1PR1 is a Gαi-coupled receptor response to LPA (Fig. 4 A). In contrast, both LPAR1 and LPAR1ΔC
(Fukushima et al., 1998; Lee et al., 1998b; Windh et al., 1999; Ishii receptors couple to the heterotrimeric Gαi protein in an equiv-
et al., 2000). To examine whether LPAR1-induced inter-GPCR alent manner, which was assessed as dissociation of heteromeric
coupling of β-arrestin1 to S1PR1 requires heterotrimeric G pro- G proteins using LgBiT-GNAI2/SmBiT-GNG (Fig. 4 B). However,
teins, we used HEK293 cells lacking GNAS, GNAL, GNAQ, GNA11, LPAR1ΔC mutant was unable to induce β-arrestin1 recruitment
GNA12, GNA13, GNAI1, GNAI2, GNAI3, GNAO1, GNAZ, GNAT1, and to S1PR1 in response to LPA (Fig. 4 C), suggesting that initial
GNAT2 (fullΔGα) generated with CRISPR/Cas9 system (Fig. S3). β-arrestin1 recruitment to LPAR1 is required for the LPA-
Even in the HEK293 fullΔGα cells, S1P activation of S1PR1 induced mediated inter-GPCR coupling of β-arrestin to S1PR1.
β-arrestin1 coupling to a similar extent as wild-type cells, sug-
gesting that GPCR/β-arrestin1 coupling is G-protein independent Transmembrane helix 4 of S1PR1 is important for the
(Figs. 2 B and 3 A), a finding that was reported previously β-arrestin coupling of S1PR1
(Grundmann et al., 2018). We observed that LPA stimulation of We next examined the hypothesis that direct interactions
LPAR1 induced S1PR1/β-arrestin1 coupling in the HEK293 fullΔGα between S1PR1 and LPAR1 are needed for inter-GPCR

Figure 2. Activated LPAR1 induces S1PR1/β-arrestin coupling. (A) Schematic of NanoBiT system to measure S1PR1 and the β-arrestin1 interaction. SmBiT
and LgBiT were fused to the C-terminus of S1PR1 and the N-terminus of β-arrestin1, respectively. S1PR1 and β-arrestin1 coupling can be detected as lumi-
nescence signal emitted by complementation of SmBiT and LgBiT. (B) S1PR1-SmBiT or S1PR1(R120A)-SmBiT was transfected with LgBiT-β-arrestin1,
and luminescence was measured 15–20 min after S1P stimulation. (C) LPAR1 or empty vector was transfected with S1PR1-SmBiT and LgBiT-β-arrestin1, and
luminescence was measured 15–20 min after LPA stimulation. (D and E) Cells were incubated with 1 µM Ki16425 or W146 for 30 min before stimulation, and
luminescence was measured 15–20 min after LPA (D) or S1P (E) stimulation. (F) LPAR1 or empty vector was transfected with S1PR1(R120A)-SmBiT and LgBiT-
β-arrestin1, and luminescence was measured 15–20 min after LPA stimulation. Experiments were repeated (i.e., three to eight independent experiments), and
results are expressed as mean ± SD. βARR, β-arrestin; RLU, relative light units.
β-arrestin coupling. The transmembrane helix 4 of S1PR1 LPAR1-induced inter-GPCR β-arrestin coupling attenuates
was reported to interact directly with CD69, a trans- S1PR1/Gi signaling
membrane C-type lectin (Bankovich et al., 2010). The In many GPCRs, β-arrestin recruitment is an initial trigger for
S1PR1(TM4) mutant in which transmembrane helix 4 is re- receptor internalization by facilitating the interaction with AP-2
placed with that of S1PR3 decreased the association with and clathrin to recruit GPCRs to the endocytic machinery (Tian
CD69, suggesting that it is the domain involved in inter- et al., 2014). S1PR1 with N-terminal Flag tag was expressed in
molecular association with GPCR modulators. We therefore HEK293A cells, and LPAR1 cell-surface receptor expression was
examined the role of the transmembrane helix 4 of S1PR1 in analyzed by flow cytometry. Surprisingly, Flag-S1PR1 surface
LPAR1-mediated inter-GPCR β-arrestin coupling to S1PR1. expression was not altered by LPA stimulation while S1P stim-
S1PR1(TM4)-SmBiT can be expressed at same level as S1PR1- ulation induced Flag-S1PR1 internalization (Fig. 5 A). Immuno-
SmBiT (Fig. S4 A) and recruits β-arrestin1 after S1P stimu- fluorescence analysis confirmed these conclusions (Fig. S4 B).
lation (Fig. 4 D). However, the LPAR1-mediated β-arrestin1 These results suggest that while LPAR1-induced inter-GPCR
coupling of S1PR1(TM4) was significantly attenuated (Fig. 4 β-arrestin coupling to S1PR1, this event in and of itself is not
E), indicating that the transmembrane helix 4 of S1PR1 is sufficient to induce S1PR1 endocytosis.
important for the LPAR1-mediated β-arrestin1 coupling of Next, we examined whether LPAR1 activation modu-
S1PR1. lates the S1PR1 signal transduction. Coupling of S1PR1 to the

Figure 3. LPAR1-mediated S1PR1/β-arrestin
coupling in G protein–deficient cells. LPAR1
or empty vector was transfected with S1PR1-
SmBiT and LgBiT-β-arrestin1 into HEK293
fullΔGα cells lacking all Gαs. (A and B) Lumi-
nescence was measured 15–20 min after S1P
(A) or LPA (B) stimulation. Experiments were
repeated (i.e., n = 3 independent experiments),
and results are expressed as mean ± SD. βARR,
β-arrestin; RLU, relative light units.
heterotrimeric G protein pathway was assessed using LgBiT- S1PR1 in murine lymph nodes under homeostatic conditions. For
GNAO1/SmBiT-GNG and AUY954, an S1PR1 selective agonist this, we used the S1PR1-GFP signaling mouse, which records
(Pan et al., 2006). AUY954 induced S1PR1-mediated heteromeric cumulative S1PR1 coupling to β-arrestin while allowing high-
G protein dissociation in a dose-dependent manner, which was resolution imaging studies (Kono et al., 2014). Immunofluores-
significantly suppressed by coexpression with LPAR1 (Fig. 5 B). cence and confocal microscopy of brachial lymph node sections
Other LPA receptors (LPAR2 and LPAR5) expressed at similar in adult mice showed strong S1PR1 coupling to β-arrestin in LECs
levels as LPAR1 failed to suppress S1PR1-mediated Gαi protein that make up the cortical, medullary, and subcapsular sinuses
activation (Fig. 5, B and C). These results indicate that LPAR1 (Fig. 7, A and B). As previously reported (Kono et al., 2014), high
specifically induces inter-GPCR β-arrestin coupling to suppress endothelial venules (HEVs) also exhibit S1PR1 coupling to
S1PR1 heterotrimeric Gαi protein signaling output without in- β-arrestin (Fig. S5 A). When mice were treated with the LPAR1
ducing receptor endocytosis. inhibitor AM095 for 5 d, S1PR1 coupling to β-arrestin in sinus-
lining LECs of lymph nodes was suppressed (Fig. 7, B–D). These
Endogenous LPAR1 stimulates S1PR1/β-arrestin coupling data are consistent with quantitative imaging data using S1PR1
in vivo at lymphatic sinuses luciferase signaling mice shown above.
Next, to examine whether endogenously expressed LPAR1 in- High-resolution images of cell–cell junctions in sinus-lining
duces inter-GPCR β-arrestin coupling to S1PR1, we isolated MEF LECs of lymph nodes is shown in Fig. 8 A. The junctional
cells from S1PR1 luciferase signaling mice, in which endogenous structure is complex and contains both continuous and punctate
S1PR1/β-arrestin2 coupling can be monitored via the firefly split vascular endothelial (VE)–cadherin– and PECAM-1–positive
luciferase fragment complementation system (Kono et al., 2017). structures. We compared the junctional architecture of sinus-
As shown in Fig. 6 A, LPA induced S1PR1/β-arrestin2 coupling in lining LECs from lymph nodes (lumbar, popliteal, brachial, and
a dose-dependent manner that was blocked by Ki16425, indi- mesenteric) of vehicle- and AM095-treated mice. Both punc-
cating that the activation of endogenously expressed LPAR1 in- tate and continuous VE-cadherin–positive LEC junctions were
duces inter-GPCR β-arrestin coupling to S1PR1. quantified by image analysis. As shown in Fig. 8 B, the frequency
S1PR1 luciferase signaling mice were used to determine if of punctate junctions was decreased and continuous junctions
LPAR1-induced inter-GPCR β-arrestin coupling to S1PR1 occurs increased in LECs of AM095-treated mice. Similarly junctional
in vivo. As previously observed, significant S1PR1 coupling to architectural change was seen in sinus-lining LECs of brachial
β-arrestin is seen in several organs in normal mice under ho- lymph nodes from Lpar1 KO mice (Fig. S5, B and C). Together,
meostatic conditions (Kono et al., 2017). AM095, an orally these data suggest that signaling of LPAR1 suppresses the for-
available LPAR1 selective antagonist with desirable in vivo mation of continuous junctions and thus enhances the sinus LEC
pharmacokinetic features (Swaney et al., 2011), completely junctional porosity.
blocked LPA/LPAR1–mediated β-arrestin1 coupling of S1PR1
in vitro (Fig. 6 B). Administration of AM095 to S1PR1 luciferase LPAR1 remodels the sinus-lining LEC junctional architecture
signaling mice significantly decreased bioluminescence signals and lymphocyte retention in lymph nodes
(Fig. 6, C–E). Detailed imaging of dissected mice showed that To examine whether LPAR1 modulates S1PR1-dependent barrier
S1PR1 coupling to β-arrestin in lung, spleen, and lymph nodes function in an in vitro model of endothelial cells, LPAR1 was
was significantly attenuated by AM095 treatment (Fig. 6, F–H). expressed in HUVECs using an inducible lentiviral system (Fig.
Since lymphatic endothelial cells (LECs) express both LPAR1 S5 D), and barrier function was quantified by measuring
and S1PR1 (Heng et al., 2008), we further examined the in vivo transendothelial electrical resistance (Stolwijk et al., 2015). As
relevance of LPAR1-induced inter-GPCR β-arrestin coupling to expected, the S1PR1 agonist AUY954 induced a sustained

Figure 4. The C-terminus of LPAR1 and TM4 of S1PR1 is important for LPAR1-induced inter-GPCR β-arrestin coupling. (A) LPAR1-SmBiT or LPAR1ΔC-
SmBiT was transfected with LgBiT-β-arrestin1, and luminescence was measured 15–20 min after LPA stimulation. (B) A G-protein dissociation assay was
performed by transfecting LgBiT-GNAI2, GNB1, and SmBiT-GNGT1 plasmids with LPAR1 or LPAR1ΔC. Luminescence was measured 6–9 min after LPA
stimulation. (C) LPAR1 or LPAR1ΔC was transfected with S1PR1-SmBiT and LgBiT-β-arrestin1, and luminescence was measured 15–20 min after LPA stim-
ulation. (D) S1PR1-SmBiT or S1PR1(TM4)-SmBiT was transfected with LgBiT-β-arrestin1, and luminescence was measured 15–20 min after S1P stimulation. (E)
LPAR1 or empty vector was transfected with S1PR1-SmBiT or S1PR1(TM4)-SmBiT and LgBiT-β-arrestin1, and luminescence was measured 15–20 min after LPA
stimulation. Experiments were repeated (i.e., three to five independent experiments), and the results are expressed as mean ± SD. P values were determined by
two-way ANOVA followed by Sidak’s multiple comparisons test comparing “S1PR1(TM4)-SmBiT + LPAR1” to “S1PR1-SmBiT + LPAR1”; *, P = 0.0018; **, P ≤
0.001. βARR, β-arrestin; RLU, relative light units.
increase in vascular barrier function (Fig. 9 A). LPA itself did not known to be downstream of LPAR1 (Knipe et al., 2015). As an-
influence barrier function in the presence or absence of AUY954 ticipated, S1PR1 activation by AUY954 strongly induced junc-
(Fig. 9 A). However, in HUVECs expressing LPAR1, LPA induced tional VE-cadherin (Fig. 9, E and F). In S1PR1-activated HUVECs,
a small and transient increase in barrier function (Fig. 9 C). In minimal intercellular gaps were observed and VE-cadherin ap-
sharp contrast, LPA inhibited the AUY954-induced vascular peared as continuous, zipper-like structures at cell–cell borders
barrier increase significantly (Fig. 9 C). This was completely (Fig. 9 F). Cortical F-actin was induced, and p-MLC staining was
reversed by Ki16425, an antagonist of LPAR1 (Fig. 9, B and D), attenuated, suggesting an increase in Rac GTPase activity and a
suggesting that LPAR1 induces inter-GPCR β-arrestin coupling to decrease in Rho GTPase activity, respectively (Fig. 9, E and F).
attenuate S1PR1-induced barrier function and thereby enhance LPA treatment strongly induced intercellular gaps that punctu-
the porosity of the endothelial monolayer. ate continuous VE-cadherin staining, strong F-actin staining,
To determine the cellular changes induced by LPAR1 and and stress fibers and a marked increase in p-MLC staining
S1PR1 inter-GPCR β-arrestin coupling, we examined the status of (Fig. 9 G). In the presence of both LPA and AUY954, junctional
VE-cadherin, a major junctional protein. F-actin and phospho- architecture was modulated to contain a hybrid of continuous
myosin light chain (p-MLC) were also examined to determine cell–cell border staining interspersed with punctate VE-cadherin
the role of Rho-coupled actin/myosin architecture, which is localization at the termini of actin stress fibers (Fig. 9 H). p-MLC

Discussion
A major finding of this study is that LPAR1 directly regulates
S1PR1 function. This constitutes a heretofore undescribed cross-
talk mechanism between LPA and S1P, two lysophospholipids
that acquired extracellular functions as vertebrates evolved
(Hla, 2005). As vertebrates acquired closed vascular systems,
immune cells, which are now faced with the challenge of navi-
gating in and out of the circulatory system, used S1P, an abun-
dant circulatory lipid mediator with defined spatial gradients for
lymphocyte trafficking (Cyster and Schwab, 2012). Our present
results suggest that LPA signaling modulates S1PR1 signaling in
specific contexts. The S1PR1 receptor is expressed abundantly in
endothelial cells, and its cell-surface expression is controlled by
multiple processes (Yanagida and Hla, 2017). For example, the
lymphocyte activation–induced molecule CD69 directly interacts
with S1PR1 to induce its ligand-dependent endocytosis, a process
that dictates whether lymphocytes egress (Shiow et al., 2006;
Bankovich et al., 2010). Indeed, tissue residency of various
T cells is controlled by CD69 (Shiow et al., 2006). In endothelial
cells, cell-surface signaling of S1PR1 regulates vascular barrier
function (Lee et al., 1999; Oo et al., 2007). However, S1PR2,
which activates the Rho GTPase, disrupts the endothelial barrier
Figure 5. LPAR1 inhibits S1PR1/G-protein signaling. (A) Flow cytometric
(Sanchez et al., 2007), and its function in collecting LECs is
analysis showing surface Flag-S1PR1 expression after stimulation with 1 µM
S1P (blue line) or LPA (orange line) for 1 h or without simulation (gray) in needed for lymphocyte trafficking from tissues to the lymph
HEK293A cells stably expressing Flag-S1PR1 and LPAR1. (B) S1PR1 and LPAR1, nodes (Xiong et al., 2019). Thus, our finding that LPAR1 modu-
LPAR2, or LPAR5 were transfected with LgBiT-GNAO1, GNB1, and SmBiT- lates S1PR1 directly suggests functional cross-talk between LPA
GNGT1 plasmids. Luminescence was measured 6–9 min after AUY954 stim- and S1P.
ulation. Data are derived from three to seven independent experiments and
Our study also provides a method to discover novel regu-
are expressed as mean ± SD. P values were determined by two-way ANOVA
followed by Sidak’s multiple comparisons test comparing “S1PR1 + LPAR1” to lators of GPCR signaling. By adapting a receptor reporter that
S1PR1 alone; *, P ≤ 0.01; **, P ≤ 0.0001. (C) Flow cytometric analysis of induces Venus expression downstream of GPCR/β-arrestin
HEK293A cells transfected with LPAR1 (orange), LPAR2 (brown line), or coupling with a whole-genome–wide CRISPR/dCas9–dependent
LPAR3 (dark green line) tagged with Flag at the N-terminus or empty vector transcriptional activation system, we identified LPAR1 as a
(gray). RLU, relative light units.
regulator of S1PR1 function. This system could be adapted to
other GPCRs or signaling pathways. Given the modularity and
and F-actin at stress fibers were slightly attenuated (Fig. 9, G and flexibility of the CRISPR/dCas9 system, which can both activate
H). However, intercellular gaps were induced when compared and repress genes (Shalem et al., 2015), we suggest that many
with S1PR1-activated HUVECs (Fig. 9, F and H). Quantification of novel signaling proteins that modulate GPCRs could be identified
VE-cadherin–positive junctions is shown in Fig. 9, I and J. Total using similar screens.
VE-cadherin staining intensity was increased by AUY954 We also describe, in detail, mechanistic insight into interac-
treatment, which was blocked by LPAR1 activation. Continuous tions between S1PR1 and LPAR1. S1PR1 and LPAR1 interaction
junctions (3–25 µm) were stimulated by AUY954, which acti- requires the TM4 domain of S1PR1, which was previously
vates S1PR1. In contrast, LPAR1 activation induced punctate identified to be critical for direct interaction with CD69, an event
junctions while suppressing continuous junctions. Thus, LPAR1 critical for lymphocyte egress (Shiow et al., 2006). Activated
activation, which induces inter-GPCR β-arrestin coupling to LPAR1 recruits β-arrestin, which is then transferred to S1PR1, a
S1PR1, helps form complex cell–cell adherens junction archi- phenomenon that we refer to as inter-GPCR β-arrestin coupling.
tecture and decreased vascular barrier function. Similar cellular Recent structural studies indicate that both the C-terminal tail
mechanisms may occur in lymphatic endothelial sinuses to and the third intracellular loop of GPCRs are involved in direct
regulate junctional porosity. interaction with β-arrestin (Ranjan et al., 2017). Since the
Lymphatic sinus junctional porosity may permit efficient third intracellular loop of S1PR1 interacts directly with Gαi
lymphocyte egress from lymph nodes. We therefore examined family of heterotrimeric G proteins (Lee et al., 1996), inter-
the retention of adoptively transferred lymphocytes when GPCR β-arrestin signaling resulted in attenuation of S1PR1/
LPAR1 is inhibited by AM095. As shown in Fig. 10 A, intrave- Gαi signaling. However, this mechanism, in and of itself, is not
nously injected lymphocytes accumulated more in lymph nodes, sufficient to induce S1PR1 endocytosis. Thus, we suggest that
but not in spleen, when LPAR1 is inhibited. Lymph node sections LPAR1-induced inter-GPCR β-arrestin coupling results in
showed that adoptively transferred lymphocytes accumulated in suppression of signaling by plasma membrane–localized
T cell–rich areas of lymph nodes (Fig. 10 B), suggesting that S1PR1. This may allow rapid reversal of S1PR1 inhibitory ac-
lymph node retention is enhanced when LPAR1 is inhibited. tivity and thus acute regulation of S1PR1 GPCR.

Figure 6. Endogenous LPAR1-induced inter-GPCR β-arrestin coupling in vivo. (A) MEFs isolated from S1PR1 luciferase signaling mice were added with
luciferin and then stimulated with LPA at various concentration in the presence or absence of 1 µM Ki16425. Luminescence was measured 8–12 min after LPA
stimulation. Data were derived from four independent experiments and are expressed as mean ± SD. P values were determined by two-way ANOVA followed
by Sidak’s multiple comparisons test comparing vehicle to Ki16425; *, P = 0.0104; **, P = 0.0021. (B) LPAR1 was transfected with S1PR1-SmBiT and LgBiT-
β-arrestin1. The cells were incubated with 1 µM AM095 for 30 min before stimulation, and luminescence was measured 15–20 min after LPA stimulation.
(C and D) Representative bioluminescence images of mice comparing the effects of vehicle (C) or AM095 (30 mg/kg; D) 2 h after gavage. Red open rectangles
were positioned around cephalic, thoracic, and epigastric regions. (E) The bioluminescence activity was quantified by determining the total flux (photons per
second [p/s]) in each region. n = 9 for each group; expressed as mean ± SD. P value was determined by paired t test. *, P ≤ 0.05; **, P ≤ 0.001. (F–H) Mice were
subjected to imaging before administration (F) and then dissected in order to image internal organs after vehicle (G) or AM095 (30 mg/kg; H) administration.
Arrow points to a lymph node. Lu, lung; Sp, spleen; βARR, β-arrestin; RLU, relative light units.
A key issue we addressed in this study is whether this lymph nodes are the cells in which inter-GPCR β-arrestin
phenomenon occurs in vivo. For this, we turned to the re- coupling between LPAR1 and S1PR1 occurs. Such structures
cently developed real-time S1PR1 luciferase signaling reporter are the sites at which many lymphocytes egress from the
mice, which induce luciferase activity upon S1PR1/β-arrestin lymph node parenchyma into the lumen of the sinuses (Baluk
coupling (Kono et al., 2017). Our data show that a constitutive et al., 2007; Randolph et al., 2017). In addition, lymph from
luciferase signal in several organs of adult S1PR1 luciferase afferent lymphatics that permeate through the lymph node
signaling reporter mice is LPAR1 dependent. In particular, parenchyma flow through these sinus walls to ultimately
cervical and mesenteric lymph nodes showed strong lucifer- drain from the efferent lymphatic vessels. Our data suggest
ase activity that was suppressed by the LPAR1 antagonist that inter-GPCR β-arrestin coupling between LPAR1 and S1PR1
AM095. High-resolution confocal microscopy studies show regulates the specialized properties of lymph node sinus-
that sinus-lining LECs in cortical and medullary sinuses of lining LECs.

Figure 7. S1PR1/β-arrestin coupling in LPAR1 antagonist–treated lymph nodes. (A and B) Brachial lymph node sections from S1PR1-GFP signaling mice
treated with vehicle or AM095 were stained with B220 (red, B cells), CD8a (blue, T cells), and VEGFR3 (white, LECs; A); B220 (blue), CD11c (red, dendritic cells),
and LYVE1 (white, LECs); or CD169 (red, macrophages) and LYVE1 (white; B). LYVE1+ lymphatics were identified as subcapsular sinuses if they were found in
the subcapsular space and contained B cells and dendritic cells. Medullary sinuses contain CD169+ macrophages, and cortical sinuses are macrophage-free.
(C and D) Quantification of the total (C) and Prox1–double-positive (D) GFP signal (S1PR1-β-arrestin coupling) of brachial, inguinal, and mesenteric lymph
nodes of vehicle- or AM095-treated mice. Bars represent 200 µm in A and 20 µm in a, b, and B. Data were derived from eight sections for each group and are
expressed as mean ± SD. P value was determined using an unpaired t test with Welch’s correction comparing vehicle to AM095; **, P ≤ 0.0021; *, P ≤ 0.0332.
A.U., arbitrary unit.
It is noteworthy that S1P-dependent lymphocyte egress oc- barrier function. Our results show that this mechanism alters the
curs at cortical and medullary sinuses (Grigorova et al., 2009). junctional architecture and decreases endothelial barrier func-
S1P that is enriched in lymph that is secreted from LECs via tion. Specifically, junctions were remodeled from continuous
SPNS2-dependent processes (Hisano et al., 2012; Mendoza et al., structures at cell–cell borders to punctate structures at the ter-
2012), together with low S1P in the lymphatic parenchymal mini of actin-rich stress fibers. This results in the formation of
spaces, provides the spatial S1P gradient needed for efficient abundant intercellular gaps, which explains the decreased vas-
lymphocyte egress (Cyster and Schwab, 2012). Cell-surface cular barrier function. Increased LPAR1-induced Rho GTPase
S1PR1 on lymphocytes detects this gradient for a spatial cue pathways and decreased S1PR1-induced Rac GTPase pathways
for the egress process, which involves traverse of the lympho- are likely involved, as determined by the analysis of the down-
cyte through the sinus-lining LECs (Pham et al., 2010). Once the stream targets p-MLC and F-actin at the cell cortex and stress
lymphocytes have entered the lumen of the cortical and med- fibers, respectively (Knipe et al., 2015; Burg et al., 2018). These
ullary sinuses, ensuing lymph flow helps drain them into ef- results suggest that junctional remodeling may be a factor in the
ferent lymphatic vessels (Grigorova et al., 2009), thus ensuring high permeability and lymphocyte egress seen in sinus-lining
efficient lymphocyte trafficking. Our results suggest that LPAR1- LECs of lymph nodes. Previous studies focused on junctions
dependent inter-GPCR β-arrestin coupling keeps LEC S1PR1 in have described the presence of button-like junctions in collecting
an inactive state. It is noteworthy that LPA is generated in the LECs of trachea lymphatics (Baluk et al., 2007), sinus-lining LECs
lymphoid tissue parenchyma (Nakasaki et al., 2008) and regu- of lymph nodes (Pham et al., 2010), and lymphatic capillaries of
lates lymphocyte motility and traffic within the lymph node the small intestinal villi (Zhang et al., 2018). Such junctional
(Zhang et al., 2012; Bai et al., 2013). That LPA and S1P treatment specialization was hypothesized to allow lymph fluid flow.
induces additive effects on β-arrestin coupling to S1PR1 suggests Whether such cell–cell junctions are important for efficient
that these processes are independent and provide graded lymphocyte egress is not known. Our data using LPAR1 inhibitor
responses. (AM095) and the analysis of lymph nodes from Lpar1 KO mice is
We addressed the role of LPAR1-induced inter-GPCR consistent with the notion that LPAR1/S1PR1 cross-talk is im-
β-arrestin coupling in endothelial cell adherens junctions and portant in LEC junctional specialization and provision of a

Figure 8. LPAR1 inhibits the formation of
continuous junctions in LECs. (A) Lymph node
sections (35 µm) from vehicle or 8-h AM095–
treated mice were stained with Prox1 (blue),
VE-cadherin (red), and PECAM-1 (green). Arrows
indicate VE-cadherin–positive adherens junc-
tions. Bars, 10 µm. (B) Quantification of junc-
tional length in the above confocal images.
Confocal images (n = 16) from three to five lymph
nodes from two mice for each group were ana-
lyzed as described, and junctions of various
lengths were quantified. Data are expressed as
mean ± SD. P values were determined using a
two-way ANOVA followed by Sidak’s multiple
comparisons test comparing vehicle to AM095;
**, P ≤ 0.0021; ****, P ≤ 0.0001.
permissive environment for efficient lymphocyte egress. How- monoclonal CD8a (53–6.7), Alexa Fluor 647 rat monoclonal
ever, further studies using blocking antibodies to inhibit lym- CD169 (3D6.112), Alexa Fluor 594 rat monoclonal B220 (RA3-
phocyte entry followed by detailed analysis of lymphocyte egress 6B2), Alexa Fluor 647 Armenian hamster monoclonal CD11c
kinetics in situations in which LEC LPAR1 activity is modified are (N418), rabbit polyclonal anti-Prox1, Brilliant violet 421 rat
needed to unequivocally determine the relevance of this mech- monoclonal CD4 (GK1.5; BioLegend); rabbit polyclonal anti–
anism in lymphocyte trafficking. S1PR1 (H60), mouse monoclonal anti–VE-cadherin (F-8; Santa
In summary, we have described a mechanism by which LPAR1 Cruz Biotechnology); rabbit polyclonal anti–p-MLC2 (Cell Sig-
suppresses cell-surface S1PR1/Gαi signaling by inter-GPCR naling Technology); biotin-conjugated rat monoclonal anti-
β-arrestin coupling. This process regulates the LEC junctional LYVE1 (ALY7), allophycocyanin rat monoclonal CD8a (53–6.7;
architecture and barrier function at sinus-lining endothelial cells eBioscience); goat polyclonal anti-VEGFR3, Goat polyclonal
and may provide an optimal environment for efficient lympho- anti–VE-cadherin (R&D Systems); rat monoclonal anti-PECAM-1
cyte egress. Cross-talk between LPA and S1P receptors regulates (MEC13.3; BD Pharmingen); and rabbit monoclonal anti-ERG
complex functions of circulatory and immune systems. Pharma- (EPR3864; Abcam). The secondary antibody used for Western
cologic modulation of this mechanism may be useful in lymphatic blotting was HRP-conjugated goat anti-rabbit IgG (Jackson Im-
and immune disorders. munoResearch). The secondary antibodies used for immuno-
fluorescence were Alexa Fluor 405 donkey anti-goat IgG
(Abcam), Alexa Fluor 647 donkey anti-mouse and anti-goat IgG
Materials and methods (Invitrogen), Alexa Fluor 488 goat anti-rabbit IgG (Invitrogen),
Reagents DyLight 550 donkey anti-rat IgG (Invitrogen), and DyLight 405
Primary antibodies used in this study include the following: PE donkey anti-rabbit IgG (Jackson ImmunoResearch). Alexa Fluor
rat monoclonal anti-Flag tag (L5), Alexa Fluor 647 mouse mon- 405 streptavidin and Alexa Fluor 546 Phalloidin were from In-
oclonal anti-hemagglutinin (HA; 16B12), Alexa Fluor 647 rat vitrogen. S1P and LPA were from Avanti Polar Lipids. Ki16425

Figure 9. LPA/LPAR1 attenuates S1PR1-mediated barrier function. (A–D) HUVECs were analyzed for barrier function by real-time measurement of
transendothelial electrical resistance (TEER) in the absence (A and B) or presence (C and D) of doxycycline (Dox), which can induce LPAR1 expression by the
Tet-On system. 1 d after seeding, the cells were starved with 0.5% charcoal-treated FBS in the absence (A and C) or presence (B and D) of 1 µM Ki16425. At time
0, 100 nM AUY954 (blue), LPA (orange), AUY954 with LPA (dark green), or vehicle (black) was added. Data are from n = 3 independent experiments and
expressed as mean ± SD. P values were determined by two-way ANOVA followed by Sidak’s multiple comparisons test comparing “AUY954 + LPA” to AUY954
alone; *, P ≤ 0.0001. (E–H) HUVECs expressing LPAR1 were starved with 0.5% charcoal–treated FBS for 2 h and then treated with 100 nM AUY954 and/or LPA
for 30 min. Cells were fixed and stained for VE-cadherin (red) and p-MLC (green). F-actin and nuclei were stained with phalloidin (white) and DAPI (blue),
respectively. Arrowheads indicate intercellular gaps. Bars, 20 µm. (I) Quantification of VE-cadherin–positive area in above confocal images expressed as
mean ± SD. P value was determined by one-way ANOVA followed by Holm–Sidak’s multiple comparisons test; **, P ≤ 0.0021; *, P ≤ 0.0332. (J) Quantification
of junctional length in above confocal images expressed as mean ± SD. P value was determined by two-way ANOVA followed by Tukey’s multiple comparisons
test; ***, P ≤ 0.0002; **, P ≤ 0.0021; *, P < 0.0332. ns, not significant. AUY, AUY954.

(Gibco), respectively. For the S1PR1-TANGO system, mouse
S1pr1 linked to the tetracycline transcriptional activator via a
TEV protease cleavage site and mouse β-arrestin2 linked to TEV
protease were designed to be cloned in a single vector using a
bicistronic internal ribosome entry site as described previously
(Shalem et al., 2015), and the PCR amplicon from this vector was
cloned into pCDH-CMV-MCS-EF1α-Neo lentivector (System Bio-
sciences) with NheI and NotI digestion sites. The nuclear local-
ization signal–Venus (a gift from Karel Svoboda; 15753; Addgene;
Petreanu et al., 2007) with PEST degradation sequence at
C-terminal was cloned into downstream of the tetracycline-
responsive element site on pLVX-TetOn lentivector (Clontech).
600 µg/ml Geneticin (G418; Gibco) and 1 µg/ml Puromycin
(Gibco) were used for selecting the cells transduced with these
constructs.
To produce lentiviral particles, HEK293T cells were seeded
on 10-cm dishes 1 d before transfection. On the following day,
when they had reached 80–90% confluency, medium was re-
placed by fresh 10% FBS/DMEM medium 1 h before transfection.
20 µg lentiviral plasmid, 12.6 µg pMDL/pRRE, 9.6 µg pVSV-G,
and 6 µg pRSV-REV were diluted with water and mixed with
85.25 µl of 2 M CaCl2 solution, and then 688 µl of 2 × HBS so-
lution (274 mM NaCl, 1.5 mM Na2HPO4-7H2O, and 55 mM Hepes,
pH 7.0) was slowly added into the plasmid solution while vor-
texing. After incubation at room temperature for 20 min, the
Figure 10. LPAR1 regulates transferred lymphocyte trafficking at lymph solution mixture was added drop-wise directly to cells. Medium
nodes. (A) CFSE-labeled lymphocytes were injected into mice treated with was replaced by 10% FBS/McCoy’s 5A medium 12–16 h after
vehicle or AM095 (30 mg/kg, gavage), and then the number of CD4- and
CFSE-positive cells in lymph nodes and spleen was counted. n = 6 for each
transfection. Lentiviral particle–containing supernatant was
group; expressed as mean ± SD. P values were determined using an unpaired harvested 2 d after the medium change and filtered with a 0.45-
Student’s t test; *, P ≤ 0.0048. (B) 35-µm lymph node sections from vehicle- µm syringe filter (Corning). PEG-it Virus Precipitation Solution
or AM095-treated mice were stained with VEGFR3 (white, LECs), B220 (red, (System Biosciences) was used when concentration was needed.
B cells), CD8a (blue, T cells), and CFSE-CD4 (green, T cells). Bars, 100 µm. ns, U2OS cells were seeded 1 d before infection. On the following
not significant.
day, when they had reached 20–30% confluency, medium was
replaced by 10% FBS/McCoy’s 5A medium containing lentiviral
and AM095 were from Sigma. W146 was from Cayman. AUY954 particles. Medium was renewed 1 d after infection, and anti-
was from Cellagen Technology. CSFE was purchased from Mo- biotics were added the following day. The single clones were
lecular Probes. isolated from antibiotic-resistant cells by limiting dilution and
then introduced with the SAM sgRNA library (a gift from Feng
Cell culture Zhang; 1000000057; Addgene) at a low multiplicity of infection.
HEK293A, HEK293T, and MEF cells were cultured in DMEM
with L-glutamine, high glucose, and sodium pyruvate medium Library screening and sgRNA sequence analysis
(Corning) supplemented with 10% FBS and penicillin– The U2OS cells transduced with the SAM sgRNA library were
streptomycin (Corning) in a 37°C incubator with 5% CO2. U2OS cultured in 400 µg/ml Zeocin (Gibco) to select cells harboring
cells were cultured in McCoy’s 5A medium (Corning) supple- SAM sgRNAs. Zeocin-resistant cells were allowed to grow
mented with 10% FBS and 1% penicillin–streptomycin in a 37°C (presort cells) or starved with 0.5% charcoal-treated FBS for 2 d.
incubator with 5% CO2. HUVECs were cultured in EGM-2 me- Then, starved cells were harvested, and Venus-positive cells
dium (Lonza) supplemented with 10% FBS or M199 medium were sorted by FACS (post-sort cells) as shown in Fig. 1 A. The
(Corning) supplemented with 10% FBS, penicillin–streptomycin, sorted cells were seeded and expanded to repeat sorting. After a
endothelial cell growth factor from sheep brain extract, and 5 second expansion, genomic DNAs were harvested from 10 × 107
U/ml heparin on human fibronectin–coated dishes in a 37°C pre- and post-sort cells using Quick-gDNA MidiPrep (Zymo
incubator with 5% CO2. Research) according to the manufacturer’s protocol. Amplifica-
tion and purification of genomic DNAs for NGS analysis was
Generation of the U2OS cell line for library screening performed as described previously (Joung et al., 2017). After
The U2OS cells transduced with dCas9-VP64 (a gift from Feng quality control with Agilent 2200 TapeStation, libraries were
Zhang; 61425; Addgene) and MS2-P65-HSF (a gift from Feng subjected to single-end sequencing on an Illumina NextSeq to
Zhang; 61426; Addgene; Konermann et al., 2015) were selected generate ≥50 million reads for both pre- and post-sort cells.
with 6 µg/ml Blasticidin (Gibco) and 200 µg/ml Hygromycin Reads were assigned to target genes using the previously

described Python script “count_spacers.py” with default pa- stimulation with LPA, luminescence was measured and nor-
rameters (Joung et al., 2017). The resultant count table was used malized with initial reads. Bioluminescence in live mice and
as input for the script “mageck” to generate significance scores internal organs was measured as described previously (Kono
for each target gene (Li et al., 2014). et al., 2017).
RNA isolation and quantitative real-time PCR Generation of Gα-depleted HEK293 cells using the CRISPR/
Total RNA was isolated using TRI reagent (Zymo Research) and Cas9 system
further purified with the Direct-zol RNA MicroPrep kit (Zymo Gα-depleted HEK293 cells were generated by mutating genes
Research), treated with DNase (30 U/µg total RNA, QIAGEN), encoding members of the Gαi family from previously established
and reverse transcribed using qScript XLT cDNA SuperMix HEK293 cells devoid of three Gα families (Gαs, Gαq, and Gα12;
(Quanta Bioscience). Expression of mRNA was quantitated using Grundmann et al., 2018) using the CRISPR/Cas9 system as de-
PerfeCTa SYBR Green FastMix Reaction Mixes (Quanta Biosci- scribed previously (Ran et al., 2013; O’Hayre et al., 2017), with
ence) and the StepOnePlus Real-Time PCR System (Applied Bio- minor modifications. sgRNA constructs targeting the GNAI1,
systems) with cDNA equivalent to 7.5 ng total RNA. GNAI2, GNAI3, GNAO1, GNAT1, GNAT2, and GNAZ genes, whose
Primers used for real-time PCR include the following (59–39): mRNA was expressed in HEK293 cells (Atwood et al., 2011), were
HPRT-Fw, TGACACTGGCAAAACAATGCA; HPRT-Rv, GGTCCT designed using a CRISPR design tool (http://crispr.mit.edu) so
TTTCACCAGCAAGCT; SPNS2-Fw, AACGTGCTCAACTACCTG that a SpCas9-mediated DNA cleavage site (3 bp upstream of the
GAC; SPNS2-Rv, ATGAACACTGACTGCAGCAG; LPAR1-Fw, ACT protospacer adjacent motif [PAM] sequence [NGG]) encom-
GTGGTCATTGTGCTTGG; LPAR1-Rv, ACAGCACACGTCTAGAAG passes a restriction enzyme–recognizing site. Designed sgRNA-
TAAC; FAM156A-Fw, TATGCTGTTGGGAGGGAAGC; and targeting sequences including the SpCas9 PAM sequences were
FAM156A-Rv, GCAGTATCGACATTCACATCGG. as follows: 59-CTTTGGTGACTCAGCCCGGGCGG-39 (GNAI1;
where the restriction enzyme site [Sma I in this case] is un-
NanoBiT assay derlined and the PAM sequence is in bold), 59-CGTAAAGACCAC
HEK293A cells were seeded at a density of 8 × 108 cells per 6- GGGGATCGTGG-39 (GNAI2; Mbo I), 59-AGCTTGCTT
cm dish 1 d before transfection. The following day, expression CAGCAGATCCAGGG-39 (GNAI3; Mbo I), 59-AATCGCCTTGCT
vectors and polyethylenimine (PEI; pH 7.0; Polysciences, Inc.) CCGCTCGAGGG-39 (GNAO1; Xho I), 59-TTTCAGGTGCCGGTGAG
were diluted in 200 µl Opti-MEM (Gibco). 300 ng LgBiT- TCCGGG-39 (GNAT1; Hinf I), 59-AACCATGCCTCCTGAG
β-arrestin1(EE) and 600 ng GPCR-SmBiT expression vectors CTCGTGG-39 (GNAT2; Sac I), and 59-GATGCGGGTCAGCGAG
were used for the β-arrestin recruitment assay, and 200 ng TCGATGG-39 (GNAZ; Hinf I). The designed sgRNA-targeting
LgBiT-GNA, 1,000 ng GNB1, 1,000 ng SmBiT-GNGT1, and sequences were inserted into the BbsI site of the pSpCas9(BB)-
400 ng GPCR expression vectors were used for the G-protein 2A-GFP (PX458) vector (a gift from Feng Zhang; 42230; Addg-
dissociation assay. 10 µl of 1 mg/ml PEI was incubated in Opti- ene) using the following set of synthesized oligonucleotides: 59-
MEM for 5 min at room temperature, and then diluted vectors CACCGCTTTGGTGACTCAGCCCGGG-39 and 59-AAACCCCGG
and PEI were combined and mixed by vortexing and incubated GCTGAGTCACCAAAGC-39 (GNAI1; note that a guanine nucleo-
for 20 min at room temperature. After incubation, the solu- tide [G] was introduced at the −21 position of the sgRNA (un-
tion mixture was added drop-wise directly to cells. The fol- derlined), which enhances transcription of the sgRNA); 59-CAC
lowing day, transfected cells were detached with 0.5 mM CGCGTAAAGACCACGGGGATCG-39 and 59-AAACCGATCCCC
EDTA/PBS. After centrifugation at 190 g for 5 min, cells were GTGGTCTTTACGC-39 (GNAI2); 59-CACCGAGCTTGCTTCAGCAG
suspended in 4 ml of 0.01% fatty acid–free BSA (Sigma)/HBSS ATCCA-39 and 59-AAACTGGATCTGCTGAAGCAAGCTC-39 (GNAI3);
(Corning) supplemented with 5 mM Hepes (Corning) and 59-CACCGAATCGCCTTGCTCCGCTCGA-39 and 59-AAACTCGAG
seeded on a white 96-well plate at 80 µl/well. 20 µl of 50 µM CGGAGCAAGGCGATTC-39 (GNAO1); 59-CACCGTTTCAGGTGCCG
coelenterazine (Cayman) was added and incubated for 2 h at GTGAGTCC-39 and 59-AAACGGACTCACCGGCACCTGAAAC-39
room temperature in the dark. Initial luminescence was (GNAT1); 59-CACCGAACCATGCCTCCTGAGCTCG-39 and 59-AAA
measured as baseline using SpectraMax L (Molecular De- CCGAGCTCAGGAGGCATGGTTC-39 (GNAT2); 59-CACCGATGCGG
vices), and then cells were stimulated with ligands and incu- GTCAGCGAGTCGA-39 and 59-AAACTCGACTCGCTGACCCGCATC-
bated at room temperature. Luminescence after stimulation 39 (GNAZ). Correctly inserted sgRNA-encoding sequences were
was measured and normalized with initial reads. Develop- verified with a Sanger sequencing (Fasmac) using the primer 59-
ment and validation of the NanoBiT G-protein dissociation ACTATCATATGCTTACCGTAAC-39.
assay is described elsewhere (Inoue et al., 2019). To achieve successful selection of all-allele mutant clone, we
performed an iterative CRISPR/Cas9–mediated mutagenesis.
Split firefly luciferase complementation assay in MEFs Specifically, in the first round, mutations were introduced in the
MEFs isolated from S1PR1 luciferase signaling mice (Kono et al., GNAZ gene. In the second round, the GNAI2, GNAI3, and GNAO1
2017) were seed on a white 96-well plate. The following day, genes were simultaneously mutated. In the last round, the
medium was replaced by 80 µl of 0.01% fatty acid–free BSA/ GNAI1, GNAT1, and GNAT2 genes were targeted. Briefly, HEK293
HBSS supplemented with 5 mM Hepes and incubated for 2 h at cells devoid of three Gα families (Grundmann et al., 2018) were
room temperature. 20 µl of 40 mg/ml Luciferin (Perkin Elmer) seeded into a 6-well culture plate and incubated for 1 d before
was added, and initial luminescence was measured. After transfection. A plasmid encoding sgRNA and SpCas9-2A-GFP

was transfected into the cells using Lipofectamine 2000 (Thermo nodes from Lpar1+/− and Lpar1−/− (Contos et al., 2000) were
Fisher Scientific) according to the manufacturer’s protocol. 3 d harvested and sectioned for confocal microscopy imaging
later, cells were harvested and processed for isolation of GFP- studies.
positive cells (∼6% of cells) using a fluorescence-activated cell
sorter (SH800; Sony). After expansion of clonal cell colonies Immunofluorescence staining
with a limiting dilution method, clones were analyzed for mu- HUVECs were washed with cold PBS and fixed with 2% para-
tations in the targeted genes by restriction enzyme digestion as formaldehyde (PFA) for 10 min at room temperature. U2OS cell
described previously (O’Hayre et al., 2017; Grundmann et al., were washed with cold PBS and fixed with cold methanol for
2018). PCR primers that amplify the sgRNA-targeting sites 10 min on ice. Lymph nodes were fixed in 4% PFA in PBS at 4°C,
were as follows: 59-AGCTGGTTATTCAGAAGAGGAGTG-39 and washed in PBS and embedded in optimal cutting temperature
59-TGGTCCTGATAGTTGACAAGCC-39 (GNAI1); 59-AAATGGCAT (OCT) compound (Tissue-Tek, Thermo Fisher Scientific) for
GGGAGGGAAGG-39 and 59-TAAAACCTCAGTGGGGCTGG-39 (GNAI2); frozen section. Cryosections (35 µm) were permeabilized with
59-AGCTGGCAGTGCTGAAGAAG-39 and 59-TCATACAAATGA PBS-0.1% Triton at room temperature for 30 min and then
CCAAGGGCTC-39 (GNAI3); 59-GGTCCTTACCGAGCAGGAG-39 and blocked with PBS containing 75 mM NaCl, 18 mM Na3 citrate, 2%
59-CGACATTTTTGTTTCCAGCCC-39 (GNAO1); 59-TAGGTGTGG FBS, 1% BSA, and 0.05% Triton X-100. Incubation with primary
CTACGGGGTC-39 and 59-GCACTCTTCCAGCGAGTACC-39 (GNAT1); antibodies was performed overnight at 4°C, followed by three
59-ACTGCTTCCATCTTAGGTCTTCG-39 and 59-CATCAACCCACC washes with PBS and incubation with secondary antibodies for
CTCTCACC-39 (GNAT2); 59-CGAAATCAAGCTGCTCCTGC-39 and 3 h at room temperature. LEC images were obtained with cos-
59-TGTCCTCCAGGTGGTACTCG-39 (GNAZ). Candidate clones that taining of rat anti-CD31 antibody (BD Pharmigen), goat anti-VE-
harbored restriction enzyme–resistant PCR fragments were cadherin, and rabbit anti-Prox1. Confocal images were taken
further assessed for their genomic DNA alterations by direct using a Zeiss LSM 800 with Airyscan confocal microscope. The
sequencing or TA cloning as described previously (O’Hayre et al., three- dimensional reconstructions of z-stack (xy projection)
2017; Grundmann et al., 2018). images are shown. Image processing and quantification was
performed by using Adobe Photoshop, ImageJ, or Fiji software
Measurement of endothelial barrier function in vitro (National Institutes of Health). GFP, CD31, VE-cadherin, and
Endothelial barrier function was evaluated by measuring the Prox1-positive immunofluorescent signals were subjected to
resistance of a cell-covered electrode using an endothelial cell threshold processing, and areas occupied by their signal were
impedance system Zθ device (Applied BioPhysics) in accordance quantified using Fiji software as described previously (Yanagida
with the manufacturer’s instructions. Briefly, arrays were et al., 2017). The junction lengths were measured using Fiji
cleaned with 10 mM L-cysteine, washed with sterile water, software. Total lymph nodes from CFSE-CD4–injected mice were
coated with fibronectin for 30 min at 37°C, and incubated with frozen in OCT, sectioned (35 µm), and stained with B220, CD8,
complete cell culture medium to run electrical stabilization. and VEGRF3 antibodies.
HUVECs were seeded on a 96-well electrode array (96W10idf) at
a density of 2.5 × 104 cell per well in the presence or absence of Immunoblot analysis
1 µg/ml doxycycline. The following day, confluent cells were Cells were washed with cold PBS and lysed in modified RIPA
starved for 2–3 h in EBM-2 (Lonza) supplemented with 0.5% buffer (50 mM Tris, pH 7.4, 100 mM sodium chloride, 2 mM
charcoal–treated FBS and then stimulated with AUY954 and/or EDTA, 1% Triton X-100, 0.5% Fos-Choline, and 10 mM sodium
LPA. Resistance was monitored and expressed as fractional re- azide) containing phosphatase inhibitors (1 mM sodium ortho-
sistance, normalizing to the baseline at time 0. vanadate, 1 mM sodium fluoride, and 5 mM β-glycerophosphate)
and protease inhibitor cocktail (Sigma). After incubation on ice
Imaging studies in mice for 30 min and a freeze/thaw cycle, protein concentrations in
All animal procedures were approved by the Animal Care and supernatant from centrifugation at 10,000 g (15 min at 4°C)
Use Committees of the National Institute of Diabetes and Di- were determined by bicinchoninic acid assay (Pierce) and de-
gestive and Kidney Diseases, Boston Children’s Hospital, and natured for 30 min at room temperature in Laemmli’s sample
University of Maryland School of Medicine and performed in buffer supplemented with 10% β-mercaptoethanol. An equal
accordance with National Institutes of Health guidelines. S1PR1- amount of protein was loaded and separated on an SDS-
GFP and S1PR1-luciferase signaling mice have been previously polyacrylamide gel and transferred electrophoretically to a
described (Kono et al., 2014, 2017). Bioluminescence images polyvinylidene difluoride membrane (Millipore). Transferred
were acquired 2 h after injection with vehicle (10 µM Na2CO3 proteins were then probed with rabbit polyclonal anti-S1PR1
and 20% 2-hydroxypropyl-β-cyclodextrin) by gavage. 3 h after (Santa Cruz Biotechnology) and HRP-conjugated goat anti-
the first imaging for vehicle, the AM095 (30 mg/kg) was ad- rabbit IgG (Jackson ImmunoResearch).
ministrated to the mice through gavage, and bioluminescence
images were acquired 2 h later. S1PR1-GFP signaling mice were Flow cytometry analysis
treated with vehicle or AM095 (20 mg/kg twice a day) for 5 d by U2OS cells, HEK293A cells, and HUVECs were detached with
gavage, and lymph nodes were collected. C57BL/6J mice were 0.05% Trypsin (Corning), 0.5 mM EDTA, and Accutase (In-
treated with AM095 (30 mg/kg twice by gavage, every 4 h), and novatice Cell Technologies), respectively. The harvested cells
lymph nodes were collected 8 h after the first treatment. Lymph were fixed with 1% PFA for 10 min on ice and labeled with PE

anti-Flag and Alexa Fluor 647 anti-HA antibodies for detecting 17K08264 (A. Inoue), and Japan Agency for Medical Research and
cell–surface expression. The samples were analyzed using a BD Development grants PRIME JP17gm5910013 (A. Inoue) and LEAP
Calibur FACS system, and FlowJo software was used for data JP17gm0010004 (A. Inoue and J. Aoki). Y. Hisano and K. Yanagida
analysis. were supported in part by postdoctoral fellowships from the Japan
Society for the Promotion of Science Overseas Research Fellowships.
In vivo T cell migration assay Y. Hisano was also supported by the Uehara Memorial Foundation.
Mouse (C57BL/6; The Jackson Laboratory) CD4 T cells from T. Hla received research funding from the ONO Pharma-
spleen and lymph nodes were prepared (CD4 enrichment kit; ceutical Corporation; consulted for Steptoe and Johnson, LLP,
STEMCELL Technologies) and CFSE labeled (Molecular Probes). and Bridge Medicine Inc.; and is an inventor of ApoM+HDL, S1P
Recipient mice were given vehicle or 30 mg/kg AM095 by ga- chaperones, and S1P receptor antagonists. The remaining au-
vage. 2 h later, 106 labeled CD4 T cells were adoptively trans- thors declare no competing financial interests.
ferred i.v. 16 h later, spleen or lymph nodes were collected and Author contributions: Y. Hisano contributed to conception of
stained with anti-CD4-BV421 (clone GK1.5; BioLegend) and the screen, conducting the screen, validation studies in vitro,
anti–CD8-APC (clone 53–6.7; eBioscience). The samples were lymph node experiments, writing the manuscript, analysis of
analyzed with FACSAria flow cytometer (BD Biosciences). Data data, and figure preparations. M. Kono and R.L. Proia contrib-
were analyzed with FlowJo software v 8.8.7 (Tree Star). Values uted to studies of luciferase signaling mice. A. Cartier contrib-
are expressed as the percentage of CSFE+ CD4+ cells out of total uted to studies of GFP signaling mice and junction analysis,
CD4+ cells. quantitation in vitro and in vivo, figure preparation, and con-
Spleen and lymph nodes were collected from above recip- focal microscopy. E. Engelbrecht contributed to analysis of NGS
ient mice and immediately submerged in OCT compound data for guide RNAs and targets. K. Kano and J. Aoki contributed
(Sakura Finetek). Tissues in OCT were quickly frozen using to Lpar1 KO mice studies. K. Kawakami and S. Galvani contrib-
dry ice and then kept at −80°C for long-term storage. Sections uted to NanoBiT assays. Y. Xiong, W. Piao, and J.S. Bromberg
of the lymph nodes were stained as above and imaged by contributed to T cell adoptive transfer experiments. K. Yanagida
confocal microscopy. and A. Kuo contributed to analysis of GFP signaling mice. Y. Ono,
S. Ishida, and A. Inoue contributed to the analysis and setup of
Statistical analysis NanoBiT signaling assays. T. Hla contributed to conception of
Data are expressed as means ± SD. Statistical analysis was per- the screen, overall direction of the project, analysis of data, and
formed as mentioned using Prism software (GraphPad). P values writing/editing of the manuscript.
<0.05 were considered statistically significant.
Submitted: 4 October 2018
Online supplemental material Revised: 29 March 2019
Fig. S1 shows how SPNS2 and LPAR1 SAM sgRNAs activate target Accepted: 6 May 2019
genes and Venus expression. Fig. S2 shows how LPAR1 stimula-
tion with LPA causes an additive effect in S1P-stimulated S1PR1-
SmBiT/β-arrestin coupling. Fig. S3 shows DNA sequences of the References
Gα genomic loci in mutant HEK293 cells. Fig. S4 shows S1PR1 Aikawa, S., T. Hashimoto, K. Kano, and J. Aoki. 2015. Lysophosphatidic acid as
protein expression and localization. Fig. S5 shows how LPAR1- a lipid mediator with multiple biological actions. J. Biochem. 157:81–89.
https://doi.org/10.1093/jb/mvu077
mediated S1PR1/β-arrestin coupling regulates LEC junctions. Arnon, T.I., Y. Xu, C. Lo, T. Pham, J. An, S. Coughlin, G.W. Dorn, and J.G.
Cyster. 2011. GRK2-dependent S1PR1 desensitization is required for
lymphocytes to overcome their attraction to blood. Science. 333:
1898–1903. https://doi.org/10.1126/science.1208248
Acknowledgments Atwood, B.K., J. Lopez, J. Wager-Miller, K. Mackie, and A. Straiker. 2011.
The authors thank Drs. Hiroko Kishikawa, Yuji Shinjo, and Expression of G protein-coupled receptors and related proteins in
Kumiko Makide for technical assistance with FACS. The SAM HEK293, AtT20, BV2, and N18 cell lines as revealed by microarray
analysis. BMC Genomics. 12:14. https://doi.org/10.1186/1471-2164-12-14
sgRNA library, dCas9-VP64, MS2-P65-HSF, and pSpCas9(BB)- Bai, Z., L. Cai, E. Umemoto, A. Takeda, K. Tohya, Y. Komai, P.T. Veeraveedu,
2A-GFP (PX458) plasmids were provided by Professor Feng E. Hata, Y. Sugiura, A. Kubo, et al. 2013. Constitutive lymphocyte
Zhang (Broad Institute of Harvard and MIT, Cambridge, MA). transmigration across the basal lamina of high endothelial venules is
regulated by the autotaxin/lysophosphatidic acid axis. J. Immunol. 190:
The pCAGGS-ChR2-Venus plasmid was provided by Karel 2036–2048. https://doi.org/10.4049/jimmunol.1202025
Svoboda (Howard Hughes Medical Institute, Maryland, MA, and Baluk, P., J. Fuxe, H. Hashizume, T. Romano, E. Lashnits, S. Butz, D. Vest-
Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). weber, M. Corada, C. Molendini, E. Dejana, and D.M. McDonald. 2007.
Functionally specialized junctions between endothelial cells of lym-
This work was supported by National Institutes of Health phatic vessels. J. Exp. Med. 204:2349–2362. https://doi.org/10.1084/jem
grants R35 HL135821 (T. Hla), RO1AI062765, and 1RO1AI14496 (J.S. .20062596
Bromberg), a Fondation Leducq transatlantic network grant Bankovich, A.J., L.R. Shiow, and J.G. Cyster. 2010. CD69 suppresses sphin-
gosine 1-phosophate receptor-1 (S1P1) function through interaction
(SphingoNet; T. Hla and R.L. Proia), the National Institute of Di- with membrane helix 4. J. Biol. Chem. 285:22328–22337. https://doi.org/
abetes and Digestive and Kidney Diseases, National Institutes of 10.1074/jbc.M110.123299
Health intramural program (M. Kono and R.L. Proia), American Barnea, G., W. Strapps, G. Herrada, Y. Berman, J. Ong, B. Kloss, R. Axel, and
K.J. Lee. 2008. The genetic design of signaling cascades to record re-
Heart Association postdoctoral fellowships (A. Cartier and A. Kuo), ceptor activation. Proc. Natl. Acad. Sci. USA. 105:64–69. https://doi.org/
Japan Society for the Promotion of Science KAKENHI grant 10.1073/pnas.0710487105

Blaho, V.A., and T. Hla. 2011. Regulation of mammalian physiology, devel- Knipe, R.S., A.M. Tager, and J.K. Liao. 2015. The Rho kinases: critical medi-
opment, and disease by the sphingosine 1-phosphate and lysophos- ators of multiple profibrotic processes and rational targets for new
phatidic acid receptors. Chem. Rev. 111:6299–6320. https://doi.org/10 therapies for pulmonary fibrosis. Pharmacol. Rev. 67:103–117. https://doi
.1021/cr200273u .org/10.1124/pr.114.009381
Burg, N., S. Swendeman, S. Worgall, T. Hla, and J.E. Salmon. 2018. Sphin- Kobayashi, N., S. Kawasaki-Nishi, M. Otsuka, Y. Hisano, A. Yamaguchi, and
gosine 1-Phosphate Receptor 1 Signaling Maintains Endothelial Cell T. Nishi. 2018. MFSD2B is a sphingosine 1-phosphate transporter in
Barrier Function and Protects Against Immune Complex-Induced Vas- erythroid cells. Sci. Rep. 8:4969. https://doi.org/10.1038/s41598-018
cular Injury. Arthritis Rheumatol. 70:1879–1889. https://doi.org/10.1002/ -23300-x
art.40558 Konermann, S., M.D. Brigham, A.E. Trevino, J. Joung, O.O. Abudayyeh, C.
Chun, J., T. Hla, K.R. Lynch, S. Spiegel, and W.H. Moolenaar. 2010. Inter- Barcena, P.D. Hsu, N. Habib, J.S. Gootenberg, H. Nishimasu, et al. 2015.
national Union of Basic and Clinical Pharmacology. LXXVIII. Lyso- Genome-scale transcriptional activation by an engineered CRISPR-Cas9
phospholipid receptor nomenclature. Pharmacol. Rev. 62:579–587. complex. Nature. 517:583–588. https://doi.org/10.1038/nature14136
https://doi.org/10.1124/pr.110.003111 Kono, M., Y. Mi, Y. Liu, T. Sasaki, M.L. Allende, Y.P. Wu, T. Yamashita, and
Contos, J.J.A., N. Fukushima, J.A. Weiner, D. Kaushal, and J. Chun. 2000. R.L. Proia. 2004. The sphingosine-1-phosphate receptors S1P1, S1P2, and
Requirement for the lpA1 lysophosphatidic acid receptor gene in normal S1P3 function coordinately during embryonic angiogenesis. J. Biol.
suckling behavior. Proc. Natl. Acad. Sci. USA. 97:13384–13389. https://doi Chem. 279:29367–29373. https://doi.org/10.1074/jbc.M403937200
.org/10.1073/pnas.97.24.13384 Kono, M., A.E. Tucker, J. Tran, J.B. Bergner, E.M. Turner, and R.L. Proia. 2014.
Cyster, J.G., and S.R. Schwab. 2012. Sphingosine-1-phosphate and lymphocyte Sphingosine-1-phosphate receptor 1 reporter mice reveal receptor ac-
egress from lymphoid organs. Annu. Rev. Immunol. 30:69–94. https://doi tivation sites in vivo. J. Clin. Invest. 124:2076–2086. https://doi.org/10
.org/10.1146/annurev-immunol-020711-075011 .1172/JCI71194
Dixon, A.S., M.K. Schwinn, M.P. Hall, K. Zimmerman, P. Otto, T.H. Lubben, Kono, M., E.G. Conlon, S.Y. Lux, K. Yanagida, T. Hla, and R.L. Proia. 2017.
B.L. Butler, B.F. Binkowski, T. Machleidt, T.A. Kirkland, et al. 2016. Bioluminescence imaging of G protein-coupled receptor activation in
NanoLuc Complementation Reporter Optimized for Accurate Mea- living mice. Nat. Commun. 8:1163. https://doi.org/10.1038/s41467-017
surement of Protein Interactions in Cells. ACS Chem. Biol. 11:400–408. -01340-7
https://doi.org/10.1021/acschembio.5b00753 Lee, M.J., M. Evans, and T. Hla. 1996. The inducible G protein-coupled receptor
Fukushima, N., Y. Kimura, and J. Chun. 1998. A single receptor encoded by edg-1 signals via the G(i)/mitogen-activated protein kinase pathway.
vzg-1/lpA1/edg-2 couples to G proteins and mediates multiple cellular J. Biol. Chem. 271:11272–11279. https://doi.org/10.1074/jbc.271.19.11272
responses to lysophosphatidic acid. Proc. Natl. Acad. Sci. USA. 95: Lee, M.-J., S. Thangada, C.H. Liu, B.D. Thompson, and T. Hla. 1998a. Lyso-
6151–6156. https://doi.org/10.1073/pnas.95.11.6151 phosphatidic acid stimulates the G-protein-coupled receptor EDG-1 as a
Grigorova, I.L., S.R. Schwab, T.G. Phan, T.H. Pham, T. Okada, and J.G. Cyster. low affinity agonist. J. Biol. Chem. 273:22105–22112. https://doi.org/10
2009. Cortical sinus probing, S1P1-dependent entry and flow-based .1074/jbc.273.34.22105
capture of egressing T cells. Nat. Immunol. 10:58–65. https://doi.org/ Lee, M.-J., J.R. Van Brocklyn, S. Thangada, C.H. Liu, A.R. Hand, R. Menzeleev,
10.1038/ni.1682 S. Spiegel, and T. Hla. 1998b. Sphingosine-1-phosphate as a ligand for
Grundmann, M., N. Merten, D. Malfacini, A. Inoue, P. Preis, K. Simon, N. the G protein-coupled receptor EDG-1. Science. 279:1552–1555. https://
Rüttiger, N. Ziegler, T. Benkel, N.K. Schmitt, et al. 2018. Lack of beta- doi.org/10.1126/science.279.5356.1552
arrestin signaling in the absence of active G proteins. Nat. Commun. 9: Lee, M.-J., S. Thangada, K.P. Claffey, N. Ancellin, C.H. Liu, M. Kluk, M. Volpi,
341. https://doi.org/10.1038/s41467-017-02661-3 R.I. Sha’afi, and T. Hla. 1999. Vascular endothelial cell adherens junction
Hall, A. 2012. Rho family GTPases. Biochem. Soc. Trans. 40:1378–1382. https:// assembly and morphogenesis induced by sphingosine-1-phosphate. Cell.
doi.org/10.1042/BST20120103 99:301–312. https://doi.org/10.1016/S0092-8674(00)81661-X
Heng, T.S.P., and M.W. Painter. Immunological Genome Project Consortium. Li, W., H. Xu, T. Xiao, L. Cong, M.I. Love, F. Zhang, R.A. Irizarry, J.S. Liu, M.
2008. The Immunological Genome Project: networks of gene expres- Brown, and X.S. Liu. 2014. MAGeCK enables robust identification of
sion in immune cells. Nat. Immunol. 9:1091–1094. https://doi.org/10 essential genes from genome-scale CRISPR/Cas9 knockout screens.
.1038/ni1008-1091 Genome Biol. 15:554. https://doi.org/10.1186/s13059-014-0554-4
Hisano, Y., N. Kobayashi, A. Kawahara, A. Yamaguchi, and T. Nishi. 2011. The Liu, C.H., S. Thangada, M.-J. Lee, J.R. Van Brocklyn, S. Spiegel, T. Hla, and G.
sphingosine 1-phosphate transporter, SPNS2, functions as a transporter Guidotti. 1999. Ligand-induced trafficking of the sphingosine-1-phos-
of the phosphorylated form of the immunomodulating agent FTY720. phate receptor EDG-1. Mol. Biol. Cell. 10:1179–1190. https://doi.org/10
J. Biol. Chem. 286:1758–1766. https://doi.org/10.1074/jbc.M110.171116 .1091/mbc.10.4.1179
Hisano, Y., N. Kobayashi, A. Yamaguchi, and T. Nishi. 2012. Mouse SPNS2 Mendoza, A., B. Bréart, W.D. Ramos-Perez, L.A. Pitt, M. Gobert, M. Sunkara, J.J.
functions as a sphingosine-1-phosphate transporter in vascular endothelial Lafaille, A.J. Morris, and S.R. Schwab. 2012. The transporter Spns2 is
cells. PLoS One. 7:e38941. https://doi.org/10.1371/journal.pone.0038941 required for secretion of lymph but not plasma sphingosine-1-phosphate.
Hisano, Y., S. Ota, S. Takada, and A. Kawahara. 2013. Functional cooperation Cell Reports. 2:1104–1110. https://doi.org/10.1016/j.celrep.2012.09.021
of spns2 and fibronectin in cardiac and lower jaw development. Biol. Mizugishi, K., T. Yamashita, A. Olivera, G.F. Miller, S. Spiegel, and R.L. Proia.
Open. 2:789–794. https://doi.org/10.1242/bio.20134994 2005. Essential role for sphingosine kinases in neural and vascular
Hla, T. 2005. Genomic insights into mediator lipidomics. Prostaglandins Other development. Mol. Cell. Biol. 25:11113–11121. https://doi.org/10.1128/MCB
Lipid Mediat. 77:197–209. https://doi.org/10.1016/j.prostaglandins.2005 .25.24.11113-11121.2005
.06.008 Moolenaar, W.H., and T. Hla. 2012. SnapShot: Bioactive lysophospholipids.
Holthuis, J.C., and A.K. Menon. 2014. Lipid landscapes and pipelines in Cell. 148:378–378.e2. https://doi.org/10.1016/j.cell.2012.01.013
membrane homeostasis. Nature. 510:48–57. https://doi.org/10.1038/ Mutoh, T., R. Rivera, and J. Chun. 2012. Insights into the pharmacological
nature13474 relevance of lysophospholipid receptors. Br. J. Pharmacol. 165:829–844.
Inoue, A., F. Raimondi, F.M.N. Kadji, G. Singh, T. Kishi, A. Uwamizu, Y. Ono, https://doi.org/10.1111/j.1476-5381.2011.01622.x
Y. Shinjo, S. Ishida, N. Arang, et al. 2019. Cell. 177:1–15. https://doi.org/ Nakanaga, K., K. Hama, K. Kano, T. Sato, H. Yukiura, A. Inoue, D. Saigusa, H.
10.1016/j.cell.2019.04.044 Tokuyama, Y. Tomioka, H. Nishina, et al. 2014. Overexpression of au-
Ishii, I., J.J.A. Contos, N. Fukushima, and J. Chun. 2000. Functional com- totaxin, a lysophosphatidic acid-producing enzyme, enhances cardia
parisons of the lysophosphatidic acid receptors, LP(A1)/VZG-1/EDG-2, bifida induced by hypo-sphingosine-1-phosphate signaling in zebrafish
LP(A2)/EDG-4, and LP(A3)/EDG-7 in neuronal cell lines using a retro- embryo. J. Biochem. 155:235–241. https://doi.org/10.1093/jb/mvt114
virus expression system. Mol. Pharmacol. 58:895–902. https://doi.org/ Nakasaki, T., T. Tanaka, S. Okudaira, M. Hirosawa, E. Umemoto, K. Otani, S.
10.1124/mol.58.5.895 Jin, Z. Bai, H. Hayasaka, Y. Fukui, et al. 2008. Involvement of the ly-
Joung, J., S. Konermann, J.S. Gootenberg, O.O. Abudayyeh, R.J. Platt, M.D. sophosphatidic acid-generating enzyme autotaxin in lymphocyte-
Brigham, N.E. Sanjana, and F. Zhang. 2017. Genome-scale CRISPR-Cas9 endothelial cell interactions. Am. J. Pathol. 173:1566–1576. https://doi
knockout and transcriptional activation screening. Nat. Protoc. 12: .org/10.2353/ajpath.2008.071153
828–863. https://doi.org/10.1038/nprot.2017.016 O’Hayre, M., K. Eichel, S. Avino, X. Zhao, D.J. Steffen, X. Feng, K. Kawakami,
Kawahara, A., T. Nishi, Y. Hisano, H. Fukui, A. Yamaguchi, and N. Mochizuki. J. Aoiki, K. Messer, R. Sunahara, et al. 2017. Genetic evidence that
2009. The sphingolipid transporter spns2 functions in migration of β-arrestins are dispensable for the initiation of β2-adrenergic receptor
zebrafish myocardial precursors. Science. 323:524–527. https://doi.org/ signaling to ERK. Sci. Signal. 10:eaal3395. https://doi.org/10.1126/
10.1126/science.1167449 scisignal.aal3395

Ohta, H., K. Sato, N. Murata, A. Damirin, E. Malchinkhuu, J. Kon, T. Kimura, measurements. Pflugers Arch. 467:2193–2218. https://doi.org/10.1007/
M. Tobo, Y. Yamazaki, T. Watanabe, et al. 2003. Ki16425, a subtype- s00424-014-1674-0
selective antagonist for EDG-family lysophosphatidic acid receptors. Sumida, H., K. Noguchi, Y. Kihara, M. Abe, K. Yanagida, F. Hamano, S.
Mol. Pharmacol. 64:994–1005. https://doi.org/10.1124/mol.64.4.994 Sato, K. Tamaki, Y. Morishita, M.R. Kano, et al. 2010. LPA4 regu-
Oo, M.L., S. Thangada, M.T. Wu, C.H. Liu, T.L. Macdonald, K.R. Lynch, C.Y. lates blood and lymphatic vessel formation during mouse embry-
Lin, and T. Hla. 2007. Immunosuppressive and anti-angiogenic sphin- ogenesis. Blood. 116:5060–5070. https://doi.org/10.1182/blood
gosine 1-phosphate receptor-1 agonists induce ubiquitinylation and -2010-03-272443
proteasomal degradation of the receptor. J. Biol. Chem. 282:9082–9089. Swaney, J.S., C. Chapman, L.D. Correa, K.J. Stebbins, A.R. Broadhead, G.
https://doi.org/10.1074/jbc.M610318200 Bain, A.M. Santini, J. Darlington, C.D. King, C.S. Baccei, et al. 2011.
Oo, M.L., S.H. Chang, S. Thangada, M.T. Wu, K. Rezaul, V. Blaho, S.I. Hwang, Pharmacokinetic and pharmacodynamic characterization of an
D.K. Han, and T. Hla. 2011. Engagement of S1P1-degradative mecha- oral lysophosphatidic acid type 1 receptor-selective antagonist.
nisms leads to vascular leak in mice. J. Clin. Invest. 121:2290–2300. J. Pharmacol. Exp. Ther. 336:693–700. https://doi.org/10.1124/jpet
https://doi.org/10.1172/JCI45403 .110.175901
Pan, S., Y. Mi, C. Pally, C. Beerli, A. Chen, D. Guerini, K. Hinterding, B. Swendeman, S.L., Y. Xiong, A. Cantalupo, H. Yuan, N. Burg, Y. Hisano, A.
Nuesslein-Hildesheim, T. Tuntland, S. Lefebvre, et al. 2006. A mono- Cartier, C.H. Liu, E. Engelbrecht, V. Blaho, et al. 2017. An engineered S1P
selective sphingosine-1-phosphate receptor-1 agonist prevents allograft chaperone attenuates hypertension and ischemic injury. Sci. Signal. 10:
rejection in a stringent rat heart transplantation model. Chem. Biol. 13: eaal2722. https://doi.org/10.1126/scisignal.aal2722
1227–1234. https://doi.org/10.1016/j.chembiol.2006.09.017 Tanaka, M., S. Okudaira, Y. Kishi, R. Ohkawa, S. Iseki, M. Ota, S. Noji, Y.
Petreanu, L., D. Huber, A. Sobczyk, and K. Svoboda. 2007. Channelrhodopsin- Yatomi, J. Aoki, and H. Arai. 2006. Autotaxin stabilizes blood vessels
2-assisted circuit mapping of long-range callosal projections. Nat. and is required for embryonic vasculature by producing lysophospha-
Neurosci. 10:663–668. https://doi.org/10.1038/nn1891 tidic acid. J. Biol. Chem. 281:25822–25830. https://doi.org/10.1074/jbc
Pham, T.H., P. Baluk, Y. Xu, I. Grigorova, A.J. Bankovich, R. Pappu, S.R. .M605142200
Coughlin, D.M. McDonald, S.R. Schwab, and J.G. Cyster. 2010. Lym- Tian, X., D.S. Kang, and J.L. Benovic. 2014. β-arrestins and G protein-coupled
phatic endothelial cell sphingosine kinase activity is required for lym- receptor trafficking. Handb. Exp. Pharmacol. 219:173–186. https://doi
phocyte egress and lymphatic patterning. J. Exp. Med. 207:17–27. https:// .org/10.1007/978-3-642-41199-1_9
doi.org/10.1084/jem.20091619 van Meeteren, L.A., P. Ruurs, C. Stortelers, P. Bouwman, M.A. van Rooijen,
Proia, R.L., and T. Hla. 2015. Emerging biology of sphingosine-1-phosphate: J.P. Pradère, T.R. Pettit, M.J. Wakelam, J.S. Saulnier-Blache, C.L.
its role in pathogenesis and therapy. J. Clin. Invest. 125:1379–1387. Mummery, et al. 2006. Autotaxin, a secreted lysophospholipase D, is
https://doi.org/10.1172/JCI76369 essential for blood vessel formation during development. Mol. Cell. Biol.
Ran, F.A., P.D. Hsu, J. Wright, V. Agarwala, D.A. Scott, and F. Zhang. 2013. 26:5015–5022. https://doi.org/10.1128/MCB.02419-05
Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8: Vu, T.M., A.N. Ishizu, J.C. Foo, X.R. Toh, F. Zhang, D.M. Whee, F. Torta, A.
2281–2308. https://doi.org/10.1038/nprot.2013.143 Cazenave-Gassiot, T. Matsumura, S. Kim, et al. 2017. Mfsd2b is essential
Randolph, G.J., S. Ivanov, B.H. Zinselmeyer, and J.P. Scallan. 2017. The for the sphingosine-1-phosphate export in erythrocytes and platelets.
Lymphatic System: Integral Roles in Immunity. Annu. Rev. Immunol. 35: Nature. 550:524–528. https://doi.org/10.1038/nature24053
31–52. https://doi.org/10.1146/annurev-immunol-041015-055354 Willinger, T., S.M. Ferguson, J.P. Pereira, P. De Camilli, and R.A. Flavell. 2014.
Ranjan, R., H. Dwivedi, M. Baidya, M. Kumar, and A.K. Shukla. 2017. Novel Dynamin 2-dependent endocytosis is required for sustained S1PR1
Structural Insights into GPCR-β-Arrestin Interaction and Signaling. signaling. J. Exp. Med. 211:685–700. https://doi.org/10.1084/jem
Trends Cell Biol. 27:851–862. https://doi.org/10.1016/j.tcb.2017.05.008 .20131343
Sanchez, T., A. Skoura, M.T. Wu, B. Casserly, E.O. Harrington, and T. Hla. Windh, R.T., M.J. Lee, T. Hla, S. An, A.J. Barr, and D.R. Manning. 1999. Dif-
2007. Induction of vascular permeability by the sphingosine-1-phos- ferential coupling of the sphingosine 1-phosphate receptors Edg-1, Edg-
phate receptor-2 (S1P2R) and its downstream effectors ROCK and 3, and H218/Edg-5 to the G(i), G(q), and G(12) families of heterotrimeric
PTEN. Arterioscler. Thromb. Vasc. Biol. 27:1312–1318. https://doi.org/10 G proteins. J. Biol. Chem. 274:27351–27358. https://doi.org/10.1074/jbc
.1161/ATVBAHA.107.143735 .274.39.27351
Shalem, O., N.E. Sanjana, and F. Zhang. 2015. High-throughput functional Xiong, Y., W. Piao, C.C. Brinkman, L. Li, J.M. Kulinski, A. Olivera, A. Cartier,
genomics using CRISPR-Cas9. Nat. Rev. Genet. 16:299–311. https://doi T. Hla, K.L. Hippen, B.R. Blazar, et al. 2019. CD4 T cell sphingosine 1-
.org/10.1038/nrg3899 phosphate receptor (S1PR)1 and S1PR4 and endothelial S1PR2 regulate
Shea, B.S., and A.M. Tager. 2012. Role of the lysophospholipid mediators ly- afferent lymphatic migration. Sci. Immunol. 4:eaav1263. https://doi.org/
sophosphatidic acid and sphingosine 1-phosphate in lung fibrosis. Proc. 10.1126/sciimmunol.aav1263
Am. Thorac. Soc. 9:102–110. https://doi.org/10.1513/pats.201201-005AW Yanagida, K., and T. Hla. 2017. A dark side to omega-3 fatty acids. Nature. 552:
Shimizu, T. 2009. Lipid mediators in health and disease: enzymes and re- 180–181. https://doi.org/10.1038/d41586-017-07678-8
ceptors as therapeutic targets for the regulation of immunity and in- Yanagida, K., C.H. Liu, G. Faraco, S. Galvani, H.K. Smith, N. Burg, J. Anrather,
flammation. Annu. Rev. Pharmacol. Toxicol. 49:123–150. https://doi.org/ T. Sanchez, C. Iadecola, and T. Hla. 2017. Size-selective opening of the
10.1146/annurev.pharmtox.011008.145616 blood-brain barrier by targeting endothelial sphingosine 1-phosphate
Shiow, L.R., D.B. Rosen, N. Brdicková, Y. Xu, J. An, L.L. Lanier, J.G. Cyster, and receptor 1. Proc. Natl. Acad. Sci. USA. 114:4531–4536. https://doi.org/10
M. Matloubian. 2006. CD69 acts downstream of interferon-alpha/beta .1073/pnas.1618659114
to inhibit S1P1 and lymphocyte egress from lymphoid organs. Nature. Zhang, F., G. Zarkada, J. Han, J. Li, A. Dubrac, R. Ola, G. Genet, K. Boyé, P.
440:540–544. https://doi.org/10.1038/nature04606 Michon, S.E. Künzel, et al. 2018. Lacteal junction zippering protects
Skoura, A., and T. Hla. 2009. Lysophospholipid receptors in vertebrate de- against diet-induced obesity. Science. 361:599–603. https://doi.org/10
velopment, physiology, and pathology. J. Lipid Res. 50(Suppl): .1126/science.aap9331
S293–S298. https://doi.org/10.1194/jlr.R800047-JLR200 Zhang, Y., Y.C. Chen, M.F. Krummel, and S.D. Rosen. 2012. Autotaxin through
Stolwijk, J.A., K. Matrougui, C.W. Renken, and M. Trebak. 2015. Impedance lysophosphatidic acid stimulates polarization, motility, and trans-
analysis of GPCR-mediated changes in endothelial barrier function: endothelial migration of naive T cells. J. Immunol. 189:3914–3924.
overview and fundamental considerations for stable and reproducible https://doi.org/10.4049/jimmunol.1201604


Hisano 2019

Uploaded by

Copyright:

Available Formats

Hisano 2019

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Hisano 2019

Uploaded by

Copyright:

Available Formats

Published Online: 30 May, 2019 | Supp Info: http://doi.org/10.1084/jem.

Lysolipid receptor cross-talk regulates lymphatic

Rockefeller University Press https://doi.org/10.1084/jem.20181895 1582

Hisano et al. Journal of Experimental Medicine 1583

Hisano et al. Journal of Experimental Medicine 1584

Hisano et al. Journal of Experimental Medicine 1585

Hisano et al. Journal of Experimental Medicine 1586

Hisano et al. Journal of Experimental Medicine 1587

Hisano et al. Journal of Experimental Medicine 1588

Hisano et al. Journal of Experimental Medicine 1589

Hisano et al. Journal of Experimental Medicine 1590

Hisano et al. Journal of Experimental Medicine 1591

Hisano et al. Journal of Experimental Medicine 1592

Hisano et al. Journal of Experimental Medicine 1593

Hisano et al. Journal of Experimental Medicine 1594

Hisano et al. Journal of Experimental Medicine 1595

Hisano et al. Journal of Experimental Medicine 1596

Hisano et al. Journal of Experimental Medicine 1597

Hisano et al. Journal of Experimental Medicine 1598

You might also like