Animal Behaviour

Usually, behaviours are carried out in response

to internal or external stimulus.
Von Frisch studied the honeybee
communication and described the bee waggle
dance.

1
Fixed action pattern
it is instinctive behavioural sequence that is
highly stereotyped, and species
characteristic.
it produced by the innate mechanism, in
response to a sign stimulus.
Niko Tinbergen, a pioneering researcher of
animal behaviour, studied the egg rolling
behaviour of the Goose as an example of an
FAP.
If one of the gooses' eggs rolls away from the
nest, the goose automatically rolls the egg back
to the nest with a repeated, specific action.

Also, when a male stickleback fish spots

another nearby male, he aggressively deals with
the stranger. The specific stimulus that triggers

2
this fixed action pattern is the red belly
coloration.

Learned behaviours:
Imprinting:
Konrad Lorenz discovered that newly hatched
geese would follow the first moving object they
saw, often Lorenz himself.
It is a form of learning behaviour that happen in
a critical period of time early in an animal's life

3
 Habituation:
It occurs when animals are exposed to the same
stimuli repeatedly, and eventually loss
responding to that stimulus.

Conditioning (associative learning):

it is one type of learning behaviour in which one
stimulus becomes linked to another through
experience.
A) Classical conditioning:
 It is a type of unconscious or automatic
learning by pairing a new stimulus with a
familiar one, an animal can be conditioned to
respond to the new stimulus.
 Ivan Pavlov showed that dogs could be
conditioned to salivate at the sound of a bell if
that sound was repeatedly presented at the
same time that they were given food.

4
B) Operant conditioning (trial and error):
 it is the basis of animal training.
 It attributed to B.F. Skinner.
 animal learns (or, is conditioned) from its
behaviours as it acts (operates) on the
environment.
 rats in boxes containing a lever that would
dispense food when pushed by the rat. The rat
would initially push the lever a few times by
accident, and would then begin to associate
pushing the lever with getting the food. Over

5
 time, the rat would push the lever more and
more frequently in order to obtain the food.

Insight (Reasoning) (problem solving):

 it is the use of past experiences and reasoning
to solve problems.
 A dog is in a room with a small gate to keep him
from leaving. He pushes a box over to the gate
in order to stand on it and jump over the gate.

6
 Social behaviours
Cooperation:
it appears to occur mostly for direct benefit or
between relatives. Spending time and
resources assisting a related individual.

Agonistic Behaviours:
 it is actually an aggressive behaviour.
 It often includes threats or actual combat
among individual animals, whether it is about
food, mating, shelter, or territory.

7
 Dominance Hierarchy:
 a type of social hierarchy that arises when
members of animal social groups interact,
creating a ranking system.
 top-ranked animals get access to resources
without conflict from another animal.

Altruism(kin-selection):
 It is a behaviour that reduces an individual
reproductive fitness (the animal may die) while
increasing the fitness of group or family.
 Kin selection occurs when an animal engages
in self-sacrificial behaviour that benefits the
genetic fitness of its relatives.
 Alarm calls are another popular example of
altruistic behaviours motivated by kin selection.
In certain groups of closely related animals, such
as squirrels and apes, members of the
8
 extended family will call out an alarm signal
when a predator is within striking range.
 vampire bats regularly vomit blood and donate
it to other members of their group who have
failed to feed that night, ensuring they do not
starve.

Communication:
 Animals communicate using signals, which can
include visual; auditory, or sound-based;
chemical, involving pheromones; or tactile,
touch-based, or olfactory, smell-based cues, or
gustatory, taste based.
 Communication behaviours can help animals
find mates, establish dominance, defend
territory, coordinate group behaviour, and care
for young.

9
 Pheromones:
 A pheromone is a chemical that an animal
produces which changes the behaviour of
another animal of the same species.
 Pheromones play a role in sexual attraction
and copulatory behaviour

Mimicry and camuflage

 Camouflage is when a species can change their
colours or patterns to match its environment to
blend in, like a chameleon!
 Mimicry is when a harmless creature makes
itself look dangerous. They "mimic" a more
dangerous species and it makes other animals
afraid to eat them.
10
 Taxis
 Taxis is a form of movement behaviour that
involves movement towards or away from a
stimulus.
 This movement can be in response to light,
known as phototaxis; chemical signals, known
as chemotaxis; or gravity, known as geotaxis.

11
 Endotherm and Ectotherm
Endotherms (mammals and birds) generate
most of the heat they need internally. When it's
cold out, they increase metabolic heat
production to keep their body temperature
constant.
Because of this, the internal body temperature of
an endotherm is constant and independent of
the temperature of the environment.
Ectotherms (fish, amphibian, and reptiles)
body temperature mainly depends on external
heat sources. That is, ectotherm body
temperature rises and falls along with the
temperature of the surrounding environment.

12
 ANIMAL BEHAVIOUR
PRACTICE 1

Questions 1–7
Choose from the list of scientists below.
(A)Niko Tinbergen
(B)Karl von Frisch
(C)B. F. Skinner
(D)Konrad Lorenz
(E)Ivan Pavlov
1.Described the waggle dance in
honeybees
2.Imprinting
3.Trained dogs to salivate at the sound of
a bell
4.Classical conditioning
5.Taught rats in cages to depress a lever
to release food
6.Baby geese followed him everywhere
7.Explained fixed action pattern

1
Questions 8–12
Choose from the terms below.
(A)Fixed action pattern
(B)Habituation
(C)Classical conditioning
(D)Imprinting
(E)Operant conditioning
8.Innate, highly stereotypical behavior that
must continue until it is completed
9.Trial and error learning
10.Sequence of behaviors that is
unchangeable and carried to completion
once initiated
11.Initially, the amoeba moved away from
the strong light; but after a while, it
resumed its normal movement pattern
12.This is the way dogs are trained

13.A sophisticated process in which the

responses of the organism are modified as
a result of experience is called
(A)fixed action pattern

2
(B)habituation
(C)imprinting
(D)classical conditioning
(E)learning

14.This behavior reduces an individual’s

reproductive fitness while increasing the
fitness of the family.
(A)Altruism
(B)Agonistic behavior
(C)Territoriality
(D)Cooperation
(E)Imprinting

15.You want to train your puppy to wait at

the curb until you tell him to cross the
road. Your friend advises you to give your
dog a treat every time he does as you ask.
Your friend is advising that you train the
dog using
(A)operant conditioning
(B)classical conditioning
(C)imprinting
3
(D)fixed action pattern
(E)habituation

16. _______________________ is
learning that occurs during a sensitive or
critical period in early life and is
irreversible for the length of the
period.
(A)Habituation
(B)Operant conditioning
(C)Trial and error learning
(D)Imprinting
(E)Classical conditioning

17.“Mary had a little lamb; its fleece was

white as snow. And everywhere that Mary
went, the lamb was sure to go.” The
behavior of the lamb is best described as
(A)habituation
(B)imprinting
(C)operant conditioning
(D)classical conditioning

4
(E)fixed action pattern
18.Fixed action patterns are initiated by
external stimuli called
(A)fixed action pattern
(B)sign stimuli
(C)agonistic behavior
(D)dominance hierarchies
(E)sensitive periods

19.Animals that help other animals are

expected to be
(A)stronger than other animals
(B)related to the animals they help
(C)male
(D)female
(E)disabled in some way

20.An animal that sacrifices itself for its

relatives is exhibiting
(A)operant conditioning
(B)kin selection
(C)classical conditioning
5
 (D)imprinting
(E)habituation

21. Zygops rufitorquis, a slow-moving weevil, has

the same markings as a flesh fly, a fast-flying
insect that is difficult for predators to catch. This is
an example of which of the following biological
phenomena?
(A) The founder principle.
(B) Allopatric speciation.
(C) Adaptive radiation.
(D) Directional selection.
(E) Mimicry

6
 ANIMAL BEHAVIOUR PRACTICE 2

1) This training is
referring to:
A. Operant conditioning.
B. Classical conditioning
C.Imprinting.
D.Fixed action pattern.
E. habituation

questions from 2 to 4…
Choose from the listed phenomena:
A.Imprinting
B. Classical conditioning
C.Fixed action pattern
D.Altruism
E. Operant conditioning
 2) Geese hatchlings follow the first thing
they see.
3) Innate, highly stereotypical behaviour,
which, once begun, is continued to
completion no matter how useless.
4) Trial and error learning

5) A farmer put a scarecrow in his field to

prevent birds from eating his crops. When
birds first saw the scarecrow, they got
scared and flew away. After encountering
the scarecrow several times, the birds
showed no reaction and remained in the
field. This can be explained by:
6) imprinting
7) habituation
8) classical conditioning
9) innate behaviour
10) operant conditioning

11) An example of a fixed action pattern is:

A. when a person sees lightning and shuts his
ears because of the thunder that will follow.
B. ducklings following their mother everywhere
she goes.
C. a turtle stops retreating into its shell after
several taps on it.
D. stickleback fish attack other male fish only if
they have a red belly.
E. training dogs using treats.

12) Geese hatchlings follow the first thing

they see. This is (a/an)
A. imprinting.
B. classical conditioning.
C. fixed action pattern.
D. altruism.
E. Conditioning

13) Birds on the sides of the road take flight

when a car approaches. After many cars
pass without harming the birds, the birds
do not fly anymore when a car
approaches. This is an example of
A.Classical conditioning
B. Operant conditioning
C.Imprinting
D.Habituation
E. Insight learning
 14) Young birds follow the first moving
object they see after they are born. This
is
A. Classical conditioning
B. Operant conditioning
C. Imprinting
D. Insight learning
E. Habituation

15) Konrad Lorenz investigated a learning

mechanism. He explains that it’s a
learning that occurs during sensitive or
critical periods in early life and it cannot
be reversed. This is considered as:
A. Habituation
B. Operant conditioning
C. Trial and error learning
D. Imprinting
E. Classical conditioning

16) The Amur bitterling are fish that live in

rivers. At the time of reproduction, the
female develops a long tube called the
egg laying tube. When a male meets a
female with this tube, he swims around
her and guides her to a freshwater
mussel. The female deposits her eggs
(30 to 40) in the respiratory cavity of the
mussel using her laying tube. The male
thus releases his sperm near the mussel.
The nature of the stimulus is:
A.Visual
B. Auditory
C.Olfactory
D.Gustatory
E. Both visual and auditory
 Evolution

Evolution is the change in gene pool (allele frequency)

that occur only in. population over time
Population: all members of one species in one
place.
Species: members can interbreed and produce
fertile offspring.
Microevolution vs macroevolution:
 Microevolution happens on a small scale (within
same species).
 macroevolution happens on a scale that
transcends the boundaries of a single species
(converting to other species).

1
 Evidence of evolution
Fossil record
 it provides evidence for the evolutionary change
through now extinct forms that led to modern species.
 99% of all organisms that ever lived on earth are now
extinct.
 Radioactive dating is a process by which the
approximate age of an object is determined through
the use of certain radioactive nuclides.
 A transitional fossil is any fossilized remains of a life
form that exhibits traits common to both an ancestral
group and its derived descendant group.
 Archaeopteryx as a transitional fossil between
dinosaurs and modern birds.

Comparative biochemistry:
 the study of evolutionary relationships or similarities
in biological processes among living organisms.
 It employs genes (nucleotide sequence), and proteins
(amino acid sequence).

2
 Organisms that have a common ancestor will have
common biochemical pathways.
 Humans and mice are both mammals. So medical
searchers can test new medicines on mice and
extrapolate the results to humans.

Comparative embryology:
 the study of similarities in embryos of different
species.
 Similarities in embryos are evidence of common
ancestry.
 All vertebrate embryos, for example, have gill slits
and tails.

3
 Comparative biogeography:
 The study of where organisms live now, and where
their ancestors lived in the past.

 About 200 million years ago, all the continents on

Earth were actually one huge "supercontinent"
surrounded by one enormous ocean. This gigantic
continent, called Pangaea, slowly broke apart and
spread out to form the continents we know today.

Comparative anatomy:
 it determines evolutionary relationships between
organisms and whether or not they share common
ancestors.
 Anatomical similarities between organisms support
the idea that these organisms evolved from a common
ancestor.

4
 A) Analogous B) Homologous
structure structure
same function different function

Different structure Same structure

Different ancestry Same ancestry

(convergent evolution) (Divergent evolution)

Ex: wings of bat, bird, and Ex: forelimbs of vertebrates

butterfly

5
C) vestigial structure:
body structure that greatly reduced in
function(useless) that may have been useful in
ancestor. Ex: appendix. Wisdom teeth, coccyx. Ear
muscle femur bone in whale.

Heterotroph hypothesis
first cells were anaerobic prokaryote
heterotrophic and would have fed on organic
molecules that had been made without cells.
Theory of endosymbiosis
organelles such as chloroplasts and mitochondria
were free-living prokaryotes which lived symbiotically
within larger heterotrophic prokaryotic cells, forming
modern day eukaryotic cells.

6
Earth is about 4.6 billion years old.
life started in water.
first prokaryotic cell evolved about 3.5 billion
years ago.
First prokaryotic cells evolved to eukaryotic cell
about 1.5 billion years ago.
Cambrian explosion part of the Palaeozoic era,
happened 540 million years ago, when most of the
major groups of animals first appear in the fossil
record.

Amphibians, reptiles, mammals, and birds evolved

after fish.

7
Several characters enabled animals and plants to
move to land:
In animals:
1) Appearance of lungs.
2) Appearance of limbs to move out.
3) Skin to keep animals from dehydration.
4) Internal fertilization.
5) Hard shell to protect egg.
In plants:
1) Root anchor plants in soil to absorb water.
2) Vascular tissue to transport water upward.
3) Waxy substance protects leaves from dehydration.
4) Seeds have hard coat to protect embryo and its
food.

8
 Oparin - Haldane Hypothesis
The Oparin-Haldane hypothesis suggests that life
arose gradually from inorganic molecules, with
“building blocks” like amino acids forming first and
then combining to make complex polymers.
Miller-Urey experiment

Ancient environment consisted of CH4(methane),

NH3(ammonia), H2O, and H2, but lack free oxygen.
Intense heat, lightning, and U.V. radiation in primitive
atmosphere provided energy for chemical reactions
that produced first cell.
Urey and Miller are scientists mimic this early
atmosphere to determine how first molecules and
early life developed.
9
 Theories of evolution

Spontaneous generation:
The theory of spontaneous generation held that living
creatures could arise from non-living matter.
Francesco Redi concluded that the flies laid eggs on
the meat in the open jar caused the maggots.
If the flies could not lay eggs on the meat in the
covered jar, no maggots were produced.
Redi proved that decaying meat did not produce
maggots.

Louis Pasteur boiled a meat broth in a swan neck

flask,
the bend in the neck of the flask prevented falling
microbes from reaching the broth.
Only bottle with broken neck will show microbial
growth from the air.

10
Gradualism:
Darwin states that organisms descend from a
common ancestor gradually.
Big changes occur by accumulation of many small
ones.
Scientists abandoned this theory because traditional
fossils are rarely found.

Punctuated Equilibrium:
Stephen Gould and Niles Eldridge proposed
that new species arise suddenly after long period of
stasis.
Fossil record confirms this model.

11
Use and Disuse: (individual evolution)
Lamarck theory relied on ideas of inheritance of
acquired characteristics
He states that individual organisms change in
response to environment.
As giraffe developed a long neck to eat leaves of tall
acacia tree, and pass this acquired trait of elongated
neck to their offspring.

Weismann disapprove this theory by cutting tails

of 22 generations of mice, but he found that size of
tails in subsequent generations was not affected.

12
Natural selection (the modern
theory of evolution):
Darwin proposed that frequency of an allele in
population can change due to selective advantages.
This theory includes following points:

1)Over production: populations tend to grow

exponentially, to over populate and exceed their
resources.

2)Variation:
 living organisms differ in size, colour, strength…
etc. some individuals have more favourable
variations.
 Variation is the raw material of natural selection.

3)Struggle for existence: living organisms

compete for food, water, space, and other
requirements in environment.

4)Survival of the fittest: degree of fittest is

measured by ability of an individual to survive and
reproduce.
Best-fit individuals survive and pass on their traits to
offspring.

13
 Examples of natural selection

A) Giraffe and long neck:

Ancestral giraffes were short-necked, although neck
length varied individually.
Giraffe population competed for limited food.
Taller individuals had better chance of surviving than
shorter necks.
Over time, proportion of long-neck giraffes increase
until only long neck giraffe exists. (No individual giraffe
neck grew, average length of neck changed in the
population).

B) Peppered Moth colour:

Until 1800 in England, most peppered moths were
light coloured, but dark individuals were rarely found.
With increasing industrialization, smoke and soot
polluted the environment, making all plants and rocks
black.
In 1950, all moths were dark, few light coloureds
were found. Before industrial revolution, white

14
 moths were camouflaged while dark moths were
easy prey for predators. After the environments
darkened by pollution, Dark moths were
camouflaged and had selective advantage.

C) Drug Resistance:
Antibiotic kill only susceptible bacteria, while resistant
individuals survive to reproduce.

15
 Types of natural selection

Directional selection: a mode of natural

selection in which a single extreme phenotype is
favoured, causing the allele frequency to continuously
shift in one direction.
 Natural selection for long giraffe nick, against short
neck.

Stabilizing selection: a type of natural

selection in which genetic diversity decreases as the
population stabilizes after the intermediate trait was
favoured.
 Human Infants with low birth weight will be weak and
experience health problems, while large babies will
have problems passing through the birth canal.
Babies with average birth weight are more likely to
survive than a baby that is too small or too large.

Disruptive selection: (or diversifying

selection) a mode of natural selection in which both
extreme phenotypes are favoured over intermediate
values
 Light-coloured oysters would blend into the rocks,
and the darkest would blend better into the shadows.
The ones in the intermediate range would show up
against either backdrop, offering those oysters no
advantage and make them easier prey.

16
17
 Causes of variation in population

Mutation:
It is Change in genetic material, and the raw material
for variation that is the raw material for evolution.

Genetic Drift:
Change in gene pool due to chance, it is two types:

A.Bottle Neck effect:

Natural disasters such as fire, earthquake, and flood
reduce size of population, resulting in loss of genetic
variation especially in small population.

18
B.Founder Effect:
it is the reduction in genetic variation that results
when a small subset of a large population is used to
establish a new colony(migrate).
The new population may be very different from the
original population, both in terms of its genotypes
and phenotypes.

Gene Flow:
Movement of alleles into or out of population.
It occurs as a result of migration of fertile individuals or
gametes between populations.
For example, pollen carried by wind across mountain
between two valleys.

19
 Population Stability

HARDY-WEINBERG EQUILIBRIUM

The Hardy-Weinberg equilibrium is a principle stating

that the allele frequency in a population will remain
constant (no evolution) from one generation to the
next in presence of some factors:
1_ population must be very large.
2_ population must be isolated.
3_ no mutation.
4_ mating must be random.
5_ no genetic drift.
6_ no natural selection.

20
 Reproductive Isolation and speciation
Speciation is the process by which new species form.
It occurs when groups in a species become
reproductively isolated.

Geographic isolation:
Occur when species are separated by mountains,
canyons, rivers or glaciers. That cause isolation
between species

Polyploidy:
many flowering plants, and majority of ferns are
polyploid.
Polyploid organisms cannot breed with organisms that
are not polyploid, and isolated from them.

21
 Temporal isolation:
Individuals of different species do not mate because
they are sexually active at different times of day or in
different seasons.

Habitat isolation:
occurs when different habitat lowers the probability of
mating between individuals.

22
 Behavioural isolation:
it occurs when populations begin to develop different
behaviours that are not preferred by members in another
population.

Patterns of evolution

Coevolution:
It is the evolutionary change in interacting
populations over time resulting from the
interactions between them.
For example, pollinator-plant
relationships(mutualism). Honeybee that lives on
nectar of flower, flower has tripping mechanism that
arches stamens (male part) over bee and dust it with
pollen. Some of bees will rub off into pistil (female part)
of another flower.

23
 Parallel evolution:
it is the similar development of a trait in distinct species that are
not closely related, but share a similar original trait in response
to similar evolutionary pressure.

Adaptive radiation:
it is emergence of numerous species from a single common
ancestor.
Darwin discovered 14 species of finches each filling a
different niche. They all evolved from single ancestral species.

24
 The phylogenetic tree
A phylogenetic tree (also phylogeny or evolutionary tree)
is a branching diagram or a tree showing the
evolutionary relationships among various biological
species or other entities based upon similarities and
differences in their physical or genetic characteristics.

Types of diversity

25
A biodiversity hotspot is a biogeographic
region that is both a significant reservoir of biodiversity
and threatened with destruction.by human..

Artificial selection
Artificial selection is the identification by humans of
desirable traits in plants and animals, and the steps
taken to enhance and perpetuate those traits in future
generations.

26
27
 EVOLUTION
PRACTICE 1

1.All of the following statements about evolution

are true EXCEPT
(A)evolution occurs more rapidly at some times
than at others
(B)evolution is directed by changes in the
environment
(C)evolution is not always from the simple to the
complex but may act in such a way that complex
forms give rise to simpler ones
(D)single organisms, as well as populations, do
commonly evolve
(E)evolution is not always a slow, gradual process

2.According to the Hardy-Weinberg theory, which

of the following represents a homozygous
dominant individual?
(A) p
(B) q
(C)p2

1
(D)q2
(E)2pq

3.All of the following are part of the

HardyWeinberg theorem, which describes a
stable, nonevolving population, EXCEPT
(A)natural selection exists
(B)mating must be random
(C)no mutations can occur in the population
(D)the population must be isolated from others
(E)the population must be large

4.Which of the following is a transition fossil?

(A)Reptiles
(B)Amphibians
(C)Archaeopteryx
(D)Fish
(E)Apes

5.All of the following are part of Darwin’s theory of

natural selection EXCEPT
(A)populations tend to overpopulate
2
(B)in any population, there is unequal ability
among individuals to survive and to reproduce
(C)only the best-fit individuals survive and get to
pass on their genes
(D)overpopulation leads to a struggle for existence
(E)organisms change in response to a need in the
environment

6.All the following are true of homologous

structures EXCEPT
(A)they demonstrate common ancestry
(B)an example is the wing of the bat and a
person’s arm
(C)an example is the wing of the bat and the wing
of a fly
(D)they are not the same thing as analogous
structures
(E)an example is the whale’s lateral fin and a
person’s arm

Questions 7–12
Choose from the list of terms below.
(A)Charles Darwin
3
(B)Lamarck
(C)Stephen J. Gould and Niles Eldridge
(D)Oparin and Haldane
(E)Hardy-Weinberg
7.Inheritance of acquired traits
8.Use and disuse
9.Theory of punctuated equilibrium
10.Populations tend to overpopulate
11.Hypothesized that under conditions that existed
in early Earth, organic molecules could form
12.Survival of the fittest
__________________________________
13.The age of Earth according to scientific
evidence is closest to (A)4,000 years old
(B)600 years old
(C)6,000 years old
(D) 4 million years old
(E) 4 billion years old

14.Pangaea is a
(A)transition fossil

4
(B)molecule that is commonly analyzed and used
to show which organisms are related
(C)species of bacteria that is resistant to all
antibiotics
(D)vestigial structure
(E)single supercontinent that existed 250 million
years ago

15.Which of the following is an example of

divergent evolution?
(A)Wildebeests separated from each other by a
newly formed river are now separate species.
(B)Whales and fish have a streamlined
appearance because they evolved in the same
environment.
(C)Insects and the flowers they pollinate have
evolved together over millions of years.
(D)Polydactyly, having extra fingers, is common in
the Amish of Pennsylvania.
(E)Change occurs in the gene pool due to chance.

Questions 16–20
Choose from the terms below.
5
(A)Geographic isolation
(B)Polyploidy
(C)Reproductive isolation
(D)Adaptive radiation
(E)Directional selection
16.Darwin discovered 14 species of finches on the
Galapagos Islands that all evolved from one
original species of finch
17.Having extra sets of chromosomes in every cell
18.The peppered moths are one example
19.Two populations of one species evolved into
two separate species after being separated for
millions of years by a canyon
20.A very small dog and a very large dog cannot
mate because of the enormous size difference of
the two animals

21.According to the theory of endosymbiosis,

(A)autotrophic cells were the first to evolve
(B)heterotrophic cells were the first to evolve
(C)chloroplasts evolved from mitochondria
(D)mitochondria evolved from chloroplasts

6
(E)chloroplasts and mitochondria evolved when
free-living prokaryotes permanently took up
residence inside larger prokaryotic cells

22. Which of the following events happened

earliest in evolutionary history?
(A) The appearance of reptiles.
(B) The appearance of insects.
(C) The appearance of birds.
(D) The appearance of mammals.
(E) The extinction of dinosaurs.

23. Many years ago, a group of islands off the

coast of South America were colonized by a single
species of finch from the mainland. Each island
now is inhabited by a different species of finch, all
of which are descendants of the original colonizing
species. This is an example of:
(A) Convergent evolution.
(B) Adaptive radiation.
(C) Symbiosis.
(D) Succession.
(E) Continental drift.
7
24. In a population of seed-eating birds, the supply
of medium-sized seeds decreases and the bird
population becomes two separate populations:
one with larger beaks and one with smaller beaks.
This demonstrates which of the following?
(A) Sexual selection.
(B) Stabilizing selection.
(C) Directional selection.
(D) Disruptive selection.
(E) Genetic drift.

25. A population of seed eating birds with beaks

that are suited to average-sized seeds best
demonstrate the results of:
(A) Inheritance of acquired characteristics.
(B) Genetic drift.
(C) Stabilizing selection.
(D) Directional selection.
(E) Disruptive selection.

26. Which of the following is LEAST likely to be a

threat to the survival of a species?
(A) Environmental pollution.
8
(B) Genetic homogeneity.
(C) Random mating.
(D) Reduction of habitat.
(E) Interspecific competition.

27. According to the concept of Darwinian fitness,

the fittest individual is the one who (A) Lives
longest.
(B) Spends the most time in courtship.
(C) Is the strongest individual in its population.
(D) Can escape predators most easily.
(E) Has the most surviving fertile offspring.

28. Punctuated equilibrium, as distinct from

gradualism, is best described as which of the
following?
(A) The number of species that appear in a
defined period of time.
(B) The abrupt appearance of species, followed
by periods of little morphological change.
(C) The accumulation of genetic changes over
time, resulting in the eventual formation of new
species.
9
(D) The region of the world where speciation
events have occurred in great numbers.
(E) The geological era in which speciation has
occurred with greatest frequency.

29. The age of the Earth is about _____ years,

and life has existed on the Earth for ____ years.
(A) 3.5 billion, 2.5 billion
(B) 3.5 billion, 1.5 billion
(C) 15 billion, 3.5 billion
(D) 4.5 billion, 600 million
(E) 4.5 billion, 3.5 billion

30. Two animal populations are considered to be

of the same species if their members
(A) Eat the same food
(B) Can live in similar ecological niches
(C) Can interbreed to produce live, fertile offspring
(D) Breed within the same geographic area
(E) Migrate to new locations at the same time of
year

10
31. According to most scientific theories of the
origin of life, the first organisms were (A)
Eukaryotic.
(B) Parasitic.
(C) Symbiotic.
(D) Anaerobic.
(E) Pathogenic.

32. The term "adaptive radiation" refers to the

(A) Ability of one species to adapt to only one
niche.
(B) Ability of a species to adapt itself to rapidly
changing conditions.
(C) Evolution from a single ancestral species into
several species adapted to various environments.
(D) Ability of a species to adjust its temperature
by radiating heat.
(E) Advantages of radial symmetry to a stationary
species.

33. Homologous structures, which have similar

underlying structures but may have different
functions, are formed by

11
(A) Divergent evolution
(B) Speciation
(C) Segregation
(D) Convergent evolution
(E) Stabilizing selection

34. The best definition of a species is

(A) A group of organisms that occupy the same
niche
(B) A population that works together to defend
itself from predators
(C) A group of organisms that can mate with each
other
(D) A population that preys on other populations
(E) A population where all members benefits from
the association in some way

12
 EVOLUTION
PRACTICE 2

1)Our common ancestors had a tail and a

large appendix to aid in their high
cellulose diet. Nowadays, instead of a
tail, we have a useless tail bone and a
small appendix which does not function
anymore. All of these are examples of:
A.vestigial structures
B. homologous structures
C.analogous structures
D.fossils
E. comparative biochemistry

2)New predators were introduced to a

forest inhabited by squirrels. The
squirrels that were smaller in size had
the advantage of running faster and
hiding better compared to bigger
squirrels that were easily captured and
killed by the predators. Small squirrels
survived longer and produced more
offspring than bigger squirrels. What
type of natural selection is presented in
this case?
1
 A.divergent selection
B. convergent selection
C.stabilizing selection
D.disruptive selection
E. directional selection

questions from 3 to 5….

Each set of lettered choices below refers to
the numbered questions or statements
immediately following it. Select the one
lettered choice that best answers each
question. A choice may be used once, more
than once, or not at all in each set.
A. Comparative Anatomy
B. Comparative Biochemistry
C. Comparative Embryology
D. Comparative Physiology
3) In fish, gill pouches develop into gills while
in humans they develop into Eustachian
tubes.
4) Based on the amino acid differences in
cytochrome c between different species,
scientists can tell whether two organisms are
related.
5) Whales and cats have common ancestry
because their limbs have similar bone
structures.
2
6) Charles Darwin, the father of evolution
describes the mechanism of natural selection
as survival of the fittest. What is meant by
"fittest"?
A. As organisms adapt to new environments,
they gain new traits and can pass them to
their offspring.
B. Organisms that are physically the
strongest and the fastest from escaping
predators are the fittest.
C. Organisms that have acquired traits that
allow them to live the longest and healthiest
compared to their counterparts are the fittest.
D. Organisms that are capable of reproducing
and passing their traits to their offspring are
the fittest.
E. Organisms that are capable of evolving
quickly are the fittest

7)The frequency of the recessive homozygote

genotype of having a hitchhiker’s thumb is
0.09. What would the percentage of
individuals being homozygous for the
dominant allele be assuming the Hardy-
Weinberg equilibrium is respected in the
population?
3
 A.91%
B.70%
C.33%
D. 49%
E.1%

8)84% of mice DNA is homologous to human

DNA. Which of the following statements
provides the best explanation for this
observation?
A.Humans and mice have the same number
of chromosomes.
B. The morphologies of humans and mice are
similar.
C.Humans and mice share the same
ecological niche.
D.Humans and mice share a very recent
common ancestor.
E. The high degree of homology is the result
of convergent evolution

4
9)The most primitive characteristic in this
cladogram is
A. Multicellular.
B. Eukaryotic.
C.Opposable thumb.
D.Vertebral column.
E. Placenta.

10) Choose the members of the mammal

clade in this cladogram.
A. hawk, koala, camel, human
B. shark, hawk
C. koala, camel, human
D. camel, human
E. shark, hawk, koala, camel, human

5
11) Which organism possesses
characteristics that evolved more
recently?
A. human
B. camel
C. koala
D. hawk
E. Paramecium

12) Several species of frogs are capable of

hybridization, but none do because the
breeding season of the frogs with red
legs lasts from November to late April
while the other species of frogs with
yellow legs have a breeding season
that lasts from late April to June. This
best describes an evolutionary process
known as
A. survival of the fittest.
B. overpopulation.
C. reproductive isolation.
D. artificial selection.
E. Temporal isolation.

13) In a certain population of goats, there

are two alleles for coat color: brown
6
 and white. Brown is dominant and
white is recessive. The frequency of
white-colored goats is 20% during
spring season. Wolves are also present
in the area, and goats constitute a
major portion of their diet. Wolves
recognize prey when they do not blend
into the environment. stabilizing
selection. What is the frequency of the
allele for brown coat color in the goats?

A. 0.09
B. 0.03
C. 0.3
D. 0.6
E. 0.9

14) In this population of goats, what

percentage is hybrid brown?
A. 7%
B. 48%
C. 50%
D. 81%
E. 91%

7
 15) If the climate were to change so that
snow covered the ground much of the
time, what change in the population of
goats would you expect?
A. The frequency of white allele would
increase.
B. The frequency of white allele would
decrease.
C. The frequency of brown allele would
increase.
D. The population of goats would decrease
and then increase.
E. The population of goats would increase
and then decrease.

16) The wings of the bird and wings of the

bee are ________________ while the
arm of the monkey and the flipper of the
whale are _____________.
A. Homologous structures, analogous
structures
B. Analogous structures, vestigial
structures
C. Analogous structures, homologous
structures

8
 D. Homologous structures, vestigial
structures
E. Vestigial structures, homologous
structures

17) Speciation is the result of

I. Random mating
II. Temporal isolation
III. Geographic isolation
IV. No mutation in the population
A. I only
B. II only
C. I and IV
D. II and III
E. I, II and III

18) Which statement is true about evidence

of evolution?
I. Closely related organisms go through
similar stages in their embryonic
development.
II. Closely related aerobic organisms
have cytochrome c with an identical chain
of amino acids.
III. Organisms that have common
ancestors have common biochemical
pathways.
9
A. I only
B. II only
C. I and II
D. II and III
E. I, II and III

Questions from 19 to 23 …...

A genetic condition is controlled by 2
alleles dominant “S” and recessive “s”.
This genetic condition affects only
homozygous recessive individuals. In a
population of size 10,000, there are 36
affected individuals.

19) The frequency of q is

A.94 %
B. 6%
C.0.36%
D.88.36%
E. 11.28 %

20) The frequency of p is

A. 6%
B. 0.36 %
C. 11.28 %
D. 94 %
E. 88.36 %
10
21) The frequency of SS (homozygous
dominant)
A. 0.36%
B. 88.36%
C.94 %
D.6%
E. 11.28 %

22) The frequency of ss (homozygous

recessive)
A. 88.36%
B. 11.28 %
C. 94 %
D. 6%
E. 0.36%

23) The frequency of Ss (hybrid)

A. 6%
B. 0.36%
C. 88.36%
D. 11.28 %
E. 94 %

24) The heterotroph hypothesis states

11
 A. First cells on Earth were anaerobic
heterotrophic prokaryotes
B. First cells on Earth were aerobic
heterotrophic prokaryotes
C. First cells on Earth were anaerobic
heterotrophic eukaryotes
D. First cells on Earth were aerobic
autotrophic prokaryotes.
E. First cells on Earth were aerobic
autotrophic eukaryotes

Questions from 25 to 30 …..

Choose from the list of terms below:
A. Charles Darwin
B. Lamarck
C. Stephen J. Gould and Niles Eldridge
D. Oparin and Haldane
E. Hardy-Weinberg
25) Inheritance of acquired traits
26) Use and disuse
27) Theory of punctuated equilibrium
28) Populations tend to overpopulate
29) Hypothesized that under conditions that
existed in early Earth, organic molecules
could form
12
30) Survival of the fittest

31) Wildebeests separated from each other

by a newly formed river are now separate
species. This fact corresponds to:
A. Divergent evolution
B. Convergent evolution
C. Coevolution
D. Parallel evolution
E. Genetic drift

32) The upland chorus frog and the European

frog can interbreed but never do, since the
upland chorus frog mates during winter time
while the European frog mates during
summer. What type of an evolutionary
process does this example represent?
A. geographic isolation
B. habitat isolation
C. behavioural isolation
D. reproductive isolation
E. temporal isolation

13
questions 33 and 34 ….

33) The figure above represents which of

the following principles of evolution?
I. natural selection
II. survival of the fittest
III. variations within species
A. I only
B. I and III only
C. II and III only
D. I, II and III
E. III only

34) What principle of natural selection is

demonstrated in the example shown in the
figure?
A. disruptive selection
B. diversifying selection
C. directional selection
D. stabilizing selection
E. speciation
14
35) What do the ladybugs in the image
below represent?

A. species diversity
B. ecosystem diversity
C. genetic diversity
D. community diversity
E. species richness

36) Kangaroos, mice, koalas,

Tasmanian wolves and Marsupial rats all
emerged from an ancestral mammal and
varied in terms of the survival traits they
possessed. Which one of these patterns
of evolution applies to this example?
A. Convergent evolution.
B. Divergent evolution.
C. Adaptive radiation.
D. Parallel evolution.
E. Co-evolution.

15
37) Life started on Earth about 3.8 billion
years ago under harsh environmental
conditions. Which type of cell was most
probably the first cell ever to form on
Earth?
A. prokaryotic and autotroph
B. prokaryotic and heterotroph
C. eukaryotic and photosynthetic
D. eukaryotic and autotrophic
E. prokaryotic and photosynthetic

38) All of the following are correct about

evolution EXCEPT:
A. Geographic isolation can cause the
formation of new species.
B. The best-adapted organisms survive.
C. If the environment changes suddenly and
an organism is not adapted for the new
environment, it might die.
D. New combinations of alleles can produce
new phenotypes.
E. Single individuals, not populations, can
change in response to a changing
environment.

39) Several species of rhododendron

are growing in the same area. All of the
16
 plants are capable of hybridization, but
none ever do because some of them
produce pollen in early June while others
produce pollen in late June. This best
describes an evolutionary process known
as:
A. Survival of the fittest
B. Overpopulation
C. Reproductive isolation
D. Artificial selection
E. Stabilizing selection

40) A gene pool in a population of

jackrabbits in a field remained constant
for many generations. The most probable
reason for this stable gene pool is that:
A.No migration occurred in a large
population with random mating and no
mutations.
B. No migration occurred in a small
population with random mating and no
mutations.
C.No migration occurred in a large
population and no mutations but
mating was not random.
D.migration occurred in a large
population and no mutations but
mating was random.
17
 E. migration occurred in a large
population and no mutations but
mating was random.

41) Two distinctly different beak sizes

occur in a single population of finch called
the black bellied seed cracker. These
birds live in an isolated region in West
Africa; the oldest inhabitants of the region
remember that all these finches used to

have the same length beak. This change

in the population is shown by this graph.
The best explanation for change in beak size:
A. Mutation.
B. Stabilizing selection
C. Genetic drift
D. Diversifying selection
E. Directional selection.

18
42) Scientists believe that the giraffe
originally had a short neck that has
grown longer over time. The most likely
explanation of this is
I. Natural selection
II. Adaptive radiation
III. Divergent selection

A. I
B. I and II
C. I and III
D. II and III
E. I, II, and III

43) Farmers have successfully bred

Brussels sprouts, broccoli, kale, and
cauliflower from the mustard plant. This
demonstrates:
A. Convergent evolution
B. Coevolution
C. Adaptive radiation
D. Natural selection
E. Artificial selection

44) A fungus infection affected nearly all

the oak trees in a particular forest so that
the coloration of the bark turned almost
19
 black. Scientists studying the ill trees
discovered that a moth population that
inhabited the forest changed from being
light brown to being almost black.
Which of the following would best explain
that color change of the moth
population?
A. The moth developed darker wings to
blend in with the trees.
B. The fungus infected the moth as well as
the oak trees.
C. The almost black moth, within the
population, were the only ones to survive
once the trees darkened because of the
fungus infection.
D. The moths were the first to change color,
which caused the trees to darken.
E. The fungus caused mutations to occur in
the moth as well as the oak trees.

45) After taking a one-week course of

an antibiotic for an ear infection, a
woman was told that she still had the
infection and that she would have to take
a course of a different antibiotic. What is
the best explanation for the fact that the
first antibiotic did not work?
20
 A. The woman became immune to the
antibiotic.
B. The bacteria that caused the infection
became immune to the antibiotic.
C. Taking the first antibiotic killed off all the
bacteria that were susceptible to it,
leaving only those that were resistant.
D. The woman contracted another infection
because there are no bacteria that are
resistant to antibiotics.
E. The woman’s hormones probably
interfered with the functioning of the
antibiotic.

46) Pangea is:

A. Transition fossil
B. Molecule that is commonly analyzed and
used to show which organisms are related
C. Species of bacteria that is resistant to all
antibiotics
D.Vestigial structure
E. Single supercontinent that existed 200 million
years ago.

47) Kangaroos, mice, koalas, Tasmanian

wolves and Marsupial rats all emerged
from an ancestral mammal and varied in
21
 terms of the survival traits they
possessed. Which one of these patterns
of evolution applies to this example? A.
divergent evolution
B. convergent evolution
C.parallel evolution
D.coevolution
E. adaptive radiation

48) Lisa suffered from a bacterial infection

and her doctor prescribed her an
antibiotic of 20mg/day to be taken over
10 days. After 5 days, Lisa felt better so
she decided to stop taking the antibiotic.
The graph below shows the number of
bacteria found in Lisa as she was taking
her antibiotic over several days. What

can
be concluded from this graph and your
knowledge about the topic?
22
A. the number of bacteria after 5 days was
very low and would no longer harm
Lisa.
B. after 5 days, the effect of the antibiotic
remains high in the body and sufficient to kill
all bacteria.
C. stopping after 5 days could make the
bacteria resistant to treatment and worsen
the individual’s health.
D. Lisa felt better after 5 days, she should stop
taking antibiotics since it can do more harm
than good to the body.
E. There is no sufficient information to make an
appropriate conclusion.

49) A forest with several different species of

rabbits had a huge fire that killed most
of the different populations of rabbits
allowing only a small, random
assortment of survivors to escape to a
different area. This is an example of
which one of these terms?
A. genetic drift
B. founder’s effect
C. bottleneck effect
D. A and B
E. A and C
23
 Ecology
Ecosystem organization

1
Properties of population:
Population size: it is the total number of individuals.

Population density: refers to the size of any

population in relation to unit of space.it is population
size divided by area.

Natality:
Natality refers to the rate of reproduction or birth per
unit time.
Mortality:
Mortality refers to the number of deaths in population
per unit time.
Dispersion: is the pattern of individuals in a
population. It is three types:

2
 Net Population Growth:
It is how the size of the population is changing over time.

 Zero population growth is the absence of population

growth in which equal birth and death rates create a
stable human population.

Age structure:
the proportionate numbers of persons in successive age
categories in a given population.

 The demographic transition is a long-term trend of

declining birth and death rates, resulting in
substantive change in the age distribution of a
population.

3
 Population growth

Exponential (unrestricted) growth:

It happens in population with no predation, no
parasitism, no competition, no emigration, and the
environment with unlimited resources. Ex, human
population, and bacteria population in lab.

Logistic (restricted) growth:

There is a limit to number (maximum number) of
individuals that can occupy one area at certain time
(Carrying Capacity).
In Carrying Capacity, birth rate is equal to death
rate. Ad it can change as the environmental
conditions change.

4
Reproductive strategists

5
Limiting factors control population size
Density independent limiting factors that
are environmental factors, most of them are
abiotic (non-living factors) such as weather,
natural disasters, and pollution, etc.

Density dependent limiting factors that

increase as the population density increase, such
as predation, competition and diseases caused by
parasites.

Types of population interaction

Competition:
o Ecological competition is the struggle between
two organisms for the same resources within an
environment.
o one of the species will become extinct, and one
will compete over to take advantage of
resources.
o the organisms that compete must be sharing the
same ecological niche (role or interaction
of organism in the environment).
o Paramecium caudatum and paramecium aurelia
when cultured separately, each population grow
rapidly and levelled off at carrying capacity.

6
when they cultured together, p.aurelia has
advantage and drive the other species to
extinction.

Predation:
It refers to one animal eating another animal, or
animal eat plants.
There is an alternative evolutionary relationship
between predator and prey. This known as
Coevolution where evolution of one species
depends on evolution of other species.

7
 Symbiosis:
It is long-term relationship between organisms of
different species living together.
It is 3 types:

Successful parasite does not kill its host.

8
 Food chain
It is Pathway along which food transfer from one
tropic level to another.
maximum number of trophic levels are 4 or 5
levels.

9
 Autotrophs are two types:
• Photoautotrophs are those organisms which
derive their energy from light by photosynthesis.
• Chemoautotrophs are organisms that obtain
energy by oxidising inorganic chemical
compounds by chemosynthesis.
10
 Hydrothermal vents are places where seawater
exits cracks in the sea floor, having been super-
heated and enriched with metals and minerals deep
in the underlying bedrock.

11
 Decomposers are a group of organisms that
essentially break down (recycle) decaying
organic matter. There are two major groups of
decomposers:
 detritivores that feed on dead plant and animal
matter and then digest them within their bodies in
order to gain nutrients and energy. E.g., insects and
worms.

 saprotrophs are a type of decomposers that

secrete extracellular enzymes into dead organic
matter, decompose them and absorb nutrients.

Energy in the form of food, moves from

producers to herbivores to carnivores.

12
10% of energy transfer to next trophic level
in form of organic matters.
90% loss of energy used in respiration as heat.
Also, biomass decrease shrinks with each
trophic level.

13
 Keystone species
Keystone species are those which have an extremely
high impact on a particular ecosystem relative to
its population.
Keystone species are also critical for the overall
structure and function of an ecosystem, and
influence which other types of plants and animals
make up that ecosystem. Thus, in the absence of a
keystone species, many ecosystems would fail to
exist.

14
 Food web
Food chains are not isolated; they are interwoven
with other food chains to form food web.
An organism can one trophic level in one food
chain and a different trophic level in another food
chain.

15
 Biological magnification
Biological magnification, or biomagnification, is the
increasing build-up of toxic substances within
organisms that happens at each stage of the food
chain.

16
 Ecological Succession
It is a total replacement of populations with
others.
lichens (symbiont consisting of algae or
cyanobacteria with fungi) are pioneer
organisms that introduced to area as spores by
wind, and can grow on bare rock. Pioneer
organisms replaced by mosses, grasses,
bushes, and trees.
Climax community: the final stable community
that remains.
Succession is two types:
Primary succession Secondary succession
Begin with no soil Begin with soil
Pioneer organism is lichen Seeds already present
e.g., volcano e.g., fire

17
 ECOLOGY
PRACTICE 1
1.All the organisms of one species living in one area are
known as a(n)
(A)community
(B)population
(C)species
(D)ecotype
(E)detritivore

2.All the organisms living in one area are known as a(n)

(A)community
(B)population
(C)species
(D)ecotype
(E)detritivore

Questions 3–8
Choose from the terms below.
(A)Herbivore
(B)Producer
(C)Primary consumer

1
(D)Secondary consumer
(E)Decomposer
3.Converts solar energy to chemical bond energy
4.Has the greatest mass in any food chain
5.Fungi are an example of this
6.Contains the most pesticides of any organism on the
list
7.A primary consumer is also this
8.Has the least biomass in a food chain

9.All of the following are correct about the food chain

EXCEPT
(A)bacteria and fungi act as decomposers that recycle
nutrients
(B)producers are always at the bottom of any food chain
(C)energy is lost at each trophic level
(D)food chains never have more than 4 or 5 trophic
levels
(E)pesticides tend to be concentrated at the producer
level because producers have the largest mass in a food
chain

Questions 10–18
Choose from the names of the biomes below.

2
(A)Tropical rain forest
(B)Taiga
(C)Temperate grasslands
(D)Marine
(E)Tundra
10.Called the permafrost
11.Characteristic organisms: large mammals including
black bear and elk, and conifer forests
12.Smallest number of species
13.Covers less than 4 percent of Earth’s land surface
but produces 20 percent of Earth’s food
14.Largest biome
15.Most diversity of species
16.Rapidly decreasing due to human interaction
17.Most stable biome
18.Provides most of Earth’s oxygen

19.Epiphytes are
(A)a climax community of plants in the desert
(B)photosynthetic plants that grow on trees rather than
supporting themselves
(C)vegetation found in grasslands
(D)decomposers in the taiga
(E)animals found in the tundra
3
20.Eutrophication refers to
(A)the process that causes the depletion of the ozone
layer
(B)global warming
(C)the process that happens to a lake that absorbs too
many nutrients
(D)the invasion of new species that causes damage to
an ecosystem
(E)the process whereby one species outcompetes
another species

Questions 21–24
Choose from the terms below.
(A)Mutualism
(B)Parasitism
(C)Commensalism
(D)None of the above
(E)A, B, and C
21.Both organisms benefit
22.One organism benefits; the other organism is not
affected by the first organism
23.Example of symbiosis
24.Example of Batesian mimicry
__________________________________

4
25.The result of the action of decomposers is
(A)decrease in ammonia
(B)increase in transpiration
(C)nitrogen fixation
(D)decrease in oxygen
(E)increase in oxygen

Questions 26–29
Choose from the terms below about the nitrogen cycle.
(A)Nitrogen-fixing bacteria
(B)Denitrifying bacteria
(C)Nitrifying bacteria
26.These live in the roots of legumes
27.Convert the ammonium ion into nitrates
28.Convert nitrates into free nitrogen in the atmosphere
29.Convert free nitrogen from the atmosphere into the
ammonium ion
__________________________________
30.Which of the following shows the correct order of the
biomes as you move from the equator to the North Pole
in the western hemisphere?
(A)Tropical rain forest—desert—temperate rain forest—
taiga—tundra

5
(B)Tundra—taiga—temperate deciduous forest—
desert—tropical rain forest
(C)Desert—taiga—tundra—temperate deciduous
forest—tropical rain forest
(D)Tundra—temperate deciduous forest—taiga—
desert—tropical rain forest
(E)Desert—tropical rain forest—temperate deciduous
forest—taiga—tundra

6
 ECOLOGY
PRACTICE 2

1) Which living organism is responsible for moving

nitrogen from the biotic part to the abiotic part of the
nitrogen cycle and vice versa?
A. nitrogen-fixing bacteria
B. denitrifying bacteria
C. green plants
D. nitrifying bacteria
E. there is more than one way for this process to
occur

1
2) Which of these statements is NOT a similarity
between the nitrogen cycle and the carbon cycle?
A. both cycles can transform either carbon or
nitrogen from the ocean to the atmosphere or vice
versa
B. both undergo chemical changes that transform
the form of the molecules containing them
C. carbon and nitrogen are present in all living
things
D. both cycles involve releasing the element in a
molecular form into the atmosphere
E. both have short-term and long-term parts in
their cycles

The graph below represents the annual precipitation

and the temperature for the various biomes in the
world.

2
3) Which of the following biomes could be
represented by the letter X on the graph?
A. tropical rainforest
B. desert
C. boreal forest
D. temperate grassland
E. tropical savanna

4) In a tundra, which of the following biotic factors

is most probably not present?
A. polar bears
B. birds
C. shrubs
D. oak trees
E. insects

Questions from 5 to 7 …..

Choose from the names of the biomes below:
A. Tropical rain forest
B. Taiga
C. Temperate grasslands
D. Marine
E. Tundra
5) Called the permafrost
6) Characteristic organisms: large mammals
including black bear and elk, and conifer trees
Covers

3
7) less than 4% of Earth’s land surface but has
more than 50% of the Earth’s species.

8) All of the following are density-independent

factors EXCEPT:
A. Floods
B. Famine
C. Earthquake
D. Tsunami
E. Naturally occurring fires

Questions from 9 to 11 ….
Each set of lettered choices below refers to the
numbered questions or statements immediately
following it. Select the one lettered choice that best
answers each question. A choice may be used
once, more than once, or not at all in each set.
A. Marine
B. Tropical rain forest
C. Desert
D. Tundra
E. Taiga

9) It is characterized by extreme daily temperature

changes.
10) There is the presence of permafrost.
11) It is also called boreal forest

4
12) When a population reaches its carrying
capacity, it might be subjected to crash after some
time. All of these are reasons for the population to
decline EXCEPT:
A. immigration
B. emigration
C. the introduction of a new predator
D. severe competition
E. excess waste products that could poison the
environment

questions 13 and 14 ….

13) According to the food web, if for some reason

all the dragonflies go extinct, all of these possibilities
might occur EXCEPT:
A.The population of fruit flies will increase.
B. The population of butterflies will decrease.

5
 C.Amongst the dragonfly predators, frogs will be
affected the least.
D.The population for thrush will decrease.
.
E. There will be an imbalance in the food web.

14) All of the following animals are occupying more

than one trophic level EXCEPT:
A.pythons
B. wolves
C. eagles
D.frogs
E. rats

15) The organism that plays a vital role in being a

pioneer in primary succession is
A.fungus.
B. plant.
C.lichen.
D.fern.
E. moss.

16) What is a community?

A. A group of producers and consumers living and
interacting in an area
B. A group of species living and interacting in an
area
C. A group of populations living and interacting in
an area
D. A group of organisms living and interacting in
an area
6
 E. None of the above definitions

Questions 17 and 18 ….
Each set of lettered choices below refers to the
numbered questions or statements immediately
following it. Select one lettered choice that best
answers each question. A choice may be used
once, more than once, or not at all in each set.
A.Decomposers (e.g., bacteria)
B. Producers (e.g., grasses)
C.Primary consumers (e.g., mice)
D.Secondary consumers (e.g., snakes)
E. Tertiary consumers (e.g., hawks)

17) An autotrophic organism capable of producing

complex organic compounds from simple inorganic
molecules through the process of photosynthesis.
18) An organism whose ecological function involves
the recycling of nutrients by performing the natural
process of decomposition as it feeds on decaying
organisms.

19) Which of the following nutrient cycles has its

largest reservoir in the atmosphere?
A. carbon cycle
B. nitrogen cycle
C. potassium cycle
D. phosphorus cycle
7
 E. oxygen cycle

20) A food chain consists of producers, primary

consumers, secondary consumers, and tertiary
consumers. If the producers produce 10,000 kcal of
energy, how many kcal are theoretically available to
the secondary consumers based on normal trophic
efficiencies?
A. 10000
B. 1000
C. 100
D. 10
E. 5

Questions 21 to 22 …
A.Marine biome
B. Desert
C.Taiga
D.Temperate grasslands
E. Tundra
21) It is an environment characterized by the
presence of salt water. It is found in all of Earth's
oceans.
22) It is a snow forest characterized by coniferous
trees such as spruce.

8
23) If an energy pyramid has 4 step trophic
levels and the first step has 700 Kcal energy,
then the amount of energy available at the
highest trophic level is
A. 700 kcal
B. 70 kcal
C. 7 kcal
D. 0.7 kcal
E. 0.07 kcal

24) Nitrogen fixation is

A. The process by which nitrogen fixing
bacteria remove nitrogen from the atmosphere
B. The process by which consumers convert
nitrogen gas to amino acids
C. The process by which primary producers
release nitrogen to the atmosphere
D. The process by which bacteria convert
nitrogen gas to amino acids
E. The process by which primary producers
convert ammonia to nitrogen gas

25) The clownfish live among the sea anemone

tentacles. The clownfish protects the sea
anemone by chasing away the attackers, in turn,
the sea anemone protects the clownfish from
predators. This type of symbiosis is
A. Parasitism
B. Commensalism
C. Mutualism
9
 D. Predation
E. Speciation

26) The first carnivore in the food chain is

A.One step from the primary producer
B. Two steps from the primary producer
C.Three steps from the primary producer
D.Two steps from the herbivore
E. Three steps from the herbivore

27) Which is NOT true about Tundra?

I.It includes wide variety of animal species
II.It is called permafrost
III.It is dominated by conifers
IV.It is located in far northern parts of North
America, Europe and Asia
A. I only
B. III only
C. I and III
D. II and IV
E. I, III and IV

10
28) Based on the data in the above graph, the
greatest volume of ice was lost
A.Between 1994 and 2000
B. Between 2002 and 2006
C.Between 2008 and 2016
D. Between 2002 and 2016
E. Between 1994 and 2016

29) The most reasonable explanation for the

loss of ice since 1994 is
A. An increase in the total productivity of the
world’s oceans
B. A gradual rise in the earth’s average
temperature
C. An increase in the total amount of ice at
earth’s pole
D. An increase in the sun rays
E. An increase in the human activity at the
polar areas

Questions 30 and 31 …..

11
The following graph shows the logistic growth in
the population of yeast.

30) The cause of rapid growth of phase A is probably

due to
I. Unlimited resources
II. Yeast reproduces rapidly
III. Many yeast cells die
IV. Few yeast cells die
A. II only
B. I and II
C. I and III
D. II and IV
E. I, II and IV

31) The cause behind slow growth in phase B

may be due to
I. Decrease in birth rate and increase in death
rate
II. Increase in birth rate and decrease in death
rate
III. Increase in nutrient quantity in the medium
IV. Depletion of nutrients in the medium

12
A. I only
B. I and III
C. I and IV
D. II and III
E. II and IV

32) In spring and winter, the food of the fox is

mostly small rodents due to the lack of fruits. By
contrast, in summer and autumn, its food consists of
50% fruit.So, the diet of fox, as function of seasons,
is:
A. Herbivorous
B. Zoophagous
C. Insectivorous
D. Carnivorous
E. Omnivorous

33) The meadow voles, grasshoppers,

spiders, mice, and other organisms, along with
the soil, minerals, and water make up a/an
A. Ecosystem
B. Population
C. Community
D. Food chain
E. Desert biome

34) Humans eat beef from cattle that were corn

fed. Cattle and humans occupy which of the
following trophic levels?
A. Producer and primary consumer
13
 B. Primary consumer and secondary consumer
C. Secondary consumer and tertiary consumer
D. Tertiary consumer and quaternary consumer
E. Both are primary consumers

35) The graph below represents a characteristic of

life. Which one is it?

A. adaptation
B. growth
C. homeostasis
D. evolution
E. reproduction

36) What is the highest level of organization in

ecology?
A. population
B. ecosystem
C. biosphere
D. species
E. community

14
15
 Cell Division
Chromosomes are thread-like
structures(chromatin) located inside the nucleus
of eukaryotic cell, and inside cytoplasm in
prokaryotic cells.
It turned to visible condensed chromosome
through cell division.
Each chromosome is made of protein(histone)
and a single molecule of deoxyribonucleic acid
(DNA). Passed from parents to offspring, to pass
on traits generation after generation.

1
 Human chromosomes
in humans, each cell normally contains 23 pairs
of chromosomes, for a total of 46.
Twenty-two of these pairs, called autosomes,
look the same in both males and females.
The 23rd pair, the sex chromosomes, differ
between males and females. Females have two
copies of the X chromosome, while males have
one X and one Y chromosome.

A karyotype is a laboratory-produced image of

a person’s chromosomes isolated from an
individual cell and arranged in numerical order. A
karyotype may be used to look for
abnormalities in chromosome number or
structure.

2
 Homologous chromosomes
Homologous chromosomes(in diploid cell) are
made up of chromosome pairs of approximately the
same length, centromere position, and staining
pattern, for genes with the same
corresponding loci. One homologous chromosome
is inherited from the organism's mother; the other is
inherited from the organism's father.

Diploid vs Haploid cells

3
 Types of human cells
There are two types of cells in any organism
reproduce sexually:
Somatic cell Reproductive cell
Most body cells except In reproductive organs
the reproductive organs

Diploid(2N) has 46 Also, Diploid(2N) has 46

chromosomes in human chromosomes in human cell
cell

Undergo mitosis division Undergo meiosis division

Produce 2 diploid cells Produce 4 haploid unique

that are identical to the gametes
mother cell

4
 Cell Cycle

Interphase
 G_1 the first gap phase, the cell grows physically
larger, copies organelles.
S phase the cell synthesizes a complete copy of
the DNA in its nucleus (DNA REPLICATION).

5
In S phase,
each chromosome (one chromatid or
one DNA molecule) duplicates to two
chromatids or two DNA molecules.

G_2 the second gap phase, the cell grows more,

makes proteins and organelles, and begins to
reorganize its contents in preparation for mitosis.

M phase
During the mitotic (M) phase, the cell divides its copied
DNA and cytoplasm to make two new cells. M phase
involves two distinct division-related processes: mitosis
and cytokinesis.
In cytokinesis, the cytoplasm of the cell is split in two,
making two new cells.
6
Cancer is mutation in protein that control the cell
cycle, result in rapid uncontrolled cell cycle.

Types of cell division

7
 MITOSIS

Karyotypes are prepared from mitotic cells that have been

arrested in the metaphase of the cell cycle, when
chromosomes are most condensed.

8
MEIOSIS

9
In plants, this occurs when a cell plate forms in between the
daughter cells. In animals, this occurs when a cleavage
furrow forms.
10
11
 Amount of DNA through cell
division

DNA DNA
amount numbe
(number of r in
chromatids) in
daughter
daughter cell
cell
After Duplicated same
replicati (multiply by 2)
on (S
phase)
After Divided by same
mitosis 2(half)
After Divided by Divided by
meiosis
4 2(half)

12
number of cells result from several
cell divisions = 2(numbers of cell
divisions).

if amount of DNA in mother cell is X, then the sum

of DNA amount in all cells(culture) =

x*2(numbers of cell division)

13
 CELL DIVISION
PRACTICE 1

Questions 1–6
(A)Mitotic cell division
(B)Meiotic cell division
1.The human liver can be induced to regenerate
when liver cells become damaged and need to be
replaced.
2.A fertilized egg grows into a fetus and then a baby
during a nine-month gestation period.
3.Human males begin to produce sperm at puberty.
4.A fertilized ovum undergoes rapid cell division
immediately after it is fertilized by a sperm cell.
5.A cut on your skin heals.
6.A cancerous tumor grows larger.
______________________________
7.Which of the following does NOT occur by
mitosis?
(A)Growth
(B)Production of gametes
(C)Repair
(D)Development of an embryo
(E)Cleavage furrow forms in animal cells

Questions 8–9

1
8.How many chromosomes are in this cell?
(A)0
(B)2
(C)3
(D)4
(E)Cannot be determined

9.How many chromatids are in this cell?

(A)0
(B)2
(C)3
(D)4
(E)Cannot be determined

_________________________
10.In which stage in the life of a cell is the nucleolus
visible?
(A)Prophase
(B)Anaphase
(C)Telophase
(D)Cytokinesis
(E)Interphase

2
11.Which of the following is NOT found in plant
cells?
(A)Cell plate
(B)Cleavage furrow
(C)Middle lamella
(D)Centromere
(E)Chromatids

12.If a cell has 12 chromosomes at the beginning of

meiosis, how many chromosomes will it have
at the end of meiosis?
(A)6
(B)12
(C)24
(D)48
(E)It varies with the species.

13.If a cell has 12 chromosomes at the beginning of

mitosis, how many will it have at the end of
mitosis?
(A)6
(B)12
(C)24
(D)48
(E)It varies with the species.

14.All of the following are true of meiosis in plants

EXCEPT
(A)crossing-over occurs during prophase

3
(B)there is no replication of chromosomes between
meiosis I and meiosis II
(C)spindle fibers are attached to the centriole
(D)synapsis occurs during prophase
(E)homologous pairs of chromosomes line up on the
metaphase plate in meiosis I

Questions 15–17

Match the event of mitosis with stages listed below.

15.Which stage is metaphase I of meiosis?
(A)A
(B)B
(C)C
(D)D
(E)E

16.Which stage is metaphase II of meiosis?

(A)A
(B)B
(C)C
(D)D
(E)E

17.Which stage is anaphase II of meiosis?

4
(A)A
(B)B
(C)C
(D)D
(E)E
_____________________________________

18.Cells that retain the ability to divide indefinitely

and that can differentiate into any type of cell are
called
(A)cyclins
(B)divisible cells
(C)stem cells
(D)internal regulators
(E)external regulators

19.Chromosomes become visible for the first time

during
(A)interphase
(B)prophase
(C)metaphase
(D)anaphase
(E)telophase

20.Chromosomes replicate during

(A)interphase
(B)prophase
(C)metaphase
(D)anaphase
(E)telophas

5
 CELL DIVISION
PRACTICE 2
cell taken from the testicles of this insect during
spermatogenesis

1) This cell is in:

A. Meiosis I
B. Meiosis II
C. Multiplication phase
D. Spermiogenesis
E. Growth phase

2) Scientists discovered an alien and analysed its

cells to discover that it has 22 chromosomes. This
alien undergoes mitosis and meiosis in a similar way
to humans. As such, scientists deduced that the
genome in this alien is
A.n=22
B. n=11
C.n=44
D.n=88
E. n=6

1
questions from 3 to 5 ….
In a Petri dish, we dispose a culture of plant cells.
Under specific treatment, all cells undergo the
beginning of G1 phase at t0 (synchronized cell cycle
at the beginning of the experiment). Let X be the
DNA mass of the culture at t0.
Given:
For the studied cells:
- Cell cycle lasts 12 hours.
- G1 lasts 7 hours.
- S lasts 3 hours.
- G2 lasts 1 hour.
3) The DNA mass of the culture after 36 hours will
be:
A.X
B. 2X
C. 4X
D.8X
E. 16X

4) The cultured cells are diploid cells and contain

4 chromosomes each. The number of chromosomes
found in each cell after t0 + 35 hours is
A.4 chromosomes with one chromatid each.
B. 4 chromosomes with two chromatids each.
C.8 chromosomes with one chromatid each.
D.8 chromosomes with two chromatids each.
E. The data is insufficient.
2
5) The germ cell of drosophila has 8
chromosomes, at the end of meiosis I each of
the daughter cells obtained has
A.8 chromosomes made up of 2 chromatids.
B. 8 chromosomes made up of 1 chromatid.
C.16 chromosomes made up of 2 chromatids.
D.4 chromosomes made up of 2 chromatids.
E. 4 chromosomes made up of 1 chromatid.

Questions 6 and 7 ….
The following figure shows a cell during one of
the phases of mitosis.

6) The phase of mitosis shown in the above

figure is
A.Telophase
B. Anaphase
C.Metaphase
D.Prophase
E. Cytokinesis

7) By the end of mitosis of the above cell,

3
 A. 2 daughter cells having 4 chromosomes of 2
chromatids are produced
B. 2 daughter cells having 4 chromosomes of
1 chromatid are produced
C. 4 daughter cells having 2 chromosomes of 2
chromatids are produced
D. 2 daughter cells having 2 chromosomes of 1
chromatid are produced
E. 2 daughter cells having 8 chromosomes of 1
chromatid are produced

8) A cell undergoing mitosis was shown to have

16 chromosomes at metaphase. How many
chromosomes will each of the daughter cells have at
the end of mitosis?
A. 4
B. 8
C. 16
D. 32
E. it depends on the species

questions 9 and 10 ….
The following graph shows the intracellular DNA
mass over a period of time.

4
9) Based on the graph, which of the following cells
is most probably represented?
A.skin cell
B. liver cell
C.sperm cell
D.spermatogonium cell
E. red blood cell

10) Which of the following phases is represented by

letter F?
A.G1 phase
B. S phase
C.metaphase I
D.telophase I
E. metaphase II

11) All of these are true about meiosis EXCEPT:

A.The daughter cells produced are identical to each
other.
B. It produces sex cells.

5
C.It is characterized by reducing the number of
chromosomes into half.
D.It is responsible for the diversity found in living
organisms.
E. Crossing-over occurs during prophase I.

12) The cells of the yellow dung fly contain 5 pairs

of autosomal chromosomes and one pair of sex
chromosomes. Upon completion of Meiosis II, how
many chromosomes will each yellow dung fly
gamete contain?
A.5
B. 6
C.10
D.12
E. 24

13) The point at which the cytoplasm divides is

A.mitosis.
B. prophase.
C.cytokinesis.
D.interphase.
E. metaphase.

14) During karyotype preparation, the dividing cells

are blocked at
A.prophase.
B. anaphase.
C.interphase.
6
D.telophase.
E. metaphase.

15) Which of the following statements is NOT

true about plant mitosis?
I. A cleavage furrow is formed in the middle
of the cell during cytokinesis.
II. A cell plate is formed in the middle of the
cell during cytokinesis.
III. The centromere divides and sister
chromatids separate to opposite poles of the
cell.
IV. Centrioles change into asters and migrate to
opposite poles of the cell during prophase.
A. I only
B. II only
C. I and IV
D. II and IV
E. II, III and IV

16) The amount of DNA in a cell obtained at the

end of mitosis is 3.3 a.u.
A.The amount of DNA in this cell is 6.6 a.u
during G2 of Interphase and 3.3 a.u during G1.
B. The amount of DNA in this cell is 6.6 a.u
during G1 of Interphase and 3.3 a.u during G2.
C.The amount of DNA in this cell is 3.3 a.u
during G1 and S – phase of Interphase.

7
D.The amount of DNA in this cell is 6.6 a.u
during G2 and beginning of S – phase of
Interphase.
E. The amount of DNA in this cell is 6.6 a.u
during G1 and S – phase of Interphase.

17) A laboratory technician started observing cells

during their division. He observed chromosomes
moving towards two different poles of the cell. He
called this polar ascension. In which phase is polar
ascension observed?
A. Prophase
B. Metaphase
C. Anaphase
D. Telophase
E. Interphase

18) A cell was taken from the apical meristem

of onion root tips and cultured in a suitable
medium where they undergo normal cell
division. Microscopic observations are
continuously done and show that the time spent
during metaphase is 14 min, during prophase 14
min, during interphase 642 min, during
anaphase 7 min and during telophase 7 min.
The number of cells produced after some time is
32 cells considering that at t0 the cells were in
interphase. The time required to produce these
cells is approximately:
A.24 hours
8
B. 60 hours
C.30 hours
D. 46 hours
E. 96 hours

19) A cell undergoing mitosis was shown to have

16 chromosomes at metaphase. How many
chromosomes will each of the daughter cells have at
the end of mitosis?
A. 4
B. 8
C. 16
D. 32
E. it depends on the species

20) In mitosis, chromosomes condense and

become visible during:
A. telophase
B. anaphase
C. metaphase
D. prophase
E. interphase

9
 DNA Replication
DNA STRUCTURE

DNA bases pair up with each other, A with T and C with G,

to form units called base pairs.
Each base is also attached to a sugar molecule and a
phosphate molecule. Together, a base, sugar, and
phosphate are called a nucleotide.
Nucleotides are arranged in two long strands that form a
spiral called a double helix.
Covalent bonds occur within each linear strand. Hydrogen bonds
occur between the two bases. guanine attached to cytosine by
triple hydrogen bond, adenine attached to thymine by double
hydrogen bond.
DNA replication occurs during S phase of interphase
before cell division to ensure that every daughter cell

1
 receive one identical copy of DNA of the mother cell.
it is Semi-conservative replication: the two new
molecules of DNA that are produced, each consist of
one old strand and one new strand.

Steps of replication:

2
 helicase enzyme breaks hydrogen bond
between the two DNA standards.
DNA dependent DNA polymerase bind the new
nucleotides by covalent bond forming the new
standard. Each old standard of DNA serves as a
template for new standard formed by free
nucleotides from cytoplasm according to base-
pairing rules.
DNA ligase enzyme detects places where the
sugar and phosphate chain are broken, and rebuilds
the link.
Telomeres are noncoding nucleotide sequences at
the end of chromosomes protecting chromosome
ends from degradation, and built by telomerase
enzyme.

Chargaff Rule
Chargaff's rules state that in the DNA of any species
and any organism, the amount of guanine should be
equal to the amount of cytosine and the amount of
adenine should be equal to the amount of thymine.

3
 Protein Synthesis (gene expression)
Transcription:
 occurs in nucleus.
 mRNA sequence formed from DNA at gene that
needed to be expressed.
 mRNA built by DNA dependant RNA polymerase
by base-pairing rule: A with U, and C with G.
 gene is specific fragment of DNA, located at certain
position on certain chromosome, and produces certain
protein that controls hereditary characteristic(trait).

 RNA consists of ribose nucleotides (nitrogenous

bases appended to a ribose sugar) attached by
phosphodiester bonds.The nitrogenous bases in
RNA are adenine, guanine, cytosine, and uracil,
which replaces thymine in DNA.

4
 RNA processing (splicing):
 occur in nucleus.
 conversation of initial mRNA into final mRNA, by
removing noncoding introns, and keeping only coding
exons.
 mRNA introns transcript from DNA introns.
 final mRNA is shorter than initial mRNA.
 final transcript mRNA leaves the nucleus through
nuclear pores, directing towards ribosome in
cytoplasm.

5
 Translation:
 occur at Ribosome in Cytoplasm.
 it is the formation of polypeptide chain
(protein) from mRNA.
 mRNA translated as Codon formed of 3
nucleotides.
 amino acids in cytoplasm are carried by
tRNA molecules to the codons of
mRNA at ribosome.
 each codon has complementary anti-codon on
tRNA.
 AUG is the start codon for translation on
mRNA. and code for methionine amino
acid,
 Three stop Codons (UAA – UAG – UGA):
marks the end of translation. And do not
code for any amino acid.
 rRNA is important for activity of ribosome.

6
 The Genetic code

Each group of three nucleotides(codon) encodes

one amino acid. Since there are 64 combinations of 4
nucleotides taken three at a time and only 20 amino
acids, the code is degenerate (more than one
codon per amino acid, in most cases).
This is an advantage to the organism because if
there is a mistake via a mutation, there is a
higher chance that the altered codon will still
code for the same amino acid.
production of different cell types is
regulated by expression of
7
specific genes that produce
specific sets of mRNAs that produce
specific sets of proteins, that control
traits.
97% percent of the human genome
does not code for protein
in prokaryotic cells, transcription and translation
occur at same time in cytoplasm. While in
eukaryotes, transcription occur in nucleus then
translation go on in ribosome.

Summary of protein synthesis

8
 Watson and Crick model of DNA
Watson and Crick defined DNA as a double helix
with two long helical strands twisted together of
Deoxyribose Nucleic Acid. (stolen from Rosalind
Franklin)
According to them, each DNA strand has discrete
units known as bases. The bases along one DNA
strand match the bases along the other DNA strand.

Hershey and Chase experiment

Hershey and Chase showed that when bacteriophages,
which are composed of DNA and protein, infect bacteria,
their DNA enters the host bacterial cell, but most of their
protein does not.

9
 Griffith experiment
Griffith’s experiment was the first experiment which
suggested that bacteria can transfer genetic information
through a process called transformation.

10
 DNA REPLICATION
PRACTICE 1

1.All of the following about the structure of DNA are

correct EXCEPT
(A)DNA is a polymer
(B)DNA contains deoxyribose
(C)the two strands are connected by hydrogen bonding
(D)adenine bonds to guanine
(E)nucleotides consist of a sugar, phosphate, and
nitrogenous base

2.If guanine makes up 28 percent of the nucleotides in a

sample of DNA from an organism, then thymine would
make up _____ percent of the nucleotides.
(A)0
(B)22
(C)28
(D)44
(E)56

3.All of the following statements about RNA are correct

EXCEPT

1
(A)there are three kinds of RNA: mRNA, rRNA, and
tRNA
(B)RNA stands for ribonucleic acid
(C)RNA is single stranded
(D)RNA contains the nitrogen bases C, G, A, and T
(E)RNA contains the sugar ribose

4. The nucleic acid that is translated to make a protein

is:
(A) rRNA
(B) DNA
(C) hnRNA
(D) tRNA
(E) mRNA

5.If the sequence of a strand of DNA is

AAATAACCGGGGATC, then the sequence on the
corresponding mRNA strand is
(A)AAAUAACCGGGGATC
(B)TTTATTGGCCCCTAG
(C)UUUTUUGGCCCCUAG
(D)TTTUTTGGCCCCTAG
(E)UUUAUUGGCCCCUAG

2
6.All of the following are correct about RNA processing
EXCEPT
(A)it is a rare occurrence and results in mutations
(B)introns are removed
(C)it occurs after transcription
(D)the initial transcript is longer than the final transcript
(E)it occurs in the nucleus

Questions 7–13
Choose from the terms below.
(A)Translation
(B)Transcription
(C)Replication
(D)RNA processing
(E)None of the above
7.Synthesis of RNA
8.Requires RNA polymerase
9.Synthesis of DNA
10.Removal of introns, noncoding regions of DNA
11.Involves the formation of a polypeptide chain
12.Occurs during interphase of the cell cycle
13.Requires DNA polymerase

3
14.97 percent of the human genome
(A)does not code for protein
(B)codes for about 30,000 genes
(C)codes for about 3 billion genes
(D)is located in the mitochondria
(E)has been cut up by restriction enzymes

15. The nitrogenous base guanine makes up 30 percent

of the bases in the DNA of a certain organism. What
percentage of this organism's bases is composed of
adenine?
(A) 20%
(B) 30%
(C) 40%
(D) 50%
(E) 60%

16. Which of the following is a step of translation?

(A) A cell makes new mRNA.
(B) A cell makes new copies of DNA.
(C) An RNA molecule is read to make tRNA.
(D) An RNA molecule is read to make DNA.
(E) An RNA molecule is read to make a polypeptide.

4
Questions from 17 to 20 …
(A) DNA
(B) rRNA
(C) mRNA
(D) tRNA
(E) RNA polymerase
17. The molecule that carries the genetic information
from one cell generation to the next.
18. The product of transcription that determines the
sequence of amino acids in a polypeptide chain.
19. A nucleic acid that bonds temporarily with a specific
amino acid during protein synthesis.
20. The protein that carries out transcription.

3' .... A-G-T-T-G-A ...... 5'

21. The DNA base sequence above directs the
synthesis of which of the following base sequences in
messenger RNA?
(A) 5' .... -A-G-T-T-G-A ..... 3'
(B) 5' .... -U-C-A-A-C-U ..... 3'
(C) 5' .... -U-T-A-A-T-U ..... 3'
(D) 5' .... -T-C-T-T-C-T ....... 3'
(E) 5' .... -C-A-T-T-A-C ..... 3'

Questions from 22 to 25…

5
(A) AUG (met).
(B) UAA (stop).
(C) UGG (trp)
(D) GGG (ala)
(E) UUU (phe)
22. The corresponding DNA nucleotide sequence is
ATT.
23. This is the codon that causes no additional amino
acid to be added to a growing polypeptide.
24. This is the start codon for the beginning of a
polypeptide chain.
25. The corresponding tRNA anti codon is AAA.

26. Transcription is best defined as a process that.

(A) Creates an exact replica of DNA.
(B) Produces tRNA from an mRNA template.
(C) Indicates the direction of DNA synthesis.
(D) Maintains the tertiary structure of DNA.
(E) Synthesizes mRNA from a DNA template.

27. A tRNA molecule specialized for transfer of the

amino acid serine has the anticodon AGA. It will
specially bind to an mRNA molecule with which of the
following codons?

6
(A)AGA
(B) TCT
(C) TGT
(D) UCC
(E) UCU

28. What is the maximum number of amino acids that

could be incorporated into a polypeptide encoded by
15 nucleotides of messenger RNA?
(A) 3
(B) 5
(C) 15
(D) 30
(E) 45

29. The codon GUG in messenger RNA has been

transcribed from which of the following sequences in
DNA?
(A) GAG.
(B) CAC.
(C) TAT.
(D) CTC.
(E) ATA.

7
30. Which of the following correctly pairs two of the
nucleotides bases that form double-stranded DNA?
(A) Adenine .. Cytosine.
(B) Cytosine .. Guanine.
(C) Guanine .. Thymine.
(D) Thymine .. Uracil.
(E) Uracil .. Cytosine.

31. A function of transfer RNA is to:

(A) Receive the genetic information from nuclear DNA.
(B) Store the genetic information in the nucleus.
(C) Store RNA in the ribosomes.
(D) Transfer the genetic information from the nucleus to
the cytoplasm.
(E) Position amino acids for protein synthesis by pairing
with codons in messenger RNA.

Questions 32 to 35….
(A) DNA
(B) tRNA
(C) mRNA
(D) rRNA
(E) RNA polymerase
32. Translated to synthesize protein.
8
33. Transports amino acids during protein synthesis.
34. Passed on to progeny cells during cell division.
35. Includes a structure known as the "anticodon."

36. Which of the following RNA sequences would be

transcribed from the DNA sequence ATGCCTAGGAC?
(A) TACGGATCCTG
(B) UAGCGAUCCUG.
(C) AUGCCUAGGAC
(D) UACGGAUCCUG
(E) GCAUUCGAAGU

9
 DNA REPLICATION
PRACTICE 2

Questions 1 and 2 ….
The figure below represents an important process
that occurs in the human cell. Refer to the figure to
answer the questions that follow.

1) What process does this figure represent?

A.DNA replication
B. RNA processing
C.Protein synthesis
D.Transcription
E. None of the above.

2) The numbers 123 on the tRNA must be replaced

with the following anti-codon:
A.UAC
B. CAU
C.AUG

1
 D.UAG
E. AUC
Questions 3 to 5 …
A.Transcription
B. Translation
C.DNA replication
D.RNA processing

3) This process takes place in the cytoplasm.

4) This process takes place during the S phase of the
cell cycle.

5) The mRNA is ready to exit the nucleus.

Questions 6 and 7 …

6) If 2 is thymine, then B must be

A. guanine.
B. cytosine.
C. thymine.

2
 D. adenine.
E. uracil.
7) If 5 is adenine, then E must be
A. guanine.
B. cytosine.
C. thymine.
D. adenine.
E. uracil.

8) How does the process shown differ in a eukaryotic

cell?
A. Eukaryotic cells do not carry out transcription.
B. Eukaryotic cells do not carry out replication.
C. Eukaryotic cells do not carry out both
transcription and replication.
D. Eukaryotic cells carry out both processes, but
they do not occur at the same time.
E. Eukaryotic cells carry out both processes in the
Golgi body.
9) RNA processing involves
A. Removal of introns
B. Formation of m-RNA
C. Formation of peptide
D. Formation of DNA
E. Removal of exons

10) If guanine makes up 28% of the nucleotides in

a sample of DNA from an organism, then thymine
would make up ______ % of the nucleotides.

3
 A. 0
B. 22
C. 28
D. 44
E. 56

11) Which of the following m-RNA strands is

complementary to the given transcribed DNA
strand?
CCGATAGATCAAA transcribed DNA strand
A.CCGAUAGAUCAAA
B. GGCUAUCUAGUUU
C.GGCTATCTAGTTT
D.GGCUAUCTAGTUU
E. GGCUAAGAAGUUU

12) 35% of the nitrogenous bases that form a

DNA segment is Guanine, then the percentages of
Thymine is
A.15 %
B. 35%
C.30%
D.70 %
E. 50%

Questions from 13 to 16 …
A. DNA polymerase
B. RNA polymerase
C. helicase

4
 D. ligase
E. restriction enzyme
13) is responsible for unwinding the strands of DNA
during replication
14) plays a major role during transcription
15) a protein that cleaves DNA at specific sites
16) is responsible for linking the two sections of
DNA during replication

17) A whole gene codes for the following

tetrapeptide: Arginine- Lysine- Proline- Valine Given
the following table:
Arg Lys Met Pro Gly Val His Stop
codon
CGU AAA AUG CCC GGU GUU CAU UGA
CGC AAG CCU GGC GUC CAC UAA
CGA CCA GGA GUA UAG
CGG GGG GUG
CCG
The possible sequence of nucleotides on the
transcribed strand of the gene is:
A.GGTAAACCTGTTTAA
B. AUGCGUAAACCCGUUUAA
C.TACGCATTTGGACAAATT
D.CGUAAACCCGUU
E. TACCGTAAACCTGTTTAAATT

5
18) A biology class was performing an experiment
in the lab. The students had obtained a DNA strand
with radioactive thymine. Later as they left the strand in
a medium for multiplication, they realized that the
radioactivity was observed only in part of the DNA and
not all DNA molecules. The process was explained by
the teacher as:
A. DNA translation
B. Cell proliferation
C. Semi-conservative replication of DNA
D. Conservative replication of DNA
E. Semi-conservative translation of DNA

19) A DNA molecule has 20% A and 30% G. The

total number of nucleotides in the DNA molecule is 20.
The number of thymine nitrogenous bases in the DNA
is:
A. 2
B. 3
C. 4
D. 5
E. 6

6
7
Classical Genetics

1
 The autosomal traits
A) Laws of Mendel:
The three laws of inheritance proposed by Mendel
include:

Law of Dominance
Law of Segregation
Law of Independent Assortment

1) Law of Dominance
When homozygous(pure) dominant organism crossed
by homozygous recessive organism, the offspring will
be hybrid (carry 2 different alleles), but will exhibit only
the dominant trait.

2
 2)law of segregation
It States that during formation of gametes, the two
traits carried by each parent separate.
In a monohybrid cross, both the alleles are
expressed in the F2 generation without any blending.
Thus, the law of segregation is based on the fact
that each gamete contains only one allele.

3
 3) Law of Independent Assortment
(Dihybrid Cross):
alleles for different genes assorted independently
during meiosis.
this happens only for genes carried on different
chromosomes.

4
 Test cross
in a test cross, a dominant phenotype organism
is crossed with recessive organism in order to
determine the dominant genotype
(homozygous or heterozygous).
The homozygous dominant organism will
produce 100% hybrid dominant offspring.
the hybrid dominant organism will produce
50% hybrid dominant, and 50%
recessive.

5
B) Non mendelian laws:
Incomplete Dominance
Incomplete dominance is a form of Gene interaction in
which both alleles of a gene are partially expressed
(blended), often resulting in an intermediate or third
phenotype.

6
 Codominance inheritance
A condition in which both alleles of a gene pair in a
heterozygote are fully expressed, with neither one being
dominant or recessive to the other, without blending.

Blood group inheritance

Human blood type has 3 alleles:
 dominant A allele.
 dominant B allele.
 recessive O allele.
 A and B alleles are codominance.

7
 Polygenic inheritance
It occurs when one characteristic is controlled by two or
more genes. It has many intermediate traits.
Examples in human: height, skin colour, eye colour and
weight.

Sex- Linked Genes

 this is a gene that located on X chromosome.
 This is because the X chromosome is large and
contains many more genes than the smaller Y
chromosome.
 most of sex-linked genes are recessive that male
need only one recessive gene to exhibit the trait, while
female need 2 recessive genes.

8
 This is why males exhibit recessive sex-linked traits
more than females.
 common examples recessive sex-linked genes
are color blindness and haemophilia.
 son inherits trait from mother, while
daughter inherits trait from both parents.

9
sex-linked dominant traits more common in
females because Males can only get an X
chromosome from their mother while females get an X
chromosome from both parents. As a result, females
tend to show higher prevalence of X-linked dominant
disorders because they have more of a chance to
inherit a faulty X chromosome.

Carrier female found only in sex-linked recessive

traits by inheritance of one affected X from any parent,
but no carrier female could be found in sex linked
dominant traits because inheritance of one affected X
is mean a diseased female.

Sex Influenced Inheritance

it is an autosomal trait that are expressed based on
the influence of the sex hormones.

10
 The Pedigree
it is a family tree indicates phenotype of a
certain trait.

11
 Linked genes
These are genes that are inherited together because
they are physically close to one another on the same
chromosome.
Only crossing over can separate linked genes.

12
 Classical genetics
Practice 1

1.A hybrid red flower (Rr) is crossed with a white

flower. What percentage of the offspring will be red?
(A)0%
(B)25%
(C)50%
(D)75%
(E)100%

2.A red flower is crossed with a white flower, and all

the offspring are pink. What law of inheritance does
this follow?
(A)Dominance
(B)Segregation
(C)Incomplete dominance
(D)Law of independent assortment
(E)Codominance

3.Which of the following crosses best demonstrates

the law of segregation?

1
(A)AA × aa
(B)aa × aa
(C)Aa × aa
(D)Aa × Aa
(E)AA × AA

4.If two pink Japanese four o’clock flowers (RW) are

crossed, what is the chance that an offspring will be
pink?
(A)0%
(B)25%
(C)50%
(D)75%
(E)100%

5.A couple has two children. One child has blood

type A, and the other child has blood type O. What
are all the possible blood types of the parents?
(A)Either both have type A, or one has type A and
the other has type O, or one has type A and the
other has type B.
(B)There is only one possibility. Both parents have
type A blood.

2
(C)There is only one possibility. Both parents have
type O blood.
(D)There is only one possibility. One parent has
type A, and the other has type O.
(E)It is not possible to determine from the
information given.

6.Which is true about blood type?

(A)Type A is dominant over type B.
(B)Type B is dominant over type A.
(C)Type O is dominant over types A and B.
(D)Type AB is dominant over both A and B.
(E)Types A and B are dominant over type O.

7.A man with hemophilia marries a woman who has

normal hemoglobin and is not a carrier. Which of the
following is true?
(A)None of their children will have the disease nor
will they be carriers.
(B)All the boys will have the disease.
(C)All the girls will have the disease.
(D)All the boys will be carriers.
(E)All the girls will be carriers.

3
8.If a man is color-blind and his wife is a carrier,
which of the following is true?
(A)Each girl has a 50% chance of being color-blind.
(B)No girl will be color-blind because girls cannot be
color-blind.
(C)All the boys will be carriers.
(D)All the girls will be carriers.
(E)All children will be either a carrier or color-blind.

9.A farmer planted 1,000 seeds of corn. The

offspring were 544 tall with yellow seeds, 188 tall
with green seeds, 183 short with yellow seeds, and
64 short with green seeds. What were the
genotypes of the parents?
(A)TTYY × ttyy
(B)TtYy × ttyy
(C)ttyy × ttyy
(D)ttyy × TtYy
(E)TtYy × TtYy

10.The genotype ratio from a monohybrid cross is

(A)1:1:1 homozygous dominant: hybrid:
homozygous recessive
(B)3:1 homozygous dominant: hybrid
4
(C)1:2:1 homozygous dominant: hybrid:
homozygous recessive
(D)3:1 hybrid: homozygous recessive
(E)cannot be stated universally

Questions 11–12

Refer to this hypothetical pedigree of an inherited

trait in humans.
11.Which is true of the shaded-in trait?
(A)The trait is autosomal recessive.
(B)The trait is autosomal dominant.
(C)The trait is sex-linked dominant.
(D)The trait is sex-linked recessive.
(E)The trait is inherited as incomplete dominance.

5
12.What is the most likely genotype for person C?
(A)AA
(B)Aa
(C)aa
(D)X–X–
(E)X–X

13. Which of the following is LEAST likely to be the

offspring of a father with type AB blood and a mother
with type A blood?
(A) Type A son
(B) Type A daughter
(C) Type 0 son
(D) Type AB son
(E) Type B daughter

14. An individual expressing a dominant trait has a

genotype that can be:
(A) Only be heterozygous (Aa)
(B) Only be homozygous recessive (aa)
(C) Only be homozygous dominant (AA)
(D) Either heterozygous or be homozygous recessive
(Aa or aa)

6
(E) Either heterozygous or be homozygous dominant
(Aa or AA)

15. In the cross Ff x Ff, in which F codes for the

dominant trait, the proportion of offspring with the
dominant phenotype is expected to be
(A) 0
(B) 1/4
(C) 1/2
(D) 3/4
(E) 100%

16. In a man showing the recessive phenotype for a

particular autosomal trait, what is the expected
percentage of his sperm cells that will carry the
recessive allele associated with this trait?
(A) 0%
(B) 25%
(C) 0%
(D) 75%
(E) 100%

17. Which of the following crosses is a testcross?

(A)AAxAA

7
(B) AAxAa
(C) Aa x Aa
(D) A_x aa
(E) aa x aa

Questions 18 and 20 …
In humans, one type of albinism is inherited as an
autosomal recessive trait. An albino woman and a
pigmented man have two children. The older child is
pigmented and the younger child is albino. The allele for
albinism is represented by a and the allele for
pigmentation is represented by A.
18. Based on the information given, what is the
genotype of the older child?
(A) aa only.
(B) Aa only.
(C) AA only.
(D) Either aa or Aa.
(E) Either Aa or AA.

19. Based on the information given, what is the

genotype of the father?
(A) aa only.
(B) Aa only.
(C) AA only.
8
(D) Either aa or Aa.
(E) Either Aa or AA.

20. If this couple has a third child, what is the probability

that the child will be albino?
(A) 15%.
(B) 25%.
(C) 50%.
(D) 75%.
(E) 100%.

21. A man who is colorblind marries a normal woman,

and together they have a daughter who is not colorblind.
If the daughter marries a man with normal vision, what is
the probability of their first-born child being a son who is
colorblind?
(A) 0%
(B) 25%
(C) 50%
(D) 75%
(E) 100%

22. Black coat color in horses is caused by a dominant

allele, while white coat color is due to the recessive
allele. Two black horses produce a foal with a white
9
coat. If they were to produce a second foal, what would
be the probability of the second foal having a black
coat?
(A) 0
(B) 1/4
(C) 2/4
(D)3/4
(E) 100%

23. A woman with blood type A and a man with blood

type AB marry and produce children. Which of the
following blood types is NOT possible in their children?
(A) Type A
(B) Type B
(C) Type O
(D) Type AB
(E) All blood types are possible in their children

24)

10
Type of inheritance?
a) Sex linked dominant
b) Sex linked recessive.
c) Autosomal dominant.
d) Autosomal recessive.

25.A testcross is done to

(A)determine if crossover has occurred
(B)prevent sex-linked traits from being passed on
(C)determine if a person has Huntington’s disease
(D)prevent crossover from occurring
(E)determine if an organism exhibiting the dominant
phenotype is carrying a recessive allele for that trait

11
 CLASSICAL GENETICS
PRACTICE 2

Questions 1 to 3 …

1) What is the most appropriate mode of inheritance

of this disease?
A.sex-linked dominant
B. sex-linked recessive
C.autosomal recessive
D.autosomal dominant
E. nondisjunction
2) If the couple 3 and 4 from generation II have
another child, how likely is the child to inherit the
disease?

A.100%
1
B. 50%
C.25%
D.0%
E. It cannot be determined based on the data
provided.

3) What is most likely the genotype of person

number 6 from generation II?
A.GG
B. Gg
C.gg
D.XG Xg
E. XG XG

4) A man who is heterozygous type A+ married a

woman who is heterozygous type B+. Which of
these blood types will their child most probably
have?
A.blood type O+
B. blood type A+
C.blood type B+
D.blood type AB+
E. All the above blood types have the same
probability;

Questions 5 and 6 …
In a breeding experiment using Gray and white
rabbits of unknown genotypes, the following results
were obtained.
2
 Parents Offspring
Cross Female Male Gray White
I Gray x white 82 78
II Gray x Gray 118 39
III white x white 0 50
IV Gray x white 74 0
5) If the Gray female from cross IV mated with the gray
male from cross II, then which of the following would
most likely be true?
A.All of the offspring would be gray.
B. All of the offspring would be white.
C.Half of the offspring would be gray.
D.One-quarter of the offspring would be gray.
E. One-quarter of the offspring would be white.

6) If two gray progeny of cross IV mate with each

other, what is the probability that any one
individual offspring will be gray?
A.100%
B. 75%
C.50%
D.25%
E. 0

7) A test cross is done to

A.determine if crossover has occurred.
B. prevent sex-linked traits from being passed on.
C.determine if a person has Huntington’s disease.
D.prevent crossover from occurring.

3
 E. determine if an organism with the dominant
phenotype is homozygous dominant or hybrid.

8) A red flower is crossed with a white flower, and

only red offspring result. If two of these red
offspring cross, what is the chance of having a
white offspring?
A.0%
B. 25%
C. 50%
D.75%
E. 100%

9) The gene for color blindness is carried on the

non-homologous segment of sex chromosome
X. The allele for color blindness is recessive.
We can conclude that
I. Sons cannot inherit color blindness from
their fathers.
II. The chance for a carrier mother and a
normal father to have color blind boys is 50 % of
children.
III. A color blind mother and a normal father
have all their boys having color blindness.
IV. The chance for a carrier mother and a color
blind father to have color blind girls is 25 %.
A.I only
B. III only
C.I, II and III
D.II, III, and IV
4
E. I, III, and IV

Questions 10 and 11 …
The following pedigree shows transmission of an
autosomal recessive disease

10) The genotype of individual II 2 is

A.NN
B. Nd
C.dd
D.Maybe NN or Nd
E. Maybe Nd or dd

11) The genotype of individual II 4 is

A.NN
B. Nd
C.dd
D.Maybe Nd or dd
E. Maybe NN or Nd
Questions 12 to 14 …

5
The following table shows different crosses
made between pea plants of long and short
stems.
Cross Result
Long stem plants x 100% long stem plants
I short stem plants
Short stem plants x 100% short stem
II short stem plants plants
60 long stem plants
Long stem plants x
and 20 short stem
long stem plants
III plants
80 long stem plants
Long stem plants x
and 79 short stem
short stem plant
IV plants

12) The genotype of parents in cross III

A.Both have LL
B. Both have Ls
C.Both have ss
D.One has LL and the other has Ls
E. One has Ls and the other has ss

13) Cross IV is
A.A test cross done between pure long and pure
short stem plants
B. A test cross done between pure long and
hybrid short stem plants

6
C. Self cross done between hybrid long and
hybrid short stem plants
D.A test cross done between hybrid long and
pure short stem plants
E. A test cross done between hybrid long and
hybrid short stem plants

14) If one of the plants obtained in cross II is

crossed with a plant obtained from cross I, the
result would be
A.75 % long stem plants (LL) and 25 % short
stem plants (ss)
B. 50 % long stem plants (Ls) and 50 % short
stem plants (ss)
C.50 % long stem plants (LL) and 50 % short
stem plants (ss)
D.100 % plants having long stem with genotype
(Ls)
E. 100 % plants having short stem with genotype
(ss)

15) In a dihybrid cross with independent genes

present on different autosomes, the phenotypic
proportion of F2 generation is:
A.1/4- 1/4- 1/4-1/4
B. 1/2-1/2
C.3/4 -1/4
D.9/16- 3/16- 3/16- 1/16
E. 8/9-3/9-3/9-1/9

7
16) In the case of pea plants, tall (T) is
dominant over dwarf (t). What is the genotype
of the parents of a generation of plants half of
which are tall and half of which are dwarf?
A.Tt x tt
B. Tt x Tt
C.TT x tt
D.XTXt x XTXt
E. XTXT x XtXt

17) In a rabbit, the gene coding for the color of hair

and the gene coding for the length
of hair are independent. Yellow female rabbits having
long hair are crossed with yellow male rabbits having
long hair. The resulting offspring have the following
phenotype:
90 yellow body with long hair
30 black body with long hair
30 yellow body with short hair
10 black Body with
short hair
The results show that:
A.There exists a lethal allele
B. It is the normal result of a self-cross where the
allele for yellow is dominant over the allele for
black hair and the alleles short hair and long hair
are codominant alleles.
8
C.It is the normal result of a self-cross where the
allele for black is dominant over the allele for
yellow hair
D.The allele for yellow is dominant over the allele for
black hair and the allele for long hair is dominant
over the allele for short hair
E. The allele for yellow is dominant over the allele for
black hair and the allele for short hair is dominant
over the allele for long hair

9
 Molecular Genetics
Mutation
A mutation is a change in a DNA sequence.
Mutations can result from DNA copying mistakes made
during cell division, exposure to ionizing radiation,
exposure to chemicals called mutagens, or infection by
viruses.
Somatic mutations: occur in body cells and cannot
be inherited.
Sex cell mutation: occur in gametes and can be
passed onto offspring.

Gene mutation
It is change in nucleotide sequence of gene.

Types of gene mutation:

1
 Inversion:
when a segment of a chromosome is reversed end to
end.
Frame shift mutation (deletion and insertion):
A frameshift mutation is a genetic mutation caused by
a deletion or insertion in a DNA sequence that shifts
the way the sequence in codons and amino acids.
It’s the most disastrous mutation because of changing
all amino acids sequence in polypeptide chain.

substitution (point) mutation:

Silent mutation: does not change an amino
acid, and has no effect on phenotype.

2
Nonsense mutation: changes an amino acid to
a STOP codon, resulting in shorter polypeptide chain.

Missense mutation: changes an amino acid

to another amino acid.

translocation occurs when a chromosome

breaks and the (typically two) fragmented pieces re-
attach to different non homologous chromosomes.

3
 Diseases of Genetic mutation
disease Type of symptoms
mutation
Phenylketonuria Autosomal recessive Caused by building up
(PUK) phenylalanine in the
body, so if no dietary
change is instituted in
birth, mental
retardation will result.
Cystic fibrosis autosomal recessive Characterized by a build-
up of fluid in lungs and
digestive system.
Huntington’s Autosomal dominant It causes the
progressive
disease breakdown
(degeneration) of
nerve cells in the
brain.
Onset is usually in
middle age.
hemophilia Sex linked recessive It is usually an
inherited bleeding
disorder in which the
blood does not clot
properly
Color blindness Sex linked recessive It is an inability to see
the difference between
certain colors.

4
 Chromosomal mutation
It’s a change in number of chromosomes.
Aneuploidy is the presence of an abnormal number
of chromosomes in a cell.
Polyploidy is the extra sets of chromosomes.It is
common among plants.

Any chromosomal mutation result from

nondisjunction, where homologous pairs fail to
separate in metaphase I or metaphase II during cell
division.

5
 Chromosomal abnormalities
Down syndrome:
47 Trisomy 21 (result from excess autosome
chromosome at homologous 21)

Turner syndrome:
45 chromosomes, Monosomy X (result from absence of
one X chromosome.

Klinefelter syndrome:
47 chromosomes, Result from excess X chromosome

6
 Genetic engineering
Restriction enzyme:

restriction enzyme is a protein produced by E. Coli

bacteria that cleaves DNA at specific sites along
the molecule.
In the bacterial cell, restriction enzymes cleave foreign
DNA, thus eliminating infecting organisms.
Each restriction enzyme recognizes a short, specific
sequence of nucleotide bases. These regions are
called recognition sequences.
restriction sites: specific sequences of
nucleotides, which are recognized by restriction
enzymes.
palindromic sequences: nucleic acid sequences
where the one strand matches its complementary
strand when read in the same direction.

7
 recombinant DNA technology
A human gene is introduced into a plasmid, which is
then introduced to a bacterial cell. The bacteria will
then use its cellular machinery to produce the protein.
For example, insulin is regularly produced by
means of recombinant DNA within bacteria.
Recombinant technology can be used for genetic
diseases cure.

8
Horizontal Gene Transfer in Bacteria

In transformation, a bacterium takes up a piece of

DNA floating in its environment.
In transduction, DNA is accidentally moved from
one bacterium to another by a virus.
In conjugation, DNA is transferred between
bacteria through a tube between cells.

9
Gel Electrophoresis of DNA (DNA Finger-printing)
(DNA analysis)
it based on motion of negative charge DNA (due to
phosphate group) in an electric field toward the
positive electrode in agarose gel.
Length and fragment size and Shape of the molecule
influences how the DNA runs, short fragments run
faster, large fragments run slowly, after cutting
DMA segments by restriction enzyme.
similar DNA fragments reach the positive electrode at
the same time.
DNA analysis used in:
1) Crime solving.
2) Paternity testing
3) Determine phylogeny (evolution relationship).

10
 Polymerase chain reaction (PCR)
PCR process used for DNA amplification.
Steps:

- Denaturation
The solution tube containing the DNA is heated to at
94°C to break the hydrogen bonds and separate the
DNA strands.
- Annealing
cooling to 50 allowing DNA polymerase enzymeto bind
to the individual strands of DNA. the nucleotides from
the added mixture solution will pair with the separated
strands of DNA.Taq polymerase is the heat-stable
DNA polymerase extracted from the thermophilic
bacteria)
- Extension
Now we formed a new complementary strand of DNA.
Then the process will be repeated to make copies of
DNA.

11
 Viruses
Viruses are boarder line between living and non-living
(obligate intra cellular parasite) that reproduce only in
its host.
viruses consist of nucleic acid (either DNA or RNA
but never both) enclosed by protein coat(capsid).

1) Viruses with DNA genome

Once inside the host, viral genome enters into two
possible life cycles:

A) Lytic cycle:
viral genome replicates by host DNA polymerase.
replicated genome packed in protein capsid that
expressed from viral genome by host RNA
polymerase.
12
finally host cell membrane lysis by special viral
enzyme and the new viruses escape to infect other
cells.

B)Lysogenic cycle:
viral genome inserted into host genome, and remain
dormant.
every time the cell genome replicate, also the viral
genome replicate until every daughter cell will carry
the viral genome.
until the cell be under stress (illness, radiation,
chemicals), the virus genome gets out the host
genome, and begin lytic cycle (transcription and
translation).

13
2) Viruses with RNA genome
A) lytic cycle:
RNA virus uses its specific enzyme (RNA dependent
RNA polymerase) to replicate its genome.
then pack its genome into protein capsid that
expressed from its genome.

B) Lysogenic cycle:
RNA virus that enters lysogenic cycle called retrovirus.
it needs specific enzyme (reverse transcriptase) to
transcript its RNA to DNA that inserted into host
genome.
HIV virus, and coronavirus virus are retroviruses.

14
 Molecular genetics
Practice 1

1.Polyploidy results from

(A)nondisjunction
(B)aneuploidy
(C)Down syndrome
(D)infection with a virus
(E)RNA processing

Questions 2–6
Choose from the terms below.
(A)Gel electrophoresis
(B)Restriction enzymes
(C)Polymerase chain reaction
(D)Recombinant DNA
(E)RNA processing
2.Referred to as molecular scissors
3.Used to separate large molecules of DNA on the
basis of their rate of movement through an agarose
gel in an electric field
4.Taking DNA from two sources and combining
them into one cell
5.Could cure cystic fibrosis
6.An automated technique by which a tiny piece of
DNA can be rapidly amplified

Questions 7–12
Refer to the list below of inherited diseases.
1
(A)Phenylketonuria
(B)Cystic fibrosis
(C)Huntington’s disease
(D)Hemophilia
(E)Down syndrome
7.Results from a mutation of chromosomes
8.Characterized by a buildup of fluid in the lungs
9.If no dietary change is instituted at birth, mental
retardation will result
10.Autosomal dominant disease of the nervous
system that results in death
11.Sex-linked recessive disorder
12.Onset is usually in middle age

13.A man with Klinefelter’s syndrome has 47

chromosomes and has three sex chromosomes,
XXY. This abnormality came about as a result of
(A)crossing-over
(B)deletion of a chromosome
(C)addition of a chromosome
(D)nondisjunction
(E)mutation in a gene

2
Questions from 14 to 17 …
(A) 5' UAACG 3'
(B) 5' ATTCG 3'
(C) 5' TAAGC 3'
(D) 5' ATACG 3'
(E) 5' AUUGC 3'
14. DNA complement to 3' TAAGC5'.
15. Product of a single inversion in 5' AATGC 3'.
16.Transcription product of 3' ATTGC 5'.
17.Result of single base-pair mutation in 5' TTTCG3'.

18. For a mutation to be significant for the process of

evolution, it must be present
(A) In diploid cells.
(B) In the nerve cells of an individual.
(C) In gametes.
(D) In all members of the population.
(E) During mitosis in heart cells.

Questions 19 to 22 …
(A) Replication
(B) Recombination
(C) Transcription

3
(D) Translation
(E) Deletion
19. A DNA strand serves as a template for the synthesis
of another DNA strand of equal length.
20. DNA serves as a template for the synthesis of a new
molecule of RNA.
21. Two DNA molecules exchange corresponding
segments.
22. An RNA molecule provides directions for the
assembly of protein.

4
 Molecular Genetics
Practice 2

1) What type of chromosomal mutation is represented

in the figure below?

A.Deletion
B. Addition
C.translocation
D.silent mutation
E. inversion

2) An experiment was conducted on mice to test the

effect of different levels of radiation on the formation
of protein X. After many trials, scientists noticed that
the amino acid sequence in protein X formed by
these mice was different by one amino acid
compared to the original one. The mutation that has
occurred in these mice is:
I. nonsense mutation
II. silent mutation
III. missense mutation
A.I only
B. II only
C.III only
1
 D.I and II only
E. None of the above.

3) Down’s syndrome is a chromosomal abnormality

characterized by three copies of chromosome 21.
This abnormality is the result of:
A.the inversion of a chromosome
B. the deletion of a chromosome
C.genetic mutation
D.nondisjunction
E. crossing-over

4) A man with Klinefelter’s syndrome has 47

chromosomes and has three sex chromosomes,
XXY. This abnormality came about as a result of
A.crossing-over.
B. a deletion of a chromosome.
C.an addition of a chromosome.
D.nondisjunction.
E. a mutation in a gene.

Questions 5 and 6 ….
The genes coding for one of the MHC proteins,
DQ, are extracted from two identical skin cells
and put in two tubes A and B. The same
restriction enzyme is added to the two tubes. The
produced fragments from each tube are
separated by gel electrophoresis. The results are
tabulated below.
2
 Tube A Tube B

5) The length in base pair (bp) of this gene is

A.1000 bp
B. 2400 bp
C.1200 bp
D.1100 bp
E. 900 bp

6) The result indicates that a mutation at the level of the

DQ gene has taken place at fragment
A.400
B. 500
C.300
D.200
E. 900

7) Which of the following diseases results from a

chromosomal abnormality?
A.Huntington’s disease

3
 B. Sickle cell anemia
C.Cystic fibrosis
D.Down syndrome
E. Phenylketonuria (PKU)

8) Mutations are a permanent alteration that attack

sequences of genes. The following strand is a strand
of DNA coding for estrogen, a sexual hormone.
3'ACC.GAC.TAT.ATA.TAT.CCG.CAC.TAC.TTC.GA
C.ACT 5'
mutation by deletion attacks the ninth nucleotide.
The mutated sequence will be
A.3'ACC.GAC.TAC.ATA.TAT.CCG.CAC.TAC.TTC.
GAC.ACT 5'
B. 3'ACC.GAC.TAG.TAT.ATC.CGC.ACT.ACT.TCG.
ACA.CT 5'
C.3'ACC.GAC.TAT.ATA.TAT.CCG.CAC.TAC.GAC.
ACT 5'
D.3'ACC.GAC.TAA.TAT.ATC.CGC.ACT.ACT.TCG.
ACA.CT 5'
E. 5'ACC.GAC.TAG.ATA.TAT.CCG.CAC.TAC.GAC.
ACT 3'

Three individuals A, B, and C are suspects in murder

case. Based on blood stains collected from victim S,
we obtained, with a specific probe of a determined
locus, the DNA fingerprint S. The DNA fingerprint of
suspect A was obtained with the same probe based on
blood, skin, and hair samples; the same goes for the

4
fingerprint of B. The DNA fingerprint of C was obtained
based on a blood sample.
9)Based on the results, we can conclude that

A.suspects B and C
participated in the murder.
B. suspects A and C
participated in the murder.
C. suspects A and B
participated in the murder.
D.the three suspects A, B, and
C participated in the murder.
E. none of the suspects
participated in the murder.

10) In gel electrophoresis, DNA bands are

separated according to
A.Their solubility in agarose gel
B. The sequence of nucleotides
C.Composition of nitrogenous bases
D.Size of fragment
5
E. Size of fragment and sequence of nucleotides

11) A piece of DNA is amplified by

A.Gel electrophoresis
B. DNA recombination
C.PCR
D.Addition of restriction enzymes
E. Transcription

12) A couple with normal phenotype, who each

have a family history of albinism, is
expecting a baby. They had DNA
fingerprinting in order to determine their
genotypes and to know if the fetus is going
to be albino or not. The following document
shows the fingerprinting for this couple and
their fetus.

From the above DNA fingerprinting, we can

conclude that
A.The allele for albinism is dominant and the
fetus will have the condition
B. The allele for albinism is dominant and the
fetus will not have the condition
C.The allele for albinism is recessive and the
fetus will have the condition
D.The allele for albinism is recessive and the
fetus will not have the condition

6
 E. The allele for albinism is recessive and masks
the normal allele

Karyotype A Kary o type B

13) Which statement correctly reflects the gender?

A. Karyotype A belongs to a male
because of the presence of XX pai
B. Karyotype B belongs to a female
because of the presence of XY pair
C.Karyotype B belongs to a male
because of the presence of XY pair
D.Karyotype B belongs to an abnormal
female because of the presence of two
chromosomes XY
E. Karyotype A belongs to an abnormal
female because of the presence of two
chromosomes XX

14) Which of the following statements best

explains the fact that a mutation in a cell’s
7
 DNA does not always result in an error in the
polypeptide produced from that DNA
sequence?
A.Some polypeptides are produced by a code other
than a nucleic acid code
B. The nucleolus can repair damaged DNA
C.The Golgi body can repair damaged DNA
D.Each amino acid is coded by more than one
codon
E. Scientists have no idea why this phenomenon
occurs

Questions 15 to 17 …
Tay-Sachs disease is known as an infantile
disease which is characterized by relentless
deterioration of mental and physical abilities.
It begins at 6 months of age and usually
results in death by the age of five. A couple
has two girls out of which one is 2 years old
and has the disease. The mother got
pregnant and she is afraid of having another
affected child. She visited a genetic
counsellor who requested that a DNA
analysis test be completed for the whole
family. The results of the DNA analysis of all
family members are shown in the following
table.

8
15) Based on the above given, the band(s)
which correspond(s) to the:
A.Disease are bands A and C
B. Disease are bands B and C
C.Normal phenotype is band A
D.Normal phenotype are bands A and B
E. Normal phenotype are bands A and C

16) Depending on the test analysis, the fetus is:

A.Of unknown genotype
B. Normal carrier of the disease
C.Normal with homozygous genotype
D.Diseased with homozygous genotype
E. Diseased with heterozygous genotype

17) The locus of the gene coding for the

disease is on:
A.An autosome
B. X chromosome segment not
homologous with Y
C. Y chromosome segment not
homologous with X

9
D.Homologous segment of X and Y sex
chromosomes
E. Can’t be determined with this data

18) The document below represents the normal and

the mutant DNA sequence coding for a protein.
Normal DNA sequence: TAT CAT CCT AAG GTA
Mutant DNA sequence: TAT CAT CGT AAG GTA
The mutation that affects the DNA sequence is:
A.Mutation by substitution
B. Mutation by deletion
C.Mutation by addition
D.Silent mutation due to a deletion mutation
E. Mutation by insertion

19) A scientist conducted a series of experiments

on a specimen to identify whether it is a living or
nonliving organism. The results of the
experiments are found in the table below:
- Is capable of production when put in a host.
- Is incapable of growth after some time
- possesses DNA
- is capable of adapting to changing
environments
- is incapable of utilizing energy
Based on the results, what conclusion can the
scientist make?

10
A.the fact that it can adapt to changing
environments makes this specimen a living
organism regardless of other characteristics
B. any specimen possessing any form of nucleic acid
such as DNA will be considered a living organism
C.it is a non-living structure since it is incapable of
growing and developing
D.it is living since being able to reproduce on its own
is not necessary to conclude that a specimen is
not living
E. the table does not show enough evidence to
make any assumptions on the viability of the
specimen

20) Which of the following is most likely to be the

specimen in the experiment?
A.virus
B. bacteria
C.protozoan
D.amoeba
E. zooplankton

11
21) The cause of this abnormality is that the
zygote results from the union of sperm and
oocyte II where the:
A.Oocyte has (n+1)
chromosomes
B. Sperm has (n+1)
chromosomes
C.Sperm has n chromosomes
D.Oocyte has n chromosomes
E. Sperm or oocyte has 2n
chromosomes

22) Here is a fragment of DNA that has been cut at

certain points and will be run through a gel.

At the end of the experiment, which choice

represents the correct order of DNA
fragments, starting from the wells toward the
positive end?
A.1,2,3,4,5
B. 5,4,3,2,1
C.5,2,4,1,3
D.5,2,3,1,4
E. 3,1,4,2,5

23) The karyotype of an infant having “cri du chat

syndrome” presents an abnormality in

12
 .

The abnormality is called

A.Inversion
B. Translocation
C.Deletion
D.Trisomy
E. Substitution

24) Reverse transcriptase is an enzyme found in

(A) macrophages
(B) T lymphocytes
(C) B lymphocytes
(D) HIV virus
(E) antibodies

13
14
 Molecular Genetics
Mutation
A mutation is a change in a DNA sequence.
Mutations can result from DNA copying mistakes made
during cell division, exposure to ionizing radiation,
exposure to chemicals called mutagens, or infection by
viruses.
Somatic mutations: occur in body cells and cannot
be inherited.
Sex cell mutation: occur in gametes and can be
passed onto offspring.

Gene mutation
It is change in nucleotide sequence of gene.

Types of gene mutation:

1
 Inversion:
when a segment of a chromosome is reversed end to
end.
Frame shift mutation (deletion and insertion):
A frameshift mutation is a genetic mutation caused by
a deletion or insertion in a DNA sequence that shifts
the way the sequence in codons and amino acids.
It’s the most disastrous mutation because of changing
all amino acids sequence in polypeptide chain.

substitution (point) mutation:

Silent mutation: does not change an amino
acid, and has no effect on phenotype.

2
Nonsense mutation: changes an amino acid to
a STOP codon, resulting in shorter polypeptide chain.

Missense mutation: changes an amino acid

to another amino acid.

translocation occurs when a chromosome

breaks and the (typically two) fragmented pieces re-
attach to different non homologous chromosomes.

3
 Diseases of Genetic mutation
disease Type of symptoms
mutation
Phenylketonuria Autosomal recessive Caused by building up
(PUK) phenylalanine in the
body, so if no dietary
change is instituted in
birth, mental
retardation will result.
Cystic fibrosis autosomal recessive Characterized by a build-
up of fluid in lungs and
digestive system.
Huntington’s Autosomal dominant It causes the
progressive
disease breakdown
(degeneration) of
nerve cells in the
brain.
Onset is usually in
middle age.
hemophilia Sex linked recessive It is usually an
inherited bleeding
disorder in which the
blood does not clot
properly
Color blindness Sex linked recessive It is an inability to see
the difference between
certain colors.

4
 Chromosomal mutation
It’s a change in number of chromosomes.
Aneuploidy is the presence of an abnormal number
of chromosomes in a cell.
Polyploidy is the extra sets of chromosomes.It is
common among plants.

Any chromosomal mutation result from

nondisjunction, where homologous pairs fail to
separate in metaphase I or metaphase II during cell
division.

5
 Chromosomal abnormalities
Down syndrome:
47 Trisomy 21 (result from excess autosome
chromosome at homologous 21)

Turner syndrome:
45 chromosomes, Monosomy X (result from absence of
one X chromosome.

Klinefelter syndrome:
47 chromosomes, Result from excess X chromosome

6
 Genetic engineering
Restriction enzyme:

restriction enzyme is a protein produced by E. Coli

bacteria that cleaves DNA at specific sites along
the molecule.
In the bacterial cell, restriction enzymes cleave foreign
DNA, thus eliminating infecting organisms.
Each restriction enzyme recognizes a short, specific
sequence of nucleotide bases. These regions are
called recognition sequences.
restriction sites: specific sequences of
nucleotides, which are recognized by restriction
enzymes.
palindromic sequences: nucleic acid sequences
where the one strand matches its complementary
strand when read in the same direction.

7
 recombinant DNA technology
A human gene is introduced into a plasmid, which is
then introduced to a bacterial cell. The bacteria will
then use its cellular machinery to produce the protein.
For example, insulin is regularly produced by
means of recombinant DNA within bacteria.
Recombinant technology can be used for genetic
diseases cure.

8
Horizontal Gene Transfer in Bacteria

In transformation, a bacterium takes up a piece of

DNA floating in its environment.
In transduction, DNA is accidentally moved from
one bacterium to another by a virus.
In conjugation, DNA is transferred between
bacteria through a tube between cells.

9
Gel Electrophoresis of DNA (DNA Finger-printing)
(DNA analysis)
it based on motion of negative charge DNA (due to
phosphate group) in an electric field toward the
positive electrode in agarose gel.
Length and fragment size and Shape of the molecule
influences how the DNA runs, short fragments run
faster, large fragments run slowly, after cutting
DMA segments by restriction enzyme.
similar DNA fragments reach the positive electrode at
the same time.
DNA analysis used in:
1) Crime solving.
2) Paternity testing
3) Determine phylogeny (evolution relationship).

10
 Polymerase chain reaction (PCR)
PCR process used for DNA amplification.
Steps:

- Denaturation
The solution tube containing the DNA is heated to at
94°C to break the hydrogen bonds and separate the
DNA strands.
- Annealing
cooling to 50 allowing DNA polymerase enzymeto bind
to the individual strands of DNA. the nucleotides from
the added mixture solution will pair with the separated
strands of DNA.Taq polymerase is the heat-stable
DNA polymerase extracted from the thermophilic
bacteria)
- Extension
Now we formed a new complementary strand of DNA.
Then the process will be repeated to make copies of
DNA.

11
 Viruses
Viruses are boarder line between living and non-living
(obligate intra cellular parasite) that reproduce only in
its host.
viruses consist of nucleic acid (either DNA or RNA
but never both) enclosed by protein coat(capsid).

1) Viruses with DNA genome

Once inside the host, viral genome enters into two
possible life cycles:

A) Lytic cycle:
viral genome replicates by host DNA polymerase.
replicated genome packed in protein capsid that
expressed from viral genome by host RNA
polymerase.
12
finally host cell membrane lysis by special viral
enzyme and the new viruses escape to infect other
cells.

B)Lysogenic cycle:
viral genome inserted into host genome, and remain
dormant.
every time the cell genome replicate, also the viral
genome replicate until every daughter cell will carry
the viral genome.
until the cell be under stress (illness, radiation,
chemicals), the virus genome gets out the host
genome, and begin lytic cycle (transcription and
translation).

13
2) Viruses with RNA genome
A) lytic cycle:
RNA virus uses its specific enzyme (RNA dependent
RNA polymerase) to replicate its genome.
then pack its genome into protein capsid that
expressed from its genome.

B) Lysogenic cycle:
RNA virus that enters lysogenic cycle called retrovirus.
it needs specific enzyme (reverse transcriptase) to
transcript its RNA to DNA that inserted into host
genome.
HIV virus, and coronavirus virus are retroviruses.

14
 Molecular genetics
Practice 1

1.Polyploidy results from

(A)nondisjunction
(B)aneuploidy
(C)Down syndrome
(D)infection with a virus
(E)RNA processing

Questions 2–6
Choose from the terms below.
(A)Gel electrophoresis
(B)Restriction enzymes
(C)Polymerase chain reaction
(D)Recombinant DNA
(E)RNA processing
2.Referred to as molecular scissors
3.Used to separate large molecules of DNA on the
basis of their rate of movement through an agarose
gel in an electric field
4.Taking DNA from two sources and combining
them into one cell
5.Could cure cystic fibrosis
6.An automated technique by which a tiny piece of
DNA can be rapidly amplified

Questions 7–12
Refer to the list below of inherited diseases.
1
(A)Phenylketonuria
(B)Cystic fibrosis
(C)Huntington’s disease
(D)Hemophilia
(E)Down syndrome
7.Results from a mutation of chromosomes
8.Characterized by a buildup of fluid in the lungs
9.If no dietary change is instituted at birth, mental
retardation will result
10.Autosomal dominant disease of the nervous
system that results in death
11.Sex-linked recessive disorder
12.Onset is usually in middle age

13.A man with Klinefelter’s syndrome has 47

chromosomes and has three sex chromosomes,
XXY. This abnormality came about as a result of
(A)crossing-over
(B)deletion of a chromosome
(C)addition of a chromosome
(D)nondisjunction
(E)mutation in a gene

2
Questions from 14 to 17 …
(A) 5' UAACG 3'
(B) 5' ATTCG 3'
(C) 5' TAAGC 3'
(D) 5' ATACG 3'
(E) 5' AUUGC 3'
14. DNA complement to 3' TAAGC5'.
15. Product of a single inversion in 5' AATGC 3'.
16.Transcription product of 3' ATTGC 5'.
17.Result of single base-pair mutation in 5' TTTCG3'.

18. For a mutation to be significant for the process of

evolution, it must be present
(A) In diploid cells.
(B) In the nerve cells of an individual.
(C) In gametes.
(D) In all members of the population.
(E) During mitosis in heart cells.

Questions 19 to 22 …
(A) Replication
(B) Recombination
(C) Transcription

3
(D) Translation
(E) Deletion
19. A DNA strand serves as a template for the synthesis
of another DNA strand of equal length.
20. DNA serves as a template for the synthesis of a new
molecule of RNA.
21. Two DNA molecules exchange corresponding
segments.
22. An RNA molecule provides directions for the
assembly of protein.

4
 Molecular Genetics
Practice 2

1) What type of chromosomal mutation is represented

in the figure below?

A.Deletion
B. Addition
C.translocation
D.silent mutation
E. inversion

2) An experiment was conducted on mice to test the

effect of different levels of radiation on the formation
of protein X. After many trials, scientists noticed that
the amino acid sequence in protein X formed by
these mice was different by one amino acid
compared to the original one. The mutation that has
occurred in these mice is:
I. nonsense mutation
II. silent mutation
III. missense mutation
A.I only
B. II only
C.III only
1
 D.I and II only
E. None of the above.

3) Down’s syndrome is a chromosomal abnormality

characterized by three copies of chromosome 21.
This abnormality is the result of:
A.the inversion of a chromosome
B. the deletion of a chromosome
C.genetic mutation
D.nondisjunction
E. crossing-over

4) A man with Klinefelter’s syndrome has 47

chromosomes and has three sex chromosomes,
XXY. This abnormality came about as a result of
A.crossing-over.
B. a deletion of a chromosome.
C.an addition of a chromosome.
D.nondisjunction.
E. a mutation in a gene.

Questions 5 and 6 ….
The genes coding for one of the MHC proteins,
DQ, are extracted from two identical skin cells
and put in two tubes A and B. The same
restriction enzyme is added to the two tubes. The
produced fragments from each tube are
separated by gel electrophoresis. The results are
tabulated below.
2
 Tube A Tube B

5) The length in base pair (bp) of this gene is

A.1000 bp
B. 2400 bp
C.1200 bp
D.1100 bp
E. 900 bp

6) The result indicates that a mutation at the level of the

DQ gene has taken place at fragment
A.400
B. 500
C.300
D.200
E. 900

7) Which of the following diseases results from a

chromosomal abnormality?
A.Huntington’s disease

3
 B. Sickle cell anemia
C.Cystic fibrosis
D.Down syndrome
E. Phenylketonuria (PKU)

8) Mutations are a permanent alteration that attack

sequences of genes. The following strand is a strand
of DNA coding for estrogen, a sexual hormone.
3'ACC.GAC.TAT.ATA.TAT.CCG.CAC.TAC.TTC.GA
C.ACT 5'
mutation by deletion attacks the ninth nucleotide.
The mutated sequence will be
A.3'ACC.GAC.TAC.ATA.TAT.CCG.CAC.TAC.TTC.
GAC.ACT 5'
B. 3'ACC.GAC.TAG.TAT.ATC.CGC.ACT.ACT.TCG.
ACA.CT 5'
C.3'ACC.GAC.TAT.ATA.TAT.CCG.CAC.TAC.GAC.
ACT 5'
D.3'ACC.GAC.TAA.TAT.ATC.CGC.ACT.ACT.TCG.
ACA.CT 5'
E. 5'ACC.GAC.TAG.ATA.TAT.CCG.CAC.TAC.GAC.
ACT 3'

Three individuals A, B, and C are suspects in murder

case. Based on blood stains collected from victim S,
we obtained, with a specific probe of a determined
locus, the DNA fingerprint S. The DNA fingerprint of
suspect A was obtained with the same probe based on
blood, skin, and hair samples; the same goes for the

4
fingerprint of B. The DNA fingerprint of C was obtained
based on a blood sample.
9)Based on the results, we can conclude that

A.suspects B and C
participated in the murder.
B. suspects A and C
participated in the murder.
C. suspects A and B
participated in the murder.
D.the three suspects A, B, and
C participated in the murder.
E. none of the suspects
participated in the murder.

10) In gel electrophoresis, DNA bands are

separated according to
A.Their solubility in agarose gel
B. The sequence of nucleotides
C.Composition of nitrogenous bases
D.Size of fragment
5
E. Size of fragment and sequence of nucleotides

11) A piece of DNA is amplified by

A.Gel electrophoresis
B. DNA recombination
C.PCR
D.Addition of restriction enzymes
E. Transcription

12) A couple with normal phenotype, who each

have a family history of albinism, is
expecting a baby. They had DNA
fingerprinting in order to determine their
genotypes and to know if the fetus is going
to be albino or not. The following document
shows the fingerprinting for this couple and
their fetus.

From the above DNA fingerprinting, we can

conclude that
A.The allele for albinism is dominant and the
fetus will have the condition
B. The allele for albinism is dominant and the
fetus will not have the condition
C.The allele for albinism is recessive and the
fetus will have the condition
D.The allele for albinism is recessive and the
fetus will not have the condition

6
 E. The allele for albinism is recessive and masks
the normal allele

Karyotype A Kary o type B

13) Which statement correctly reflects the gender?

A. Karyotype A belongs to a male
because of the presence of XX pai
B. Karyotype B belongs to a female
because of the presence of XY pair
C.Karyotype B belongs to a male
because of the presence of XY pair
D.Karyotype B belongs to an abnormal
female because of the presence of two
chromosomes XY
E. Karyotype A belongs to an abnormal
female because of the presence of two
chromosomes XX

14) Which of the following statements best

explains the fact that a mutation in a cell’s
7
 DNA does not always result in an error in the
polypeptide produced from that DNA
sequence?
A.Some polypeptides are produced by a code other
than a nucleic acid code
B. The nucleolus can repair damaged DNA
C.The Golgi body can repair damaged DNA
D.Each amino acid is coded by more than one
codon
E. Scientists have no idea why this phenomenon
occurs

Questions 15 to 17 …
Tay-Sachs disease is known as an infantile
disease which is characterized by relentless
deterioration of mental and physical abilities.
It begins at 6 months of age and usually
results in death by the age of five. A couple
has two girls out of which one is 2 years old
and has the disease. The mother got
pregnant and she is afraid of having another
affected child. She visited a genetic
counsellor who requested that a DNA
analysis test be completed for the whole
family. The results of the DNA analysis of all
family members are shown in the following
table.

8
15) Based on the above given, the band(s)
which correspond(s) to the:
A.Disease are bands A and C
B. Disease are bands B and C
C.Normal phenotype is band A
D.Normal phenotype are bands A and B
E. Normal phenotype are bands A and C

16) Depending on the test analysis, the fetus is:

A.Of unknown genotype
B. Normal carrier of the disease
C.Normal with homozygous genotype
D.Diseased with homozygous genotype
E. Diseased with heterozygous genotype

17) The locus of the gene coding for the

disease is on:
A.An autosome
B. X chromosome segment not
homologous with Y
C. Y chromosome segment not
homologous with X

9
D.Homologous segment of X and Y sex
chromosomes
E. Can’t be determined with this data

18) The document below represents the normal and

the mutant DNA sequence coding for a protein.
Normal DNA sequence: TAT CAT CCT AAG GTA
Mutant DNA sequence: TAT CAT CGT AAG GTA
The mutation that affects the DNA sequence is:
A.Mutation by substitution
B. Mutation by deletion
C.Mutation by addition
D.Silent mutation due to a deletion mutation
E. Mutation by insertion

19) A scientist conducted a series of experiments

on a specimen to identify whether it is a living or
nonliving organism. The results of the
experiments are found in the table below:
- Is capable of production when put in a host.
- Is incapable of growth after some time
- possesses DNA
- is capable of adapting to changing
environments
- is incapable of utilizing energy
Based on the results, what conclusion can the
scientist make?

10
A.the fact that it can adapt to changing
environments makes this specimen a living
organism regardless of other characteristics
B. any specimen possessing any form of nucleic acid
such as DNA will be considered a living organism
C.it is a non-living structure since it is incapable of
growing and developing
D.it is living since being able to reproduce on its own
is not necessary to conclude that a specimen is
not living
E. the table does not show enough evidence to
make any assumptions on the viability of the
specimen

20) Which of the following is most likely to be the

specimen in the experiment?
A.virus
B. bacteria
C.protozoan
D.amoeba
E. zooplankton

11
21) The cause of this abnormality is that the
zygote results from the union of sperm and
oocyte II where the:
A.Oocyte has (n+1)
chromosomes
B. Sperm has (n+1)
chromosomes
C.Sperm has n chromosomes
D.Oocyte has n chromosomes
E. Sperm or oocyte has 2n
chromosomes

22) Here is a fragment of DNA that has been cut at

certain points and will be run through a gel.

At the end of the experiment, which choice

represents the correct order of DNA
fragments, starting from the wells toward the
positive end?
A.1,2,3,4,5
B. 5,4,3,2,1
C.5,2,4,1,3
D.5,2,3,1,4
E. 3,1,4,2,5

23) The karyotype of an infant having “cri du chat

syndrome” presents an abnormality in

12
 .

The abnormality is called

A.Inversion
B. Translocation
C.Deletion
D.Trisomy
E. Substitution

24) Reverse transcriptase is an enzyme found in

(A) macrophages
(B) T lymphocytes
(C) B lymphocytes
(D) HIV virus
(E) antibodies

13
14
 CELL RESPIRATION
Cell respiration is an exergonic reaction (release energy)
from a glucose molecule.
Aerobic respiration occurs in presence of oxygen.
Anaerobic respiration occurs in absence of oxygen.

1
 Aerobic Respiration
C6H12O6 + 6O2 → 6CO2 + 6H2O + energy
It occurs in presence of Oxygen.
it consists of: glycolysis, Krebs cycle, and
oxidative phosphorylation (electron
transport chain and chemiosmosis).
It is the reverse of photosynthesis process.

A) Glycolysis
it the anaerobic phase of aerobic respiration.
it occurs in cytoplasm.
the glucose molecule release 2 pyruvate, 2 ATP, and
2 NADH2

2
B) kerbs cycle (citric acid cycle):
It goes twice for one glucose molecule.
It occurs in the matrix of mitochondria.
It is the first stage of aerobic phase of cellular
respiration.
Steps:
 pyruvic acid (from glycolysis) converts to Acetyl-
CoA that enters Krebs cycle.

 The by-product is CO2 which is exhaled.

 NAD+ and FADH+ are coenzymes
carry protons (H+) to electron transport
chain by reducing to NADH2 and
FADH.
 ATP also is produced.
 NADH release 3 ATP, while FADH2 release 2 ATP.
 so, the net product of kerbs cycle is:
CO2, ATP, NADH2, FADH2.

3
C) oxidative phosphorylation:
it occurs in cristae (the inner membrane of
mitochondria).
It is the second stage of aerobic phase of
cellular respiration.
it creates proton concentration gradient through
electron transport chain, that produce 32 ATP
(chemiosmosis) by using ATP synthase.
O2 is the final hydrogen acceptor.
The ATP synthase is a mitochondrial enzyme localized
in the inner membrane, works as a turbine where it
catalyzes the synthesis of ATP from ADP and

4
phosphate, driven by a flux of protons across a gradient
generated by activated electron.

5
 Anaerobic respiration(fermentation)
it occurs in cytoplasm after glycolysis. in absence of
oxygen.

Lactic fermentation:
 It happens in skeletal muscle, and bacteria in yogurt.
 It produces 2 ATP, and lactic acid from pyruvate.
Alcohol fermentation:
 It happens in yeast, and some protozoa.
 It produces alcohol, CO2, 2 ATP.
 Fermentation oxidize NADH2 to NAD+ to
regenerate glycolysis.

6
 Photosynthesis
6CO2 + 6H2O + Sunlight ———> C6H12O6 + 6O2
It is the process that sunlight used by
photoautotrophic organism (plant, algae, and
cyanobacteria) for making glucose.( converting
solar energy to chemical energy). it is an
endergonic reaction (begin with energy). we
measure the rate of photosynthesis by using
iodine solution as an indicator. iodine changes from
yellow color to blue in presence of starch. but
before using iodine, we sink leaf in boiling alcohol to
get rid of green chlorophyll.

7
Red, violet and blue light are the best
wavelength that absorbed by chlorophyll, while
green, yellow colours are reflected.
photosynthesis consist of two processes: light
dependent reaction, light independent reaction
(Calvin cycle).

8
Light dependent reaction:
it occurs in thylakoid in chloroplast. light
absorbed by chlorophyll, then exited electrons
separate water to hydrogen, electrons, oxygen
(photolysis).
The electron transport chain moves protons across
the thylakoid membrane into the lumen (the space
inside the thylakoid disk).
ATP synthase that passes protons into the stroma
space, create the energy to synthesize ATP.
ATP, NADPH, O2(by-product) produced.

Light independent reaction (Calvin

cycle):
it occurs in stroma in chloroplast.
it initiates by NADPH, ATP from light reaction, and
CO2 from atmosphere for making sugar (carbon
fixation).

9
phosphoglyceraldhyde(PGAL) and G3P are
sugars involved in Calvin cycle.

10
Photosynthesis and cellular respiration
Practice 1
1. All of the following are correct about cell respiration
EXCEPT
(A) it is an oxidative process
(B) all plant and animal cells carry out respiration all the
time
(C) it consists of glycolysis, Krebs cycle, and the
electron transport chain
(D) oxygen molecules are pumped across the cristae
membrane to the outer compartment
(E) most ATP is produced during cell respiration as a
result of the electron transport chain and chemiosmosis

2. Glycolysis
(A) produces water
(B) requires oxygen
(C) involves an electron transport chain
(D) is the breakdown of glucose to produce pyruvic acid
(E) produces carbon dioxide

3. The electron transport chain is located in the

(A) cytoplasm
(B) cristae of the mitochondria
1
(C) outer compartment of mitochondria
(D) inner matrix
(E) Golgi body

4. Each NADH molecule carrying protons to the electron

transport chain can produce ____________ molecules
of ATP.
(A) 1
(B) 2
(C) 3
(D) 20
(E) an unlimited number of

5. Which of the following is the most important thing that

occurs during cell respiration?
(A) CO2 is produced during the Krebs cycle.
(B) Protons and electrons combine with oxygen to form
water.
(C) Oxygen is released.
(D) A proton gradient is created.
(E) ATP is produced.

6. The loss of electrons is known as

(A) reduction
2
(B) oxidation
(C) redox
(D) electron transport chain
(E) lysis

7. The immediate result of the electron transport chain is

(A) water is produced
(B) ATP is produced
(C) lactic acid is produced
(D) glucose is broken down into 2 pyruvic acid
molecules
(E) a proton gradient is created

8. The role of oxygen in aerobic respiration is

(A) to transport CO2
(B) as the final proton and electron acceptor in the
electron transport chain
(C) to transport electrons in glycolysis
(D) to provide electrons for the electron transport chain
(E) most important in the Krebs cycle

9. Which of the following is a waste product of aerobic

cell respiration?
I. Water
3
II. Carbon dioxide
III. ATP
(A) I only
(B) II only
(C) I and II only
(D) III only
(E) I, II, and III

Questions 10–15
The three circles represent three major processes in
aerobic respiration.

10. Process A represents

(A) glycolysis
(B) the Krebs cycle
(C) the electron transport chain
(D) alcohol fermentation
(E) lactic acid fermentation

11. Process A occurs in

(A) mitochondria
4
(B) chloroplasts
(C) the nucleus
(D) the cytoplasm
(E) different organelles in different cells

12. Process C represents

(A) glycolysis
(B) the Krebs cycle
(C) the electron transport chain
(D) alcohol fermentation
(E) lactic acid fermentation

13. Which of the following is correct about these

processes?
(A) Process A requires energy.
(B) Process B requires energy.
(C) Process C requires energy.
(D) Process A depends on a gradient.
(E) Process B releases oxygen.

14. Which is true about process C?

(A) It requires water.

5
(B) It is universal. It is the way all organisms produce
energy.
(C) It involves the membrane structure ATP synthase.
(D) It only occurs in animals, not plants.
(E) It results in the by-product pyruvic acid.

15. Which is true about process B?

(A) It produces the most energy of all the processes.
(B) It produces energy by chemiosmosis.
(C) Its production of energy is explained by the laws of
diffusion.
(D) The raw material is pyruvic acid.
(E) It releases carbon dioxide.
________________________________________
16. Which of the following probably evolved first?
(A) the Krebs cycle
(B) chemiosmosis
(C) glycolysis
(D) the electron transport chain
(E) the citric acid cycle

17. All of the following are correct about ATP synthase

EXCEPT
(A) it is a molecule located within the cristae membrane
6
(B) it spins like a turbine
(C) it binds a phosphate to a molecule of ADP
(D) it is an important component of glycolysis
(E) its function depends on a proton gradient

18. The breakdown of glucose into pyruvic acid occurs

during the process of
(A) glycolysis
(B) lactic acid fermentation
(C) the Krebs cycle
(D) the electron transport chain
(E) alcohol fermentation

19. Choose the pair that is correctly matched.

(A) Krebs cycle—cytoplasm
(B) Electron transport chain—outer compartment of
mitochondria
(C) Glycolysis—cristae membrane
(D) Glycolysis—mitochondria
(E) Electron transport chain—cristae membrane

20. During strenuous exercise, skeletal muscles use up

________ and produce large amounts of ________,
which causes pain and fatigue in the muscle.
7
(A) pyruvic acid—carbon dioxide
(B) carbon dioxide—pyruvic acid
(C) pyruvic acid—lactic acid
(D) oxygen—lactic acid
(E) glycogen—carbon dioxide

Questions 21– 25
Choose from the terms below:
(A) Oxygen
(B) Protons
(C) PGAL
(D) NADPH
(E) ATP
21. Provides the energy for the light-independent
reactions
22. A sugar synthesized during photosynthesis
23. Released as a waste product from the light-
dependent reactions
24. A molecule that carries H2 from the light-dependent
reactions to the light-independent reactions
25. Pass through ATP synthase channels
________________________________________
26. The oxygen that plants give off

8
(A) comes from the light-dependent reactions of
photosynthesis
(B) comes from the light-independent reaction of
photosynthesis
(C) is a by-product of respiration
(D) comes from carbon dioxide that plants absorb
(E) is carried from the Calvin cycle to the light reactions
by NADP

27. All of the following statements are correct about

photosynthesis EXCEPT
(A) water provides hydrogen for carbon fixation
(B) the light-independent reactions occur in the stroma
(C) the light-independent reactions normally occur at
night in most plants
(D) the light-dependent reactions occur in the thylakoid
membranes
(E) the thylakoid membranes are part of the grana

28. All of the following statements are correct about the

light-dependent reactions of photosynthesis EXCEPT
(A) carotenoids are accessory pigments
(B) they take place in the grana
(C) when light strikes chlorophyll a, electrons enter an
electron transport chain

9
(D) PGAL, a 3-carbon sugar, is produced
(E) they take place within the thylakoid membranes

29. All of the following statements about photolysis are

correct EXCEPT
(A) it occurs during the light-independent reaction
(B) it releases oxygen
(C) it provides hydrogen for carbon fixation
(D) it supplies electrons to chlorophyll a
(E) it is the process of splitting apart molecules of water

30. Here is an absorption spectrum for an unknown

substance. What color is the substance?

(A) Red

10
(B) Blue
(C) Green
(D) Yellow
(E) Violet

Questions 31–35
Indicate which of the following events occurs during
(A) Light-dependent reactions
(B) Light-independent reactions
31. Oxygen is released
32. Carbon fixation occurs
33. ATP is produced
34. Electrons flow through an electron transport chain
35. Calvin cycle occurs
________________________________________
36. The sugar formed from photosynthesis is
(A) ATP
(B) glucose
(C) pyruvic acid
(D) PGAL
(E) sucrose

11
37. Which of the following is not a photosynthetic
pigment?
(A) Chlorophyll a
(B) Chlorophyll b
(C) Carotenoid
(D) Bromothymol blue
(E) Phycobilins

38. Carotenoids absorb all colors of light EXCEPT

(A) green
(B) blue
(C) yellow
(D) red
(E) violet

39. The initial role of chlorophyll in photosynthesis is to

(A) synthesize sugar
(B) absorb light energy
(C) fix carbon dioxide
(D) synthesize carbon
(E) convert ADP to ATP

12
40. Which of the following is produced by both cellular
respiration and the light-dependent reactions of
photosynthesis?
(A) glucose
(B) ATP
(C) CO2
(D) pyruvic acid
(E) oxygen

13
Photosynthesis and cell respiration
Practice 2

ADP + P ATP
1) Which of the following biological processes would
provide the energy for the reaction above?
(A) The synthesis of proteins from amino acids.
(B) The combination of glycerol and fatty acids to form a
fat.
(C) The combination of glucose and fructose to form
sucrose.
(D) The hydrolysis of protein to amino acids.
(E) The oxidation of glucose.

2) The breakdown of glucose to pyruvic acid is called

(A) Hydrolysis
(B) Biosynthesis
(C) Glycolysis
(D) Electron transport
(E) Oxidative phosphorylation

3) In which step of aerobic respiration is most of the

carbon dioxide formed?
(A) Glycolysis
1
(B) The Calvin cycle
(C) The Krebs cycle
(D) Electron transport
(E) ATP synthesis

4) Chloroplasts trap light energy by

(A) Using the molecule chlorophyll to absorb photons of
light.
(B) Using the molecule glucose to absorb photons of
light.
(C) Using glucose that they have made to create ATP.
(D) Using light energy to convent ATP into ADP+ P.
(E) Converting C02 into glucose.

5) Which of the following processes utilizes atmospheric

oxygen?
(A) Photosynthesis
(B) Cellular respiration
(C) Fermentation
(D) Glycolysis
(E) Hydrolysis

6) Which of the following are the final products of

fermentation?
(A) Carbon and oxygen.
2
(B) Glucose and alcohol.
(C) Carbon dioxide and oxygen.
(D) Carbon dioxide and alcohol.
(E) Oxygen and water.

7) Cellular respiration shares which of the following

characteristics with the light-dependent reactions of
photosynthesis?
(A) Production of ATP
(B) Production of AMP
(C) Production of GTP
(D) Production of oxygen
(E) Use of carbon dioxide in synthetic reactions

Questions from 8 to 10 …
(A) Mitochondria
(B) Cytoplasm
(C) Pyruvate
(D) Lactic acid
(E) Glucose
8) Location of cellular respiration in prokaryotes.
9) End product of anaerobic metabolism in muscle cells.
10) Location of glycolysis in eukaryotes.

3
11) A student ran an experiment to study the process of
photosynthesis in a lab. The setup of the experiment is
shown in the figure below.

The gas produced in this experiment is:

A. oxygen
B. carbon dioxide
C. nitrogen
D. both B and C
E. It depends on the intensity of light

12) A kind of microorganism X is cultured in a test

tube on a chemical medium composed of water and
mineral ions. When this tube is placed in the light and
in the dark, X does not multiply. When sucrose is
added to the liquid, X multiplies. Microorganism X is:
A.photoautotroph
B. heterotroph
C.composed with chlorophyll
D.mixotrophic
E. photoautotroph or chemoautotroph

4
 13)The graph below shows how the rate of
photosynthesis varies with different
concentrations of carbon dioxide.Why did the
rate of photosynthesis platue?

A.Plants do not require a concentration more than

0.06% of carbon dioxide.
B. The rate will increase again if we increase the
concentration of carbon dioxide beyond 0.16%.
C.Other factors such as light and water are constant;
thus, they act as limiting factors.
D.The plant could be placed in the dark.
E. The rapid increase that occurred at lower carbon
dioxide concentrations exhausted the photosynthetic
mechanism of the plant.

Questions from 14 to 16 ….

A. Glycolysis
B. Krebs cycle
C. Chemiosmosis

5
 D. Lactic acid fermentation
E. Alcohol fermentation
14)This phase produces the maximum amount of
ATP.
15)Oxygen acts as a substrate in this phase.
16)Yeast carries out this process to produce
carbon dioxide.

17)Which photosynthetic reaction uses carbon

dioxide molecules to produce glucose?
A. Light-dependent reaction
B. Calvin cycle
C. Both light-dependent and light-independent
reactions
D. Electron transport chain
E. None of the above.

18)ATP is produced during which of the following

processes?
I. Photosynthesis
II. Aerobic respiration
III. Fermentation
A. I only
B. II only
C. I and III only
D. II and III only
E. I, II, and III
6
Questions 19 to 23 …
A. Light-dependent reactions
B. Light-independent reactions
C. Krebs cycle
D. Glycolysis

19)It occurs in the cytoplasm.

20)Water is broken down.
21)Pyruvate is the product.
22)Sugar is produced.
23)Oxygen is released.

Questions 24 to 26 …
A.Alcoholic fermentation
B. Lactic acid fermentation
C.Glycolysis
D.Krebs cycle
E. Electron transport chain
24)It occurs during strenuous exercise when
the body cannot keep up with the demand
of oxygen.
25)It occurs in the cytoplasm where one
glucose molecule is broken apart into two
molecules of pyruvate.
26)A phase of cellular respiration that occurs
in the cristae of mitochondria is

7
The graph below shows the variation of the
amount of oxygen used by the cell as a function
of the intensity of exercise.

27)Referring to the data from the above graph,

we can conclude that
I. As the exercise becomes difficult, the body
relies more on lactic acid fermentation.
II. Low intensity exercises do not require
increased oxygen uptake.
III. Difficult exercise requires additional oxygen
in order to generate extra ATP for muscles.
IV. During exercise the body relies only on the
aerobic pathway.
A.I only
B. III only
C.I and II
D.II and IV
E. I, II and IV

28) How can you explain the plateau (constant)

of oxygen consumption.
I. Very high intensity exercise does not require
increased amount of oxygen.
8
II. Red blood cells are saturated with oxygen
and can’t bind more oxygen molecules
IV. The body uses CO2 instead of O2 when
doing very high intensity exercises.
A. I only
B. II only
C.III only
D.I and II
E. II and III

Questions from 29 to 33 …
The three circles represent three major processes in
aerobic respiration.

29)Process A represents:
A.Glycolysis
B. The Krebs cycle
C.The electron transport chain
D.Alcohol fermentation
E. Lactic acid fermentation

30)Process A occurs in:

A. Mitochondria
B. Chloroplasts

9
 C. The nucleus
D. The cytoplasm
E. Different organelles in different cells

31)Process C represents:
A. Glycolysis
B. The Krebs cycles
C. The electron transport chain
D. Alcohol fermentation
E. Lactic acid fermentation

32)Which process (es) produce (s) the most amount

of energy?
A. A
B. B
C. C
D. A and B
E. A and C

33)Which is true about process C?

A. Energy is produced by substrate level
phosphorylation
B. It is universal. It is the way all organisms
produce energy
C. It involves the membrane structure ATP
synthetase
D. It only occurs in animals, not plants
E. It results in the by-product pyruvic acid
10
11
 Biochemistry
ORGANIC COMPOUNDS
 Organic compounds are compounds that contain
carbon, and hydrogen atoms linked by
covalent bond.
There are five classes of organic compounds:
(carbohydrates, lipids, proteins, nucleic
acids, and vitamins).

Carbohydrates

 Elements: Carbon, Hydrogen, Oxygen.

 3 Carbon atoms as minimum.
 One gram release 4 calories.
 Types: Simple carbohydrates
(Monosaccharaides, Disaccharides), and
Complex Carbohydrates (Polysaccharides).
 It is the direct source of energy.
A) Monosaccharaides: (CnH2nOn):
1) Trioses(C3H6O3): has 3 carbon atoms.
Example: PGAL and G3P (Glyceraldehyde 3
phosphate), it is the first sugar molecule formed
during photosynthesis).

1
2) Pentoses: 5 carbon atoms.
Examples:
 Ribulose bi phosphate: important in light
independent reaction in photosynthesis.
 Ribose: (C5H10O5), it is important in formation of
ATP& RNA.
 Deoxyribose: (C5H10O4), important in formation of
DNA.

3) Hexoses (C6H12O6):
 It has 6 carbon atoms.
 Examples:
o Glucose (Grape sugar): It is the primary Cellular
energy source for plants & animals.
o Fructose (Fruit sugar)
o Galactose (Milk sugar)
 Glucose, Fructose & Galactose are ISOMERS.
 ISOMERS are molecules have same chemical
formula but differ in structural formula
(arrangement of atoms).

2
B) Disaccharides: (C12H22O11):
 It consists of two monosaccharides joined
by (dehydration) removing of water.
 (Hydrolysis) is opposite of dehydration. It
is the breakdown of compound with
addition of water. It is what occur during
digestion.

3
C) Polysaccharides:
they are polymers formed from many
monomers(glucose) joiner together by
dehydration.

Oligosaccharides are a type of

carbohydrate chain made up of three to 10
simple sugars

4
 Lipids
 it is formed of carbon, hydrogen, and
oxygen, and sometimes phosphorous.
 Hydrogen is much more than oxygen.
 One gram of lipids releases 9 calories.
 It is less dense than water.
 types: Triglycerides – Phospholipids (main
component of ant cell membrane) - Cholesterol –
Waxes (cover plant leaf) – Steroids (some
hormones).
 Triglyceride formed of 1 glycerol &3 fatty acids
(saturated & unsaturated).

 Fats (lipids with saturated fatty acids) in animals,

solid in room temperature & case heart disease.
 Oils (lipids with unsaturated fatty acids) is found in
plants, liquid in room temperature & do not cause
heart disease.

5
 Triglycerides are not polymers.
 Lipids are degraded into fatty acids and glycerol by
(Hydrolysis).
 Cholesterol is the most important steroid that found in
animal cell only &. build sex hormones (oestrogen,
progesterone, & testosterone).
 Arteriosclerosis is a result of excess fat in our body,
and may cause Heart attack.

 Function of lipids:
o Energy storage.
o Phospholipids are a major component of
cell membrane.
o Cushioning of body organs, like liver, heart
& kidneys.
o Heat insulation
o Buoyancy in aquatic animals.

6
 Proteins
 formed of Carbon, Hydrogen, Oxygen, Nitrogen.
 One gram of protein releases 4 calories of heat.
 Proteins are polymers or polypeptides consisting of
repeating units called amino acids joined by
peptide bonds.
 Amino acid consist of a carboxyl group, an amine
group, hydrogen atom & a variable (R), all attached
to a central carbon atom.

 Variable (R) differs among the 20 types of amino

acids.
 proteins are synthesized in Ribosomes in cells.
 They are considered the greatest percentage
organic molecules in living organisms.
 Proteins are degraded into a mixture of amino acids
by (Hydrolysis).
 Proteins are synthesized by(dehydration) of amino
acids.

7
 Protein Structure:
o Shape of protein is result of 4 levels of structure:
primary, secondary, tertiary, & quaternary.
Primary structure: sequence of amino acids
makes up protein chain by peptide bonds.
Secondary structure: result from additive
hydrogen bond that make the helical structure of
many proteins.
Tertiary structure: three-dimensional shape
of protein. It formed by It formed by (Ionic bond,
Hydrogen bond, disulphide bond, in addition to
peptide bond).
Tertiary structure determines the way protein
functions and its specificity. protein denature (lose
shape, function) in high temperature and
adverse pH
Quaternary structure: consist of more than one
polypeptide chain. Ex: Haemoglobin.

8
Function of protein:
 Enzymes are protein in nature.
 Peptide Hormones are proteins.
 Actin & Myosin are protein found in muscle cel
 Nails, Hair, Keratin are proteins.
 Proteins are important for repair and growth.
 Antibodies formed by lymphocytes are proteins
 Haemoglobin (it is red pigment protein inside R.B.C
that binds oxygen).
 Protein channels have transporting function in cell
membrane

9
 Nucleic acids
 formed of Carbon, Hydrogen, Oxygen, Nitrogen,
Phosphorus.
 The nucleic acids are Deoxyribonucleic acid (DNA) &
Ribonucleic acid (RNA), and Adenosine Triphosphate
(ATP).
 ATP (energy molecule) is one nucleotide consist of
three phosphate group, pentose(ribose) sugar,
one adenine (nitrogenous base).

 DNA (double strand) and RNA (single strand)

made up of thousands of repeating small monomers
(nucleotides).
 In DNA and RNA Nucleotide consists of:
o One Phosphate group.
o Five carbon sugar (pentose).
o Organic nitrogenous base.
 All Nucleotides differ in their Nitrogenous Base & have
same sugar and phosphate group.

10
 The pentose sugar in RNA is ribose & deoxyribose in
DNA.
 Nitrogen Bases of DNA are purine (adenine, guanine)
or pyrimidine (cytosine & thymine).
 Nitrogen Bases of RNA are purine (adenine, guanine)
or pyrimidine (cytosine & uracil).
 The organic nitrogenous bases are joined by weak
hydrogen bonds. (Double between A& T, triple
between G & C).
 The back-bone of nucleic acid molecule is formed of
phosphate-sugar units linked together by covalent
phosphate diester bonds.

11
12
13
An ionic bond essentially donates an electron to
the other atom participating in the bond, while electrons
in a covalent bond are shared equally between the
atoms.

14
 Isotopes

 Isotopes are atoms of the same element that have

different numbers of neutrons but the same
number of protons and electrons.
 Isotopes are the same atomic number (number of
protons), and different mass number (protons +
neutrons.

Water structure

15
 A hydrogen bond (responsible for specific
water properties) is intermolecular bond formed
due to the attraction between hydrogen and oxygen of
two different molecules.
 covalent bonds are intramolecular attractions
between hydrogen and oxygen of same molecule.

Properties of water

Cohesion:
 Because of the polarity of the molecules, water
molecules are attracted to each other by
Hydrogen bonds.
 Cohesiveness also leads to high surface tension.
An example of the surface tension is seen by beading
of water on surfaces and by the ability of insects to
walk on liquid water without sinking.

16
 Adhesion:
 is water's ability to attract other molecules by
hydrogen bonds.

 Adhesion and cohesion lead to capillary action,

which is seen when the water rises up a narrow glass
tube or within the stems of plants.

The high specific heat (capacity) and high

heat of vaporization:
 a lot of energy is needed to break hydrogen bonds
between water molecules.
 water resists extreme temperature changes.
 This is important for weather and also for species
survival.

17
  The high heat of vaporization means evaporating
water has a significant cooling effect. Many animals
use perspiration to keep cool.

Ice is less dense than liquid water:

 For most materials, the solid phase is denser than the
liquid phase.
 Hydrogen bonds between water molecules are
responsible for the lower density of ice. An
important consequence is that lakes and rivers freeze
from the top down, with ice floating on water.
 Topmost layer of water freezes and ice remains on
top allowing aquatic life to survive under ice in
north and south poles.

Water is universal solvent:

 because it is able to dissolve many different
substances.
 Because of its polarity and ability to form hydrogen
bonds, water makes an excellent solvent,

18
 PH scale
pH is a measure of how acidic/basic solution is.
The range goes from 0 – 14.
with 7 being neutral.
pH of less than 7 indicate acidity.
whereas a pH of greater than 7 indicates a base.
pH is really a measure of the relative amount of free
hydrogen and hydroxyl ions in the solution.
solution that has more free hydrogen ions is acidic
(PH lower than 7), whereas solution that has more free
hydroxyl ions (less hydrogen ions, pH more than 7)
is basic.

19
 A buffer is an aqueous solution that
consists of a mixture of a weak acid and its
salt (acid buffer) or a weak base with its salt
(basic buffer). Its pH changes very little
when a small amount of strong acid or base
is added to it and is thus used to prevent
a solution's pH change.
 Ex: carbonic acid buffer in blood and
intestine.

20
 Biochemistry
Practice 1
1. A solution with a pH of 2 is ________ times more
acidic than one with a pH of 5.
(A) 3
(B) 10
(C) 100
(D) 1,000
(E) 10,000

2. The radioisotope I-131 is used to diagnose and treat

diseases of the
(A) brain
(B) thyroid
(C) pancreas
(D) lungs
(E) stomach

3. All of the following are correct about water EXCEPT

(A) water is a molecule
(B) there is little attraction between water molecules
(C) the covalent bonds between oxygen and hydrogen
are polar or unbalanced
1
(D) the reason that water and lipids do not mix is
because water is a polar molecule while lipids are
nonpolar
(E) water has a relatively high heat of vaporization
because of strong intermolecular attractions

4. Which is NOT a characteristic of water?

(A) Water has a high specific heat.
(B) Water has a high heat of vaporization.
(C) Water exhibits strong cohesion tension.
(D) Water is less dense than ice.
(E) Water is known as a universal solvent.

5. The pH of blood in humans

(A) is lowest at birth and gradually increases with age up
to a maximum level
(B) is different for men and women
(C) varies with the activity level of the individual
(D) is highest at birth and gradually decreases to a
minimum level
(E) is normally 7.4 and resists change at all times

6. Which of the following is not a carbohydrate?

(A) Glucose

2
(B) Lactose
(C) Insulin
(D) Starch
(E) Sucrose

7. Which of the following is not a polysaccharide?

(A) Cellulose
(B) Glycogen
(C) Chitin
(D) Glycerol
(E) Starch

8. Which of the following is correctly matched?

(A) Proteins—nucleotides
(B) Lipids—glycerol
(C) Carbohydrates—amino acids
(D) DNA—glucose
(E) None of the above is correctly matched.

9. A polysaccharide found in plants whose function is

storage is
(A) starch
(B) glycogen

3
(C) chitin
(D) glucagon
(E) cellulose

10. Isotopes differ from each other only in

(A) the number of electrons
(B) the number of protons
(C) the number of neutrons
(D) how they react chemically
(E) the size of the atom

Questions 11–17
Choose from these structural formulas below.

4
11. This is a monosaccharide.
12. This is necessary for growth and repair of tissue.
13. This combines with fatty acids to form lipids.
14. This is used as a quick energy source.
15. This is linked to cardiovascular disease.
16. This is an important part of any protein.
17. This consists of a sugar, a phosphate, and a
nitrogenous base.

Questions 18–20
Match the description to the property of water.
(A) Water exhibits strong cohesion tension.
(B) Water has a high heat of vaporization.
(C) Water has a high specific heat.
(D) Ice is less dense than water.
(E) Water is a universal solvent.
18. Water moves up tall trees because this is true.
19. Sweating is a cooling process because of this
characteristic of water.
20. Fish can live through the winter in a lake that has ice
floating on the surface.

5
 Biochemistry
Practice 2
1) During digestion, large organic molecules are
hydrolysed to simple molecular units. Which of the
following is NOT an example of such hydrolysis?
(A) DNA to RNA.
(B) Starch to glucose.
(C) Polypeptides to amino acids.
(D) Fats to glycerol and fatty acids.
(E) Polysaccharides to monosaccharides.

2) Which of the following molecular characteristics

CANNOT be determined from the molecular formula
C6H1206?
(A) The kinds of atoms.
(B) The number of atoms.
(C) The molecular weight.
(D) The positions of atoms.
(E) The numerical proportion of atoms.

1
3) The generalized structural formula pictured above
represents which of the following?
(A) A monosaccharide.
(B) A glucose molecule.
(C) A lipid.
(D) An amino acid.
(E) A fatty acid.

4) Acid rain is a serious environmental problem. A

sample of rainwater collected in the Adirondack
Mountains had an H+ concentration of 10-4 M. The pH of
this sample was.
(A) -4
(B) 0.0001
(C) 4
(D) 7.40
(E) 10.000

5) Functions of lipids include which of the following?

I. Formation of parts of cell membranes.
II. Cushioning of organs in the body.
III. Conservation of body heat.
(A) I only.
(B) II only.

2
(C) I and III only.
(D) II and III only.
(E) I, II, and III.

6) A lipid molecule is composed of glycerol and fatty acid

molecules in a ratio of
(A) 1: 1
(B) 1 :2
(C) 1 :3
(D) 1:4
(E) 1 :5

7) Which of the following is a product of the hydrolysis of

glycogen?
(A) RNA.
(B) Glucose.
(C) Fats.
(D) Amino acids.
(E) Proteins.

8) If a carbon atom has 6 protons, 7 neutrons, and 6

electrons, then that carbon atom is a
(A) Cation
(B) Anion
3
(C) Isotope
(D) Metal
(E) Electrically charged element

9) gram of which of the following releases the most

energy when oxidized?
(A) Amino acid.
(B) Protein.
(C) Nucleic acid.
(D) Fat.
(E) Carbohydrate.

Questions 10 to 13…
(A) Nucleic acids
(B) Steroids
(C) Phospholipids
(D) Polypeptides
(E) Polysaccharides
10) Take the form of starch or cellulose in plants
11) Form the fundamental structure of the cell
membrane
12) The primary structure in hydrophobic hormones
13) Store energy in animals as glycogen

4
14) Animals obtain usable energy from all of the
following molecules EXCEPT
(A) Fatty acids
(B) Amino acids
(C) Glycerol
(D) Urea
(E) Fructose

15) Which of the following substances has the greatest

amount of energy per gram?
(A) Starch
(B) Alanine
(C) Cellulose
(D) Vitamin C
(E) Fat

16) An unidentified liquid is isolated from a sample of

ground-up bean seeds. When the liquid is added to a
test tube of water and shaken vigorously, the water and
the unknown liquid separate into two layers after a few
minutes. To which class of biological macromolecules
should the unknown liquid most likely be assigned?
(A) Carbohydrates
(B) Enzymes
(C) Lipids
5
(D) Nucleic acid
(E) Proteins

17) Which of the following is true about the production of

starch from monosaccharides?
(A) Carbon dioxide is produced as a by-product.
(B) The formation of peptide bonds is required.
(C) Water is produced as a by-product.
(D) The reactions occur only in animal cells.
(E) It can only occur during photosynthesis.

18) The pH of a medium is adjusted from 4.5 to 5.5.

From this information, one can conclude that the
(A) Medium has been made neutral.
(B) Medium has been made more acidic.
(C) Medium has been buffered.
(D) · H+ concentration has been decreased.
(E) H+ and Off concentration have both be increased.

19)The glucose produced in tree leaves may be

transported to the roots, where it is typically converted to
and stored as
(A) Starch
(B) Lipids
6
(C) Proteins
(D) Nucleic acid
(E) Glycogen

20)The molecule in the diagram above is a.

(A) Nucleotide.
(B) Lipid.
(C) Protein.
(D) Nucleic acid.
(E) Disaccharide.

21)Monomers are linked together to form polymers in

most proteins and carbohydrates by which of the
following?
(A) Dehydration reaction
(B) Hydrolysis reaction
7
(C) Ionic bonds
(D) Hydrophobic interactions
(E) Hydrogen bonds

Questions 22 to 24 …
(A) Proteins
(B) Monosaccharides
(C) Lipids
(D) DNA
(E) RNA
22)Contain carbon, hydrogen, and oxygen in a 1:2:1
ratio
23)Are often not soluble in water
24)This group includes enzymes

25)protein's tertiary structure refers to the

(A) Amino acid sequence
(B) Attachment sites for ribosomes
(C) Three-dimensional folding of the polypeptide
(D) Sequence of nucleotides
(E) Binding sites for oxygen

26)The 5-carbon sugar in DNA is

(A) Deoxyribose
8
(B) Ribose
(C) Glucose
(D) Fructose
(E) Pentane

Questions 27 to 20 …
(A) Nucleotide.
(B) Amino acid.
(C) Lipid.
(D) Glucose.
(E) Protein.
27) A monomer that serves as the building block of
polypeptides.
28) A building block of DNA.
29)A polymer.
30)Primary cellular energy source for plants and
animals.

31)Which of the following properties of water is primarily

responsible for its transport in the trunk of a large
tree?
(A) Cohesion
(B) Neutral pH
(C) High specific heat

9
(D) Low molecular weight
(E) Low density as a solid

32)Which of the following is a true statement about

simple sugars and complex carbohydrates?
I. Both are composed of the same chemical elements.
II. Both are present in equal proportions in most foods.
III. Simple sugars can be assembled into complex
carbohydrates.
(A) I only.
(B) II only.
(C) III only.
(D) I and II only.
(E) I and III only.

33) The two nucleotide chains of DNA double helix are

held together by hydrogen bonds between
(A) Sugars
(B) Phosphates
(C) Nitrogenous bases
(D) Amino acids
(E) Enzymes

10
34) Which of the following characteristics directly
contributes to the function of a protein?
(A) Tertiary structure
(B) Base pairing
(C) Atomic mass
(D) Nucleic acid composition
(E) Type of peptide bonds

35) All of the following is true about RNA EXCEPT

(A) It is single stranded
(B) Its bases are adenine, thymine, guanine, and uracil
(C) It has a sugar-phosphate backbone
(D) Its sugar is ribose
(E) It is found in the both the nucleus and the cytoplasm
of the cell

11
 Enzymes
Practice 1
1) Which of the following is a characteristic of enzymes?
(A) They are complex carbohydrate macromolecules.
(B) They lower the activation energy required for
metabolic reactions to occur.
(C) They require the addition of heat energy for proper
function.
(D) They can only be used once.
(E) They function only in a living cell.

2) the function of a molecule is catalytic, the molecule is

most likely a.
(A) Lipid.
(B) Nucleotide.
(C) Cellulose molecule.
(D) Protein.
(E) Carbohydrate.

3) Vitamins are essential in the diet of an animal

because they directly affect reactions that require
(A) Haemoglobin
(B) Coenzyme
(C) Nucleic acids
1
(D) Bile
(E) Antibodies

Questions from 4 to 7 ….
(A) B12 (Vitamin)
(B) Calcium (mineral)
(C) Amylase (enzyme)
(D) Alanine (amino acid)
(E) Testosterone (hormone)
4) An organic nutrient that may serve as a coenzyme in
a metabolic reaction.
5) An organic molecule that reduces the energy of
activation of a particular metabolic reaction.
6) An inorganic nutrient required for regulatory functions
in many cell types.
7) A steroid molecule that regulates one or more
metabolic reactions.

8) Catalase is a very stable enzyme that accelerates the

breakdown of hydrogen peroxide to form water and
oxygen gas. If a test tube with catalase and 1 %
hydrogen peroxide is allowed to stand until no more gas
is given off, which of the following should be added to
make the reaction begin again?
(A) Catalase.
(B) Hydrochloric acid.

2
(C) Hydrogen peroxide.
(D) Water.
(E) Oxygen.

9) All of the following are correct about enzymes

EXCEPT
(A) the mechanism by which enzymes work is known as
lock and key
(B) they are proteins
(C) they denature at high temperatures
(D) they are assisted by vitamins and minerals
(E) enzymes are not degraded during a reaction

10) All of the following are correct about enzymes

EXCEPT
(A) enzymes are organic catalysts
(B) enzymes lower the energy of activation
(C) enzymes are assisted by cofactors
(D) enzymes are affected by changes in temperature but
not changes in pH
(E) enzymes are larger than the substrates they work on

3
11) Enzymes function because of their particular shape
or conformation. Which level of protein structure is most
directly responsible for the shape of a protein?
(A) Primary
(B) Secondary
(C) Tertiary
(D) Quaternary
(E) Cannot be determined

4
 ENZYMES
Practice 2
1) Protein proteases are enzymes found in laundry
detergents that help in breaking down stains such as
blood, sweat and eggs. The graphs below show the
effect of temperature and pH on the activity of these
enzymes. Based on the graphs, the label on the
detergent box would most probably state the
following:
“This detergent is_________ and works best at a
temperature range of __________. “

A.acidic, 30°C-50°C
B. acidic, 55°C-65°C
C.basic, 40°C-55°C
D. basic, 55°C-65°C

1
 E. neutral, 70°C-90°C
2) Which of the following organic compounds is capable
of performing the following functions: transport
substances, make hormones and speed up reactions?
A.carbohydrates
B. proteins
C.lipids
D.nucleic acids
E. A and B

Questions 3 and 4 …

3) X, Y, and Z are respectively:

A.Enzyme, product, substrate
B. Product, enzyme, substrate
C.Substrate, enzyme, product
D.Product, substrate, enzyme
E. Enzyme, substrate, product

4) The type of reaction catalyzed by this enzyme is:

A.Synthesis reaction
B. Decomposition reaction
C.Mechanical break down
D.Neutralization reaction

2
 E. Displacement reaction

5) Consider the following experiment:

Test tube A B C
10 ml of 10 ml of
10 ml of starch starch
starch solution solution
solution 1%+1 ml 1%+1 ml
Content amylase amylase
1%+1 ml
amylase solution+ solution+
solution few HCl few NaOH
drops drops
Reaction with
+ - -
Fehling solution
What can you say concerning the digestion
process in these tubes?
A.Digestion occurred in test tube A because amylase
requires a pH near 7 to act
B. Digestion didn’t occur in test tube A because the
Fehling test is positive
C.Digestion occurred in test tube B because the
Fehling test is negative
D.No digestion occurred in test tubes B and C
because salivary amylase doesn’t work on starch
E. Digestion occurred in test tubes B and C because
salivary amylase work on starch

Questions 6 and 7 …

3
The following graph studies the activity of 2 different
enzymes as a function of pH
Activity of enzyme %

Enzyme B
Enzyme A

6) From the above graph we can conclude that

A.Enzyme A is found in the intestine and enzyme B is
found in the stomach
B. Enzyme A is found in the mouth and enzyme B is
found in the intestine
C.Enzyme A is found in the stomach and enzyme B
is found in the intestine
D.Enzyme A is found in the stomach and enzyme B
is found in the mouth
E. Both enzymes A and B are found in the stomach

7) At pH 7,
A.The amount of substrate obtained by enzymes A
and B is 50 % and 0% respectively
B. The amount of substrate obtained by enzymes A
and B is 10 % and 0% respectively
C.The amount of substrate obtained by enzymes A
and B is 0 % and 50% respectively
4
D.The amount of substrate obtained by enzymes A
and B is 0 %
E. The amount of substrate obtained by enzymes A
and B is 100%

8) The following figure shows the structure of

Ribonuclease enzyme before and after addition of
urea.

Addition of urea

Active Ribonuclease
Which statement is true about Ribonuclease
enzyme?
A.Urea causes the denaturation of the Ribonuclease
enzyme but the enzyme maintains its activity.
B. Urea causes the denaturation of the Ribonuclease
enzyme and the enzyme loses its activity.
C.Urea causes the denaturation of the Ribonuclease
enzyme and the enzyme maintains 50 % of its
activity.
D.Urea causes a modification in the sequence of
amino acids of the Ribonuclease enzyme to make
it inactive.
E. Urea causes a modification in the number of amino
acids of the Ribonuclease enzyme without affecting
its activity
A coagulated egg is cut into small pieces which are
placed in test tubes and subjected to digestion

5
 experiments. The conditions are shown in the
following table.

Questions 9 and 10 …
Tube Temperature Tube content
water+ egg white+ pepsin+
1 37oC
HCl
2 37oC water+ egg white+ HCl
3 37oC water+ egg white+ pepsin
water+ egg white+ pepsin+
4 100oC
HCl
water+ egg white+ pepsin+
5 0 oC
HCl

9) The contents of one of the five tubes become

transparent because the fragments are
A.dissolved in water.
B. cut into small invisible pieces.
C.degraded into simpler molecules in the presence of
enzymes.
D.digested into simpler molecules in the presence of
hydrochloric acid.
E. dissolved in water under the action of heat.

10) The contents of one tube undergo digestion. It is

A.Tube 1 because of the presence of an enzyme and a
suitable chemical medium.
B. Tube 2 because of the presence of hydrochloric acid
as a catalyst.

6
C.Tube 3 only because of the presence of an enzyme.
D.Tube 4 because of the effect of the very high
temperature.
E. Tube 5 because of the effect of the very low
temperature.

11) Grade 12 students measure the enzyme activity on

a substrate at various temperatures of
pH=3.

Based on the data, what results can be predicted if the

experiment is carried out at 62oC?
A.No prediction would be valid.
B. An amount of product equal to that at 20oC would
form.
C.An amount of product equal to that at the optimum
temperature would form.
D.An amount of product equal to that at 5oC would form.
E. Little or no product would form.

7
 12) The graph below shows the effect of temperature
on the rate of photosynthesis.

The graph shows that the rate of photosynthesis

increases as the temperature increases, followed by a
sharp decrease in the rate to reach 0. The reason
behind this is that
A.temperature is the limiting factor in photosynthesis.
B. at high temperatures water molecules will vaporize
causing the process of photosynthesis to stop.
C.at high temperatures the chloroplasts will release all its
pigments thus reducing the capture of light.
D.the enzymes responsible for photosynthesis are
denatured at high temperatures.
E. Other factors such as the presence of carbon dioxide
and light interfered in the rate of photosynthesis

13) A student conducted an experiment to study the

effect of temperature on the function of salivary
amylase. She placed the enzyme at -2°C for several
8
 hours. Later, she removed the enzyme at -2°C and
mixed it with a solution of minced bread at 37°C. She
performed an iodine test to check for the presence of
starch in the solution and the result was negative.
What do you conclude from this experiment?
A.Starch is still present since salivary amylase does not
digest starch.
B. Low temperature denatured the enzyme rendering it
inactive.
C.The enzyme has been activated by rising temperature
and digested the starch.
D.Low temperature caused permanent deactivation of
the enzyme.
E. The iodine test is a test used to detect the presence of
monosaccharides, hence the negative result.

9
10
 Cell Transport
Selective Permeable(dialysis):
o A characteristic of a living cell membrane.
o The substances that pass through a selective
permeable membrane change with the need of the
cell.
o allow passage of water & small non polar particles.
but prevent passage of large or polar molecules like:
starch, protein, sucrose.

Solvent: The substance that does the dissolving.

Solute: the substance that dissolve.

Hypertonic solution: solution that have a

greater solute concentration than another.
Hypotonic solution: solution that have lower
solute concentration than another
Isotonic solution: solution that has the same
solute concentration as another

1
 Types of Transport
Passive Transport
o It does not require energy (ATP).
o Movement of molecules from(higher)concentration
to (lower) concentration.
o It is three types: (Simple diffusion – Facilitated
diffusion – Osmosis).

Simple diffusion:
o Only small nonpolar molecules can passively
diffuse through the phospholipid membrane
o The steeper the gradient, the faster the rate of
diffusion.
o Example: Humans obtain oxygen & get rid of
carbon dioxide by simple diffusion across moist
membranes in air sacs (alveoli) in lungs.

2
 Facilitated diffusion:
o It relies on special protein channels to assist
in transporting specific substances across a
membrane.
o Example: transport of glucose.

Osmosis:
o the movement of water across a semipermeable
membrane.
o The net movement of water is from an area of high-
water concentration(hypotonic) to an area of
lower water concentration(hypertonic).

3
 Cell in hypotonic solution:
o More Water pass into the cell than amount that
passes out.
o Animal cell swill and rupture(lysis).
o Plant cell will be turgid only due to cellulosic cell
wall.
Cell in hypertonic solution:
o More Water passes out of cell than amount that
passes out.
o Animal cell shrink(shrivel).
o Plant cell plasmolysis (shrinking of the vacuole
away from the cell wall).
Cell in isotonic solution:
o Amount of water pass into the cell is equal to the
amount pass out (no change).
o The normal saline solution which is 0.9% Is
isotonic to red blood cell and most of animal
cell.

4
 Active Transport
Require Energy (ATP).
Movement of molecules is against a gradient (from
lower to higher concentration).
Ex: Transport of Na, Mg, K, Cl ions through cell
membrane.
Exocytosis is the process of vesicles fusing with
the plasma membrane and releasing their contents to
the outside of the cell.

Endocytosis is the process of capturing a

substance or particle from outside the cell and
bringing it into the cell.
 It is three types:
o Phagocytosis: cell engulf large solid particles.
o Pinocytosis: cell drink dissolved molecules.

5
o Receptor mediated: particles attach to cell
membrane.

6
7
 Cell transport
Practice 1

1) All of the following about plasma membrane

structure and function are correct EXCEPT
(A) all plasma membranes have the identical
composition and structure
(B) diffusion of gases across a membrane requires
that the membrane be moist
(C) facilitated diffusion is an example of passive
transport
(D) proteins serve as membrane channels
(E) plasma membranes contain receptors that are
specific for the molecules they uptake

Questions 2 to 4:
Five beakers are used in an experiment about osmosis.
Each beaker contains 50 mL of a sucrose solution of
varying concentrations: 0.2 M, 0.4 M, 0.6 M, 0.8 M, or
1.0 M. Pieces of fresh potato (each 10.0 g in mass) are
cut up, weighed, and placed into the beakers. After 12
hours, the potatoes are carefully removed from each
beaker and weighed again. See the data in the table
below.

1
 2) In this experiment
(A) water flowed into the potato only
(B) water flowed out of the potato only
(C) sucrose flowed into the potato only
(D) sucrose flowed both into and out of the potato
(E) water flowed both into and out of the potato

3) Given the results of this experiment, what is the

molarity(concentration) within the potato cells?
(A) Less than 0.2 M
(B) Less than 0.4 M but greater than 0.2 M
(C) Less than 0.6 M but greater than 0.4 M
(D) Less than 0.8 M but greater than 0.6 M
(E) Greater than 0.8 M

4) The results of this experiment give support to the theory

that
(A) water diffuses down a gradient

2
 (B) water can be actively transported against a
gradient
(C) solutes will diffuse from high concentration to low
concentration
(D) living cells respond in different ways to the same
conditions
(E) potato cells respond differently from other living
cells

5) Here is a sketch of a plant cell placed into a

solution. Which of the following is correct?

(A) The solution is hypotonic to the cell, and the cell will
swell andburst.
(B) The solution is hypotonic to the cell, and the cell will
become turgid.
(C) The solution is hypertonic to the cell, but nothing
will happen to the cell.
(D) The solution is hypertonic to the cell, and the cell
will shrink.
(E) The solution is hypertonic to the cell, and the cell
will swell.

3
6) Which of the following does NOT require ATP?
(A) Facilitated diffusion
(B) Activation of the contractile vacuole
(C) Sodium-potassium pump
(D) Receptor-mediated endocytosis
(E) Pinocytosis

7) This bar graph shows the relative concentrations of

different ions in pond water and in the cytoplasm of the
algae Chlamydomonous. Which statement best
describes what this graph indicates?

(A) Chlamydomonous belongs to the kingdom

Protista.
(B) The pond water is hypertonic to the
Chlamydomonous cells.
(C) Only Mg+ and Cl− are absorbed by active
transport.
(D) The Chlamydomonous has contractile vacuoles
that pump out excess water.

4
 (E) Chlamydomonous cells can regulate what
materials they exchange with their surroundings.

8) Which cell organelle in Chlamydomonous is LEAST

involved in transport in single-celled organisms living in
pond water?
(A) Mitochondria
(B) Chloroplast
(C) Plasma membrane
(D) Contractile vacuole
(E) Nucleus

Questions 9 –12
Wet mounts of three living samples of elodea cells are
prepared for viewing under the light microscope. Each
slide is mounted with a different solution and viewed after
5 minutes.

Sample A—Elodea + 5 drops of 10% NaCl

Sample B—Elodea + 5 drops of isotonic saline
Sample C—Elodea + 5 drops of distilled water

9) The cells in sample A would

(A) exhibit turgor pressure
(B) undergo lysis
(C) swell and burst
(D) exhibit plasmolysis
(E) remain unchanged
5
10) The results of the experiment illustrate which of the
following processes?
(A) Hydrolysis
(B) Dehydration
(C) Active transport
(D) Polymerization
(E) Osmosis

11) Which cell structure(s) would be visible in sample A

that was not visible prior to exposure to the 10% NaCl?
(A) Nucleus
(B) Plasma membrane
(C) Mitochondria
(D) Golgi body
(E) Chloroplasts

12) Which of the following statements about this

experiment is correct?
(A) The movement of salt is the dependent variable
(B) The elodea cells in sample C are in a hypotonic
solution
(C) There is no passage of water in either direction
in sample B
(D) NaCl is a toxin that would destroy any cell, no
matter the concentration
(E) You cannot predict with any certainty what would
happen to thesecells; they are living organisms

6
13) Which process requires energy?
(A)Passive diffusion
(B)Facilitated diffusion of calcium through a channel
(C)Water flowing into a paramecium in a lake
(D)A contractile vacuole removing water from an amoeba
(E)Osmosis of water into a cell

14) What would occur if a plant cell were placed into a

strong hypertonic solution?
(A)Nothing would happen because the cell wall would
prevent any movement of water or salt.
(B)It would shrink because water would flow toward the
more concentrated solution.
(C)It would swell because salt would flow into the cell.
(D)It would shrink because water would flow into the
cell.
(E)It would swell because water and salt would flow
down the gradient and into the cell.

7
 CELL TRANSPORT

Practice 2
1) Freshwater fish have to make many adaptations in
order to survive in an environment with less
concentration of salt in their surroundings. All of the
following are characteristics of freshwater fish
EXCEPT:
A.they need to have an internal salt concentration
higher than that of freshwater
B. they can eat more to replenish the lost salt from their
bodies
C.they need to urinate large amounts with little salt
D.They do not need to drink at all
E. Their kidneys should be able to expel maximum
amount of salt to the outside

2) The following figure shows a beaker containing

water and solute separated by a selectively
permeable membrane. What would happen after a
few minutes?

1
A.Osmosis of water from medium 1 to medium 2 takes
place.
B. Diffusion of the solute from medium 1 to medium 2
takes place.
C.Osmosis of water from medium 2 to medium 1 takes
place.
D.Diffusion of the solute from medium 2 to medium 1
takes place.
E. Nothing changes.

Questions 3 and 4 ….
A student cut three potato pieces weighing 10.0g each
and placed each in a different beaker containing
different salt concentrations. The physiological
concentration of the potato cell is 4.6%. Refer to the
figure below and your own knowledge to answer the
following questions.

3) After 2 hours, the student removed one of the potato

pieces from one of the beakers and weighed it. The
potato piece weighed 12.2g. Which beaker was this
piece taken from?

2
A.A
B. B
C.C
D.The data given is not enough for a definite answer.
E. It could be either beaker A or B.

4) What kind of change would the potato in beaker B go

through?
A.The potato will increase in weight.
B. Turgid pressure will increase causing the potato cells
to burst.
C.No change will occur since the amount of water
flowing in and out of the cell is the same.
D.Plasmolysis will occur due to dehydration.
E. Salt will enter the potato cells since the amount of salt
outside is more than the salt inside.

5) When a red blood cell is placed in a hypotonic

solution,
A.The cell swells and bursts since water flows into the
cell.
B. The cell shrinks since the water flows outside the
cell.
C.The cell maintains its shape since water diffuses in
and out of the cell.
D.The cell swells and bursts since water flows outside
the cell.
E. The cell shrinks since water flows into the cell.
observations of these cells are done and the results
are shown in the following table.

3
Solution number 1 2 3
Concentration of 0.03 0.09 26
the solution (g/cc)
Aspect of red Red blood Red blood Red blood
blood cells cells bulge cells remain cells shrink
and lyse normal
6) Taking into consideration that the cytoplasm of red
blood cells has a concentration of 9 g/100 cc, which
statement is INCORRECT?
A.The red blood cells lyse in medium 1 because the
water passes through osmosis from the exterior
hypotonic medium into the interior hypertonic
medium.
B. Red blood cells undergo hemolysis in medium 1 due
to the flux of water from the extracellular medium
towards the intracellular medium.
C.The red blood cells remain normal in solution 2
because both the intracellular and extracellular
media are isotonic.
D.The red blood cells shrink in medium 3 because
water exits from the hypotonic medium to the
hypertonic medium.
E. The red blood cells cannot lyse in medium 3
because there is no exchange that occurs between the
two media.

7) An animal cell placed into a 0.9% solute solution

would do which of the following?
(A) Remain unchanged
(B) Swell and burst
4
 (C) Shrivel
(D) Swell and divide
(E) Release solute by exocytosis

8) What is the main difference between passive transport

and active transport?
A.Passive transport needs energy, active transport does not.
B. Active transport needs energy, passive transport does not.
C.Only passive transport involves a protein.
D.Only active transport can transport ions across the cell
membrane
E. Only active transport involves a protein.

9) Osmosis is the
A.diffusion of ions and small molecules.
B. diffusion of glucose and proteins.
C.diffusion of water.
D.active transport of water, ions, or small molecules.
E. Diffusion of protein.

10)What part of the cell determines what enters and

leaves the cell?
A.the plasma membrane
B. the nucleus
C.the vesicles

5
 D.the Golgi apparatus
E. chloroplast

11)During active transport, molecules move from an

area of ____________ concentration to an area of
____________ concentration.
a. higher, lower
b. lower, higher
c. higher, the same
d. lower, the same
e. the same, higher

12)the bag will:

A.swell
B. shrink
C.no change
D.plasmolysis
E. turgid

6
7
 Circulatory System
Function of circulatory system:
Circulates OXYGEN and removes Carbon Dioxide.
Provides cells with NUTRIENTS, and removes the
waste products of metabolism to the excretory organs
for disposal.
Protects the body against disease and infection.
Clotting stops bleeding after injury.
Transports HORMONES to target cells and organs.
Circulatory system is formed of: Heart, Blood,
Vessels.
heart pumps about 5 litres of blood through 70
beats/minute.
It is formed of two atria and two ventricles.
Atria (plural of atrium): these are upper thin wall
chambers receive blood from body by veins.
Ventricles: lower thick wall champers pump blood
out of heart by arteries.
Normal blood pressure is 120/80.
The systolic blood pressure (the number on top) is
the pressure produced when the heart contracts and
pushes out blood. The diastolic blood pressure (the
number on the bottom) is the pressure when the heart
relaxes and fills with blood between heartbeats.

Cardiac cycle
 General diastole:
All cambers relaxed, Deoxygenated blood enters
heart through vena cava (blood that comes from
upper parts of body enter through superior vena
cava, and blood from lower parts, enter the heart
through inferior vena cava).

Atrial systole:
Atria contract, then Blood transfers from right
atrium to right ventricle through tricuspid valve.

Ventricle systole:
Ventricle contract, then Blood transfer to lung
through pulmonary artery.

Ventricles have larger volume, thicker walls and

more mitochondria than auricles because they have
to pump blood to different organs and the pressure
with which the blood flows through them is more than
the auricles.

The SA (sinoatrial) node generates an electrical

signal that causes the upper heart chambers (atria) to
contract. The signal then passes through the AV
(atrioventricular) node to the lower heart
chambers (ventricles), causing them to contract, or
pump. The SA node is considered the pacemaker of
the heart. and affected by nervous system,
temperature and hormones like adrenaline.
 Septum is a separating wall between right and left
sides of Heart.
Heart has 4 valves:
 tricuspid valve: located between the right atrium and
the right ventricle
 pulmonary valve: located between the right ventricle
and the pulmonary artery
 mitral valve: located between the left atrium and the
left ventricle
aortic valve: located between the left ventricle and
the aorta

Blood vessels
 The blood
It consists of different cell types suspended in a liquid
called plasma.
plasma: is the yellow liquid portion (90% water)
that contains hormones, antibodies, nutrients,
metabolic wastes, dissolved gasses.
Cells:
1) Red Blood Cells: (Erythrocytes)
o It has no Nucleus.
o It has red protein pigment called Haemoglobin
that bind to oxygen forming Oxyhaemoglobin.

2) Platelets: (Thrombocytes):
o they are cell fragments.
o responsible for blood clotting.

3) White Blood Cells: (Leukocytes)

o It fights infections (viruses and bacteria).
o Two types: lymphocytes and Phagocytes.
o Lymphocytes (B cells and T cells): produce
antibodies that target the specific bacteria and
viruses.
o Phagocytes: engulf bacteria and viruses by
pseudopods(phagocytosis). Then digest pathogen
by lysosomes.
All blood cells produced from bone marrow.
Red blood cells recycled by liver and spleen.
 Agglutination
it is clumping reaction happens when an
antibody in plasma meets its antigen on
red blood cell surface causing destruction of the
antigen.
This happens during mismatched blood
transfusion.
Blood is further classified as being either "Rh positive"
(meaning it has Rh factor) or "Rh negative" (without Rh
factor). So, there are eight possible blood types:

W.B.C increase and cause fever if infection

happen.
Low number of W.B.C cause low immunity.
Leukaemia is W.B.C cancer.
Iron is essential for formation of Haemoglobin
and R.B.C., so Iron deficiency cause Anaemia
disease.
Sickle cell anaemia: is a genetic mutation that
result in sickle R.B.C. instead of normal rounded
R.B.C. Forming Haemoglobin with low oxygen
carrying capacity, and obstruction of blood
vessels.

Heart chambers in vertebrates

 Respiratory system

Respiratory System Parts:

Nose:
It is an entry point.
contain hair to trap dusts.
Contain blood vessels that warm air.
has mucus that trap germs and substances.
Pharynx(throat):
 It passes air to trachea.
Epiglottis:
 it regulates airflow into the trachea, and keeps food from
blocking the airways.
 Larynx: house of vocal folds.
Trachea:
 it is the major airway to the lungs.
 Lined with mucus, and cilia.
Bronchi: branched to bronchioles that are airways to
the alveoli. It also lined with cilia.
Alveolus:
 (Singular of alveoli) it is the structural and functional unite
of lungs.
 It is thin, enormous (large surface are) air sac surrounded
by blood capillaries.
 Oxygen and carbon dioxide transport through wet alveoli
membrane by simple diffusion.

Medulla in brain center that regulate breathing

rhythm by monitoring carbon dioxide level in blood.
(Increase acidity stimulate brain to regulate
breathing).
A normal blood pH level is 7.35 to 7.45
concentration of oxygen level in blood has little effect
on medulla.
Haemoglobin in blood combines with oxygen to form
oxyhaemoglobin.
carbon dioxide is carried in plasma as a part of
carbonic acid bicarbonate ion system, by action of
carbonic anhydrase enzyme.

Diaphragm is the main respiratory muscle.

When diaphragm relaxes, and the thorax cavity
volume decrease, so air pumped out of the lung.
When the diaphragm contracts, the volume of thorax
cavity increase, and the air get into the lung

Some animals exchange gas through moist skin.

Like amphibians and annelids.
DR MAI ABD EL SALAM 00201123056296

Excretion
Excretion is the removal of metabolic wastes from the
body.
Excretory structures in human body:
Lungs excrete water vapor and CO2.
kidneys filter blood to eliminate wastes.
Liver deaminate amino acids and excrete urea.
Skin excretes water, salts, and urea.

Nitrogenous Wastes:
Ammonia in fish, amphibian, Platyhelminthes, hydra.
Urea in humans, annelids.
Uric acid in insects, reptiles, and birds

Human excretory system

1
DR MAI ABD EL SALAM 00201123056296

Function of kidney:
 filter blood.
 excrete nitrogenous wastes.
 regulate level of water and salt in blood plasma.
 Regulate blood PH.
 Regulate blood pressure.

Kidney filter 1500 litre of blood daily.

Kidneys supplied by blood from renal artery
Urine travel from kidneys through large ducts
called ureter to be stored in urinary bladder.
When bladder contracts, urine will be pushed
through urethra to out of body.

Nephron

2
DR MAI ABD EL SALAM 00201123056296

it is the functional unit of kidney.

Each kidney has one million nephrons.

Structure of nephron:

 Glomerulus:
• a cluster of capillaries inside Bowman capsule filter
blood by forcing plasma out of capillaries and into
Bowman capsule.
• Here filtration occur by passive diffusion and non-
selective process that filtrate every small molecule out
of glomerulus to bowman capsule.

 Proximal convoluted tubule:

• small, tube close to glomerulus.
• Here active, selective uptake of molecules that did
not filtered into Bowman capsule.

 Loop of Henle:
• water is reabsorbed through it.
• Desert animals have very long loops of Henle to
reabsorb water.

 Distal convoluted tubule: (site of Aldosterone

action)
• active, selective uptake again of molecules that did
not filtered into Bowman capsule.
• Aldosterone Hormone increase amount of sodium
reabsorbed into blood by distal tubule (control blood
pressure).

3
DR MAI ABD EL SALAM 00201123056296

 Collecting duct: (site of ADH action)

• ADH (antidiuretic hormone) regulate the water level in
blood by making walls of collecting duct more
permeable to water.
• ADH increase water reabsorption and decrease urine
output and increase its concentration.
• In absence of ADH, walls are impermeable to water
that cannot leave the tube.

 N.B. people with renal failure need dialysis to get rid

of metabolic wastes of blood.

Structure of skin

4
DR MAI ABD EL SALAM 00201123056296

It is formed of three layers: epidermis, dermis, and

hypodermis.
Epidermis:
 It is the top layer of skin that separate animal or
human from environment.
 It contains melanocytes that secrete melanin
pigment (responsible for skin color, and protect body
from U.V. radiation).

Dermis:
 It contains blood vessels, sweat glands, and
sebaceous glands which produce oils.
 It contains nerve endings, and hair follicles.
3)Hypoderm:
 It composed of loose connective tissue, and fat cells.

Function of skin:
 Vitamin D production.
 responsible for sensation.
 protection against infections
 excrete sweat to maintain water and salt balance.
 regulate body temperature.
 protection against dryness(desiccation).
 Hair of skin reduce wind flow and heat loss in
mammals.

5
DR MAI ABD EL SALAM 00201123056296

Nervous system

Neuron interaction

1
DR MAI ABD EL SALAM 00201123056296

The four main functions of the nervous system are:

Control of body’s internal environment to maintain

‘homeostasis’:
An example of this is the regulation of body
temperature. As we exercise, we create heat, in order
to maintain a relatively constant core temperature, the
nervous system sends messages to the blood vessels to
dilate (expand), increasing blood flow to the skin, and
increasing sweating to help disperse the accumulating
heat.
Programming of spinal cord reflexes:
An example of this is the stretch reflex. This reflex
functions to protect us from injury. If we were out
jogging and accidentally ran into a pot-hole and rolled
our ankle, the stretch reflex would instantly sense the
stretch in the muscles around the ankle and send
messages to those muscles telling them to contract and
resist the stretch.
Memory and learning:
A certain amount of repetition was required to learn and
memorise. New movements, take time for the nervous
system to learn.
Voluntary control of movement:
Every voluntary movement that a person performs is
under the direct control of the nervous system as the
nervous system sends the messages to the particular
body parts to move.

2
 DR MAI ABD EL SALAM 00201123056296

Brain structure

Brain Stem (Medulla):

 it controls involuntary movement.
 It contains respiratory center, heart rate center, and
blood pressure center.

Cerebellum:
It controls body balance.

Cerebrum:
It controls voluntary movement, memory, and
consciousness.
Hypothalamus:
_ It is responsible for Homeostasis for regulation body
temperature, water and salts level in blood, and
hormonal level.

3
DR MAI ABD EL SALAM 00201123056296

Nerve cell(neuron)

It is the structural and functional unite of nervous

system.
Nerve cell structure:
 Dendrites: it receives impulses from other nerve cell
to carry electrical signal to cell body.
 Cell body: it has nucleus, ribosome, mitochondria,
and other organelles.
 Axon:
o It transmits impulse from cell body to another
cell.
o It wrapped by myelin sheath that protect the
axon and speed impulse.

4
DR MAI ABD EL SALAM 00201123056296

nerve impulse transmission

the only way a neuron can transmit information is by

varying the frequency of its action potentials.

5
DR MAI ABD EL SALAM 00201123056296

synapse

It is the space between two adjacent nerve cells or

between motor cell and effector organ.
Transmission of nerve impulse through synapse is
chemical signal by releasing neurotransmitter that
secreted from pre synaptic cell to postsynaptic. While
nerve impulse transmission through neuron
membrane is electrical.
Examples of neurotransmitters: acetylcholine,
adrenaline, dopamine.

6
DR MAI ABD EL SALAM 00201123056296

Structure of eye

Cornea: It is the transparent, anterior or front part of

our eye, which covers the pupil and the iris. The main
function is to refract the light along with the lens.
Iris: It is the pigmented, coloured portion of the eye,
visible externally. The main function of the iris is to
control the diameter of the pupil according to the
light source.
Pupil: It is the small aperture located in the centre of
the Iris. It allows light to enter and focus on the
retina.
Lens: it is along with the cornea refracts light so that
it focuses on the retina.
Retina: It is light sensitive and acts as a film of a
camera. It has photoreceptor cells. It converts the
image into electrical nerve impulses for the visual
perception by the brain.
Optic nerve: it carries all the nerve impulses from the
retina to the human brain for perception.

7
DR MAI ABD EL SALAM 00201123056296

8
DR MAI ABD EL SALAM 00201123056296

Digestive System

Function:
 Ingestion.
 Digestion.
 Absorption.
 Egestion.

Digestive system consists of:

Alimentary Canal (main organs): mouth, pharynx,
oesophagus, stomach, small intestine, large
intestine, rectum, and anus.

Associates: glands that pour digestive juices by

ducts into alimentary canal.
They are salivary gland, liver, pancreas, gall
bladder.
1
DR MAI ABD EL SALAM 00201123056296

Mouth:
 Oral cavity for ingestion.
 Teeth and tongue function is mechanical digestion
of food by crushing.
 Salivary Glands secrete amylase enzyme
that hydrolyse Starch to Maltose (starch
digestion starts here).
 pH is 7 (neutral).

Pharynx:
It transfers food from mouth to oesophagus.

Oesophagus:
 It is a narrow tube through which food moves to
stomach.
 No digestion occurs here.
 I t has involuntary muscle for peristalsis.
 Peristalsis: is involuntary movement of digestive
tract, controlled by autonomic nervous system.

Stomach:
 It secretes gastric juice which include: Pepsin
enzyme & HCL
 HCL function:
o kill microbes.
o convert inactive pepsinogen enzyme to active
pepsin.
o provide pH 2-3 (acidic).
 pepsin enzyme breaks protein (polypeptide
chains) into amino acids (protein digestion
begins in stomach).

2
DR MAI ABD EL SALAM 00201123056296

 Mucus laying stomach and protect it from Auto-

digestion.
 Peptic ulcer will result due to lining deficiency of
mucus or excessive HCL.

Small Intestine:
 It consists of three parts: duodenum, ileum, and
jejunum.
 Most of digestion and absorption processes
happen in small intestine.
 Absorption of digested food occurs by villi.
 Villi: millions of fringelike projections that line small
intestine and absorb nutrients.

 Indigestible wastes travel to large intestine.

 It is site of digestion (Disaccharides, Nucleic acids,
Lipids, Starch, Proteins) to result:
(Monosaccharides, Nucleotides, amino acids,
glycerol, fatty acids).

3
DR MAI ABD EL SALAM 00201123056296

 There are juices: (Intestinal juice, Bile juice, and

Pancreatic juice).

 Intestinal Juice:
It has:
• Disaccharidase enzymes that hydrolyse
disaccharides to monosaccharides.
• Nuclease enzyme that hydrolyses nucleic
acids to nucleotides.

 Bile Juice:
 It produced by liver, stored and in gall
bladders.
 It contains Bile salts that digest large fat
particles to smaller parts by emulsification
process.

 Pancreatic Juice:
 It secreted by pancreas through pancreatic
duct into duodenum.
 Its components:
Pancreatic amylase: hydrolyse starch to
maltose.
Pancreatic lipase: digest lipids to fatty acids
and glycerol.
Trypsin: digest proteins to amino acids.
Bicarbonates: make alkaline medium pH (8-9) in
intestine.

4
DR MAI ABD EL SALAM 00201123056296

Large Intestine:
 It absorbs water from indigestible food.
 E. coli is bacteria live in large intestine and feed
on indigestible food, and secrete vitamins B & K
(mutualistic relationship).
 Watery Diarrhea is a result of removal of large
intestine.

Liver:
 It produces bile that emulsify lipids.
 produce blood plasma protein e.g., fibrinogen &
prothrombin that are essential for blood clotting.
 break and recycle blood cells.
 detoxify blood (remove toxins like drugs and
alcohol).
 store excess glucose as glycogen.
 metabolize cholesterol.
 metabolize protein and produce urea as
nitrogenous waste.

Fehling Test
It used to detect for glucose in the urine,
thus detecting diabetes. Another use is in the
breakdown of starch (amylase activity) to convert
it to glucose.
Positive test means the presence of glucose,
negative test in case of absence of glucose.

5
DR MAI ABD EL SALAM 00201123056296

6
DR MAI ABD EL SALAM 00201123056296

Endocrine system
Endocrine gland a ductless gland that release
hormones directly in blood stream.
Hormone is a chemical signal release from
endocrine gland and transported through blood
plasma to target the affected organ.
Hypothalamus is the bridge between nervous
system and endocrine system, so it controls all
endocrine glands through anterior pituitary
gland, it secretes tropic (releasing hormones)
that stimulate other glands.
Exocrine gland is a gland that makes substances
such as sweat, tears, saliva, milk, and digestive
juices, and releases them through a duct.
Examples of exocrine glands include sweat glands,
salivary glands, mammary glands.
Pancreas is both endocrine (by releasing
insulin and glucagon directly in blood without
duct, and exocrine (pour pancreatic digestive
juice into small intestine).

1
DR MAI ABD EL SALAM 00201123056296

Endocrine Glands and their Associated Hormones

Endocrine Associated Effect

Gland Hormones
hypothalamus releasing and regulate hormone
inhibiting release from
hormones anterior pituitary
gland.

antidiuretic water reabsorption

hormone (ADH) from kidneys
(decrease water
output, increase
urine salt
concentration).
vasoconstriction
that increases
blood pressure.

oxytocin produce uterine

contractions.
promote milk
secretion in
females.

2
DR MAI ABD EL SALAM 00201123056296

Anterior growth promotes growth

Pituitary hormone (GH) of body
gland tissues
protein synthesis.
metabolic
functions.
prolactin promotes milk
(PRL) production
thyroid stimulates thyroid
stimulating hormone release.
hormone (TSH)
adrenocorticotr stimulates
opic hormone hormone release
(ACTH) by adrenal
cortex(glucocortico
ids).
follicle- stimulates gamete
stimulating production (ova
hormone (FSH) and sperm).
luteinizing stimulates
hormone (LH) production of sex
hormones by
gonads.
ovulation.
melanocyte- stimulates
stimulating melanocytes of the
hormone skin increasing
(MSH) melanin pigment
production.

3
DR MAI ABD EL SALAM 00201123056296

antidiuretic stimulates water

hormone reabsorption by
(ADH) kidneys,
increasing urine
Posterior concentration,
Pituitary and decrease.
gland (store
ADH and
oxytocin
that it stimulates
released by oxytocin uterine
Hypothalam contractions
us) during childbirth.
milk ejection.

Thyroxine T4 stimulate and

triiodothyroni maintain
ne T3 metabolism;
growth and
development
(Iodine is
Thyroid essential for
formation of
thyroid hormones).

calcitonin reduces blood

Ca2+ levels.

4
DR MAI ABD EL SALAM 00201123056296

Parathyroid parathyroid increases blood

gland hormone Ca2+ levels
(PTH)
insulin reduces blood
glucose levels.
Pancreas glucagon increases blood
glucose levels

testosterone promote sperm

production.

male secondary
sexual
Testes characteristics.
(Low pitch deep
voice, hair on face
and chest, wide
shoulders, high
muscular building).
Estrogen promotes uterine
lining growth.
Female
secondary sexual
characteristics
Ovaries (high pitch sharp
voice, narrow
shoulders, high fat
building,
development of

5
DR MAI ABD EL SALAM 00201123056296

progesterone promote and

maintain uterine
lining growth.
mammary glands).
stimulate the
production of T
cells, which are
Thymus
thymosin an important part
of the immune
system.
Aldosterone increases blood K+
and Na+ levels.
Adrenal
cortex
cortisone anti-
inflammatory(immune
) effect
adrenaline stimulate fight-or-
flight response;
Adrenal increase blood
medulla glucose levels;
increase metabolic
activities

6
DR MAI ABD EL SALAM 00201123056296

Diabetes: disease that result in increasing

blood glucose level higher than normal range (60-
140) mg / dl.
it is two types:

7
DR MAI ABD EL SALAM 00201123056296

Hormone mechanism

Steroid Hormone: it is lipid in nature, can

diffuse through plasma membrane to bind to
receptor inside the target cell.
e.g., estrogen, testosterone.

Peptide Hormone: it is protein in nature,

cannot diffuse through plasma membrane,
so it binds to receptor on cell surface.
e.g., insulin.

8
DR MAI ABD EL SALAM 00201123056296

Feedback Mechanism

A feedback mechanism is a regulatory system that

either returns the body to a normal internal state
(homeostasis) or, brings an internal system
further away from homeostasis. Two mechanisms
exist:

Positive feedback mechanism:

response enhances the original stimulus.
• Labour contraction.
• Lactation.
Negative feedback mechanism:
the response reduces the original effect of the
stimulus.
• Body temperature.
• Sugar metabolism

9
DR MAI ABD EL SALAM 00201123056296

10
DR MAI ABD EL SALAM 00201123056296

Immune System

Viral diseases:
 Viral infection cannot be treated with antibiotic.
 Virus only replicates in its host cell, so it is not living
organism.
 Retro-viruses are RNA viruses contain reverse
transcriptase enzyme that makes viral DNA copy
from the viral RNA genome. E.g., HIV virus that cause
AIDS disease.
 Phage is a virus that attack bacteria.
 A virus' host range is the range of cell types and host
species a virus is able to infect.

1
DR MAI ABD EL SALAM 00201123056296

Bacterial diseases:

 Streptococci is bacteria causes Sore throat disease.

 Antibiotic can kill bacteria by interfering with its
replication, or its protein synthesis, or by breaking
down its membrane or by any others mechanisms.
 Bacteria that killed by antibiotic is sensitive to this
antibiotic, but bacteria that survive, is resistant to the
antibiotic.
 Antibiotic does not create resistant strains, only
resistant bacteria naturally selected (survive and
reproduce).

Cancers:
 Result from infection by some viruses, or exposure to
some rays or chemicals, but most of cancers are with
unknown reason.
 Caused by mutation in gene that code for proteins
involved in cell division, causing abnormal rapid cell
division that produces functionless and distorted
cancerous cell.

Allergic diseases:
 Caused by hypersensitivity to specific substance.
Result in release of Histamine that produce some
symptoms, like rash, itching, high temperature.
 Bronchial Asthma is an allergic disease.

2
DR MAI ABD EL SALAM 00201123056296

Inflammatory response to the injury

The body always responds to an injury. Redness and

heat are caused by increased blood flow. Swelling is
the result of the increased movement of fluid and
white blood cells into the injured area. The release of
chemicals and the compression of nerves in the area
of injury cause pain.

diapedesis is the migration of blood cells through the

intact walls of blood vessels into the surrounding
tissue. while chemotaxis is the movement of a cell or
an organism in response to a chemical stimulant.

3
DR MAI ABD EL SALAM 00201123056296

4
DR MAI ABD EL SALAM 00201123056296

The Immune System has 3 Lines of Defense Against

infectious agent:

Clonal selection and expansion: There is a time

between exposure to antigen of foreign protein,
and the production of antibody, for choosing and
proliferation of already differentiated lymphocytes that
synthesize the needed antibody.

5
 DR MAI ABD EL SALAM 00201123056296

Types of Immunity

Passive Immunity Active Immunity

Organism does not Organism produce antibodies
produce antibodies, but by exposure to antigen.
receive them.
Lasts for short time. Long lasting
 Natural: like antibodies  Natural: antigen inters the
delivered from mother to body which trigger production
baby through placenta or of antibodies by lymphocytes
milk. e.g., chicken box.
 Artificial: performed  Artificial: vaccination by
antibodies that injected giving killed or attenuated
to human in bacteria or virus to trigger
serum(serotherapy). immune response.

How vaccines discovered?

 Cow pox virus is a disease infect cows.
 Small pox disease never infect people who deal with
infected cows.
 Cow pox virus and small pox have similar antigens.
 Edward Jenner discovered that Inoculation cow
sores discharge on children skin scratches, protect
them against small pox.
 This happen because Antibodies that destroy
cowpox can also destroy small pox virus due to
antigen similarity.

6
DR MAI ABD EL SALAM 00201123056296

The autoimmune diseases

A condition in which the body's immune system
mistakes its own healthy tissues as foreign and
attacks them.
Most autoimmune diseases cause inflammation that
can affect many parts of the body.

7
DR MAI ABD EL SALAM 00201123056296

8
DR MAI ABD EL SALAM 00201123056296

Muscle-Skeletal System

Function of skeletal system:

 Supporting body
 Storage of Minerals like calcium.
 Blood cell production (in bone marrow).
 Protection of internal body organs.
 Leverage (force of motion).

Types of Skeletal Systems in Animals

Hydrostatic Skeleton:
Fluid filled the body cavity that support the muscles.
e.g., worms and cnidarians.
Exoskeleton:
Exoskeleton made of chitin or calcium (do not grow as
organism grow, only Ched and regrow) E.g.,
arthropods
Endoskeleton:
Internal skeleton made of calcium. e.g., echinoderms
and vertebrates.

1
DR MAI ABD EL SALAM 00201123056296

Bone vs cartilage

Muscle tissues

2
DR MAI ABD EL SALAM 00201123056296

Epithelial tissue lines the cavity and the surfaces of

organs and blood vessels throughout the animal
body whereas connective tissue supports,
connects and separates different types of tissues
and organs in the body.

Sarcomere: Is the structural and functional unite of

the muscular system.
Skeletal muscle cell has thousands of
fibres(myofibrils) inside its cytoplasm.
Myofibrils consist of thick and thin filaments: each
thin filament consists of actin proteins; each thick
filament consists of myosin proteins.
Sliding Filament Theory: actin protein filaments
slide over myosin filament causing shortening of
sarcomere that and contract muscle.

3
DR MAI ABD EL SALAM 00201123056296

Ligaments, Tendons, and Joints

Ligaments: fibrous tissue connect one bone with

another bone.
Tendons: fibrous tissue connect muscle with
bone.
Joints: point of connection two or more bones.

Sun light is the main source of vitamin D that

responsible for calcium levels and bone building.
Rickets disease is a result of calcium deficiency in
children.
Osteoporosis is a result of calcium deficiency in
adults.

4
 Human systems
Practice 1
1. All of the following are functions of the liver EXCEPT
(A) cholesterol production
(B) recycles red blood cells
(C) site of bile production
(D) site of deamination of amino acids
(E) excretion of urea

2. Absorption of nutrients occurs in the

(A) stomach
(B) beginning of the small intestine
(C) latter part of the small intestine
(D) colon
(E) rectum

3. Which pair is correctly matched?

(A) Pyloric sphincter—small intestine
(B) Colon—villi
(C) Pancreas—bile
(D) H. pylori—ulcers
(E) Amylase—digests proteins
1
Questions 4–10
Match the description to the parts of the human
digestive system below.
(A) Small intestine
(B) Stomach
(C) Esophagus
(D) Colon
(E) Mouth
4. Digestion of starch begins
5. Digestion of starch is completed
6. Digestion of proteins begins
7. Water absorption
8. Vitamin production
9. Organ of egestion
10. Contains villi
________________________________________
11. Gastric enzymes work best in an environment with a
pH of
(A) 3
(B) 6
(C) 7
(D) 8
(E) 11

2
12. Intestinal enzymes work best in an environment with
a pH of
(A) 2
(B) 6
(C) 7
(D) 8
(E) 11

13. The lacteal is found in the ___________ and is

involved with___________.
(A) stomach; release of hormones
(B) duodenum; hydrolysis of lipids
(C) villi; the absorption of fatty acids
(D) colon; the reabsorption of water
(E) liver; production of hydrolytic enzymes

14. The digestive tract consists of ___________ and is

under the control of the ___________ nervous system.
(A) smooth muscle; autonomic
(B) smooth muscle; somatic
(C) skeletal muscle; autonomic
(D) skeletal muscle; somatic
(E) striated muscle; autonomic

3
15. Which of the following statements is correct about
the heart?
(A) The right ventricle pumps blood to the aorta.
(B) The left ventricle pumps blood to the entire body.
(C) The right atrium receives oxygenated blood from the
lungs.
(D) The right ventricle pumps blood to the right atrium.
(E) The right ventricle has the thickest wall of all the
chambers.

16. All of the following are correct about gas exchange

in humans EXCEPT
(A) hemoglobin carries oxygen and carbon dioxide in
fairly equal amounts
(B) breathing rate is regulated by the medulla of the
brain
(C) the purpose of the nose is to filter, warm, and
moisten air
(D) gas exchange occurs in alveoli
(E) when carbon dioxide builds up in the blood, the pH
lowers

17. All of the following are correct about human red

blood cells EXCEPT
(A) they live 120 days

4
(B) they are called leukocytes
(C) they do not have a nucleus
(D) they are formed in the bone marrow
(E) they carry oxyhemoglobin

18. All of the following are correct about human

circulation EXCEPT
(A) arteries have thick muscular walls
(B) the pacemaker of the heart is the SA node
(C) leukocytes fight disease
(D) hemoglobin carries oxygen
(E) the only artery carrying deoxygenated blood is the
aorta

19. All of the following are related to blood clotting

EXCEPT
(A) fibrinogen
(B) erythrocytes
(C) thromboplastin
(D) calcium ions
(E) thrombocytes
20. All of the following are correct about the normal
direction of blood flow EXCEPT
(A) vena cava → right ventricle
5
(B) right atrium → tricuspid valve
(C) aortic semilunar valve → aorta
(D) lungs → pulmonary vein
(E) pulmonary vein → left atrium

21. Which of the following correctly follows the flow of

blood in the human body?
(A) Right ventricle—aorta—body—left atrium—left
ventricle—pulmonary artery
(B) Right ventricle—pulmonary artery—lungs—
pulmonary vein— left atrium
(C) Left atrium—left ventricle—pulmonary artery—
pulmonary vein—right atrium
(D) Left atrium—left ventricle—pulmonary artery—
lungs—pulmonary vein—right atrium
(E) Left ventricle—left atrium—aorta—lungs—pulmonary
vein

22. All of the following are correct about human

circulation EXCEPT
(A) blood in capillaries travels slowly to allow for
diffusion of nutrients and wastes
(B) normal blood pressure is higher in males than in
females

6
(C) the average heart rate and pulse is about 70 beats
per minute
(D) your heart rate normally changes in response to
physical activity
(E) arteries have thicker walls than veins

23. The largest amount of the carbon dioxide is carried

to the lungs by
(A) leukocytes
(B) thrombocytes
(C) erythrocytes
(D) hemoglobin in red blood cells
(E) the plasma as the bicarbonate ion

24. All of the following are true about blood EXCEPT

(A) white blood cells are formed in the bone marrow
(B) platelets are not cells but are cell fragments
(C) arteries contain valves to help in the pumping of
blood
(D) the liquid portion of the blood is called plasma
(E) red blood cells live about 120 days

Questions 25–29

7
Match the hormone to the correct gland from which it
comes.
(A) Thyroxin
(B) Oxytocin
(C) Insulin
(D) Thyroid-stimulating hormone
(E) Adrenaline
25. Pancreas
26. Anterior pituitary
27. Posterior pituitary
28. Adrenal medulla
29. Thyroid

Questions 30–34
Match the hormone and its function. Use each letter
once only.
(A) Raises blood sugar
(B) Lowers blood sugar
(C) Stimulates the ovaries
(D) Stimulates the uterine lining
(E) Stimulates growth of long bones
30. Progesterone
31. HGH

8
32. Glucagon
33. FSH
34. Insulin

35. All of the following are correct about the endocrine

system EXCEPT
(A) endocrine glands are ductless
(B) parathormone is the fight-or-flight hormone
(C) the islet cells in the pancreas produce both glucagon
and insulin
(D) ecdysone controls metamorphosis in some insects
(E) polypeptide hormones must bind with a receptor and
trigger a secondary messenger

36. All of the following hormones are produced by the

anterior pituitary EXCEPT
(A) glucagon
(B) follicle-stimulating hormone
(C) human growth hormone
(D) thyroid-stimulating hormone
(E) adrenocorticotropic hormone

37. The main target of antidiuretic hormone is the

(A) liver
9
(B) kidney
(C) heart
(D) thyroid
(E) spleen

38. Tropic hormones

(A) are secreted by the thyroid
(B) are secreted by the liver
(C) are released by the hypothalamus
(D) are released only in females
(E) are hormones that stimulate other glands

39. Which of the following is correct about the kidney?

(A) Filtration occurs in the Bowman’s capsule and is
nonselective.
(B) Filtration is selective and occurs by active transport.
(C) Filtration is selective and occurs by passive
transport.
(D) Reabsorption is selective and occurs by passive
transport only.
(E) Reabsorption occurs in the glomerulus.

40. In humans, urea is

(A) produced in the kidney and excreted by the skin
10
(B) produced in the liver and excreted mainly by the
kidneys
(C) produced in the kidney from the metabolism of fats
(D) produced in the lungs as a by-product of exhaling
(E) accumulates in our bodies as we age

41. Which is true about the human circulatory system?

(A) The pH varies throughout the day and night.
(B) Erythrocytes clot blood.
(C) Leukocytes fight germs.
(D) Blood type O is dominant.
(E) Humans have an open circulatory system.

42. ADH most directly affects the

(A) glomerulus
(B) Bowman’s capsule
(C) thymus
(D) lacteal
(E) collecting tubule of the nephron

43. The following are all correct about the nervous

system EXCEPT
(A) dendrites are sensory

11
(B) axons carry an impulse away from the cell body
(C) the parasympathetic nervous system is associated
with fight-or-flight
(D) the central nervous system consists of the brain and
spinal cord
(E) the interneuron is located in the spinal cord

44. Which would occur if the parasympathetic system

were stimulated?
(A) Increase in blood sugar
(B) Increase in digestion
(C) Increase in breathing rate
(D) Increase in adrenaline
(E) Increase in epinephrine

45. The walls of arteries consist of

(A) striated muscle and are under voluntary control
(B) striated muscle and are not under voluntary control
(C) smooth muscle and are controlled by the somatic
nervous system
(D) smooth muscle and are controlled by the autonomic
nervous system
(E) a mixture of striated and smooth muscle under
control of the autonomic nervous system

12
46. Development of an embryo without fertilization is
called
(A) Budding
(B) Parthenogenesis
(C) Regeneration
(D) Gastrulation
(E) Organogenesis

47. All of the following are correct about asexual

reproduction EXCEPT
(A) it can create numerous offspring quickly
(B) the offspring are genetically identical to the parent
(C) it enables animals living in isolation to reproduce
without a mate
(D) there is no expenditure of energy maintaining
reproductive systems or hormonal cycles
(E) it is advantageous when the environment is
changing and the organism is stressed

Questions 48–52
Refer to the list below of primary germ layers.
(A) Ectoderm
(B) Endoderm
(C) Mesoderm

13
48. Gives rise to the lining of the digestive tract
49. Gives rise to the brain and eye
50. Gives rise to the blood
51. Gives rise to the bone
52. Gives rise to the viscera

Questions 53–56
Refer to the list below of parts of the male reproductive
system.
(A) Prostate gland
(B) Vas deferens
(C) Testes
53. Secretes semen directly into the urethra
54. Duct that carries sperm during ejaculation
55. Male gonads
56. Site of meiosis

Questions 57–60
Choose from the list below of parts of the female
reproductive system.
(A) Uterus
(B) Cervix
(C) Endometrium

14
(D) Fallopian tube
(E) Ovary
57. Where fertilization normally occurs
58. Where meiosis occurs
59. Lining of the uterus
60. Mouth of the uterus through which the baby passes

Questions 61–63
Refer to the terms below about the menstrual cycle.
(A) Luteal Phase
(B) Menstruation
(C) Ovulation
(D) Follicular phase
61. FSH stimulates the ovaries
62. Follicle secretes estrogen and progesterone
63. Secondary oocyte ruptures out of ovary
________________________________________
64. The end of cleavage is marked by the formation of
(A) three embryonic layers
(B) the archenteron
(C) the blastula
(D) zygote
(E) the secondary oocyte
15
65. Gastrulation is marked by the formation of the
(A) blastula
(B) secondary oocyte
(C) three embryonic layers
(D) blastocoel
(E) zygote

66. Which hormone is released by the anterior pituitary

and directly causes ovulation?
(A) Luteinizing hormone
(B) Progesterone
(C) Gonadotropic-releasing hormone (GnRH)
(D) Follicle-stimulating hormone
(E) Estrogen

67. Which hormone causes the lining of the uterus to

thicken in preparation for implantation of the embryo?
(A) Luteinizing hormone
(B) Progesterone
(C) Gonadotropic-releasing hormone (GnRH)
(D) Follicle-stimulating hormone
(E) Androgen

16
68. Which is the correct order of the stages of the
menstrual cycle?
(A) Follicular phase—ovulation—menstruation—luteal
phase
(B) Ovulation—luteal phase—menstruation—follicular
phase
(C) Follicular phase—ovulation—luteal phase—
menstruation
(D) Luteal phase—ovulation—menstruation—follicular
phase
(E) Luteal phase—follicular phase—ovulation—
menstruation

Questions 69–70
Refer to the terms below that refer to the chick embryo.
(A) Chorion
(B) Yolk sac
(C) Amnion
(D) Allantois
69. Analogous to the placenta; where nitrogenous waste
accumulates
70. Encloses the embryo in protective fluid

71. All of the following are part of the first line of defense
of the immune system EXCEPT

17
(A) leukocytes
(B) skin
(C) stomach acid
(D) cilia
(E) mucus

72. All of the following are true of the second line of

defense EXCEPT
(A) increased production of histamine
(B) sneezing, redness, and itchy and runny nose and
eyes
(C) inflammatory response
(D) stomach acid
(E) phagocytes

73. All of the following are correct about the immune

system EXCEPT
(A) the first line of defense is nonspecific
(B) the second line of defense is nonspecific
(C) release of histamine is responsible for the
inflammatory response
(D) macrophages engulf huge numbers of microbes
(E) T lymphocytes release antibodies

18
Questions 74–80
Refer to terms below.
(A) T lymphocytes
(B) B lymphocytes
(C) Macrophages
(D) Antibodies
(E) Histamine
74. Produce antibodies
75. Fight pathogens by hand-to-hand combat
76. Neutralize specific antigens
77. Use pseudopods to engulf large numbers of germs
78. Attacks and kills infected body cells
________________________________________
79. Certain danger in a blood transfusion comes when
the
(A) recipient has antigens to the donor blood
(B) recipient has antibodies to the donor blood
(C) donor has antibodies to the recipient’s blood
(D) donor has antigens to the recipient’s antigens
(E) donor’s blood contains gamma globulin

80. A person with blood type A has

(A) A antibodies circulating in the plasma

19
(B) A antigens on the surface of the red blood cells
(C) B antibodies on the surface of the red blood cells
(D) A antigens circulating in the plasma
(E) O antibodies circulating in the plasma

81. A person with AB blood type has

(A) both A and B antigens on the surface of the red
blood cells
(B) both A and B antigens circulating in the plasma
(C) O antigens circulating in the plasma
(D) no antigens on the surface of the red blood cells
(E) no antibodies on the surface of the red blood cells

82. Which is an example of passive immunity?

(A) Lifelong immunity.
(B) Babies who are nursing receive antibodies from their
mothers.
(C) You become resistant to a viral infection once you
have recovered from it.
(D) You become resistant to mumps after receiving the
mumps vaccine.
(E) People who have AIDS have antibodies against the
virus but are still gravely ill.

20
21
 Human systems
Practice 2
1) We inject antibodies into an infected subject to
attack immediately the infectious agent. This
technique is called
A.Vaccination
B. Serotherapy
C.Chemotherapy
D.Radiotherapy
E. Antibiotics shots

2) Curare is a natural substance that has the effect

of fixing on the receptor of the motor endplate.
This can have a result:
A.To activate this synapse
B. To block the action of acetylcholine
C.To contract the muscle
D.No effect on this synapse
E. Synthesis of acetylcholine

3) motor endplate. This can have a result:

A.To activate this synapse
B. To block the action of acetylcholine
C.To contract the muscle
D.No effect on this synapse
E. Synthesis of acetylcholine

4) The mean survival time of spermatozoid in the

female reproductive system of the Human
species is:
1
A.One hour
B. One day
C.Four days
D.One week
E. Two weeks

5) Certain organochlorine insecticide disturbs the

functioning of the synapse by blocking the
acetylcholinesterase. This disruption can be
explained by:
A.A prolonged effect of the acetylcholine
B. A blockage of acetylcholine receptors
C.An inhibition of acetylcholine
D.A blockage of the synthesis of acetylcholine
E. No effect

6) The digestive system is made up of the digestive

tract which is a series of hollow organs joined
together. The organs of the digestive system are
indicated in the given figure.

2
 Make use of the following statements to answer
the question that follows:
I. All the given organs are part of
the digestive system.
II. All the given organs secrete
digestive juices.
III. All the given organs are part of
the digestive tract.
IV. All the given organs participate in
the process of digestion.
Which of the given statement(s)
is/are true?
A. I
B. II
C. III
D. IV
E. I and IV

7) One of the following proteins is not an enzyme.

Which one?
A.The intestinal lipase
B. The salivary amylase
C.The pancreatic insulin
D.The gastric pepsin
E. The pancreatic trypsin

8) In a medullar reflex action, the spinal motor nerve

transmits nerve impulses from:
A.The spinal cord to the effector organ
B. The sensory receptor to the effector organ
3
 C.The effector organ to the spinal cord
D.The sensory receptor to the spinal cord
E. The effector organ to the sensory receptor

9) All of the following are examples of homeostasis in the

human body EXCEPT:
A.insulin is released after eating a sugary snack to
maintain a constant blood glucose level
B. carbon dioxide is exhaled from lungs to ensure a
stable pH of blood
C.on hot days, sweating makes sure body temperature
remains at 37°C
D.being able to run and throw objects with high precision
ensures we can protect ourselves from predators
E. urinating will remove unnecessary excess water from
the body

10) A student wanted to study the effect of exercise on

his heart rate. This student does not have any cardiac
or respiratory problems. The results of his experiment
are shown in the table below. Predict what could the
heart rate most probably be after he rested for 7
minutes?
Effect of Exercise on Heart
Rate
Pulse taken Heart rate
At rest 72
Immediately after 112
exercise

4
 1 minute after 96
exercise
7 minutes after ?
exercise
A.75
B. 52
C.65
D.115
E. 98

11) In the following graph, the time of the greatest

increase in the blood sugar levels occurs:

A.during the first 2 hours

B. between the 2nd and the 4th hour
C.between the 4th and the 6th hour
D.between the 6th and the 7th hour
E. between the 7th and the 8th hour

5
 12) Dissection of the pancreas showed that it contains a
duct that collects a liquid produced by pancreatic cells
and the gland is also connected to many blood
vessels. What can be concluded regarding the type of
gland the pancreas is?

A.the pancreas acts as an endocrine gland

B. the pancreas acts as an exocrine gland
C.the pancreas acts as an endocrine and an exocrine
gland
D.the pancreas can alternate between being an
endocrine gland and an exocrine gland, but never
both at the same time
E. the type of gland that the pancreas represents
depends on body temperature

13) Which of these relationships is NOT correct?

A.pepsin: sucrose
B. lipase: fats
C.amylase: starch
D.trypsin: protein
E. maltase: maltose

14) What type of reproduction is shown in the figure

below?

6
 A.budding
B. fragmentation
C.sexual reproduction
D.binary fission
E. parthenogenesis

15) A man with an unknown blood type needs an urgent

blood transfusion. What is the safest choice of blood
type that could be given to this man?
A.A+
B. A-
C.O+
D.O-
E. AB-

16) Which is an example of passive immunity?

A.It is lifelong
B. Babies who are nursing receive antibodies from
their mothers
C.People become resistant to a viral infection
once they have recovered from it

7
 D.People become resistant to mumps after
receiving the mumps vaccine
E. People who have AIDS have antibodies against
the virus but are still gravely ill

17) When humans run during a marathon, their

rate of breathing increases. This is primarily
controlled by:
A.Lungs
B. Cerebrum
C.Medulla oblongata
D.Cerebellum
E. Pleura

18) The following table shows three experiments

held on 3 different mice.
Mouse Experiments Results
Mouse with a
1 normal thyroid Normal growth
gland
Mouse whose
Stoppage of
2 thyroid gland has
growth
been removed
Mouse whose The graft is
thyroid gland has rapidly
been removed vascularized,
3
followed by leading to normal
grafting at another growth of the
level animal.
8
 What does the experimental results justify?
A.Thyroid gland is responsible for the growth of
mice
B. Thyroid gland stops working when its location
is changed
C.The communication between the thyroid and
the organism isn’t via blood
D.The location of the thyroid gland is important
E. Thyroid gland isn’t responsible for the growth of
mice

Consider the following experiment:

19) The above procedure shows that the tadpole

originates from:

9
A.The skin cells of the green frog
B. The unfertilized egg of the brown frog
C.The enucleated egg of the brown frog
D.The fertilized egg having a diploid nucleus of the
skin cell of the green frog
E. Recombined egg having a diploid nucleus of the
skin cell of the green frog

20) The produced tadpole will grow to be a:

A.Brown frog
B. Green frog
C.Brown frog with small green dots
D.Any of the colors because its color
depends on the environment
E. Green frog with small brown dots

The following figure represents the functioning

mechanism of a hepatic cell of a healthy
individual.

10
21) The document shows that insulin:
A.Is a hyperglycemic hormone
B. Is a hypoglycemic hormone
C.Promotes glycogenolysis
D.Decreases glycogenogenesis
E. Doesn’t have any effect on glycemia

22) A female got her first menstrual period at the

age of 12. She reaches menopause at the age of
50. She gave birth to two children. The length of
her menstrual cycle is 28 days and was not
variable. Knowing that only one ovary is active
during each menstrual cycle, calculate the
number of oocytes II produced by this female.
A. 495
B. 525
C. 476
D. 1944
E. 1980

23) Taste cells are sensory receptors located on the

surface of the tongue. These receptors are
involved in the detection of flavors. To determine
the characteristics of the nerve message, a taste
receptor is subjected to NaCl solutions of
increasing concentrations. Two oscilloscopes O1
and O2 are connected: one, O1, to the F1 nerve
fiber of the taste receptor and the other, O2, to the
F2 nerve fiber of a neuron related to F1 to
measure action potential (AP).

11
 Scheme showing the experimental setup
Conditions and recordings at the level of the
oscilloscope O1 figure in the following table.
Concentration
of
1 3 10 30 100
NaCl solution
(mmol/L)
Recordings at
the level of O1
Number of 0 AP 1 AP 5 AP 9 AP 13
A.P AP
The nervous message:
A.Is coded in frequency of action potential at the
level of the nerve fiber F1
B. Is coded in amplitude of action potential at the
level of the nerve fiber F1
C.Is coded in frequency and in amplitude of action
potential at the level of the nerve fiber F1
D.Is transmitted from the nerve fiber F2 to the nerve
fiber F1 after the stimulation of F1
E. Coding is not clear because there is insufficient
data

12
 24) The schematic below illustrates an experiment
done with mice.

In this transplantation experiment:

A.Mice B and C don’t reject the graft
B. After thymus ablation mouse C loses the ability of
graft rejection
C.Granulocytes are the agents of graft rejection in
mouse B
D.Antibodies are capable of graft rejection in mouse
C
E. The immune response responsible for graft
rejection is phagocytosis in mouse B and C

25) An experiment was done on nerve fibers to study

the effect on transmission of the nerve impulse.
Two variables were examined: variable 1 is the
diameter of the nerve fiber and variable 2 is
myelinated vs. unmyelinated nerve fiber. The
speed of conduction of the nerve impulse was
recorded as shown in the document below.

13
 Diameter of nerve fiber (µm) 1 2 3 4
Speed of conduction of nerve
impulse in myelinated nerve 1 5 8 15
fiber (a.u)
Speed of conduction of nerve
impulse in non myelinated nerve 0.2 1 3 5
fiber (a.u)
Referring to the data of the above table, we can
conclude that
I. The speed of conduction of the nerve impulse
increases as the diameter of the nerve fiber
increases.
II. The speed of conduction of nerve impulse decreases
as the diameter of the nerve fiber increases.
III.The speed of conduction of nerve impulse is faster in
a myelinated nerve fiber.
IV. The speed of conduction of nerve impulse is faster in
a non- myelinated nerve fiber.
A.I and III
B. I and IV
C.II and III
D.II and IV

The following document shows different experiments

done in vitro to study the digestion of lipids.

14
26) Referring to the data in the above document,
bile
A. digests lipids into fatty acids and glycerol
B. emulsifies lipids to make it easier for the
enzymes to digest lipids
C. digests and emulsifies lipids
D. maintains the temperature of the tube
E. has no effect on the digestion of lipids

27) The enzyme found in pancreatic juice that

digests lipids is
A. Pancreatic amylase
B. Trypsin
C. Maltase
D. Lipase
E. Pepsin

28) The amount of mitochondria in the left ventricle

is more than the that in the left atrium. How can

15
 you explain this variation in the amount of
mitochondria?
I. The size of the ventricle is bigger than the
size of atrium.
II. The left ventricle pumps the blood with larger
force to all parts therefore it needs a larger
amount of energy produced by cellular
respiration.
III.The left atrium pumps blood to the left
ventricle with smaller force than that of the
left ventricle therefore it needs less amount of
energy produced by cellular respiration.
IV. The left atrium pumps the blood with big force
to all body parts therefore it needs a big
amount of energy produced by cellular
respiration.
A.I only
B. I and II
C.I and IV
D.II and III
E. I, II and III

The following graph shows the percentage

composition of mitochondria in different cells of the
mouse.

16
 29) Based on the data given in the above bar graph,
the approximate percentage of mitochondria in the
liver is
A.around 20 %
B. around 12%
C.around 10 %
D.around 15 %
E. around 18%

questions 30 to 31 …
The cockroach is an insect known for its rapid escape.
In order to identify the stimulus that causes its escape
and the sense organ that receives the stimulus, the
following experiments were performed.
Experiment Result
Cockroach was placed in a glass Cockroach
Experiment 1 box with a speaker producing the doesn’t run
voice of the toad away
Cockroach was placed alone in Cockroach
the glass box with air blowing on runs away
Experiment 2
the cockroach

The antenna of the cockroach Cockroach

are covered with petroleum runs away
Experiment 3 based jelly which acts as an
insulator, and then blowing air on
the cockroach
The legs of the cockroach are Cockroach
Experiment 4 covered with petroleum based doesn’t run
away

17
 jelly then blowing air on the
cockroach

30) Based on the above experiments, the stimulus

that causes the cockroach to escape is
A.Seeing the predator
B. Smelling the odor of the predator
C.Feeling the air produced by the movement of the
predator
D.Hearing the voice of the predator
E. Hearing the voice of the predator and feeling the
air produced by the predator’s movement

31) Based on the above experiments, the sense

organs that receive the stimulus are
A.The antennae
B. The legs
C.The wings
D.The eyes
E. The ears

32) The following bar graph shows the amount of

food X in different organs of the digestive system.

We can conclude that the type of food X is

18
A.Sucrose
B. Starch
C.Lipids
D.Protein
E. Maltose

Questions 33 to 35 …
A.Glucagon hormone
B. Antidiuretic hormone
C.Parathyroid hormone
D.Thyroid hormone
E. Insulin hormone
33) Raises blood calcium
34) Promotes water retention
35) Lowers blood glucose

36) The dorsal root of the spinal nerve reaching the

leg of a frog is destroyed, then a thermal
stimulation is done on the frog’s leg.
A.The frog will feel the stimulation and move its leg
accordingly.
B. The frog will not feel the stimulation and it won’t
react to it.
C.The frog will not feel the stimulation and it will
move its leg.
D.The frog will feel the stimulation but it will be
paralyzed.
E. The frog will feel and move its other leg
accordingly.
19
37) the mode of action of the pituitary gland.
Lot of mice Experiment Result
Normal
development of
Mice with normal the ovaries and
Lot 1
pituitary gland the uterus and
normal sexual
cycle
Decrease in the
size of ovaries
Ablation (removal) of
Lot 2 and uterus and
the pituitary gland
stop of the sexual
cycle
Ablation (removal) of Normal
the pituitary gland and
development of
injection
Lot 3 of pituitary extracts the ovaries and
(FSH and LH uterus and normal
hormones) sexual cycle
Ablation (removal) of Decrease in the
the pituitary gland and size of ovaries
Lot 4 grafting it in the and uterus and
abdomen stop of the sexual
cycle
Ablation (removal) of Normal
the pituitary gland and development of
Lot 5 grafting it within its the ovaries and
area uterus and normal
sexual cycle
By referring to experiments done on mice of five lots,
we can conclude
20
 i. The pituitary gland favors the development of
ovaries and uterus by secreting FSH and LH
ii. The pituitary gland and the ovaries do not
communicate by blood
iii. The pituitary gland and the ovaries communicate
by blood
iv. The pituitary gland works only in its site
A.I only
B. I and II
C.II and III
D.I, III and IV
E. I, II and IV

38) A woman visits the gynecologist who asks her to

take some blood tests to monitor the level of some
female hormones. The results showed that she has
a constant low level of LH and FSH as well as low
level of estrogen and progesterone. How can you
explain the low level of progesterone and estrogen?
I. The low level of FSH didn’t cause follicles to
develop so they secreted low amounts of
estrogen
II. The low level of LH didn’t trigger ovulation
then corpus luteum is not formed to secrete
estrogen and progesterone
III. The low level of LH didn’t cause the follicles
to develop so they secreted low amounts of
estrogen
A.I only
B. II only

21
 C.I and II
D.II and III
E. I, II, and III

Questions 39 to 40 ….
The following figure shows one of the immune
reactions.

Immune cells

39) Which is true concerning the above immune

reaction?
A.It is the 1st line of defense and the cells involved
are phagocytes.
B. It is the 2nd line of defense and the cells involved
are phagocytes.
C.It is the 3rd line of defense and the cells involved
are phagocytes.
D.It is the 1st line of defense and the cells involved
are B-lymphocytes.
E. It is the 2nd line of defense and the cells involved
are B- lymphocytes.
22
40) The rush of immune cells to the area of injury is
the cause behind
A.Redness
B. Heat
C.Swelling
D.Heat and swelling
E. Redness and heat

41) Which of the following is NOT true about blood

circulation?
A.Deoxygenated blood is pumped by the right
ventricle to the lungs through pulmonary artery.
B. Oxygenated blood reaches the left atrium by
pulmonary vein.
C.All arteries carry oxygenated blood except the
pulmonary artery.
D.All veins carry deoxygenated blood except the
pulmonary vein.
E. The right part of the heart has oxygenated blood
while the left part has deoxygenated blood.

Questions 42 to 43 ….
In order to study the components of the immune
system that is implicated in the transplant rejection,
the following experiments were done on mice.

23
 Experiment 1: Mice A and B from different
strains

Experiment 2: Mice A and B from different strains; Mice

B1, B2 and B3 = same strain

42) The above experiments show that

A.the immune response is cell-mediated and the
memory cells have an effect on transplant rejection.
B. the immune response is humoral and the memory
cells do not have any effect on transplant rejection.
C.the immune response is cell-mediated and the
memory cells do not have any effect on transplant
rejection.
D.the immune response is humoral and the memory
cells have an effect on transplant rejection.
E. there is insufficient data.

43) In reference to the results of the experiment, which

statement is correct about grafts?

24
 A.Allografts are never rejected.
B. A thymectomized mouse loses the ability of graft
rejection.
C.Granulocytes are the agents of graft rejection.
D.Antibodies are capable of graft rejection.
E. None of these statements are correct.

44) Sarah saw a big snake while hiking. She started to

run and her heartbeat increased to 100 bpm. Which of
the following organs is implicated in this response?
A.adrenal cortex
B. adrenal medulla
C.pancreas
D.thymus
E. anterior pituitary

45) The figure below represents the digestive system.

Which of the following statements is true?

A.The accessory organs involved in digestion are the
mouth, esophagus, pharynx, liver, stomach, small
intestine, large intestine, and pancreas.

25
 B. The organs involved in digestion are the liver,
gallbladder, small intestine, and large intestine.
C.The major organs involved in digestion are the
mouth, esophagus, pharynx, liver, gallbladder,
stomach, small intestine, large intestine, and
appendix.
D.The major organs involved in digestion are the liver,
gallbladder, stomach, small intestine, and large
intestine.
E. The organs involved in digestion are the mouth,
stomach, small intestine, liver, gallbladder, and
pancreas.

46) The following table shows three experiments done

on 3 different normal mice.
Mouse Experiments Results
Mouse with a
1 normal thyroid Normal growth
gland
Removal of thyroid Stoppage of
2
gland growth
The graft is
Removal of
rapidly
thyroid gland
vascularized,
3 followed by
leading to normal
grafting at another
growth of the
location
animal.

Consider the following statements.

26
 I. The thyroid gland is responsible for the growth of
mice.
II. The thyroid gland stops working when its location is
changed.
III. The communication between the thyroid and the
organism is via blood.
IV. The location of the thyroid gland is not important as
long as it is vascularized.

What do the experimental results justify?

A.I and II
B. I and III
C.I and IV
D.I, III, and IV
E. There is insufficient data.

Questions 47 and 48…..

A woman indicated with a red color on a calendar the date
of her period throughout 3 months.

27
 47) This woman will have the chance to become
pregnant on
A.October 5.
B. September 28.
C.October 12.
D.October 15.
E. October 1.

48) The ovulation date that corresponds to the August

cycle is
A.August 17.
B. August 14.
C.August 29.
D.August 31.
E. None of the above.

49) What is the main difference between oogenesis and

spermatogenesis?
A.oogenesis produces 2 eggs, and spermatogenesis
produces 2 sperms
B. oogenesis produces 2 eggs, while spermatogenesis
produces 4 sperms
C.oogenesis produces 1 egg, while spermatogenesis
produces 2 sperms
D. oogenesis produces 4 eggs, while spermatogenesis
produces 1 sperm
E. oogenesis produces 1 egg, while spermatogenesis
produces 4 sperms

28
50) During the menstrual cycle, which hormone is
secreted the most right before ovulation?
A.LH
B. FSH
C.strogen
D.Progesterone
E. all

51) A seven-year-old boy was suffering from chicken

pox, and he had high fever and blister rash. His
parents took him to the doctor who decided that the
best treatment for him would be
A.fluids and rash ointment.
B. vaccination against chicken pox.
C.antibiotics.
D.expose him to high temperatures to inactivate the
disease.
E. a combination of A and B.

52) Which part of the nervous system gets activated

during such stressful situations?
A.Sympathetic nervous system
B. Parasympathetic nervous system
C.Both sympathetic and parasympathetic nervous
systems
D.First the parasympathetic followed by the
sympathetic nervous system
E. The “fight or flight” response is controlled by the
endocrine system only.

29
53) Which hormone is secreted abundantly during the
“fight or flight”?
A.insulin
B. FSH
C.dopamine
D.adrenaline
E. estrogen

54) A gynecologist prescribes a treatment to a newly

pregnant woman who suffered from a miscarriage a
year ago. This treatment is composed of one main
hormone that maintains a supportive environment for
the developing fetus. Which hormone is this
medication composed of?
A.Estrogen
B. FSH
C.GnRH
D.Progesterone
E. testosterone

55) All of following are correct about the gallbladder

EXCEPT:
A.It produces and stores bile.
B. It is a small organ located close to the liver.
C.A body can function well without a gallbladder.
D.It has ducts connected to the liver.
E. It helps in emulsifying fat.

30
31
DR MAI ABD EL SALAM 00201123056296

Plants
All Plants are multicellular, photoautotrophic, with
cellulosic cell wall.

Angiosperm (flowering plants) are monocots and dicots.

1
DR MAI ABD EL SALAM 00201123056296

Plane tissues

2
DR MAI ABD EL SALAM 00201123056296

Vascular tissues

Types of meristems (dividing

tissues)

3
DR MAI ABD EL SALAM 00201123056296

Flower structure

4
DR MAI ABD EL SALAM 00201123056296

Leaf structure

5
DR MAI ABD EL SALAM 00201123056296

Stomata
It controls gas exchange in the leaf.
Each stoma can be open or closed, depending on
how turgid its guard cells are.
In the light and high humidity, the guard cells
absorb water by osmosis, become turgid and the
stoma opens.
In the dark and dry atmosphere, the guard cells lose
water, become flaccid and the stoma closes.

Structure of root

6
DR MAI ABD EL SALAM 00201123056296

N.B. root hair is epidemis cells elongated in soil to

increase the surfase area of absorbtion, and anchoring
the plant.
Double fertilization in angiosperm:
Each pollen grain contains two sperm nuclei and
one tube nucleus.
After successful pollination, the pollen germinates
on the surface of the stigma of the pistil and produces
a tube that grows down through the style to an ovule
inside the ovary at the base of the pistil.
Double fertilization results from discharge of two
sperm nuclei from the pollen tube into the embryo
sac in the ovule.
Sperm + egg = zygote 2n
Sperm + two polar nuclei = endosperm 3n
(storing food for embryo).

7
DR MAI ABD EL SALAM 00201123056296

Alternation of generation
Alternation of generations means that plants alternate
between two different life stages, or generations, in
their life cycle; a haploid stage called gametophyte
and a diploid stage called sporophyte.

Plant hormones
hormone function
Auxin (IAA) Involved in tropism and enhance
apical dominance (weed killer).
ethylene Promote fruit ripening
gibberellin Induce bolting and rapid growth of a
floral stail
Abscisic Maintain Seed dormancy, close
acid stomata and inhibit growth
cytokinin Promote cell division

8
DR MAI ABD EL SALAM 00201123056296

Tropism
Tropism: is the bending of plant toward toward or away
from stimuls due to accumulation of auxin in elongated part.

9
DR MAI ABD EL SALAM 00201123056296

Photoperiodism
photoperiodism, the functional or behavioural response
of an organism to changes of duration in daily,
seasonal, or yearly cycles of light and darkness

10
DR MAI ABD EL SALAM 00201123056296

C3, C4, and CAM plants

C4 plant is characherized by kranz anatomy.

11
DR MAI ABD EL SALAM 00201123056296

Forces help water ascending in high tree:

Transpiration.
Cohesion force( attraction between water molecules).
Adhesion force( attraction between water and any
suface like xylem)
Capillary action
Root pressure.

12
DR MAI ABD EL SALAM 00201123056296

13
 Plants
Practice 1
1.All of the following are correct about plants EXCEPT
(A) gymnosperms have cones
(B) tracheophytes have xylem and phloem
(C) moss is a bryophyte
(D) bryophytes must live in a moist environment
(E) some plants have cell walls made of chitin instead of
cellulose

Questions 2–7
Choose from the terms below.
(A) Monocot
(B) Dicot
2. Vascular bundles scattered throughout the stem
3. Parallel veins in leaves
4. Seed splits in two
5. Taproots
6. Daisies, carrots, and roses are examples
7. Grasses such as lawn grass, wheat, rice, and corn
are examples
________________________________________

1
8. Angiosperms are
(A) monocots
(B) seedless plants
(C) plants with no vascular tissue
(D) flowering plants
(E) plants that reproduce only asexually

9. All of the following pairs are matched correctly

EXCEPT
(A) gymnosperm—cone bearing
(B) ferns—seedless
(C) flowering plants—reproduce by spores
(D) bryophytes—moss
(E) dicot—peanut

10. One pollen grain contains

(A) one haploid nucleus
(B) two haploid nuclei
(C) three haploid nuclei
(D) one diploid nucleus
(E) two diploid nuclei

11. Where are sperm produced in a flowering plant?

2
(A) Filament
(B) Anther
(C) Epicotyl
(D) Pistil
(E) Carpel

12. Which of the following is NOT an example of asexual

reproduction?
(A) Runners
(B) Grafting
(C) Seeds
(D) Cuttings
(E) Bulbs

Questions 13–19
Choose from the terms below.
(A) Auxins
(B) Gibberellins
(C) Abscisic acid
(D) Ethylene
(E) Cytokinins

3
13. Closes stomates during times of stress, inhibits
growth
14. Is a gas
15. Enhances apical dominance
16. Induces bolting, the rapid growth of a floral stalk
17. An example is 2,4-D, a weed killer
18. Rooting powder is made of this
19. Promotes the ripening of fruit
________________________________________
20. Tropisms are caused by
(A) ethylene
(B) stimulation from primitive nerve cells
(C) contraction of primitive muscle cells
(D) unequal distribution of abscisic acid
(E) unequal distribution of auxins

21. Absorption of nitrogen by a plant is most closely

related to
(A) cone formation in gymnosperms
(B) double fertilization
(C) geotropisms
(D) modified stomata
(E) symbionts that live in nodules on the roots of plants

4
22. Plants are broadly defined as multicellular,
photosynthetic eukaryotes. Which of the following is
NOT an additional feature of this group?
(A) Plants can respond to changes in day length.
(B) Plants have cell walls containing cellulose.
(C) Plant chloroplasts contain chlorophyll A and
chlorophyll B.
(D) Plants have starch as the primary storage
carbohydrate.
(E) Plant respiration is mostly anaerobic.

23. All of the following occur during fertilization in

flowering plants EXCEPT.
(A) Ovules are transferred from one plant to another.
(B) A pollen tube is formed.
(C) One sperm nucleus fuses with the egg nucleus to
form the zygote.
(D) One sperm nucleus fuses with the two polar nuclei to
form the endosperm.
(E) The pollen tube enters the ovary.

24. An angiosperm may have all of the following

EXCEPT
(A) A fibrous roots system.
(B) Seeds.

5
(C) Parallel venation.
(D) Flowers.
(E) Cones.

25. Which of the following structures are characteristic of

both gymnosperms and angiosperms?
(A) Fruits.
(B) Cones.
(C) Inflorescences.
(D) Seeds.
(E) Flowers.

26. Which of the following plant cell types is dead at

maturity, yet functional?
(A) Parenchyma.
(B) Collenchyma.
(C) Phloem.
(D) Xylem.
(E) Companion cell.

27. All of the following functions are performed by roots

EXCEPT:
(A) Storage.
(B) Mineral absorption.
6
(C) Cell reproduction.
(D) Anchorage.
(E) Leaf production.

28. A particular branch joins to the trunk of a tree four

feet above the ground. A year later, the tree has grown
two feet taller. How far above the ground is the same
branch?
(A) 2 feet.
(B) 3 feet.
(C) 4 feet.
(D) 5 feet.
(E) 6 feet.

Questions 29 to 30 …
(A) Bryophytes
(B) Gymnosperms
(C) Seedless vascular plants
(D) Angiosperms
(E) Legumes
29. Divided into two subgroups-monocots and dicots
30. Lack true roots, stems, and leaves

7
31. Which of the following plant movements is NOT a
tropism?
(A) Plant stems growing toward light.
(B) Plant structures growing away from light.
(C) Plant roots growing down in response to gravity.
(D) Vines coiling around tree trunks.
(E) Leaflets folding after losing turgor pressure.

32. Which of the following organisms do NOT belong to

the kingdom Plantae?
(A) Coniferous trees
(B) Fungi
(C) Angiosperms
(D) Mosses
(E) Liverwort

Questions 33 to 36….
(A) Xylem
(B) Phloem cells
(C) Cambium cells
(D) Guard cells
(E) Palisade mesophyll cells.
33. Transport dissolved carbohydrates to other plant
tissue
8
34. Control sites of gas exchange
35. Contains the largest number of chloroplasts of the
cell types listed
36.Divide to produce new tissue layers

Questions 37 to 39…
(A) Phototropism.
(B) Phototaxis.
(C) Gravitropism (geotropism).
(D) Chemotaxis.
(E) Photoperiodism.
37. Is shown by bacteria swimming toward a higher
concentration of nutrients.
38. Is shown by oat coleoptiles bending toward a source
of light.
39. Is shown by plant roots growing downward.

Questions 40 to 43 …
(A) Mosses.
(B) Fernes.
(C) Gymnosperms.
(D) Angiosperms.
(E) Fungi.
40. Organisms that do not carry out photosynthesis.
9
41. Organisms that produce flowers.
42. Photosynthetic organisms characterized by absence
of conducting tissue.
43. Multicellular organisms responsible for recycling
nutrients into the soil.

Questions 44 to 46 …
(A) Xylem.
(B) Phloem.
(C) Stomata.
(D) Epidermis.
(E) Mesophyll.
44. Tissue in which most photosynthesis takes place.
45. Tissue in which water minerals are transported.
46. Tissue with a cuticle layer.

10
 Plants
Practice 2

1) The presence of this structure attracts the

pollinators
A.1
B. 2
C.3
D.4
E. 5

2) The male gamete is formed in this structure:

A.1
B. 4
C.3
D.2
E. 5
3) The factor that affects transpiration in the
above figure is.
A. Temperature
B. Amount of water in soil
C. Sunlight
D. Humidity
E. Temperature and humidity

4) This is the diagram of:

A. monocot stem
B. dicot stem
C. monocot root
D. dicot root
E. monocot leaf
5) Following fertilization, parts of the flower fades.
One flower structure is transformed into fruit.
Which one?
A.Petals
B. Sepals
C.Stamens
D.Ovary
E. pollen

questions from 6 to 8 …
The root of many terrestrial plant species includes
several areas. At the vicinity of the root
extremity, numerous extensions exist: the root hairs forming the piliferous
following experiment was

Piliferous zone

Oil

Water

6) The problem tested in this experiment is:

A.Which area of the root is responsible for water
absorption?
B. Which area of the root is responsible for oil
absorption?
C.What is the importance of oil to the plant?
D.What is the importance of water to the plant?
E. What is the importance of leaves in absorption?
7) After 15 days, the obtained results of this
experiment will be:
A.Survival of the plants in the three tubes A, B
and C
B. Survival of the plants in tube A and B
C.Survival of the plants in tube A and C
D.Survival of the plants in tube A only
E. Survival of the plants in tube B and C

8) What will the result of the iodine test carried on

the leaves be if these three tubes were placed in
the dark?
A.Appearance of blue color on leaves of the plant in
tube A only
B. Appearance of blue color on leaves of the plant in
tube A and B
C.Appearance of blue color on leaves of the plant in
tube B and C
D.Appearance of blue color on leaves of the plant in
tubes A, B and C
E. No blue color will be detected on any of the
leaves of the three plants

Questions from 9 to 11 ….

Choose from the terms below:

A. Auxins
B. Gibberellins
 C. Abscisic acid
D. Ethylene
E. Cytokinin
9) Close(s) stomata during times of stress, inhibits
growth
10) Enhance(s) apical dominance
11) Induce(s) bolting, the rapid growth of a floral
stalk

Questions 13 and 14 …
Sally wanted to examine an important
phenomenon in plants, so she constructed the
following setup as shown in the figure below.

B.thigmotropism
C.hydrotropism
D.phototropism
E. chemotropism
12) W

13) Which phenomena does plant B do?

A.Phototropism.
B. Thigmotropism.
C.Geotropism.
D.Hydrotropism.

14) What type of hormone is found in larger

concentrations (compared to the rest of the plant)
in the area where the arrow is pointing in plant B?
A.auxin
B. abscisic acid
C.ethylene
D.gibberelins
E. cytokinins

15) Which of these correctly matches the plant cells

to their tissue systems?
I. Guard cell
II. Collenchyma cell
III. Vessel elements
A.I = dermal; II = ground; III = vascular
B. I = dermal; II = vascular; III = ground
C.I = ground; II = dermal; III = vascular
D. I = ground; II = vascular; III = dermal
E. I = vascular; II = ground; III = dermal

16) Water rises from the roots through the stem in a

plant against the force of gravity due to the
_____________ force in water. However, what
keeps the column of water together as the water
rises is the _____________ force between the
water molecules.
A.adhesion, cohesion
B. cohesion, adhesion
C.cohesion, capillary action
D.surface tension, adhesion
E. capillary action, adhesion
17) Structure 2 is
A. Ovary
B. Sepal
C. Petal
D. Receptacle
E. Stamen

18) Pollination involves a transfer of pollen from

A.4 to 1
B. 4 to 2
C.4 to 5
D. 5 to 4
E. 5 to 9

19) Sara wants to choose a hormone that elicits

seed dormancy, slows plant growth, and can
regulate stomata during adverse environmental
conditions such as drought. Which of the following
hormones is the best choice?
A. gibberellin
B. IAA
C. abscisic acid
D. ethylene
E. phytochrome

questions from 20 to 22 ….

20) This is a
A.dicot stem.
B. dicot root.
C.monocot stem.
D.monocot root.
E. It cannot be determined.

21) Structure E is the

A.meristem.
B. cambium.
C.vascular cylinder.
D.pith.
E. cortex.

22) If structure D is blocked with a specific

chemical, which of the following functions will be
lost?
A.The transport of water downward
B. The absorption of nutrients into the plant
C.The transport of water upward
D.The transport of sugar upward
E. The transport of sugar downward

23) All of following are matched correctly EXCEPT:

A.Gymnosperm- cone bearing
B. Ferns- seedless
C.Flowering plants- reproduce by spores
D.Bryophytes- moss
E. Dicot- peanut

Questions 24 to 28 …
Choose from the terms below:
A.CAM
B. C-4
C.G3P
D.NADP
E. ATP
24) Provides the energy for the light-independent
reactions
25) A sugar synthesized during photosynthesis
26) Plants that keep their stomata closed during the
day and open at night
27) A molecule that caries H2 form the light-
dependent reactions and stores energized
electrons temporarily to be used during the light-
independent reactions
28) Plant with kranz anatomy
 Taxonomy
It is a system by which we name and classify all
organisms living and extinct.
Carlous Linaeus grouped organisms depending on
similarity in shapes (Morphology).
He classified organisms into the following levels of taxa:

1
 System of binomial nomenclature:
 It was given by Carolus Linnaeus. In this system, each
name has two components - genus name and species
name.
 For example, binomial name for Mango is Mangifera
indica where 'Mangifera' denotes genus name (genus)
and 'indica' represents (species). all written in small
litters, except first litter in genus is capitalized.
 modern humans belong to the genus Homo and within
this genus to the species sapiens. So, he called Homo
sapiens.

Three-domain system

It is based on DNA analysis.

All life is organized to three domains: Bacteria,
Archaea, Eukarya (include 4 kingdoms).
Old classification was two domain system (Monera
that involve prokaryotes, and eukaryotes).

2
 Domain Bacteria
prokaryotes (lacking nucleus and membrane bounded
organelles).
many are pathogens (causing disease).
most of them are decomposers.
cell wall containing peptidoglycan.
It has a single circular chromosome of DNA (plasmids)
in addition to primary single chromosome.
Some are autotroph (photosynthetic or
chemosynthetic) and heterotroph (mutualistic, parasitic,
and saprophytic).
Examples:
 Cyanobacteria (blue green algae) has chlorophyll
(not chloroplast), and can make photosynthesis.
 Nitrogen fixing bacteria (mutualistic relationship
with plant).
 Streptococcus (cause sore-throat).
 E. coli (mutualistic relationship with human).

3
 Domain Archaea
prokaryotes (lacking nucleus and membrane bounded
organelles).
have chromosomal similarities with eukaryote (has
introns). includes extremophiles (organisms that
live in extreme environments:
 Methanogens: obtain energy by producing methane
from hydrogen.
 Halophiles: live in environment with high salt
concentration.
 Thermophiles: thrive in very high temperature.

Domain eukaryote
all organisms have nucleus and internal membrane
bounded organelles.
unicellular and multicellular.
include 4 kingdoms: Protista, fungi, plantae, animalia.

1)Kingdom Protista:
the widest variety of organisms.
some are Heterotroph, some are Autotroph.
unicellular and multicellular.
move by cilia, pseudopods, and flagella.
Protozoa is animal like Protista(heterotrophic) but
unicellular.

4
 Examples of protozoa: amoeba, paramecium.
also, algae are plant like Protista (photoautotroph,
cellulosic cell wall) but also unicellular
Examples of Algae: Giant kelp, euglena, and diatom.

2)Kingdom Fungi:
heterotrophs.
Decomposers that carry out extracellular digestion by
secreting hydrolytic enzymes outside the body and absorb
nutrients by diffusion(saprotrophic).
some fungi combine with Algae or cyanobacteria in
mutualistic relationship to form lichens (pioneer organisms
that can survive in harsh environments and even on bare
rocks and first to colonize in ecological succession.
Mycorrhizae are fungi found in roots of some plants having
mutualistic relationship.
some are parasitic that cause disease to their host. Like
Taenia and Athletes foot.
Penicillium is fungus that produce penicillin antibiotic.

5
 cell walls composed of chitin.
Yeast is the only unicellular fungus.
Reproduction:
 Asexual:
• Spore formation like bread mould.
• Budding like yeast.
 Sexual:
By conjunction (process by which 2 organisms
exchange DNA).

3)Kingdom Plantae:
multicellular.
Photoautotroph.
non-motile.
cell wall made of cellulose.
carbohydrates stored as starch.
alternation of generation: sexual reproduction generation
followed by Asexual reproduction.

4)Kingdom Animalia:
heterotrophic.
Multicellular.
No cell wall.
most reproduce sexually.
grouped into 35 phyla.

6
 Basics in animal’ classification

Tissues and Organs:

• Cell is the basic unit of all forms of life.
• Tissue is a group of similar cells that perform one
function.
• Organ is a group of tissues that work together to
perform related function.
• Some phyla consist only of cells, or tissues.

Germ Layers:
• Ectoderm: outermost layer, becomes skin and
nervous system.
• Endoderm: innermost layer, becomes viscera(guts)
or digestive system.
• Mesoderm: middle layer, becomes blood, muscles,
and bones.
 Animals are diploblast or triploblast according to
number of germ layers.

7
 Body Symmetry:

 primitive animals exhibit asymmetry, and radial

symmetry; sophisticated animals exhibit bilateral
symmetry.

Body Cavity:
 Coelom is a fluid-filled body cavity that is surrounded
by mesoderm tissue.
 Acoelomates: don’t have body cavity. They are
primitive.
 Pseudocoelomates: have fluid filled tube
between endoderm and mesoderm, and not
completely lined by mesoderm.
 Coelomates: have a coelom, and the most
complex.

8
 Cephalization
 it is the development of a head end (anterior) and
end (posterior).
 Simple animals do not have a head end.
 More sophisticated animals show cephalization.

Body Segmentation
 Some animals are segmented, some are not
segmented.

Nerve cord
 primitive animals have no Animals with no nerve
cord.
 Animals with ventral nerve cord others with
dorsal nerve cord.

Embryonic development
 In Protostome animals, mouth opening
appeared first, followed by anus.
 In Deuterostome animals, anus opening
appeared before mouth.

9
Animal phylum classification

10
 Porifera:
 no symmetry.
 sessile.
 only specialized cells but no true tissues.
 filter nutrients from water into central cavity.
 Ex: Sponges

Cnidarians:
 radial symmetry.
 only tissues.
 diploblast
 some are sessile and have polyp body plan (vase
shape) like Hydra, some are motile and medusa
body plan like
Jelly fish.
 all members have stinging cells.

11
 Platyhelminthes (Flatworms):
 bilateral symmetry.
 triploblastic.
 Acoelomate.
 flat body.
 body cells exchange nutrients and waste by
diffusion.
 Ex: tapeworms, and planaria.
 Excrete nitrogenous wastes by primitive flame
cells.

Nematodes (Round worms):

 Pseudocoelomate.
 Triploblastic.
 bilateral symmetry.
 unsegmented worms.
 parasitic.
 It has exoskeleton
formed from cuticle
 Ex: Ascaris

12
 Annelids (segmented worms):
 bilateral symmetry.
 triploblastic.
 segmented body.
 Coelomate.
 Diffusion of oxygen and carbon dioxide through
moist skin.
 Nephridia for excretion of the nitrogen wastes(urea).
 closed circulatory system.
 hermaphrodites (carry both sex
organs).
 Ex: leeches, and earthworms.

13
 Molluscs:
 have soft body covered with a hard calcium-
containing shell. Ex: snail, oyster, clam and mussel.
 octopuses, and squids lack outer shell.
 open circulatory system with blood-filled spaces
called hemocoels.
 bilateral symmetry.
 have 3 body zones:
• a-Head-foot: contain sensory and motor
organs.
• visceral mass: contain organs of digestion,
excretion, and reproduction.
• Mantle: specialized tissue surrounds visceral mass
and secrete shell.
 excrete through nephridia.
 gas exchange through gills.

14
 Arthropods:
 most diverse phylum.
 have compound eyes.
 joined appendages.
 segmented into head, thorax, and abdomen.
 chitinous exoskeleton protect the animal body.
 open circulatory system.
 Malpighian tubes (digestive tract) remove
nitrogenous wastes (uric acid).
 respiration by air duct (trachea).

Echinoderms:
 most are sessile.
 bilateral symmetry as an embryo, and radial
symmetry as an adult.
 spiny skin.
 water vascular system, and tube feet for
moving.
 reproduce sexually with external fertilization,
and asexually with fragmentation.

15
 Ex: sea star (star fish), sea urchin.

Chordates:
 have dorsal nerve chord.
 closed circulatory system.
 Endoskeleton.
 have gills or pharyngeal pouches.
 most are vertebrates (have vertebral column
and skulls).
 include:
• Cartilaginous fish. Ex: shark.
• Bony fish.
• Amphibians.
• Reptiles.
• Birds (Aves).
• Mammals.
 birds and mammals are worm-blooded or
Homeotherms (Endotherms).

16
 fish, amphibians, and reptiles are cold-blooded
(Exotherms).
 vertebrate skeleton is cartilage or bones.
 kidneys excrete nitrogenous wastes (urea in
mammals, uric acid in birds and reptiles).
 all are tetrapod (4 limbs) except fish.

17
 Mammals

mothers nourish their babies with milk from

mammary glands.
covered with hair or fair.
4 chambered hearts.
most are placental (embryo develops internally
and receive nutrients through placenta). Ex: bats,
dolphins, seals, bears, raccoons, cats, giraffes,
whales, horses, and humans.
some are marsupials or pouched (born early
and complete development in mother pouch). Like
kangaroos, koala, opossum.
others are monotremes (egg laying mammals).
Like duckbilled platypus, and spiny anteater.

18
 Primates
Primates (including humans, monkeys,
chimpanzees) are only mammals that features:
large, complex brain.
Forward facing binocular eyes.
Grasping hands.
Oppose thumb.
Nails instead of claws.
Fewer offspring, and more time caring for them.

19
20
21
22
 Taxonomy
Practice 1
Questions 1–9
Refer to the terms below.
(A) Prokaryotes
(B) Fungi
(C) Plants
(D) Animals
(E) Protista
1. Contains the most diverse eukaryotic organisms
2. Heterotrophs whose cell walls consist of chitin
3. Included in the domain Bacteria
4. Heterotrophs that reproduce sexually with a
dominant diploid stage
5. All are autotrophic eukaryotes
6. The Archaea domain includes these
7. The heterotrophic part of any lichen
8. Includes amoebas, paramecia, and euglenas
9. Eukaryotic cells that play a vital role in recycling
nutrients in an ecosystem
________________________________________
10. All of the following are true of Protista EXCEPT
(A) all are heterotrophs
1
(B) all are eukaryotes
(C) they include amoeba, paramecia, and euglena
(D) some move by pseudopods, some by cilia, and
some by flagella
(E) they include the widest variety of organisms of any
kingdom

11. Which of the following contains organisms capable

of surviving extreme conditions of heat and salt
concentration?
(A) Archaea
(B) Animalia
(C) Protista
(D) Fungi
(E) Plants

Questions 12–17
Refer to this list of animals below.
(A) Platyhelminthes
(B) Nematodes
(C) Chordates
(D) Echinoderms
(E) Cnidarians
12. Roundworms, all are parasites
2
13. Includes the flatworm planaria
14. Jellyfish and hydra
15. All organisms in the phyla contain stinging cells
16. Include mammals
17. Include monotremes and marsupials
________________________________________

18. All of the following are characteristics of primates

EXCEPT
(A) opposable thumbs
(B) front-facing eyes
(C) nurture their young for a long time
(D) examples are dolphins and whales
(E) usually have single births

19. The ectoderm becomes the

(A) nervous system
(B) digestive organs
(C) blood
(D) bones
(E) muscles

20. The endoderm becomes the

3
(A) skin
(B) digestive organs
(C) blood
(D) bone
(E) muscle

Questions 21–33
(A) Hydra
(B) Grasshopper
(C) Earthworm
21. The body plan is a polyp
22. Has an open circulatory system
23. Has a closed circulatory system
24. Has no circulatory system
25. Nervous system consists of a nerve net
26. Exchange of respiratory gases is through the moist
skin
27. Uses its digestive tract to release nitrogenous
wastes
28. Uses nephridia to remove nitrogenous wastes
29. All the members of this phylum have stinging cells
30. This animal has a transport system but lacks
capillaries

4
31. Every cell in this animal is directly in contact with its
environment
32. Exchanges respiratory gases through hemocoels
33. Sessile

Questions 34–38
(A) Uric acid
(B) Urea
(C) Ammonia
34. Most toxic
35.Excreted by humans and earthworms
36.Excreted by the digestive tracts of insects and birds
37.Excreted by the Malpighian tubules
38. Excreted by nephridia

39. All of the following are correct about animal systems

EXCEPT
(A) the hydra has a two-way digestive system
(B) earthworms are hermaphrodites
(C) grasshoppers use their digestive tract to remove
nitrogenous waste
(D) the nitrogenous waste from the earthworm is uric
acid
(E) the grasshopper has chitinous plates in the
5
6
 Taxonomy
Practice 2
1) Which of the following contains organisms is
capable of surviving extreme conditions of heat
and salt concentration?
A.Archaea
B. Animalia
C.Protista
D.Fungi
E. plants

2) Which of the following exhibits internal

fertilization, external development of the embryo,
few eggs, and much parenting?
A.Mammals
B. Amphibians
C.Reptiles
D.Birds
E. Fish

Questions 3 to 5 …
Choose from the list of terms below:
A. Cnidarians
B. Chordates
C. Annelids
D. Roundworms
E. Flatworms
3) Radial symmetry
4) Two cell layers thick
1
5) Three cell layers thick and acoelomates

6) All of these are characteristics of primates EXCEPT:

A.have opposable thumbs
B. possess binocular vision
C.have fewer offspring
D.presence of claws
E. have larger brains compared to body size

7) A cross section was taken from the unknown species

which is shown below. What type of body cavity is
found in this living organism?

A. pseudocoelomate
B. coelomate
C. acoelomate
D. gastrula
E. blastula

A scientist discovered a new species and was unsure

how to classify it, so she decided to undergo thorough
observation accompanied by some experiments to have
a clear idea of the species. The results of her

2
 observations and her experiments are found in the table
below.
Observation/experimentation Result
Symmetry bilateral symmetry
circulatory system closed circulatory
system
excrete wastes through nephridia
body segmentation present
8) In which of the following phyla could this living
organism be placed in?
A. Porifera
B. Cnidarian
C. Annelida
D. Mollusk
E. Arthropod

9) When an animal sheds its exoskeleton, it will be

vulnerable to predation. Which of the following
correctly identifies an advantage of an internal
skeleton over an external skeleton?
A.An internal skeleton supports the animal better
B. An external skeleton can dissolve easily in wet
climates
C.An external skeleton doesn’t grow with the
animal’s body
D.The internal skeleton prevents infections better
than an external one
E. Animals with external skeletons are not as
successful as animals with internal

3
10) Eukaryotic organisms that play an important
role in recycling nutrients are
I. Protists
II. Fungi
III. Plants
IV. Bacteria
A.I only
B. II only
C.I and III
D.II and IV
E. I II and IV

11) The binomial nomenclature system is defined by

A.Two names: the first one is capitalized and refers to
the genus and the second name begins with a small
letter and refers to the species.
B. Two names: the first one is capitalized and refers to
the species and the second name begins with a small
letter and refers to the genus.
C.Two names: the first one begins with a small letter and
refers to the genus and the second name is capitalized
and refers to the species.
D.Two names: the first one refers to the genus and the
second name refers to the species; both names are
written with small letter.
E. Two names: the first one refers to the genus and the
second name refers to the species; both names are
capitalized.

12) Scientists discovered a new unknown species. This

species belongs to the animal kingdom. It is about 7cm

4
 in length. It crawls without limbs and has a closed
circulatory system. Which of these phyla has the most
common characteristics with this animal?
A.Platyhelminthes
B. Nematoda
C.Annelida
D.Mollusk
E. Arthropoda

13) All of the following are true about fungi EXCEPT:

A.The cell walls are made up of chitin.
B. They can cause a health condition called the
Athlete’s foot.
C.They are considered eukaryotic organisms.
D.They are autotrophs.
E. Most of them are multicellular.

Questions 14 to 16 …
A.Nephrons
B. Nephridia
C.Malpighian tubules
D.Flame cells
E. Kidneys
14) It is responsible for excreting urea from earthworms.
15) It is the most primitive structure or organ of excretion.
16) It is responsible for excreting uric acid in insects.

17) Which of the following is the most inclusive

taxonomic category?
5
(A) Order.
(B) Phylum.
(C) Kingdom.
(D) Class.
(E) Species.

18) Which of the following is NOT members of the

Arthropoda
(A) Grasshopper
(B) Lobsters
(C) Centipedes
(D) Earthworm
(E) Spiders

19) An earthworm and a snake both possess which of

the following characteristics?
(A) Radial symmetry
(B) Dorsal tubular nervous system
(C) Closed circulatory system
(D) Chitinous exoskeleton
(E) Scales

20) mushroom is most like a

6
(A) Moss
(B) Fern
(C) Yeast
(D) Pine
(E) Seaweed

21) An organism appears to be a segmented worm.

Upon observation it is determined that the organism has
a closed circulation, a mouth and an anus, and does
NOT have an exoskeleton. The organism most likely
belongs to phylum
(A) Mollusca
(B) Annelida
(C) Echinodermata
(D) Arthropoda
(E) Chordata

22) Which of the following correctly lists the phytogenic

hierarchy?
(A) Kingdom, phylum, family, class, order, genus,
species
(B) Phylum, family, order, class, kingdom, species,
genus
(C) Kingdom, family, order, class, phylum, genus,
species

7
(D) Kingdom, phylum, class, order, family, genus,
species
(E) Family, kingdom, order, phylum, genus, class,
species

23) A eukaryotic cell that has a cell wall but lacks

chloroplasts would be classified as a
(A) Monera
(B) Chordate
(C) Plant
(D) Fungus
(E) Bacteria

Questions 24 to 28 …
(A) Hydra
(B) Grasshopper
(C) Earthworm
24) The body plan is a polyp
25) Has an open circulatory system
26) Has a closed circulatory system
27) Has no circulatory system
28) Nervous system consists of a nerve net