Fish and Shellfish Immunology 130 (2022) 624–634

Contents lists available at ScienceDirect

Fish and Shellfish Immunology

journal homepage: www.elsevier.com/locate/fsi

Full length article

Fish immune responses to natural infection with carp edema virus (Koi
sleepy disease): An emerging fish disease in India
K.B. Kushala a, 1, M.S. Nithin a, 1, S.K. Girisha a, *, S.B. Dheeraj a, N.S. Sowndarya a, T.G. Puneeth a,
T. Suresh a, B.T. Naveen Kumar b, **, T.N. Vinay c
a
College of Fisheries, Karnataka Veterinary, Animal and Fisheries Sciences University, Matsyanagar, Mangalore, 575002, Karnataka, India
b
College of Fisheries, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, 141004, Punjab, India
c
Indian Council of Agricultural Research, Central Institute of Brackishwater Aquaculture, MRC Nagar, Chennai, Tamil Nadu, 600028, India

A R T I C L E I N F O A B S T R A C T

Keywords: Emerging pathogen, carp edema virus (CEV) causes koi sleepy disease (KSD) in Koi and common carp causing
Carp edema virus severe mortalities worldwide. In the present study, a total of 150 fish species belonging to eight different families
Koi sleepy disease were sampled from the ornamental fish retailers and farms, located in Karnataka, India. The OIE protocol viz.,
Koi
level-I, II and III diagnoses confirmed the infection of CEV in 10 koi fish. Interestingly, other fish species
Natural infection
Immune response
belonging to different fish family including cyprinidae family were negative to CEV. Further, CEV infection was
Immune related genes confirmed by sequencing (partial 4a gene); it showed the similarity with that of CEV reported from India and
Germany strains with similarity of 97.4–99.94% and belonged to genogroup IIa. TEM analysis of purified CEV, in
vivo cohabitation and tissue infection experiments confirmed the CEV infection. In addition, viral load was
significantly higher (106− 7 copies) in koi collected from Dakshina Kannada than of Bengaluru (103− 4 copies). To
understand the host–pathogen interaction, different organs such as gill, kidney, liver and spleen from naturally
(CEV) infected koi were used to study the immune gene responses by using eight innate and one adaptive im­
mune response. Results indicated that TNF-α, RohTNF-α, iNOS, IFN-γ and IL-10, and catalyze β-2M of MHC class I
pathway genes were upregulated in koi. Higher expression of immune genes during the CEV infection may have
inhibited viral replication and mount an antigenic adaptive response. Similar to other viral infections, interferon-
γ play an important role during poxvirus infections. Quantification of immune genes in infected fish will provide
insights into the host responses and provide valuable information to devise intervention strategies to prevent and
control disease due to CEV.

1. Introduction hemorrhagic disease (GCHD), and herpes viral haematopoietic necrosis

(HPHN) [1,4,5].
Cyprinids widely contribute to freshwater aquaculture production Recently, carp edema virus disease (CEVD) which also known as Koi
worldwide and Koi (Cyprinus carpio var. koi) is one of the most important sleepy disease (KSD) caused by carp edema virus (CEV) has been re­
tropical ornamental fishes traded internationally [1]. Farming of Koi has ported from Koi cultured in India [6,7]. CEV is caused by the Poxvirus, a
suffered due to various pathogenic bacteria, fungi, parasites and virus DNA virus belonging to the family Poxviridae. This disease was first
[2]. Among these, viruses cause acute mortality in cultured koi fish reported from Koi in Japan (1970) [8,9]. Subsequently, the disease has
around the globe [3]. Koi are prone to viral diseases such as Koi sleepy been reported from several European and Asian countries [4,10–16].
disease (KSD), Koi herpesvirus disease (KHVD), carp pox disease (CPD), The clinical signs of CEV are anorexia, lethargy, ulcerous lesions,
spring viraemia of carp (SVC), Koi ranavirus (KIRV), grass carp skin erosions, exophthalmos and gill necrosis which resemble those

* Corresponding author. Department of Aquatic Animal Health Management, College of Fisheries, Karnataka Veterinary, Animal and Fisheries Sciences University,
Matsyanagar, Mangalore, 575002, Karnataka, India.
** Corresponding author. Department of Aquatic Environment, College of Fisheries, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab,
141004, India.
E-mail addresses: skgirisha@cofm.edu.in (S.K. Girisha), naveenkumar@gadvasu.in (B.T. Naveen Kumar).
1
contributed equally.

https://doi.org/10.1016/j.fsi.2022.09.012
Received 16 February 2022; Received in revised form 5 September 2022; Accepted 6 September 2022
Available online 17 September 2022
1050-4648/© 2022 Elsevier Ltd. All rights reserved.
K.B. Kushala et al. Fish and Shellfish Immunology 130 (2022) 624–634

observed in the course of infection with koi herpes virus (CyHV-3) [4,6, 2.2. Level-2 diagnosis: histopathology of naturally infected Koi with CEV
10,12,17,18]. CEV is considered as an emerging threat to the koi in
global ornamental trade, because of its wide distribution and potential The formalin fixed tissue samples were dehydrated in different
virulence [5,19–22]. Since, it is not possible to culture the virus in vitro concentration of ethanol in ascending order and were embedded in
in existing cell lines, a rapid diagnostic technique based on nucleic acids paraffin wax. The tissues were sectioned by using microtome
is required to prevent and control the spread of infection and disease (MicromHM325, ThermoScientific, USA) with the thickness of 5 μm and
outbreak [4,23]. they were stained by hematoxylin and eosin. Dehydrated and cleaned
CEV can be detected by using CEV-specific DNA sequences by PCR or sections were then mounted in DPX (Himedia, India) to the stained
by means of transmission electron microscopy to detect the viral parti­ tissue on glass slide and observed histological changes using light
cles [20]. Till date sequencing of the partial 4a (a putative major core microscope.
protein) has been used to differentiate the 2 main lineages of CEV [19].
Way and Stone [10,19] reported that CEV lineage 1 from Koi which is
2.3. Level-3 diagnosis: molecular diagnosis for CEV
more similar to original Japanese CEV and lineage 2 from common carp.
Recently, three genogroups were reported such as CEV genogroup I,
DNA was extracted according to PCIA method [30] with minor
which affect common carp in Europe, CEV genogroup IIa affects Koi in
modifications. PCR was performed in 30 μl of reaction mixture with 2.0
Asia as well as in Europe and CEV genogroup IIb affects both Koi and
μl of template DNA, 1 × assay buffer (10 mM Tris –HCl, pH 9.0; 1.5 mM
common carp in Europe [4,20,22,24].
MgCl2,50 mM KCl, 0.01% Gelatin), 200 μM of each deoxyribonucleotide
The disease occurs naturally in Koi at water temperature between 15
triphosphates (dATP, dCTP, dTTP, dGTP), 10 pM of forward (B–F2:
and 25 ◦ C. The mortality rate ranges from 75 to 100% in juvenile Koi. At
5′ GTTATCAATGAAATTTGTGTTG3′ ) and reverse primer (J-R2:
higher temperatures fishes initially exhibit lethargic behavior followed
5′ TAGCAAAGTACTACCTCATCC3′ ) of partial 4a gene [19] and 1U of
by death within 2–3 days [6,12,17]. Recently, CEV in common carp and
Taq DNA polymerase (Genei, Bangalore). The cycling conditions in­
Koi has also been reported at lower water temperatures between 7 ◦ C
cludes initial denaturation at 95 ◦ C for 5 min, followed by 35 cycles of
and 15 ◦ C (44–59 ◦ F) in Austria [13].
95 ◦ C for 1 min, at 55 ◦ C for 1 min, at 72 ◦ C for 1 min, and the final
So far, very less information is available on the innate (non-specific)
extension at 72 ◦ C for 10 min. PCR was carried out in Eppendorf ther­
and adaptive (specific) immune response of the host against CEV
mocycler and the product was run on an agarose gel with 100 bp DNA
infection. The innate immunity is the first line of defense against
ladder (Genei, Bengaluru) and the band was visualized under UV trans
spreading of the pathogen after its invasion into the body than the
illuminator (BIORAD, USA).
adaptive immunity [25,26]. The early innate immune response of fish
against viruses is by the mucosal-epithelial barrier along with the pro­
duction of antiviral cytokines, interferons (IFNs) [27,28]. It was re­ 2.4. Confirmation of CEV infection in the suspected fish samples
ported that there was a decrease in gene expression of mucins in CEV
infected fish which acts as a physical barrier against the pathogens [29]. 2.4.1. Sequencing of CEV positive PCR products and construction of
Previous studies have indicated that CEV infection in Koi resulted in phylogenetic tree
upregulation of interferons (IFNs) [20]. Due to lack of studies related to The CEV positive PCR product of partial 4a gene was purified by
gene expression after CEV infection in Koi, information about the standard purification kit (Hipur A Himedia). Purified PCR products were
mechanisms that allows CEV to evade the host immune system is sequenced by using Sanger’s method at the Bioserve Biotechnologies (I)
scarcely available [4]. Pvt. Ltd, Hyderabad, India. Obtained sequence results were analyzed by
To the best of our knowledge, only few studies are available related using BioEdit sequence alignment editor software (V7.0.5.2). Sequences
to Koi emphasizing immune gene response to natural CEV infection were aligned by using Multialign online programmer. The aligned se­
through the screening of host immune related genes. Therefore, in order quences were analyzed using Basic Local Alignment Search Tool
to improve the knowledge on the mechanisms at the basis of the host- (BLAST) [31]. Phylogenetic tree was constructed by using MEGA X
virus interactions with a particular attention to viral load, virus visual­ version 10.0.5 software by neighbor joining method with the bootstrap
ization, histological, phylogenetic analysis, and host immune response value of 1000 replicates.
have been performed in the present study against naturally infected Koi
with CEV. Thus, our study provides the initial information for the po­ 2.4.2. Transmission electron microscopy of purified CEV
tential innate and adaptive immune mechanisms, pathogenesis and host The PCR confirmed CEV infected fish gill samples were collected
response to naturally induced CEV infection. aseptically and homogenized with PBS (phosphate buffer saline, pH-7.4)
buffer at 1:10 ratio in centrifuge tube. The mixture was centrifuged at
2. Materials and methods 4000 g for 10 min at 4 ◦ C.The supernatant was filtered through 0.45 μm
nylon membrane filter. The filtrate was subjected to ultracentrifugation
2.1. Screening of CEV suspected fish samples through standard OIE at 36,000 g for 40 min at 4 ◦ C. Then the pellet was washed with
diagnosis protocol ammonium acetate twice and sample was subjected to transmission
electron microscopy (Technai G2 T12 BioTwin, TEM, Hillsboro, USA) at
Ornamental fish samples were collected from retailers and farms IISc, Bengaluru, Karnataka, India.
located in and around Dakshina Kannada and Bengaluru, Karnataka,
India. Samples were shipped to the laboratory in refrigerated condition. 2.4.3. CEV experimental infection study
A total of 150 fish samples were collected during 2018–2020, level-I
diagnosis such as clinical examination at farm and at laboratory was 2.4.3.1. In vitro CEV study. Briefly, Danio rerio gill (DRG) fish cell line
carried out. Further, fish were dissected and organs like kidney, liver, obtained from National Repository of Fish Cell Line (NRFC), ICAR-
spleen and gills were separated and preserved in 10% buffered formalin NBFGR, Lucknow, India was used. Monolayer DRG fish cell lines was
for level-2 diagnosis (histopathology). Some portions of the tissues grown in 25 cm2 flask (Cell star, Greiner Bio-One, Austria) with L-15
(pooled tissues) obtained from the previously mentioned dissected or­ media supplemented with 10% FBS and 1X antibiotic antimycotic so­
gans were also preserved at − 80 ◦ C for DNA (level-3 diagnosis) and RNA lution (Himedia, India). In vitro study was conducted according to Jung-
extraction. The samples were screened for all the OIE listed pathogens Schroers et al. [12]; Lewisch et al. [13]. Tissue samples of CEV infected
including CEV by PCR. Koi gill with high viral load (n = 5) were pooled and homogenized in 10
ml of L-15 medium and centrifuged at 8000 х g for 20 min. The

625
K.B. Kushala et al. Fish and Shellfish Immunology 130 (2022) 624–634

supernatant was filtered through 0.45 μm filter (PALL Life Sciences, − 80 ◦ C prior to RNA extraction and PCR analysis. From the stored tissue
Acrodisc® Syringe filter, New York) and used for in vitro infections. The samples, total RNA was extracted using RNA express kit (Himedia). RNA
filtrate (0.5 ml) was inoculated in a 5 ml flask of monolayer DRG cells for concentration and purity were analyzed using a nanodrop spectropho­
2 h, and the medium was replaced with fresh L-15 medium supple­ tometer (Thermo Scientific, USA), and quality was checked using 1%
mented with 2% FBS and 1X Antibiotic Antimycotic solution. One flask agarose gel containing 0.5 μg/ml ethidium bromide. A total of 1 μg of
was used as negative control without virus. The flasks were then incu­ total RNA was treated with DNase I solution (Himedia, India) to remove
bated at 25 ◦ C and observed under a microscope daily for 10 days to the single and double stranded DNA fragments. Then, complementary
monitor the cytopathic effect (CPE). DNA (cDNA) was synthesized using cDNA synthesis kit (PrimscriptTM
RT Reagent Kit, Takara, Japan).
2.4.3.2. In vivo CEV study To analyze each gene transcription, 1 μl of each cDNA synthesis re­
2.4.3.2.1. Cohabitation experiments. Cohabitation experiment was action was used as the template in the qPCR reactions. Primers used for
performed with healthy Koi (n = 10, triplicates) with average body gene expression are specified in Table 1 [33–38]. qPCR amplifications of
weight 10.5 ± 1.2 g. They were cohabitated at 24–26 ◦ C with the each gene primers were performed in a final volume of 10 μl for each
naturally affected CEV Koi (n = 2) in a 50 L tank supplied with a constant organ for naturally CEV infected and uninfected fishes. Reaction mixture
aeration. Ten healthy fishes were kept as negative control in separate contained 5 μl of SYBR Green Supermix (TB Green ® Premix Ex TaqTM
tanks with similar conditions. Fishes were monitored daily for mortality II, Takara, Japan), 0.5 μl of each primer set (2.5 mM), 1 μl of template
and the presence of any clinical symptoms of CEV infection. cDNA and 3.0 μl of DEPC-water. qPCR was performed in triplicate in
2.4.3.2.2. Tissue infection experiments. Naturally infected CEV Koi 96-well PCR plates and carried out in Step one plus Real-Time PCR
gill arches were cut into four pieces and then transferred to the tanks of System (Applied Biosystems, USA) with an initial denaturation cycle of
healthy Koi (n = 10, triplicates). Ten healthy fishes were kept as nega­ 95 ◦ C for 30 s, followed by 40 cycles of 95 ◦ C for 5 s and 60 ◦ C for 30 s.
tive control in separate tanks with above similar conditions. Fishes were Standard melting curve from 55 ◦ C to 95 ◦ C with increments of 0.5 ◦ C for
monitored daily for mortality and the presence of any clinical symptoms 5 s at each step was carried out to confirm the single amplicon. Each of
of CEV infection. the qPCR reaction was performed in triplicates. Samples were run in
parallel with two reference genes, β-actin and EF1α, for cDNA normal­
ization. Relative mRNA expression was calculated using the 2− ΔΔCT
2.5. Estimation of CEV load in the naturally infected koi fish gill tissue
method [39], normalizing with geometric average of reference gene
through qPCR
(β-actin) and relative to control group.
Gill tissue samples were collected from naturally CEV infected Koi
2.7. Statistical analysis
(ten CEV positive samples) and DNA was extracted and stored at − 80 ◦ C
till further use. Standard curve to quantify the CEV load in the tissue was
Data were analyzed using the SPSS16 (SPSS Inc., Chicago, IL, USA)
carried out according to Adamek et al. [20,32]. After establishing the
statistical software. Data were tested by analysis of variance (ANOVA) to
standard curve using standard protocol (Supplementary Fig. 1), amount
determine the differences in mean among different group, and compared
of DNA in each sample was quantified and expressed as number of
with posthoc multiple comparison using Duncan’s multiple range test.
copies/reactions.
Differences of means among the groups were considered statistically
significant when p < 0.05. Data were collected, analyzed and all the
2.6. Immune genes expression study through quantitative PCR (qPCR) graphs of immune genes were plotted using GraphPad Prism5 software.

After confirmation of CEV infection in the samples, the immune gene

study was conducted from the different tissue samples (gills, spleen,
liver and kidney) of CEV infected and CEV negative Koi from Dakshina
Kannada, Karnataka, India. These samples were immersed separately in
1 ml RNA-later (Takara, Japan), kept at 4 ◦ C for 24 h and stored at

Table 1
Functional gene, primer name and sequence of genes of interest and the reference genes.
Sl. No. Gene Functional gene Primer name Sequence (5′ -3′ ) Amplicon length (bp) Annealing temp. (◦ C) Reference

1 IL-1 β Interleukin 1 beta IL-1b-F AAC CTG TAC CTG GCC TGT TG 227 60 [33]
IL-1b-R ATC TCC ACC ATC TGC GAA TC
2 TNF-α Tumour necrosis factor TNFα-F ACCAGGCCTTTTCTTCAGGT 303 60
TNFα-R TGCCCAGTCTGTCTCCTTCT
3 iNOS Inducible nitric oxide synthase iNOS-F GGAGATGCAAGGTCAGCTTC 137 60
iNOS-R GGCAAAGCTCAGTGACTTCC
4 IFN - γ Interferon (IFN) - γ IFN - γF TGTGTTCCTCAACAGACACC 168 61.5 [34]
IFN - γR TGGAGAAACAGTTGACTCATGTG
5 TGF-β Transforming growth factor-β TGF-βF ACGCTTTATTCCCAACCAAA 95 60.5 [35]
TGF-βR GAAATCCTTGCTCTGCCTCA
6 IL-10 Interleukin 10 IL-10F CGCAGTGCAGAAGAGTCGAC 308 61.5 [36]
IL-10R CCCGCTTGAGATCCTGAAATAT
7 IL-12p40 Interleukin12p40 IL-12p40F TCTTGCACCGCAAGAAACTATG 125 53
IL-12p40R TGCAGTTGATGAGACTAGAGTTTCG
8 RohTNF-α Tumour necrosis factor rohTNF-F CCAGGCTTTCACTTCAGG 181 51.6 [37]
rohTNF-R GCCATAGGA ATCGGAGTAG
9 β-2 M β2-microglobulin β-2 M-F TCCAGTCCCAAGATTCAGGTG 175 59.7
β-2 M-R TGGTGAGGTGAAACTGCCAG
10 β-actin House-keeping gene β-actinF GACTTCGAGCAGGAGATGG 138 55.3
β-actinR CAAGAAGGATGGCTGGAACA
11 EF1 α Elongation factor EF-1 αF CAATTTCTGGATGGCACGGTGAC 128 60 [38]
EF-1 αR GGCATCCAGGGCATCAAGAAGAG

626
K.B. Kushala et al. Fish and Shellfish Immunology 130 (2022) 624–634

3. Results CEV in the collected fish samples. Further, the PCR product was purified
and sent for sequencing for confirmation. However, other fish species
3.1. Level − 1 diagnosis: clinical examination belonging to different families including cyprinidae family were nega­
tive to CEV.
Out of 150 fish belonging to family of Cyprinidae (81), Cichlidae
(25), Poeciliidae (21), Osphronemidae (6), Pangasiidae (6), Characidae 3.4. Sequencing and phylogenetic tree analysis of 4a partial gene
(6), Melanotaeniidae (3), Lorocariidae (2), only ten Koi samples were
showing sleepy behavioral signs (supplementary videos attached) 3.4.1. Sequencing and phylogenetic tree analysis of 4a partial gene
(Supplementary Fig. 2 and Table 2), abnormal swimming behavior Sequence analysis of the four purified PCR products were identical to
(whirling), swollen gills, enophthalmia, vasocongestion of the caudal the reference CEV from NCBI database. NCBI–BLAST analysis of
fin, ulceration of anus and sleeping in the bottom of the tank (Supple­ sequenced PCR products was 97.4 and 99.44% similar to CEV strains
mentary Fig. 3 A and B). Further, excess mucous production in gill and from India (MN519198.1) and Germany (KY550438.1) respectively.
rupture of internal organs like kidney, liver, spleen was observed Based on the sequence results, a phylogenetic tree was generated (Fig. 3)
(Supplementary Fig. 2C and D). No parasites were observed over the by using neighbor-joining method. This analysis involved 41 nucleotide
microscopic examination of gills wet mounts. sequences, of which, 4 were from present study and 37 from NCBI
reference GenBank. In the phylogenetic analysis, it was found that the
3.2. Level-2 diagnosis: histopathology of CEV infected Koi CEV strain that was detected in Karnataka belonged to the genogroup IIa
as it was showing close relatedness for the Koi CEV strains isolated from
Histopathology of CEV infected Koi was showing edema of epithelial India (MN519198.1) and Germany (KY550438.1) (Fig. 3). All the four
cells at secondary lamellae and hyperplasia of gill lamella. The epithelial nucleotide sequences of the PCR product were submitted to NCBI Gen­
cells were detached and necrosis of gill lamellae was observed. Mono­ Bank with accession number CEV24 (OK318990), CEV 145
nuclear cells present with a few eosinophilic granular cells and eryth­ (MZ662081), CEV 85 (SUB2475974), and CEV 86 (SUB2475976).
rocytes in inter lamellar region of affected gill tissue (Fig. 1A). Kidney
tissue shows vacuolization and degeneration in epithelial cells of renal 3.4.2. Transmission electron microscopic (TEM) examination of purified
tubules and infiltration of inflammatory cells, hyperemia and multifocal CEV from infected gill tissue
necrosis (Fig. 1B). Various melanomacrophage centers, vacuolation, TEM analysis showed a spherical and dense image of virus. The pu­
necrotic eosinophils and disruption to splenic architecture were rified virus particles had a surface membrane with the globular units. It
observed in the spleen (Fig. 1C). Liver tissue showing a cytoplasm measures about 150–200 nm (Fig. 4). It confirms the shape and size of
vacuolization with numerous multiple basophilic cells and liver sinus the carp edema virus belonging to the genus Poxvirus and family
with few blood cells around the hepatic vessels were observed (Fig. 1D). Poxviridae.

3.3. Level-3 diagnosis: molecular diagnosis for CEV 3.4.3. CEV experimental infection study

Ten Koi were found to be positive for CEV in PCR assay by amplifying 3.4.3.1. In vitro CEV study. Cytopathic effect was not observed even
the single 478 bp band (Fig. 2; Table 3). This confirmed the presence of after 15 days of post-infection (dpi) and subsequent two to three pas­
sages in the CEV infected DRG cell lines.
Table 2
Collected ornamental fishes for screening of carp edema virus. 3.4.3.2. In vivo CEV study
Sl. Name of the Representative sample No. of Total no. of
3.4.3.2.1. Cohabitation experiments. Koi started to show lethargy
No. family samples samples and sleepy behaviour after 2 days of cohabitation. Further, fish showed
mortality on the 4th day and it continued for 12 days with high mortality
1 Cyprinidae Gold fish (Carassius 43 81
auratus) observed on day 7 (Fig. 5).
Koi carp (Cyprinus carpio 28 3.4.3.2.2. Tissue infection experiments. After 6 days, Koi started
koi) showing sleepy behavior followed by mortality from day 8 and it peaked
Barbs (Puntius sp) 6
on day 15. Complete mortality was observed after 26 days of post-
Zebra fish (Danio rerio) 4
2 Cichlidae Angel fish (Pterophylum 11 25 infection.
sp) Both cohabitated and tissue infection experiments of Koi were found
Oscar fish (Astronotus 5 to be positive to CEV in PCR assay. The koi fish which were used as the
ocellatus) negative controls, did not show any morbidity or mortality and found
Cichlid morph (Maylandia 4
negative to CEV in PCR assay (Fig. 5).
sp)
Discuss fish (Symphosodon 5
sp) 3.5. Estimation of CEV load in the naturally infected koi fish (gill tissue)
3 Poeciliidae Guppy (Poecilia reticulata) 4 21
through qPCR
Molly (Poecilia sphenops) 11
Platy (Xiphophorus sp) 6
4 Osphronemidae Gourami (Trichopodus sp) 3 6 Viral load was ranging between 103 to 106− 7 copies per 126 ng of
Fighter fish (Betta 3 isolated DNA (Table 3). The highest viral load (106− 7 copies per 126 ng
splendens)
of DNA) was observed in fish samples of Dakshina Kannada followed by
5 Pangasiidae Iridescent shark 6 6
(Pangasianodon Bengaluru (below 104 copies per 126 ng of DNA). The negative control
hypophthalmus) of DNA template of Koi which is not affected by CEV and the negative
6 Characidae Tetra (Gymnocorymbus sp 6 6 control for the master mix have excluded potential false negative results.
and Nematobrycon sp)
7 Melanotaeniidae Rainbow fish 3 3
(Melanotaenia sp) 3.6. Immune genes expression study through quantitative PCR (qPCR)
8 Lorocariidae Sucker cat fish 2 2
(Hypostomus sp) Nine immune genes (IFN-γ, TNF-α, RohTNF-α, TGF-β, IL-10, IL-1β,
Total 150 150
IL-12p40, iNOS and β-2M) were used to study the gene expression in

627
K.B. Kushala et al. Fish and Shellfish Immunology 130 (2022) 624–634

Fig. 1. А. Histopathological changes in naturally CEV infected koi fish in

different organs at 400 × magnification.
A. Gill of naturally CEV infected Koi. The edema of epithelial cells at secondary
lamella, hyperplasia of gill lamella (sky blue and pink arrow), necrosis of
epithelial cells (blue arrow), and gill lamella (pink arrow). Mononuclear cells
(green arrow) present with a few eosinophilic granular cells (red arrow), and
erythrocytes in the interlamellar region of affected gill tissue.
B. Kidney tissue shows vacuolization, degeneration in epithelial cells of renal
tubules (green arrow), infiltration of inflammatory cells, pyknotic cells, and
hyperemia (black arrow).
C. Spleen tissue of Koi showing numerous melanomacrophage centre (sky blue
arrow), vacuolization (black arrow), blurry white (white arrow) and red pulps
(red arrow).
D. Liver tissue showing a cytoplasm vacuolization (sky blue arrow), numerous
multiple basophilic cells (black arrow) and liver sinus with few blood cells (red
arrow head).

CEV infected as well as in control (uninfected) Koi (Table 1). In all or­
gans, 2 genes namely TNF-α and IFN-α were commonly upregulated. In
gills, six genes viz., TNF-α, RohTNF-α, iNOS, IFN-γ, IL-10, and β-2M
(Fig. 6a) were differentially expressed (P < 0.05), whereas TNF-α,
RohTNF-α, iNOS, IFN-γ, IL-1β, and β-2M were expressed in kidney
(Fig. 6b). However, highest immune genes were expressed in liver
[Seven: TNF-α, RohTNF-α, iNOS, IFN-γ, IL-10, IL-12p40 and β-2M
(Fig. 6c)] and lowest in spleen [Five: TNF-α, RohTNF-α, iNOS, IFN-γ, and
β-2M (Fig. 6d)].
Out of eight innate immune genes tested, three genes namely TNF-
(11 folds), RohTNF- (8 folds), and iNOS (15 folds) showed highest
expression among five differentially expressed genes in gill tissue
(Fig. 6a); in kidney, five were expressed and three genes [RohTNF-α (25
folds), IFN-α (23 folds) and IL-1β (15 folds)] showed the highest fold
change (Fig. 6b). In case of liver, seven innate immune genes were
expressed out of eight tested with highest fold change observed in iNOS
(300 folds), TNF-α and RohTNF-α (10 folds) (Fig. 6c). But, a smaller
number of genes were expressed in spleen with highest fold change in
TNF-α (8 folds) and RohTNF-α (10 folds) (Fig. 6d).
The adaptive immune related gene i.e., β-2M showed significant
differential expression in kidney (52 folds) followed by spleen (37 folds),
gills (16 folds) and liver (7 folds) (Fig. 6a and b, c and d). The reference
gene (β-actin) expression remained constant and no significant change
was observed.

4. Discussion

In the present study, about 150 ornamental fish species belonging to

eight different families (Cyprinidae, Cichlidae, Poeciliidae, Osphrone­
midae, Pangasiidae, Characidae, Melanotaeniidae, and Lorocariidae)
were collected during 2018–2020 from various regions of Karnataka.
They were examined according to OIE protocol for OIE listed pathogens.
Further, they were also tested for non-OIE listed disease i.e., carp edema
virus (CEV) which causes KSD. Among the fish species screened, the
presence of CEV infection was detected in Koi (family of Cyprinidae). It
is also observed that the infection was found to be prevalent in Koi
during the winter months of October to February (water temperature is
between 17 and 24 ◦ C). Earlier studies have confirmed that the low
water temperature is an important physical factor that triggers the
outbreak of CEV. The first outbreak of CEV was reported from Japan in
the juvenile Koi where the water temperature was between 15 and 25 ◦ C
[8]. Also, it was reported in common carp and Koi where water tem­
perature was ranged between 7 and 15 ◦ C in Austria [5,13]. However,
earlier studies have noticed infection of Koi with CEV at a temperature
(caption on next column)
below 25 ◦ C (causing 100% mortality), and 32 ◦ C (causing 100% mor­
tality) [7,14].
Level-I diagnosis: The infected fishes exhibited clinical signs like
sleepy behavior, excess mucous production and haemorrhages in the
head region. They became lethargic and gradually settled to the bottom

628
K.B. Kushala et al. Fish and Shellfish Immunology 130 (2022) 624–634

internal primers which were designed by Way et al. [19] with a product
size of 478 bp. The sequence analysis of 4a partial gene is found to be
closely related to India and Germany strains of CEV with the similarity of
97.4–99.94% respectively. Ornamental fish species being transported
between different states within India, in terms of business and exchange
between the farms and shops, for breeding purpose may also have
facilitated the transmission of CEV.
The difference of the nucleotide sequences of the partial 4a gene
analysis allowed for identification of the virus variants [17,24] in the
phylogenetic tree, and the CEV sequence determined in this study
included in genogroup IIa. The first report of CEV in India also showed
two distinct clusters of the viruses viz., CEV sequences from Koi and
common carp based on phylogenetic analysis of 478 bp fragment of 4a
Fig. 2. Confirmation of representative infected virus using partial 4a gene gene [14]. In the present study, high relatedness between the Indian Koi
primer through PCR technique. Agarose gel electrophoresis showing an CEV sequence and Koi CEV sequences reported in UK, Poland, and Japan
amplification of partial 4a gene. Lane M: 100 bp DNA ladder, Lane N: Negative which belonged to the genogroup IIa. Similar results were also reported
control, Lane 1 and 2: Koi from Bengaluru, Lane 3 and Lane 4: Koi collected by the researchers [15,20,22,42,43].
from Dakshina Kannada. Further confirmation of CEV infection was done through the TEM
analysis of purified virus; spherical shaped virus with the size of
150–200 nm was observed. Similar results were also reported from the
Table 3
Confirmed CEV positive ornamental koi fishes in Karnataka, India.
gill sectioning samples [6,12,19].
Propagation of CEV in cell lines has not been achieved inspite of
Sl. Place Species Code CEV load (copies per μl of
several efforts by the scientists [6,14,15]. A total of 30 different fish cell
No. sample)
lines were used for its propagation but no cytopathic effect was observed
1 Mangaluru Koi fin N fin CEV 24 1584060 [44]. However, Adamek et al. [20] detected the CEV replication in the
tail
2 Bengaluru Koi fish 1 CEV 85 4078
gill explants and this showed the possibility of CEV propagation on the
3 Koi fish 2 CEV 86 2247 gill epithelial cell lines. Therefore, in the present study, Danio rerio gill
4 Koi fish 3 CEV 87 8261 (DRG) fish cell line (Danio belongs to the Cyprinidae family) was used,
5 Mangaluru Koi fish M1 CEV 2722017 but no CPE was observed in the DRG cells infecting with CEV tissue
145
homogenates. The same results were observed even after blind passage.
6 Koi fish M 2 CEV 2703427
146 Henceforth, future studies should be given high importance for in vitro
7 Koi fish M 3 CEV 2422677 cultivation of the virus to assess the pathogenicity, immune response
147 and their cytopathic effect.
8 Koi fish M 4 CEV 2778557 In vivo; the co-habitation and tissue infection experiment showed the
148
9 Koi fish M 5 CEV 2666626
unique clinical sign of sleepy behavior, recorded after 2 dpi and 6 dpi
149 respectively. Similar results were also reported from Austria showing
10 Koi fish M 6 CEV 2357169 that CEV infection can transmit to Koi and common carp after 6 h of post
150 infection (cohabitation experiment) [13]. This confirms CEV can hori­
zontally transfer to healthy fish. Thus, better management practices to
control and prevent an epidemic of CEV by providing stress free natural
of the tank with a sleepy behavior followed by mortality. Similar clinical
conditions with minimal temperature fluctuation along with routine
signs were reported in Koi with hyper production of mucus on the skin,
checking of water quality combined with examination of the suspected
gill and skin discoloration [13]. The cumulative mortality rate of CEV
fish and separating it from the unaffected stocks is very essential.
infected fish recorded to be 70–80%, which is consistent with previous
Further, understanding the host range virus, as well as their interme­
reports [17,19,21]. However, the mortality rates decreases when the
diate host is need of the hour.
temperatures increase to 28 ◦ C [40] and thus reports of CEV infection
In addition, the viral load was quantified for CEV infected gill tissues;
are usually low in summer months.
which showed higher viral load (106− 7 copies per 126 ng of DNA) in fish
Numerous factors were related to exert stress to fish which includes
collected from Dakshina Kannada followed by Bengaluru (below 104
unscientific management practices, improper handling, high stocking
copies per 126 ng of DNA). Gill epithelial cells are recognized as CEV
density, unscientific way of transportation, and bad water quality etc.
replication sites [5,9,18,21,32].
[4,21]. All these stress factors play a crucial role in the outbreak of viral
Host pathogen interaction studies on CEV is scanty, but it is very
infections in aquatic animals [20,21]. Hedrick et al. [41] reported that
much necessary to understand the same to develop strategies for pre­
water is the main abiotic vector particularly in viral transmission,
vention and control of the disease in aquaculture. In the present study,
because the virus is likely to be released by the detachment or sloughing
immune response against CEV infection in different organs was evalu­
of epithelial cells from the gill filaments.
ated; it revealed that, IFN-γ, RohTNF-α and TNF-α were upregulated in
Level-II diagnosis: in the histopathological examination, CEV infec­
infected Koi in gill, spleen, liver and kidney. These cytokines belong to
ted fish reported to show unique clinical signs such as multifocal
defense mechanisms for removing viral pathogens, therefore, the upre­
mononuclear cell infiltrates, hyperaemia, and necrotic changes in the
gulation may be due to the CEV infection in fish. Also, these cytokines
gill, hyperplasia of the gill lamellae, clubbing of gill filaments specific to
play a crucial mediator of pro-inflammatory responses and in the acti­
this poxvirus [5,7,10,13,19,39,40]. The posterior kidney shows degen­
vation of B and T cells [45].
eration and necrosis of tubular epithelia along with massive congestion
IFNs play an important role in restricting virus replication [20] and it
of blood vessels [40]. The edema of the respiratory epithelial cells of gill
acts as first line of defense for viral infection in vertebrates [46]. In
lamellae and hyperplasia of interlamellar epithelia was observed in the
higher vertebrates (mice) strong interferon response to neutralize the
infected Koi [7]. Similar histopathological changes in the gill, liver,
poxvirus (vaccinia virus) infections and in fish similar response was also
spleen and kidney were observed in the present study.
reported against viral hemorrhagic septicemia virus, rhabdovirus
Level-III diagnosis: CEV was detected by PCR method by using
infecting rainbow trout [47]. However, in the present study, naturally

629
K.B. Kushala et al. Fish and Shellfish Immunology 130 (2022) 624–634

Fig. 3. The evolutionary history of CEV was inferred using the Neighbor-Joining method. The percentage of replicate trees in which the associated taxa
clustered together in the bootstrap test (1000 replicates) is shown next to the branches. This analysis involved 41 nucleotide sequences of CEV. Evolutionary analyses
were conducted in MEGA X. (Symbol: indicates the CEV detected in the present study). From top of the tree with accession number (code) are as follows:
KY550424.1 (CEV DH-9600709), KX254026.1 (CEV R082 1.4), MK814451.1 (CEV UCD PA1), KY550426.1 (CEV DH-2970513), KY550429.1 (CEV DH-1300311),
KY550428.1 (CEV DH-4510416), KX254001.1 (CEV 112–2015), MN996230.1 (CEV CZ-14 1895), KX254022.1 (CEV M141), KX254004.1 (CEV 55–2013),
KX254000.1 (CEV 687–2014), MF418005.1 (CEV HU17), KX254025.1 (CEV R004 1.2), KX253997.1 (CEV 518–2014), KX254003.1 (CEV 274–2014), MF326541.1
(CEV/116), KY550438.1 (CEV DH-13081110), OK318990.1 (CEV24), MZ662081.1 (CEV145), MN519198.1 (CEV/63), SUB2475976 (CEV86), SUB2475974
(CEV85), KX254008.1 (CEV 588–2013), KX254011.1 (CEV 345–2013), KX254010.1 (CEV 641–2014), KX254016.1 (CEV Q089 1.2), KX254017.1 (CEV Q091 1.2),
KX254015.1 (CEV Q039 1.2), KX254014.1 (CEV Q037 1.2), KX254013.1 (CEV Q030 1.2), KX254009.1 (CEV 436–2014), MK990708.1 (CEV F12), MK990711.1 (CEV
F129), KX253998.1 (CEV 220–2014), KX254012.1 (CEV 640–2013), KX253999.1 (CEV 420–2014), KX254018.1 (CEV Q225 1.2), MK990714.1 (CEV F238),
MH397469.1 (CEV NJ2017), MK990712.1 (CEV LE1), and MK990715.1 (CEV (P4a)).

Fig. 4. Transmission electron microscopy of CEV.

630
K.B. Kushala et al. Fish and Shellfish Immunology 130 (2022) 624–634

Fig. 5. In vivo studies on Koi showing cumulative survival percentage in case of co-habitation and tissue infection experiments.

CEV infected Koi showed an elevated IFN response in fish which were with viruses such as infectious haematopoietic necrosis virus (IHNV),
having higher viral load in gill tissues. Therefore, similar to the CyHV-3 epizootic haematopoietic necrosis virus (EHNV) and frog virus 3 (FV3),
infection in carp [48], IFN can be associated with a higher resistance of caused no significant changes in TGF-β expression [55]. In this study, the
carp strains to a CEV infection. expression of TGF-β due to CEV infection was not statistical significant in
IFNs plays a significant role to control the early viral infections by all the organs. In contrast, TGF-β has been shown to enhance viral
interfering with viral replication, thus upregulating the expression of replication in humans as well as European catfish virus (ECV) and doctor
antiviral molecules. Higher expression of IFN interacts with interferon fish virus (DFV) infected Epithelioma papulosum cyprini (EPC) cells in
receptor to induce the production of an antiviral state in the infected and fishes [56,58].
noninfected neighboring cells, inhibiting different step of viral replica­ Interleukins (ILs) are the collection of cytokines responsible for the
tion [49]. communication between the immune related cells of the host [45,63]. In
The other pleiotropic cytokine responsible for immune response is the present study, interleukins such as IL-1β, IL-10 and IL12p40 was
TNF-α. This is produced by infected cells, innate and adaptive immune studied. IL-10 and IL-12p40 was upregulated in liver, IL-10 was upre­
cells which include dendritic cells, macrophages, natural killer, T and B gulated in gill and IL-1β was upregulated in kidney. IL-10 was
lymphocytes after being activated [45]. TNF-α can trigger the increased up-regulated only in gill of CEV infected Koi and lower in all other or­
production of adhesion molecules in endothelial cells which in turn gans. The observed down-regulation of IL-10 may be associated with the
encourage the extravasation of neutrophils, monocytes and other im­ increased expression of TNF-α in the infected cells. IL-10 regulates in­
mune cells to be attracted to infection site. It also can take part in flammatory responses and potently inhibits the production of multiple
apoptosis through activating caspases. TNF-α facilitates a wide range of cytokines, including IL-1β and TNF-α [64]. IL-12p40 is a regulator of
potential biologically important functions well documented in regu­ cell-mediated immune responses. IL-12p40 provides an active immune
lating apoptosis, fat metabolism, inflammation and organ regeneration defense against viruses, parasites and intracellular bacteria by activating
in fish [50]. Macrophages were activated by the upregulation of both the IFN-γ production from Th1 and NK cells [65].
TNF-α and IFN-γ by production of wide range of iNOS v TNF-α and IFN-γ Macrophages, T cells and dendritic cells involved in production of
iz., superoxide anions, oxygen and nitrogen radicals [45]. However, Nitric oxide (NO) from nitric oxide synthase (NOS) responsible in im­
functionally assessed to have pro-inflammatory activity in fish, IL-1β, mune regulation, host defence, vascular functions and neurotransmis­
IFN-α and TNF-α are often co-expressed with other macrophage-derived sions [66]. In the present study, iNOS was significantly upregulated in
inflammatory mediators such as iNOS in viral and bacterial infections all the organs. iNOS is transcriptionally activated by cytokines, IFN and
[51–55]. TNF-α which are produced during a viral infection [67]. During
The up-regulation of both TNF-α and RohTNF-α was most notable in immune-inflammation NO acts by killing the invading viruses and by
spleen, gill and liver, induced statistically significant fold changes (>10) damaging the normal cells indicating the pathogenic effect [68,69].
in TNF-α expression. In the pro-inflammatory signaling cascade, TNF-α Higher expression of iNOS production during virus infection can inhibit
upregulated significantly which leads to the downstream expression of viral replication and invoke an immune response. Poxviruses are con­
IL-1β and chemokines such as IL-8 which results in apoptotic changes of tained through innate immunity undertaken by the inflammatory and
the infected cell [28,46]. TNF-α expression indicating that the growing NK cells. These responses control viral replication and mount an anti­
number of virions enhanced pro-inflammatory cytokine production in genic adaptive response [70].
naturally CEV infected Koi. Similar up-regulation of TNF-α has been β2M is an essential part of adaptive immune response from MHC
reported with FV3-infected Xenopus, viral hemorrhagic septicemia virus class I molecules which is responsible for its structure, correct folding
(VHSV) infection and Singapore grouper iridovirus [56–59]. In addition and cell surface expression [15]. Here, β2M expression was significantly
to their various roles in the innate immune response, TNF-α was also upregulated in all four organs. The increased β2M expression in natu­
connected with the initiation of apoptosis [47,48]. Additionally, TNF-α rally CEV infected Koi recommends that poxviruses induce an anti­
stimulates increased production of antiviral cytokine, IFN-γ, which ini­ gen− specific immune response leading to the activation of cytotoxic
tiates the apoptosis [4,20,21,60,61]. lymphocytes. The different virus infecting fishes showed increased β2M
Pleiotropic cytokine TGF-β controls the inflammatory responses expression in rainbow trout (Oncorhynchus mykiss) infected with infec­
especially during parasitic pathogens reportedly induced the up- tious haematopoietic necrosis virus (IHNV) in the spleen and intestine
regulation in rainbow trout and European sea bass [39,62]. Infection [46]. Furthermore, infectious salmon anaemia virus (ISAV) showed a

631
K.B. Kushala et al. Fish and Shellfish Immunology 130 (2022) 624–634

Fig. 6. Relative mRNA expression of innate immune related gene in gills (A), kidney (B), liver (C) and spleen (D) in Koi naturally infected with CEV as
measured by quantitative real-time PCR. Data are presented as mean ± SD and multiple reference genes were used to normalize with the target gene (n = 3).
Different alphabetical letters indicate the significant difference with p < 0.05.

significant increase of β2M expression in the head kidney of Atlantic Koi was confirmed through confirmatory diagnosis as described in OIE.
salmon (Salmo salar) [47]. The results of this study indicate that poxviruses induce the expression
of TNF-α, RohTNF-α, iNOS, IFN-γ and IL-10, catalyze the β-2M of MHC
5. Conclusions class I pathway and induce apoptosis in Koi. However, further studies
should be focused to know the progression of expression of these upre­
KSD is one of the emerging fish viral diseases globally, causing severe gulated immune genes in different time intervals to determine their
mortalities leading to substantial economic losses in the aquaculture. potential as functional markers in the CEV infected Koi, which may
The mechanism of host immune response to CEV infection is poorly possibly be crucial biomarkers for immune response for the develop­
understood. These preliminary results describe host immune response ment of vaccines against the disease in future.
against CEV infected Koi for the first time. Natural infection of CEV in

632
K.B. Kushala et al. Fish and Shellfish Immunology 130 (2022) 624–634

Fig. 6. (continued).

Ethics statement References

The experiment was approved by the institution and followed the [1] H. Su, J. Su, Cyprinid viral diseases and vaccine development, Fish Shellfish
Immunol. 83 (2018) 84–95, https://doi.org/10.1016/j.fsi.2018.09.003.
standard guidelines. [2] M.S. Nithin, S.K. Girisha, K.B. Kushala, D. V Chandan, T.G. Puneeth, B.T. Naveen
Kumar, T.N. Vinay, T. Suresh, Lopamudra Sahoo, K.S. Ramesh, Novel lytic
CRediT authorship contribution statement bacteriophages (AhFM4 & AhFM5) as bio-control measures against multidrug
resistant biofilm producing Aeromonas hydrophila (AhZ1K), Aquaculture 544
(2021), 737106, https://doi.org/10.1016/j.aquaculture.2021.737106.
K.B. Kushala: Conceptualization, Data curation, Formal analysis, [3] S.K. Girisha, K.B. Kushala, M.S. Nithin, T.G. Puneeth, B.T. Naveen Kumar, T.
Investigation, Methodology, Resources, Software, Supervision, Valida­ N. Vinay, T. Suresh, S.K. Ajay, M.N. Venugopal, K.S. Ramesh, First report of the
infectious spleen and kidney necrosis virus (ISKNV) infection in ornamental fishes
tion, Visualization, Roles/Writing - original draft, Equally Contributed. in India, Transbound. Emerg. Dis. 68 (2021) 964–972, https://doi.org/10.1111/
M.S. Nithin: Conceptualization, Data curation, Formal analysis, Inves­ tbed.13793.
tigation, Methodology, Resources, Software, Supervision, Validation, [4] R. Machat, L. Pojezdal, V. Piackova, M. Faldyna, Carp edema virus and immune
response in carp (Cyprinus carpio): current knowledge, J. Fish. Dis. 44 (2021)
Visualization, Roles/Writing - original draft. S.K. Girisha: Funding
371–378, https://doi.org/10.1111/jfd.13335.
acquisition, Project administration, Validation, Supervision, Writing – [5] M. Adamek, M. Heling, J. Bauer, F. Teitge, S.M. Bergmann, D.W. Kleingeld,
review & editing. S.B. Dheeraj: Investigation, Methodology. N.S. A. Welzel, N. Scuda, J. Bachmann, C.S. Louis, K. Böttcher, G. Bräuer, D. Steinhagen,
Sowndarya: Investigation, Methodology. T.G. Puneeth: Investigation, V. Jung-Schroers, It is everywhere—a survey on the presence of carp edema virus
in carp populations in Germany, Transbound. Emerg. Dis. n/a (2021), https://doi.
Methodology. T. Suresh: Supervision, Writing – review & editing. B.T. org/10.1111/tbed.14225.
Naveen Kumar: Supervision, Writing – review & editing. T.N. Vinay: [6] T.R. Swaminathan, R. Kumar, A. Dharmaratnam, V.S. Basheer, N. Sood, P.
Software, Validation, Supervision, Writing – review & editing. K. Pradhan, N.K. Sanil, P. Vijayagopal, J.K. Jena, Emergence of carp edema virus in
cultured ornamental koi carp, Cyprinus carpio koi, in India, J. Gen. Virol. 97
(2016) 3392–3399, https://doi.org/10.1099/jgv.0.000649.
Declaration of competing interest [7] P.K. Sahoo, S. Pattanayak, A. Paul, M.K. Sahoo, P.R. Kumar, Carp Edema Virus in
Ornamental Fish Farming in India: A Potential Threat to Koi Carps but Not to Co-
cultured Indian Major Carp or Goldfish, 2020.
The authors declare that they have no conflicts of interest to this [8] Y. Murakami, Studies on mass mortality of juvenile carp.-about mass mortality
work. showing edema, Rep. Res. Fish Dis. (1976) 19–33.
[9] S. Ono, A. Nagai, N. Sugai, A histopathological study on juvenile colorcarp,
Cyprinus carpio, showing edema, Fish Pathol. 21 (1986) 167–175.
Data availability [10] K.S. Way, D. Stone, Emergence of carp edema virus-like (CEV-like) disease in the
UK, CEFAS Finfish News 15 (2013) 32–34.
Data will be made available on request. [11] O.L.M. Haenen, K. Way, D. Stone, M.Y. Engelsma, Koi sleepy disease (KSD)
door’Carp edema virus’: eerste detectie in Nederlandse koi, Aquacult (2013)
27–29, 2013.
Acknowledgement and Funding support [12] V. Jung-Schroers, M. Adamek, F. Teitge, J. Hellmann, S.M. Bergmann, H. Schütze,
D.W. Kleingeld, K. Way, D. Stone, M. Runge, B. Keller, S. Hesami, T. Waltzek,
The funding support to National Surveillance Programme for Aquatic D. Steinhagen, Another potential carp killer?: carp Edema Virus disease in
Germany, BMC Vet. Res. 11 (2015) 114, https://doi.org/10.1186/s12917-015-
Animal Diseases under Pradhan Mantri Matsya Sampada Yojana (No. 0424-7.
35028/05/2012-Fy (Trade)-Vol II dated 19th June 2020) from the [13] E. Lewisch, B. Gorgoglione, K. Way, M. El-Matbouli, Carp edema virus/koi sleepy
Department of Fisheries, Ministry of Fisheries, Animal Husbandry and disease: an emerging disease in Central-East Europe, Transbound. Emerg. Dis. 62
(2015) 6–12, https://doi.org/10.1111/tbed.12293.
Dairying, Government of India is thankfully acknowledged’. Also, au­ [14] X. Zhang, Y. Ni, J. Ye, H. Xu, Y. Hou, W. Luo, W. Shen, Carp edema virus, an
thors gratefully acknowledge the DBT Bioinformatics Centre, College of emerging threat to the carp (Cyprinus carpio) industry in China, Aquaculture 474
Fisheries, Mangalore for carrying out the analysis work. (2017) 34–39.
[15] S. Pikulkaew, K. Phatwan, W. Banlunara, M. Intanon, J.K. Bernard, First evidence
of carp edema virus infection of Koi Cyprinus carpio in Chiang Mai Province,
Appendix A. Supplementary data Thailand, Viruses 12 (2020) 1400.
[16] A. Marsella, T. Pretto, M. Abbadi, R. Quartesan, L. Cortinovis, E. Fiocchi,
A. Manfrin, A. Toffan, Carp edema virus-related mortality in wild adult common
Supplementary data to this article can be found online at https://doi. carp (cyprinus carpio) in Italy, J. Fish. Dis. 44 (2021) 939–947, https://doi.org/
org/10.1016/j.fsi.2022.09.012. 10.1111/jfd.13353.

633
K.B. Kushala et al. Fish and Shellfish Immunology 130 (2022) 624–634

[17] T. Miyazaki, T. Isshiki, H. Katsuyuki, Histopathological and electron microscopy haematopterus) in the Republic of Korea, Transbound. Emerg. Dis. 65 (2018)
studies on sleepy disease of koi Cyprinus carpio koi in Japan, Dis. Aquat. Org. 65 315–320, https://doi.org/10.1111/tbed.12782.
(2005) 197–207. [44] P. Ouyang, Y. Zhou, R. Yang, Z. Yang, K. Wang, Y. Geng, W. Lai, X. Huang, D. Chen,
[18] J. Antychowicz, M. Reichert, M. Matras, S.M. Bergmann, O. Haenen, Epidemiology, J. Fang, Z. Chen, L. Tang, C. Huang, L. Yin, Outbreak of carp edema virus disease in
pathogenicity and molecular biology of koi herpesvirus isolated in Poland, Bull. cultured ornamental koi in a lower temperature in China, Aquacult. Int. 28 (2020)
Inst. PULAWY. 49 (2005) 367. 525–537, https://doi.org/10.1007/s10499-019-00476-1.
[19] K. Way, O. Haenen, D. Stone, M. Adamek, S.M. Bergmann, L. Bigarré, N. Diserens, [45] J.L. Muñoz-Carrillo, J.F. Contreras-Cordero, O. Gutiérrez-Coronado, P.
M. El-Matbouli, M.C. Gjessing, V. Jung-Schroers, Emergence of carp edema virus T. Villalobos-Gutiérrez, L.G. Ramos-Gracia, V.E. Hernández-Reyes, Cytokine
(CEV) and its significance to European common carp and koi Cyprinus carpio, Dis. profiling plays a crucial role in activating immune system to clear infectious
Aquat. Org. 126 (2017) 155–166. pathogens, in: Immune Response Act, Immunomodulation, IntechOpen, 2018.
[20] M. Adamek, A. Oschilewski, P. Wohlsein, V. Jung-Schroers, F. Teitge, A. Dawson, [46] C.J. Secombes, J. Zou, S. Bird, Fish cytokines: discovery, activities and potential
D. Gela, V. Piackova, M. Kocour, J. Adamek, Experimental infections of different applications, Fish Defenses 1 (2009) 1–36.
carp strains with the carp edema virus (CEV) give insights into the infection [47] N.M.S. Dos Santos, A. d Vale, M.I.R. Reis, M.T. Silva, Fish and apoptosis: molecules
biology of the virus and indicate possible solutions to problems caused by koi and pathways, Curr. Pharmaceut. Des. 14 (2008) 148–169.
sleepy disease (KSD) in carp aquaculture, Vet. Res. 48 (2017) 1–16. [48] M.A. Cooper, T.A. Fehniger, A. Ponnappan, V. Mehta, M.D. Wewers, M.A. Caligiuri,
[21] M. Adamek, F. Teitge, D. Steinhagen, Quantitative diagnostics of gill diseases in Interleukin-1β costimulates interferon-γ production by human natural killer cells,
common carp: not as simple as it seems, Dis. Aquat. Org. 134 (2019) 197–207. Eur. J. Immunol. 31 (2001) 792–801.
[22] M. Matras, E. Borzym, D. Stone, K. Way, M. Stachnik, J. Maj-Paluch, M. Palusińska, [49] S. López, L. Sánchez-Tacuba, J. Moreno, C.F. Arias, Rotavirus strategies against the
M. Reichert, Carp edema virus in Polish aquaculture–evidence of significant innate antiviral system, Annu. Rev. Virol. 3 (2016) 591–609.
sequence divergence and a new lineage in common carp Cyprinus carpio (L.), [50] L. Yaoguo, X. Tiaoyi, Z. Jun, TNF Fish, TNF receptors, Science China Life Sciences
J. Fish. Dis. 40 (2017) 319–325. 64 (2) 196–220.
[23] T. Rehman, L. Yin, M.B. Latif, Y. Zhou, K. Wang, Y. Geng, X. Huang, D. Chen, [51] N.O. Harun, T. Wang, C.J. Secombes, Gene expression profiling in naïve and
J. Fang, Z. Chen, H. Guo, W. Lai, P. Ouyang, Current findings on carp edema virus, vaccinated rainbow trout after Yersinia ruckeri infection: insights into the
control challenges, and future outlook, Aquacult. Int. 28 (2020), https://doi.org/ mechanisms of protection seen in vaccinated fish, Vaccine 29 (2011) 4388–4399.
10.1007/s10499-020-00573-6, 2015–2026. [52] I. de Bruijn, R. Belmonte, V.L. Anderson, M. Saraiva, T. Wang, P. van West, C.
[24] M. Adamek, F. Baska, B. Vincze, D. Steinhagen, Carp edema virus from three J. Secombes, Immune gene expression in trout cell lines infected with the fish
genogroups is present in common carp in Hungary, J. Fish. Dis. 41 (2018) pathogenic oomycete Saprolegnia parasitica, Dev. Comp. Immunol. 38 (2012)
463–468, https://doi.org/10.1111/jfd.12744. 44–54.
[25] B. Magnadottir, Immunological control of fish diseases, Mar. Biotechnol. 12 (2010) [53] A. Oladiran, D. Beauparlant, M. Belosevic, The expression analysis of inflammatory
361–379. and antimicrobial genes in the goldfish (Carassius auratus L.) infected with
[26] C. Uribe, H. Folch, R. Enríquez, G. Moran, Innate and adaptive immunity in teleost Trypanosoma carassii, Fish Shellfish Immunol. 31 (2011) 606–613.
fish: a review, Vet. Med. (Praha). 56 (2011) 486. [54] P. Alvarez-Pellitero, Fish immunity and parasite infections: from innate immunity
[27] C. Langevin, E. Aleksejeva, G. Passoni, N. Palha, J.-P. Levraud, P. Boudinot, The to immunoprophylactic prospects, Vet. Immunol. Immunopathol. 126 (2008)
antiviral innate immune response in fish: evolution and conservation of the IFN 171–198.
system, J. Mol. Biol. 425 (2013) 4904–4920. [55] J.M. Covello, S. Bird, R.N. Morrison, S.C. Battaglene, C.J. Secombes, B.F. Nowak,
[28] C.J. Secombes, J. Zou, Evolution of interferons and interferon receptors, Front. Cloning and expression analysis of three striped trumpeter (Latris lineata) pro-
Immunol. 8 (2017) 209. inflammatory cytokines, TNF-α, IL-1β and IL-8, in response to infection by the
[29] M. Adamek, H. Syakuri, S. Harris, K.Ł. Rakus, G. Brogden, M. Matras, I. Irnazarow, ectoparasitic, Chondracanthus goldsmidi, Fish Shellfish Immunol. 26 (2009)
D. Steinhagen, Cyprinid herpesvirus 3 infection disrupts the skin barrier of 773–786.
common carp (Cyprinus carpio L.), Vet. Microbiol. 162 (2013) 456–470. [56] S. Hong, R. Li, Q. Xu, C.J. Secombes, T. Wang, Two types of TNF-α exist in teleost
[30] S.K. Otta, I. Karunasagar, I. Karunasagar, Detection of monodon baculovirus and fish: phylogeny, expression, and bioactivity analysis of type-II TNF-α3 in rainbow
white spot syndrome virus in apparently healthy Penaeus monodon postlarvae trout Oncorhynchus mykiss, J. Immunol. 191 (2013) 5959–5972.
from India by polymerase chain reaction, Aquaculture 220 (2003) 59–67, https:// [57] H.D. Morales, L. Abramowitz, J. Gertz, J. Sowa, A. Vogel, J. Robert, Innate immune
doi.org/10.1016/S0044-8486(02)00340-X. responses and permissiveness to ranavirus infection of peritoneal leukocytes in the
[31] S.F. Altschul, W. Gish, W. Miller, E.W. Myers, D.J. Lipman, Basic local alignment frog Xenopus laevis, J. Virol. 84 (2010) 4912–4922.
search tool, J. Mol. Biol. 215 (1990) 403–410. [58] R. Holopainen, H. Tapiovaara, J. Honkanen, Expression analysis of immune
[32] M. Adamek, V. Jung-Schroers, J. Hellmann, F. Teitge, S.M. Bergmann, M. Runge, response genes in fish epithelial cells following ranavirus infection, Fish Shellfish
D.W. Kleingeld, K. Way, D.M. Stone, D. Steinhagen, Concentration of carp edema Immunol. 32 (2012) 1095–1105.
virus (CEV) DNA in koi tissues affected by koi sleepy disease (KSD), Dis. Aquat. [59] X. Huang, Y. Huang, Z. Ouyang, L. Xu, Y. Yan, H. Cui, X. Han, Q. Qin, Singapore
Org. 119 (2016) 245–251. grouper iridovirus, a large DNA virus, induces nonapoptotic cell death by a cell
[33] I. Rodríguez, B. Novoa, A. Figueras, Immune response of zebrafish (Danio rerio) type dependent fashion and evokes ERK signaling, Apoptosis 16 (2011) 831–845.
against a newly isolated bacterial pathogen Aeromonas hydrophila, Fish Shellfish [60] M. Adamek, K.Ł. Rakus, J. Chyb, G. Brogden, A. Huebner, I. Irnazarow,
Immunol. 25 (2008) 239–249, https://doi.org/10.1016/j.fsi.2008.05.002. D. Steinhagen, Interferon type I responses to virus infections in carp cells: in vitro
[34] B. Swain, M. Basu, S.S. Lenka, S. Das, P. Jayasankar, M. Samanta, Characterization studies on Cyprinid herpesvirus 3 and Rhabdovirus carpio infections, Fish Shellfish
and inductive expression analysis of interferon gamma-related gene in the Indian Immunol. 33 (2012) 482–493.
major carp, rohu (Labeo rohita), DNA Cell Biol. 34 (2015) 367–378. [61] J.W. Holland, C.R.W. Gould, C.S. Jones, L.R. Noble, C.J. Secombes, The expression
[35] E.H. Stolte, S.B. Nabuurs, N.R. Bury, A. Sturm, G. Flik, H.F.J. Savelkoul, B.M. Lidy of immune-regulatory genes in rainbow trout, Oncorhynchus mykiss, during a
Verburg-van Kemenade, Stress and innate immunity in carp: corticosteroid natural outbreak of proliferative kidney disease (PKD), Parasitology 126 (2003)
receptors and pro-inflammatory cytokines, Mol. Immunol. 46 (2008) 70–79, S95–S102.
https://doi.org/10.1016/j.molimm.2008.07.022. [62] T. Lindenstrøm, C.J. Secombes, K. Buchmann, Expression of immune response
[36] S.K. Gupta, B. Sarkar, S. Bhattacharjee, N. Kumar, S. Naskar, K.B. Uppuluri, genes in rainbow trout skin induced by Gyrodactylus derjavini infections, Vet.
Modulation of cytokine expression by dietary levan in the pathogen aggravated Immunol. Immunopathol. 97 (2004) 137–148.
rohu, Labeo rohita fingerlings, Aquaculture 495 (2018) 496–505, https://doi.org/ [63] R. Medzhitov, Recognition of microorganisms and activation of the immune
10.1016/j.aquaculture.2018.06.025. response, Nature 449 (2007) 819–826.
[37] B.R. Mohanty, P.K. Sahoo, Immune responses and expression profiles of some [64] K.W. Moore, R. de Waal Malefyt, R.L. Coffman, A. O’Garra, Interleukin-10 and the
immune-related genes in Indian major carp, Labeo rohita to Edwardsiella tarda interleukin-10 receptor, Annu. Rev. Immunol. 19 (2001) 683–765.
infection, Fish Shellfish Immunol. 28 (2010) 613–621. [65] A.-C. Øvergård, I. Nepstad, A.H. Nerland, S. Patel, Characterisation and expression
[38] K. Kumari, G.-B. Pathakota, P.-K. Annam, S. Kumar, G. Krishna, Characterisation analysis of the Atlantic halibut (Hippoglossus hippoglossus L.) cytokines: IL-1β, IL-
and validation of house keeping gene for expression analysis in Catla catla 6, IL-11, IL-12β and IFNγ, Mol. Biol. Rep. 39 (2012) 2201–2213.
(Hamilton), Proc. Natl. Acad. Sci. India B Biol. Sci. 85 (2015) 993–1000, https:// [66] Q. Xue, Y. Yan, R. Zhang, H. Xiong, A.-C. Øvergård, I. Nepstad, A.H. Nerland,
doi.org/10.1007/s40011-014-0482-9. S. Patel, K.W. Moore, R. de Waal Malefyt, R.L. Coffman, A. O’Garra, Regulation of
[39] O. Byadgi, P. Beraldo, D. Volpatti, M. Massimo, C. Bulfon, M. Galeotti, Expression iNOS on immune cells and its role in diseases, Int. J. Mol. Sci. 19 (2012) 3805.
of infection-related immune response in European sea bass (Dicentrarchus labrax) [67] C.J. Lowenstein, S.L. Hill, A. Lafond-Walker, J. Wu, G. Allen, M. Landavere, N.
during a natural outbreak from a unique dinoflagellate Amyloodinium ocellatum, R. Rose, A. Herskowitz, Nitric oxide inhibits viral replication in murine
Fish Shellfish Immunol. 84 (2019) 62–72. myocarditis, J. Clin. Invest. 97 (1996) 1837–1843.
[40] H. Soliman, M. El-Matbouli, Rapid detection and differentiation of carp oedema [68] C. Tafalla, A. Figueras, B. Novoa, Role of nitric oxide on the replication of viral
virus and cyprinid herpes virus-3 in koi and common carp, J. Fish. Dis. 41 (2018) haemorrhagic septicemia virus (VHSV), a fish rhabdovirus, Vet. Immunol.
761–772. Immunopathol. 72 (1999) 249–256.
[41] R.P. Hedrick, D.B. Antonio, R.J. Munn, Poxvirus like agent associated with [69] C. Tafalla, J. Coll, C.J. Secombes, Expression of genes related to the early immune
epizootic mortality in juvenile koi (Cyprinus carpio), FHS Newsl 25 (1997) 1–2. response in rainbow trout (Oncorhynchus mykiss) after viral haemorrhagic
[42] J. Pikula, L. Pojezdal, I. Papezikova, H. Minarova, I. Mikulikova, H. Bandouchova, septicemia virus (VHSV) infection, Dev. Comp. Immunol. 29 (2005) 615–626.
J. Blahova, M. Bednarska, J. Mares, M. Palikova, Carp edema virus infection is [70] A.A. Baloch, E.E. Abdelsalam, V. Piačková, Cytokines studied in carp (Cyprinus
associated with severe metabolic disturbance in fish, Front. Vet. Sci. 8 (2021) 505. carpio L.) in response to important diseases, Fishes 7 (2022), https://doi.org/
https://www.frontiersin.org/article/10.3389/fvets.2021.679970. 10.3390/fishes7010003.
[43] S.W. Kim, J.W. Jun, S.S. Giri, C. Chi, S. Yun, H.J. Kim, S.G. Kim, J.W. Kang, S.
C. Park, First report of carp oedema virus infection of koi (Cyprinus carpio

634