Research Course Lab Report Zeynep Durmus

Understanding the Role of Microbiota in

Colorectal Cancer
Colorectal cancer (CRC) is defined as a malignant polysaccharides. The colon has the largest SCFA
tumor of intestinal epithelial cells that are characterized content in the human gastrointestinal system, with a
by uncontrolled cell proliferation, invasiveness, and molar ratio of around 60:20:20 for acetate: propionate:
metastasis. It is the third most common cancer butyrate (69 mmol/L, 25 mmol/L, 26 mmol/L)12-13.
worldwide and shows increasing morbidity and SCFAs in the proximal colon are either used by
mortality among young people1-3. In the classical enterocytes or transported across the intestinal
genetic model, CRC develops due to the accumulation epithelium into the bloodstream. SCFAs activate
of various critical mutations. In this model, the cellular signaling pathways through GPCRs:
adenomatous polyp is the main precursor of CRC4. GPR41(FFAR3), GPR43 (FFAR2), GPR109A
Serrated carcinomas account for about 10% of all CRC (HCAR2) and also through OLFR78 (mouse). These
cases5. They use an alternative pathway where serrated receptors are expressed in multiple tissues and cell
tumors replace traditional adenoma and become types in humans and animals. All three main SCFAs can
precursor lesions of colorectal cancer6. Molecularly, the activate both GPR41 and GPR43, while GPR109A is
classical pathway is mainly governed by Adenomatous activated only by butyrate and niacin, and OLFR78 is
Polyposis Coli (APC), a tumor suppressor gene, activated only by acetate and propionate14. Butyrate is
whereas serrated pathway is driven by oncogenic essential for colon health and gut microbial balance
activation of KrasG12D and/or BrafV637E and/or since it has anti-inflammatory and anti-tumor
Pik3caH1047R 7. Although CRC is a genetic disease, characteristics, and it can supply energy for intestinal
several studies suggest an association of different epithelial cells. Moreover, numerous studies have
microbial taxa with the initiation and progression of the demonstrated that butyrate can prevent the onset and
tumor8. Recent studies have shown that specific progression of CRC through a variety of mechanisms
pathogens and/or microbial communities activate such as by hyperactivating Wnt signaling pathway15-16.
inflammatory pathways and aberrant epithelial cell Tryptophan (TRP) serves a number of physiological
proliferation, enhance oncogenic immune responses, purposes, many of which are connected to the control
induce DNA damage, and alter genomic stability, of the immune system, brain function, gastrointestinal
suggesting that it plays an important role in nerve system, and intestinal flora. TRP is synthesized
tumorigenesis. Furthermore, dysbiosis of the resident into indole-3-acetic acid, indophenol-3-sulfate, indole-
gut microbiota have been shown to significantly alter 3-propionic acid, indole-3- carboxaldehyde (ICA), and
cancer risk and progression by causing abnormalities in other derivatives as part of the metabolism of the
immune responses, among others 9-10. Moreover, intestinal bacteria. Many TRP metabolites have been
reduction of some commensal microbe-derived shown to be able to bind to and activate the aryl
metabolites such as short-chain fatty acids (SCFAs) and hydrocarbon receptor (AhR)17-18. Human colon cancer
tryptophan metabolites play an important role in cell lines demonstrated that AhR activation in vitro
tumorigenesis and progression11. SCFAs have fewer promotes cell proliferation, migration, and invasion via
than six carbons in the aliphatic tail, exist in linear and transactivation of the EGFR/ERK signaling pathway.
branched structures. Acetate (C2), propionate (C3), and Recent findings indicate AhR may be a potential CRC
butyrate (C4) are the most abundant in the intestine. treatment target by indicating that AhR and its ligands
They are a metabolic by-product of microbial play significant roles in the development of intestinal
fermentation of partially and nondigestible complex tumors19.

2
Organoids are self-organized, genomically stable, great promise for the study of tissue development,
three-dimensional tissue cultures that are used to mimic disease modeling, drug screening, personalized
its corresponding in vivo organ in research. Organoids medicine, and cell therapy 22. Previous work of the lab
are derived from stem cells – either pluripotent or adult showed that while in specific-pathogen- free (SPF)
stem cells – from various organs. Tumor organoids mice, engrafted adenoma and carcinoma organoids
were developed from a variety of sources- clinical grow, in germ-free (GF) mice only engrafted
samples from patients, xenograft models from patients carcinoma organoids grow. To further explore this
(PDX, cultured in mice), as well as from murine tumor finding, microbiota metabolites and their effect on
tissue 20. Organoids provide better and more accurate tumor formation and progression should be
insights than 2D models for many reasons: compared investigated. Here we used healthy, adenoma and
to conventional two-dimensional (2D) cell cultures, carcinoma organoids derived from intestinal
organoids resemble primary tissues in both epithelium-specific oncogenic KrasG12D mouse model
composition and structure. Moreover, they can be to study the effects of designated SCFAs and TRP
greatly expanded, cryopreserved as biobanks, and derivative (Butyrate, acetate and ICA) on the cell
easily manipulated 21. In conclusion, organoids hold growth and viability of these organoids.

Expression of SCFA and TRP receptors in low and linked to both an increase in FFAR2 expression and
high grade intestinal tumors. To see how SCFA and anti-proliferative effects in which this might be helpful
TRP receptors are expressed in high and low grade, in cancer therapy24. The reduced expression of FFAR3
intestinal tumors expression patterns were profiled in BrafV637E adenomas and adenocarcinomas in
using existing RNA-seq data. Because SCFAs are duodenum can be observed (Figure 1.A.e). And, there
produced in the cecum and colon, it has been suggested have been conflicting results concerning FFAR3
that they will exclusively suppress carcinogenesis expression in human cancer and its involvement in
there24. Therefore, we expect to see significant carcinogenesis23. However, according to our data, the
expression patterns mostly in the colon. In duodenum, expression pattern of FFAR3 is similar to FFAR2 and
ileum, and colon a significant increase of HCAR2 suggests anti-proliferative effects. A significantly
expression in the Apcfl/wt colorectal adenoma and reduced expression of OlRF78 in Apcfl/wt colorectal
adenocarcinoma tissues have been observed (Figure adenoma tissues has been observed (Figure 1.A.f). And
1.A.a-c). Interestingly, there is compelling evidence yet, colon tumors have been shown to have higher
that HCAR2 serves as a tumor suppressor in the colon levels of OLFR7825. The epithelial expression of AhR
and the reduced expression of HCAR2 linked to colon in duodenum, ileum and colon significantly increased
cancer23. This inconsistency could be a result of an in adenomas and adenocarcinomas (Figure 1.B.a-c).
experimental error, but it is also interesting that the According to several studies, AhR is overexpressed in
increase can be observed in all three locations. colon tumor tissue26 which is in line with our
Therefore, the experiment needs to be repeated and the observations. Moreover, AhR expression is
results need to be re-evaluated for HCAR2. A significantly increased in Pik3caH1047R mutated
significantly reduced expression of FFAR2 (free fatty adenomas and adenocarcinomas. The loss of AhR was
acid receptor 2) in Apcfl/wt colorectal adenoma tissues also linked to decreased expression and/or activity of
has been observed (Figure 1.A.d). This observation PI3K/AKT pathway components which might be of
coincides with the studies showing a protective role of relevance in our cohort26.
FFAR2 in colon carcinogenesis23-24. A number of
stimuli, such as butyrate or FFAR2 agonists have been

3
Figure 1∣ Mouse SCFA (A) and TRP (B) receptor expressions in tissues derived from healthy wildtype mice or
transgenic mice with different pathological states. (A) HCAR2 expression in duodenum, ileum and colon (a-c).
(d) FFAR2 expression in the colon. (e) FFAR3 expression in duodenum. (f) OLFR78 expression in the colon. (B)
AhR expression in the duodenum, ileum and colon (a-c).

4
Effect of bacterial metabolites on cell viability. To cells have such diverse genetic and epigenetic
study the effect of 2 selected SCFAs and one backgrounds, their responses to HDAC inhibitor
tryptophan derivate (butyrate, ICA and acetate) on treatment varies as well. Therefore, this might be the
organoid cell lines, Resazurin and Cell Titer Glo (CTG) reason why we see an effect in the MT577 Duo
assay were performed. In these assays, butyrate organoid line as well. Moreover, acetate has been
treatment caused significantly less viable cells (Figure demonstrated to decrease cell viability and
2.a, b). It is known that butyrate has anti-inflammatory proliferation of colon cancer cells in vitro27. However,
and anti-tumorigenic characteristics, and it can prevent in both of the assays, acetate had no effect on cell
the onset and progression of CRC14. Therefore, we viability of colon cancer cells. This might be the result
would expect to see an effect on TM1783_T2-1 of experimental error such as the required
(adenoma) and MT577_T1-2 (adenocarcinoma) concentration of acetate may not be provided.
organoid lines. But we also see an effect in the MT577
Duo organoid line, which was derived from a healthy
Duodenum. In this case, the question remains; whether
butyrate can selectively kill tumor cells. Butyrate
regulates gene expression by inhibiting HDACs and
specifically prevents cell replication in transformed
cells (compared to healthy cells)28. And, HDAC
inhibitors have the ability to affect both normal and
malignant cells. However, because healthy and tumor

Figure 2∣Resazurin (a) and CTG (b) assays on MT577 Duo (healthy tissue), TM1783_T2-1 (adenoma) and
MT577_T1-2 (adenocarcinoma) organoid lines. Data are presented as mean ± SEM of four replicates. Viability
of cells exposed to the control was set at 100% and an asterisk indicated a significant difference from the control:
ns < 0.1234; ** p < 0.0021.
5
Butyrate inhibits proliferation in colon cells. To see c). We also see a slight positive effect of ICA and
the effect of butyrate, ICA and acetate on organoid acetate in TM1783_T2-1 (adenoma) and MT577_T1-2
lines morphologically, images of treated organoids (adenocarcinoma) organoid lines. However, as
were captured under the microscope and the size of the mentioned before, acetate had been demonstrated to
organoids (in diameters) was measured. As expected, decrease cell viability of colon cancer cells in vitro and
butyrate has the strongest negative effect on this positive effect on proliferation in adenocarcinoma
proliferation compared to ICA and acetate (Figure 3.a- organoid lines is unexpected (Figure 3.c).

Figure 3 ∣ Size measurement of (a) MT577 Duo (healthy tissue), (b) TM1783_T2-1 (adenoma) and (c)
MT577_T1-2 (adenocarcinoma) organoid cell lines. All images were captured at 4X magnification. Each data
point represents mean ± SEM, for each condition 3 replicate images were captured, and 15 organoids were counted
per replicate.

Histological analysis after bacterial metabolite (Figure 4.d). This finding can be expected since it’s a
treatment: To further assess the effect of bacterial healthy tissue and butyrate prevents the proliferation of
metabolites on organoids, Ki67, pERK and HE tumor cells. In TM1783 T2-1 organoids, acetate has the
stainings were performed (Figure 4.a-c). In the MT577 highest proliferation percentage. And for MT577 T1-2
T1-2 organoid line, there was no organoid in the section organoids, ICA and control have similar proliferation
which could be due to damage caused by the needle or percentage whereas butyrate and acetate have lower
loss during the embedding procedure (Figure 4.c). compared to ICA and control. This pattern coincides
MT577 Duo organoids treated with butyrate displayed with our expectations since they are known to exert an
the highest number of Ki67 positive cells, which anti-proliferative effect on colon cancer cell.
indicates that these cells have the highest proliferation
6
7
Figure 4∣Representative microscopic images of Ki67, pERK and HEs stainings of (a) MT577 Duo (healthy
tissue) organoids (b) TM1783 T2-1 (adenoma) organoids (c) MT577 T1-2 (adenocarcinoma) organoids. Scale
bar indicates 40 µm. Ki-67: specific marker for cell proliferation. (d) Percentage of Ki67 positive cells in the
different organoid lines. (e) Total number of cells of Ki67 staining in the different organoid lines. Positive cells
indicated with black and negative cells are indicated the color of the respective treatments (gray, orange, blue,
purple).

Expression levels of cell cycle genes in metabolite A1) and mCCNA2 (Cyclin A2) belong to the family of
treated organoids. To see the expression levels of highly conserved cyclins which are bound to crucial
certain genes which have a role in cell cycle, DNA cell cycle regulators. mCCNB1 is essential for effective
replication, DNA repair in treated organoid lines, control of the cell cycle's G2/M transition phase. As
qPCR was performed (Figure 5). mCCNA1 (Cyclin expected, in the MT577 Duo organoids, butyrate has
8
the highest expression levels in both mCCNA1, many tumor suppressor proteins. P19, also known as
mCCNA2, and mCCNB1, whereas their expression CDKN2D (Cyclin Dependent Kinase Inhibitor 2D),
levels have the lowest in MT577 T1-2 organoids. acts as a cell growth regulator that controls cell cycle
According to this data butyrate exerts its anti- G1 progression, and it prevents the activation of the
proliferative effects on colon cancer cells and not on CDK kinases. As expected, the butyrate-treated
healthy cells. mPcna is a cofactor of DNA polymerase MT577 T1-2 adenocarcinoma organoids have the
delta and helps to enhance the processivity of leading highest expression level of p16, without any difference
strand synthesis during DNA replication. We would in p19 expression levels. However, this highest
expect to see low expression levels of mPcna in expression in butyrate might be the result of using only
butyrate treated MT577 T1-2 adenocarcinoma one replicate. In the butyrate-treated TM1783 T2-1
organoids, however, mPcna showed one of the highest adenoma organoids, p19 has the highest expression
expression levels in this organoid line. In the other two levels which can be also expected. In the MT577 Duo
organoid lines, expression level is expected with the organoids, p16 and p19 expressions couldn’t be
respective treatments. P16, also known as CDKN2A measured although the experiment was repeated three
(Cyclin Dependent Kinase Inhibitor 2A), codes for times.

Figure 5∣Quantitative PCR results. The changes in expression of mCCNA1, mCCNA2, mCCNB1, mPcna, p16
and p19 in MT577 Duo (healthy tissue), TM1783_T2-1 (adenoma), and MT577_T1-2 (adenocarcinoma)
organoids were normalized to Cyclophilin A. The gene expression levels were calculated using the 2-ΔΔCt method,
and the results are presented as relative fold changes. For each condition 2 replicate were used, in total 6 replicates
9
were used for repeated 3 three experiment. Data are expressed as the mean ± SEM. Samples with only one
replicate indicated with *.

Methods

Organoid culture. Cryopreserved organoid lines of Histology. A ROI (at 20x magnification) from
MT577 Duo (healthy tissue), TM1783_T2-1 organoid slide images for each staining was extracted
(adenoma), MT577_T1-2 (adenocarcinoma) were using QuPath and scale bar was added using Fiji.
thawed and cultured in organoid culture medium Resazurin Assay. Medium was removed from each
containing 50% L-WRN medium plus ROCK inhibitor well of the organoids. 300 µL of working Resazurin
(Y-27632). Each medium was changed every 2 or 3 solution (10 µg/mL) was added to each well and also to
days. Organoids were passaged with TrypLE and 50 µL an empty well to use as a blank. Organoids were
of Matrigel was used to plate out the organoids after 4- incubated at 37°C in a humidified atmosphere with 5%
6 days and were split at a ratio of 1:3 to 1:5 according of CO2 for 90 minutes. 80 µL was taken from each well
to the standard culturing procedures. in duplicate, including blank, to a black 96 multi-well
plate. The plate was read at 570 nm excitation and 600
nm emission with the gain at 1800g.

Metabolite treatment. Stock solutions of butyrate Cell Titer Glo Assay. Organoids were seeded
(26.4 mg in 1.2 mL media; Stock 1:100→ 200 mM in according to the experimental protocol. Supernatant
media), ICA (8.7 mg in 1.2 mL EtOH; Stock 1:1000→ was partly removed, and the remaining well content
50 mM in media) and Acetate (59.06 mg in 1.2 mL was used for a 1:1 dilution of the CTG reagent under
media; Stock 1:100→ 600 mM in media) were light protected conditions (Promega, Cat# G7573). The
prepared according to calculations. Organoid cell lines Matrigel dome was disrupted by pipetting up and
treated with these metabolites, and they were plated out down. The plate was covered with tin foil and
according to the experimental setup (RNA isolation, incubated for 40 min at RT on a shaker at 100 rpm. Any
organoid fixation and embedding, size measurement, bubbles were removed carefully. The plate was
resazurin and CTG assays) and were grown for 4 days. measured in ClarioStar machine using the Cell Titer
After 4 days, treatments were stopped, and experiments Glo program.
were done.
Organoid imaging. Organoids were observed under
Organoid fixation and embedding. Organoids were the microscope (Leica Microsystems) after the
grown according to standard procedures. A round metabolite treatments and pictures were taken for each
coverslip (12 mm diameter) was inserted in each well cell line and condition at 4x using LASX software.
before plating the organoids. Organoids were plated on
top of the coverslip as a Matrigel dome. 2 full wells of Quantitative real-time PCR analysis. Total RNA
organoids were used for this procedure. Medium was from the organoid pellets was extracted using Qiagen
discarded and 500 µL of formalin was added to each RNeasy Mini Kit according to the manufacturer’s
well and incubated for 45 min at RT. Organoids were protocol. RNA concentration was quantified by
removed from the plate and transferred to an Nanodrop and stored at −80°C. cDNA was synthesized.
embedding Bionet cassette (Cat. No. 17995, Quantitative real-time RT-PCR was performed using
Engelbrecht Medizin- & Labortechnik). Power SYBR™ Green PCR Master Mix (Applied
Biosystems). The mRNA expression levels of each
gene were calculated relative to Cyclophilin A
10
expression levels. The qPCR primer sequences, with Tukey’s multiple comparisons test were used for
templates for cDNA synthesis and qPCR, comparisons of more than 2 groups. All analyses were
concentrations of the RNA’s were shown in using Graph Pad Prism 8 (Figs. 1-6 a-f). All data are
Supplementary section. presented as mean ± SEM (standard error). Statistical
tests were two-tailed and P < 0.05 was considered
Statistics. Two-tailed Student’s t-tests were used for significant.
comparisons between two groups. One-way ANOVA

Discussion

Changes in the gut microbiota are linked to CRC. there was no observable effect on cell viability (Figure
However, there is currently very little information 2.a-b). To confirm this hypothesis, organoids were
available about whether and how changes to the gut embedded after treatment and stained to assess the
microbiota are directly linked to the development of proliferation marker Ki67. We saw that in
CRCs. In this study, we saw that FFAR2 expression adenocarcinoma organoids, the percentage of Ki67
was reduced in adenoma tissues which confirms positive cells were lowest in butyrate and acetate
its protective role in colon carcinogenesis (Figure 1.d). treated organoids. There was an inconsistency in the
Also, the epithelial expression of AhR is increased in MT577 Duo line as previously mentioned which can be
adenoma and adenocarcinoma tissues (Figure 1.B.a-c) derived from experimental error and quantification
which is in line with the several studies26. However, in might need to be repeated. Lastly, we saw that in
HCAR2, FFAR3 and OlRF78 expressions, there had adenoma and adenocarcinoma organoids, the two
been some inconsistencies with the published data. cyclin dependent kinase inhibitor genes were
Therefore, these receptors and their expression in low upregulated. However, there are some inconsistencies
and high grade tumors should be investigated more in the expression levels with the other genes in
deeply, and results should be re-evaluated. Besides organoid lines such as mPcna. Highest expression of
repeating the experiment, protein analysis might also mPcna in butyrate treated MT577 T1-2
reveal more insights about this argument. To study the adenocarcinoma organoids might be the result of
effects of bacterial metabolites on organoid lines cell experimental error. Moreover, the statistical test for
viability assays after treatment were performed. We qPCR couldn’t be performed. Therefore, our
found that butyrate diminishes the cell viability of conclusions for this part of the experiment are not
tumor cells but also healthy cells (Figure 2a-b). This accountable. We repeated the qPCR experiment three
situation might be the result of its action as a histone times. In the first run, Ct values of the reference gene
deacetylase (HDAC) inhibitor. Moreover, by and also the other genes were too high, indicating bad
measuring the size of the treated organoids, we also quality of the cDNA. Due to a pipetting error, one of
confirm that the butyrate treated adenocarcinoma the genes couldn’t be performed. Therefore, newly the
organoids have the smallest size (Figure 3). However, experiment was repeated with newly synthesized
we also observe this in healthy and adenoma tissues. cDNA. The fold expression of the genes of three runs
The effect on butyrate to normal and tumor cells should was compared, but the values showed a high variance
be further investigated. We couldn’t make a conclusion which is why all 6 replicates were visualized.
about the effect of ICA on organoid cell lines since Moreover, some genes couldn’t be assessed in some
there was no significant effect other than in Figure 3.b. organoid cell lines, therefore there is no data available.
and due to limiting amount of published data. Acetate For troubleshooting, one of the main reasons that we
also diminishes the proliferation of the tumor cells but encounter so many problems for this experiment is that
the RNA quality was not good. The measured
11
concentration of RNA was good, but RNA quality was
not assessed, and some sample’s RNA concentrations
were too low to allow repetition. To fully comprehend
the processes behind the gut bacterial connection to
CRC development, more research is required.
Nevertheless, while additional mechanisms may be at
play here, our data raise the possibility that butyrate can
inhibit cell viability and the proliferation of colon
cancer cells. These results increase our knowledge of
whether and how changes in the gut microbiota
contribute to the development of CRC and provide new
possibilities for its therapy.

References

1. Sung, H. et al. Global Cancer Statistics 2020: of the gut microbiota in colorectal cancer. Nature
GLOBOCAN Estimates of Incidence and Mortality Medicine 25, 968–976 (2019).
Worldwide for 36 Cancers in 185 Countries. CA: A 9. Fan, X., Jin, Y., Chen, G., Ma, X. & Zhang, L. Gut
Cancer Journal for Clinicians 71, 209–249 (2021). Microbiota Dysbiosis Drives the Development of
2. Akimoto, N. et al. Rising incidence of early-onset Colorectal Cancer. Digestion 1–8 (2020)
colorectal cancer — a call to action. Nature doi:10.1159/000508328.
Reviews Clinical Oncology (2020) 10. Zhang, W. et al. Gut Microbiota-Derived
doi:10.1038/s41571-020-00445-1. Metabolites in Colorectal Cancer: The Bad and the
3. Wong, M. C. S. et al. Differences in Incidence and Challenges. Frontiers in Oncology 11, (2021).
Mortality Trends of Colorectal Cancer Worldwide 11. Dalal, N. et al. Gut microbiota-derived metabolites
Based on Sex, Age, and Anatomic Location. in CRC progression and causation. Journal of
Clinical Gastroenterology and Hepatology 19, Cancer Research and Clinical Oncology 147,
955-966.e61 (2021). 3141–3155 (2021).
4. Er, F. & B, V. A Genetic Model for Colorectal 12. van der Hee, B. & Wells, J. M. Microbial
Tumorigenesis. Cell Regulation of Host Physiology by Short-chain
https://pubmed.ncbi.nlm.nih.gov/2188735/ (1990). Fatty Acids. Trends in Microbiology 29, 700–712
5. Pino, M. S. & Chung, D. C. The Chromosomal (2021).
Instability Pathway in Colon Cancer. 13. Tan, J. et al. The Role of Short-Chain Fatty Acids
Gastroenterology 138, 2059–2072 (2010). in Health and Disease. Advances in Immunology
6. Mäkinen, M. J. Colorectal serrated 121, 91–119 (2014).
adenocarcinoma. Histopathology 50, 131–150 14. Wu, X. et al. Effects of the intestinal microbial
(2007). metabolite butyrate on the development of
7. Wong, S. H. & Yu, J. Gut microbiota in colorectal colorectal cancer. Journal of Cancer 9, 2510–2517
cancer: mechanisms of action and clinical (2018).
applications. Nature Reviews Gastroenterology & 15. Lazarova, D. L., Chiaro, C. & Bordonaro, M.
Hepatology (2019) doi:10.1038/s41575-019-0209- Butyrate induced changes in Wnt-signaling specific
8. Yachida, S. et al. Metagenomic and metabolomic gene expression in colorectal cancer cells. BMC
analyses reveal distinct stage-specific phenotypes Research Notes 7, 226 (2014).

12
16. Bordonaro, M., Lazarova, D. L. & Sartorelli, A. C. 23. Cosín-Roger, J., Ortiz-Masia, D., Barrachina, M.
Butyrate and Wnt signaling: a possible solution to D. & Calatayud, S. Metabolite Sensing GPCRs:
the puzzle of dietary fiber and colon cancer risk? Promising Therapeutic Targets for Cancer
Cell Cycle 7, 1178–1183 (2008). Treatment? Cells 9, 2345 (2020).
17. Sun, M., Ma, N., He, T., Johnston, L. J. & Ma, X. 24. Sivaprakasam, S. et al. An essential role of Ffar2
Tryptophan (Trp) modulates gut homeostasis via (Gpr43) in dietary fibre-mediated promotion of
aryl hydrocarbon receptor (AhR). Critical Reviews healthy composition of gut microbiota and
in Food Science and Nutrition 60, 1760–1768 suppression of intestinal carcinogenesis.
(2020). Oncogenesis 5, e238–e238 (2016).
18. Zhang, H. et al. Targeting regulation of tryptophan 25. Priyadarshini, M., Kotlo, K. U., Dudeja, P. K. &
metabolism for colorectal cancer therapy: a Layden, B. T. Role of Short Chain Fatty Acid
systematic review. RSC Advances 9, 3072–3080 Receptors in Intestinal Physiology and
(2019). Pathophysiology. Comprehensive Physiology 8,
19. Xie, G. & Raufman, J.-P. Role of the Aryl 1091–1115 (2018).
Hydrocarbon Receptor in Colon Neoplasia. 26. Karasová, M. et al. Inhibition of Aryl Hydrocarbon
Cancers 7, 1436–1446 (2015). Receptor (AhR) Expression Disrupts Cell
20. Brand-Saberi, B. Essential Current Concepts in Proliferation and Alters Energy Metabolism and
Stem Cell Biology. Google Books (Springer Fatty Acid Synthesis in Colon Cancer Cells.
Nature, 2020). Cancers 14, 4245 (2022).
21. Fatehullah, A., Tan, S. H. & Barker, N. Organoids 27. Sahuri-Arisoylu, M. et al. Acetate Induces Growth
as an in vitro model of human development and Arrest in Colon Cancer Cells Through Modulation
disease. Nature Cell Biology 18, 246–254 (2016). of Mitochondrial Function. Frontiers in Nutrition
22. Scalise, M. et al. From Spheroids to Organoids: The 8, (2021).
Next Generation of Model Systems of Human 28. Li, Z. & Zhu, W.-G. Targeting Histone
Cardiac Regeneration in a Dish. International Deacetylases for Cancer Therapy: From Molecular
Journal of Molecular Sciences 22, 13180 (2021). Mechanisms to Clinical Implications. International
Journal of Biological Sciences 10, 757–770 (2014).

13
Supplementary

Supplementary Table 1. Primers for quantitative real-time PCR.

mouse CcnA1 Forward GCTGTCTCTTTACCCGGAGCA

mouse CcnA1 Reverse ACGTTCACTGGCTTGTCTTCTA
mouse CcnA2 Forward CACTGACACCTCTTGACTATCC
mouse CcnA2 Reverse CGTTCACTGGCTTGTCTTCT
mouse CcnB1 Forward TTGTGTGCCCAAGAAGATGCT
mouse CcnB1 Reverse GTACATCTCCTCATATTTGCTTGCA
mouse Pcna Forward GCAAGTGGAGAGCTTGGCA
mouse Pcna Reverse AGGCTCATTCATCTCTATGGTTAC
mouse p16 Forward CCCAACGCCCCGAACT
mouse p16 Reverse GTGAACGTTGCCCATCATCA
mouse p19 Forward TCGCAGGTTCTTGGTCACTGT
mouse p19 Reverse GAACTTCACCAAGAAAACCCTCTCT
mouse Cyclophilin A Forward ATGGTCAACCCCACCGTGT
mouse Cyclophilin A Reverse TTCTTGCTGTCTTTGGAACTTTGTC

Supplementary Table 2. cDNA synthesis template.

Manufacturer Ref# Final Concentration 1x Reaction

Applied #4374967 10x RT buffer
Biosystems 1x 10 µl
Peqlab #97062-848 MgCl2 (25mM) 5.5 mM 22 µl
Sigma #D7295 dNTP mix (2.5mM
each)* 500 µM each 20 µl
Roche #11034731001 Random hexamers
(50µM) 2.5 µM 5 µl
Applied #100021540 RNAse Inhibitor
Biosystems (20U/µl) 0.4U/µl 2 µl
Applied #4311235 Multiscribe RT
Biosystems (50U/µl) 1.25U/µl 2,5 µl
dH2O 0 µl
RNA Dilutions (1µg) 38,5 µl
TOTAL 100 µl
Master Mix 61,5µl per well

14
Supplementary Table 3. RT-PCR program overview.

RT-PCR (Thermocycler Biometra)

105°C lid
25°C 10 min
48°C 1h
95°C 5 min
12°C PAUSE

Supplementary Table 4. qRT-PCR synthesis reaction template.

Applied Biosystems, Thermo Fisher, Power SYBR Green,

#4367659
Master mix for 1 reaction
SYBR 12,5 µl
f-primer 0,25 µl
r-primer 0,25 µl
A.dest 7 µl
5µl of cDNA
Master Mix 20µl per well

Supplementary Table 5. qRT-PCR program overview.

qRT-PCR program
1 cycle 10 min 95°C

40 cycles 15 sec 95°C

1 min 60°C

1cycle 15 sec 95°C

1 min 60°C
15 sec 95°C

15
Supplementary Table 6. NanoDrop measurements of the RNA samples.

# Name Conc. Units A260/A280 A260/A230

1 Blank 0,0000 ng/ul 0,000 0,000
2 TM1783_B 33,640 ng/ul 1,801 0,556
4 TM1783_ICA 547,52 ng/ul 2,119 2,158
5 TM783_ACT 464,72 ng/ul 2,129 1,011
6 TM1783_CTR 115,36 ng/ul 2,114 0,278
7 MT577 Duo_B 204,40 ng/ul 2,108 1,469
8 MT577 Duo_ICA 251,08 ng/ul 2,116 1,276
9 MT577 Duo_ACT 173,04 ng/ul 2,124 0,347
10 MT577 Duo_CTR 293,80 ng/ul 2,109 0,630
11 MT577 T1-2_B 35,440 ng/ul 2,085 0,793
12 MT577 T1-2_ICA 399,16 ng/ul 2,112 2,122
13 MT577 T1-2_ACT 372,56 ng/ul 2,111 2,057
14 MT577 T1-2_CTR 408,88 ng/ul 2,111 2,151

16