Dna Manip

Methods in
Molecular Biology 2633
Garry Scarlett Editor
DNA
Manipulation
and Analysis
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK
For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
DNA Manipulation and Analysis
Edited by
Garry Scarlett
Biophysics Laboratories, School of Biological Sciences, University of Portsmouth, Portsmouth, UK
Editor
Garry Scarlett
Biophysics Laboratories
School of Biological Sciences
University of Portsmouth
Portsmouth, UK
ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-3003-7 ISBN 978-1-0716-3004-4 (eBook)
https://doi.org/10.1007/978-1-0716-3004-4
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part
of Springer Nature 2023
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part
of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and
retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter
developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Preface
If there is such a thing as a single secret to the mystery of life, then that secret is probably
DNA. Since 1953 that has been a very badly kept secret, detailed descriptions and images of
its structure and function abound in everything from learned articles to pop culture.
However, we now not only know the structure of DNA but can decipher its code and
even modify that code. We have learned to read and write on a molecular and biological
level, the technologies that allow us to read and write DNA form the focus of this book. This
book is designed for scientists moving into recombinant DNA technologies, covering
techniques that are important for conducting experiments in fields as wide ranging as
developmental to structural biology. The chapters are laid out as readers of the long running
Methods in Molecular Biology series have come to expect, with an accessible theory section
followed by a detailed method and finally the ever-useful notes and troubleshooting pages.
No preface on the art of gene engineering could go without mentioning the discovery of
the structure of DNA and the subsequent cracking of the code by a series of elegant
experiments in the 1950s and 1960s. However, the key developments that are centrally
relevant to this book were the first recombinant DNA experiments of Berg and, shortly after,
Boyer-Cohen in 1971 and 1972; indeed, some of the principles in those early procedures
have recognisable descendants described in the following chapters. A landmark development
in the field in the mid-1970s was the arrival of Sanger dideoxy sequencing, replacing difficult
and dangerous chemical methods for determining the order of bases on a piece a DNA, with
a much easier enzymatic approach. The following decade of the 1980s was dominated by
two major breakthroughs, the polymerase chain reaction (PCR) and the less mentioned but
equally important phosphoramidite chemistry approaches to making short single-stranded
oligonucleotides. Without these developments, many of the techniques in this book would
simply not be possible, they have enabled not only de novo generation of DNA fragments but
also the rapid amplification, site selection and targeted mutation of sequences.
Initially, much of the early recombinant DNA work undertaken was on sequences of
DNA inserted into plasmids, replicating circular extra-chromosomal DNA found in bacteria
that encode useful attributes for the cell. Indeed, plasmids remain the work horses of the
DNA laboratory, and the first few chapters detail a variety of different methods of inserting
DNA sequences into them, each with specific strengths and weaknesses. Following on from
these, the next three chapters discuss how to manipulate and create DNA sequences, which
in conjunction with the molecular cloning methods discussed in the earlier part of the book
provide powerful options in the laboratory for the would-be molecular biologist. The last
decade of the twentieth century and the dawn of the new millennium saw increasingly rapid
strides in the complex field of genomic modification, not only bacterial genomes but also the
genomes of eukaryotic cells, including those in multicellular organisms. Early attempts at
eukaryotic genomic modification suffered from significant issues with targeting the correct
location within the genome, a problem that became worse the bigger the genome to be
manipulated. The first technology that really tackled this was based upon zinc finger
nucleases; this was rapidly replaced by TALENs before the extremely powerful and easy to
use CRISPR/Cas9 system rose to its current dominance. Chapters 9, 10, and 11 discuss
transgenics in the model system Xenopus, with Chaps. 10 and 11 describing methods for
CRISPR targeted gene knockouts and gene insertions, respectively. The book then has two
v
vi Preface
examples of the growing field of ‘cell-free’ DNA work, dealing with the raising of aptameric
sequences and high throughput array technologies. Chapters 14, 15 and 16 deal with the
key underpinning technologies of all DNA work, making oligonucleotides and reading the
sequence. Much of this is now available as outsourced services for starter laboratories, but
in-house provision allows for flexibility and increased speed. The last chapter deals with
ethical considerations. The growing importance of DNA and gene manipulation to wider
society has led to increasing public and governmental scrutiny, not only of ethics but also the
risks of recombinant DNA technologies. Many jurisdictions have now introduced guidelines
and laws governing the making and containment of genetically modified organisms, this is in
addition to legal implications of using animals in research.
Recombinant technologies have developed remarkably since those first experiments in
the early 1970s; the growth of manufactured kits and outsourced services have brought
nucleic acid–based experiments into the range of many laboratories that previously would
have struggled to set up the infrastructure. We hope this book helps provide the expertise for
scientists embarking on their first forays into these types of projects. Finally, I would like to
thank the many chapter authors to who have contributed and provided their time and
expertise to help support the scientific community with the resources held within this book.
Portsmouth, UK Garry Scarlett

Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
1 Classical Recombinant DNA Cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1

Ana Mikić, Arqam Alomari, and Darren M. Gowers
2 A Sequence- and Ligation-Independent Cloning (SLIC) Procedure
for the Insertion of Genes into a Plasmid Vector . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
Robert A. Holland
3 Molecular Cloning Using In Vivo DNA Assembly . . . . . . . . . . . . . . . . . . . . . . . . . . 33
Sandra Arroyo-Urea, Jake F. Watson,
and Javier Garcı́a-Nafrı́a
4 Assembling Multiple Fragments: The Gibson Assembly. . . . . . . . . . . . . . . . . . . . . . 45
Luisana Avilan
5 TA Cloning Approaches to Cloning DNA with Damaged Ends DNA . . . . . . . . . 55
Charlotte Ayling
6 PCR-Based Assembly of Gene Sequences by Thermodynamically Balanced
Inside-Out (TBIO) Gene Synthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
Timothy J. Ragan and Helen A. Vincent
7 Random Mutagenesis by PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
F. A. Myers
8 In Vitro Site Directed Mutagenesis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Michael J. McClellan
9 Xenopus Transgenesis Using the pGateway System . . . . . . . . . . . . . . . . . . . . . . . . . . 97
Liliya Nazlamova
10 CRISPR/Cas9 Gene Disruption Studies in F0 Xenopus Tadpoles:
Understanding Development and Disease in the Frog . . . . . . . . . . . . . . . . . . . . . . . 111
Anita Abu-Daya and Annie Godwin
11 A CRISPR/Cas-Based Method for Precise DNA Integration in Xenopus laevis
Oocytes Followed by Intracytoplasmic Sperm Injection (ICSI)
Fertilization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131
Sian Angela Martin
12 A Lambda-Exonuclease SELEX Method for Generating Aptamers
to Bacterial Targets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 145
Robert Gowland and Darren M. Gowers
13 Generation of Functional-RNA Arrays by In Vitro Transcription
and In Situ RNA Capture for the Detection of RNA-RNA Interactions . . . . . . . 163
Helen A. Vincent, Charlotte A. Henderson, Daniela Lopes Cardoso,
and Anastasia J. Callaghan
vii
viii Contents
14 Chemical Synthesis of Oligonucelotide Sequences: Phosphoramidite

Chemistry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185
John Brazier
15 Low Throughput Direct Cycle Sequencing of Polymerase Chain
Reaction (PCR) Products . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195
George D. Zouganelis and Nikolaos Tairis
16 Nanopore Sequencing for Mixed Samples. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213
Angela H. Beckett and Samuel C. Robson
17 Ethics, Legality, and Safety for Geneticists . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235
Simon E. Kolstoe
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247
Contributors
ANITA ABU-DAYA • European Xenopus Resource Centre, University of Portsmouth,

Portsmouth, UK
ARQAM ALOMARI • Department of Basic Sciences, College of Agriculture and Forestry,
University of Mosul, Mosul, Iraq
SANDRA ARROYO-UREA • Institute for Biocomputation and Physics of Complex Systems (BIFI)
and Laboratorio de Microscopı́as Avanzadas (LMA), University of Zaragoza,
Zaragoza, Spain
LUISANA AVILAN • Centre for Enzyme Innovation, University of Portsmouth,
Portsmouth, UK
CHARLOTTE AYLING • Biophysics Laboratories, School of Biological Sciences,
University of Portsmouth, Portsmouth, UK
ANGELA H. BECKETT • Centre for Enzyme Innovation, University of Portsmouth,
Portsmouth, UK
JOHN BRAZIER • Reading School of Pharmacy, University of Reading, Reading, UK
ANASTASIA J. CALLAGHAN • Biophysics Laboratories, School of Biological Sciences, University of
Portsmouth, Portsmouth, UK
JAVIER GARCÍA-NAFRÍA • Institute for Biocomputation and Physics of Complex Systems (BIFI)
and Laboratorio de Microscopı́as Avanzadas (LMA), University of Zaragoza,
Zaragoza, Spain
ANNIE GODWIN • European Xenopus Resource Centre, University of Portsmouth, Portsmouth,
UK
DARREN M. GOWERS • Biophysics Laboratories, School of Biological Sciences, University of
ROBERT GOWLAND • Department of Biochemistry, University of Cambridge, Cambridge, UK
CHARLOTTE A. HENDERSON • Biophysics Laboratories, School of Biological Sciences, University
of Portsmouth, Portsmouth, UK
ROBERT A. HOLLAND • Syngenta Crop Protection Research, Berkshire, UK; Centre for
Enzyme Innovation, University of Portsmouth, Portsmouth, UK
SIMON E. KOLSTOE • Reader in Bioethics, University of Portsmouth, Portsmouth, UK
DANIELA LOPES CARDOSO • Biophysics Laboratories, School of Biological Sciences, University of
SIAN ANGELA MARTIN • European Xenopus Resource Centre (EXRC), University of
MICHAEL J. MCCLELLAN • Ludwig Institute for Cancer Research Ltd, University of Oxford,
Oxford, UK
ANA MIKIĆ • Biophysics Laboratories, School of Biological Sciences, University of Portsmouth,
Portsmouth, UK
F. A. MYERS • Biophysics Laboratories, School of Biological Sciences, University of Portsmouth,
Portsmouth, UK
LILIYA NAZLAMOVA • Clinical and Experimental Sciences, South Academic Block,
Southampton General Hospital, Southampton, UK
TIMOTHY J. RAGAN • Leicester Institute of Structural and Chemical Biology, Department of
Molecular and Cellular Biology, University of Leicester, Leicester, UK
ix
x Contributors
SAMUEL C. ROBSON • Centre for Enzyme Innovation, University of Portsmouth, Portsmouth,

UK
NIKOLAOS TAIRIS • Senior Forensic DNA Analyst & Technical Witness Expert (Greece),
Augusta, GA, USA
HELEN A. VINCENT • Biophysics Laboratories, School of Biological Sciences, University of
JAKE F. WATSON • IST Austria, Klosterneuburg, Austria
GEORGE D. ZOUGANELIS • Human SciencesResearch Centre, College of Science &
Engineering, University of Derby, Derby, UK
Chapter 1
Classical Recombinant DNA Cloning

Ana Mikić, Arqam Alomari, and Darren M. Gowers
Abstract
Traditional molecular cloning involves a series of linked experimental steps performed with the overall goal
of isolating (“cloning”) a specific DNA sequence—often a gene. The main purpose of cloning is to study
either that DNA sequence or the RNA or protein product it encodes. Building on key enzymatic discoveries
in the late 1960s, gene cloning was pioneered in the early 1970s. Since then, DNA cloning and manipula-
tion have been used in every area of biological and biomedical research, from molecular genetics, structural
biology, and developmental biology to neurobiology, ancient DNA studies, and immunology. It is a
versatile technique that can be applied to a variety of starting DNA types and lengths, including cDNAs,
genes, gene fragments, chromosomal regions, or shorter fragments such as PCR products and functional
control regions such as enhancers or promoters. The starting DNA can originate from any cell, tissue, or
organism. In this chapter we will cover traditional (“classic”) molecular cloning strategy. This comprises six
linked stages in which (1) PCR is used to amplify a DNA region of interest that is then (2) digested with
restriction enzymes, alongside a selected vector, to produce complementary ends crucial for the two
molecules to be (3) ligated by an ATP-dependent DNA ligase, creating a recombinant DNA molecule.
The recombinant DNA is then (4) introduced into competent bacterial cells by transformation and
(5) grown on a selective agar media, followed by (6) colony-PCR for screening purposes. We provide a
worked example to demonstrate the cloning of an average-size gene (in this case the 2 kb DNA ligase A
gene) from E. coli into a common plasmid expression vector. We have included six color figures and two
tables to depict the key stages of a classical molecular cloning protocol. If you are cloning a segment of DNA
or a gene, remember that each DNA cloning experiment is unique in terms of sequence, length, and
experimental purpose. However, the principles of traditional cloning covered in this chapter are the same
for any DNA sequence; we have included a detailed notes section, so you should easily be able to transfer
them to your own work. Some of the following chapters in this volume will cover other, more recently
developed, cloning protocols.
Key words Molecular cloning, Gene cloning, Restriction endonucleases, Plasmid, PCR, Transforma-
tion, Bacteria
1 Introduction
1.1 Historical Before the 1970s, the largest challenge to the progression of chro-
Perspective mosomal and genetic research was lack of a reliable and reproduc-
ible method for isolating and analyzing DNA sequences of interest.
Garry Scarlett (ed.), DNA Manipulation and Analysis, Methods in Molecular Biology, vol. 2633,
https://doi.org/10.1007/978-1-0716-3004-4_1,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023
1
2 Ana Mikić et al.
This changed in the early 1970s when three key discoveries were
brought together to revolutionize genetics and initiate the field of
modern molecular biology.
The first discovery, in the late 1960s, occurred in the laboratory
of Werner Arber and Stuart Linn, whose group characterized the
first bacterial restriction endonucleases [1]. Restriction endonu-
cleases are a class of bacterial DNA-binding enzymes that evolved
as a defense against bacteriophage infection. They target and cleave
specific recognition sequences within bacteriophage genomes,
causing phage genome degradation. Although much attention
was given to the characterization of these enzymes, termed “restric-
tion factors,” their ability to cut specific DNA sequences was not
fully exploited until the laboratory of Daniel Nathans first used
them to map the Simian Virus 40 (SV40) genome [2]. Soon after,
many more restriction enzymes were isolated and their recognition
sequences determined, creating a way to selectively and specifically
cut DNA molecules. Today, thousands of restriction endonucleases
are known, with many hundreds available from commercial
suppliers.
The second key discovery that contributed to the development
of molecular cloning was made earlier in the 1960s by several
laboratories, including those of Martin Gellert, I. Robert Lehman,
Charles Richardson, and Jean Weigle. This was the discovery of a
class of enzymes able to perform the opposite function to restric-
tion endonucleases, namely, to join DNA ends. These are called the
DNA ligases [3, 4]. It is important to note that the formation of a
phosphodiester bond between two juxtaposed DNA ends (specifi-
cally, between a 5′-phosphate and 3′-hydroxyl group) by DNA
ligase is not a sequence-specific activity. Therefore, this discovery
provided a means to re-join any two DNA fragments cut by restric-
tion endonucleases. The first experiment to use restriction enzyme
digestion and subsequent ligation was performed in 1972 by Paul
Berg’s laboratory, successfully synthesizing the first recombinant
DNA molecule [5]. Although this confirmed the concept that the
DNA from any two species may be joined and a resulting recombi-
nant DNA molecule can be created, the process was long, labori-
ous, and had a low yield.
However, this changed with the third discovery—of bacterial
transformation by plasmids—that made it possible for the molecu-
lar cloning method to become a widely applicable technology.
Bacterial transformation was in fact discovered by Griffith in the
1930s, in studies on lethal and non-lethal bacterial strains
[6]. Transformation of bacterial cells enabled effective replication
of the created recombinant DNA molecule. However, its applica-
tion for the purpose of molecular cloning was not fully realized
until 1972, when Stanley Cohen and Herbert Boyer treated bacte-
rial cells with calcium chloride to induce the uptake of plasmids
carrying antibiotic-resistance genes [7]. This was a ground-
Classical Cloning 3
breaking study that set the stage for the first molecular cloning
experiment to be performed in 1973 by Boyer, Cohen, and Chang
[8]. Their method joined the individual digestion, ligation, and
transformation steps to pioneer gene cloning and lay the founda-
tion for the millions of molecular cloning experiments since.
1.2 Traditional Traditional molecular cloning consists of a set of linked experimen-

Molecular Cloning tal steps performed with the overall goal of isolating and replicating
Overview (“cloning”) a specific DNA sequence—often a gene—from a host
organism, in order to study it further. The chosen gene or region of
interest is combined with a plasmid to create a novel (not found in
nature) recombinant DNA molecule. The traditional plasmid clon-
ing protocol follows six steps, and these are clearly summarized in
Fig. 1. Prior to the experiment, careful consideration needs to be
made about the choice of plasmid vector, restriction enzyme(s),
bacterial cells, recombinant selection, and screening methods. In
the following short sections, we provide a little more background
on each of these stages and highlight important information to
consider.
1.3 Cloning Vectors A cloning vector is a small DNA molecule into which another DNA
molecule can be inserted without disrupting the stability of the
vector within a host organism. Cloning vectors can be of different
sizes and from different hosts. The most commonly used vectors
are bacterial plasmids, which are circular and typically several thou-
sand base pairs in size (2–10 kbp). Alternatively, bacteriophages,
cosmids, bacterial artificial chromosomes (BACs), yeast artificial
chromosomes (YACs), or mammalian artificial chromosomes
(MACs) have been developed (but are not covered further in this
chapter). Regardless of the type or size of a vector, all standard
cloning vectors must contain at least three structural features to
allow for the recombinant DNA to be made and replicated. A
vector must possess: (1) a multiple cloning site (MCS), also
known as a polylinker; (2) an origin of replication (ori), and (3) a
selectable marker gene.
A multiple cloning site is a region on a plasmid containing a
number of different restriction enzyme recognition sites, and into
which the exogenous DNA is incorporated during the cloning
experiment. An origin of replication allows a vector to replicate
independently of a host cell (such as an E. coli cell) to obtain
multiple copy numbers per cell cycle. A selectable marker gene
provides host cells with a selectable phenotype that can be used to
clearly distinguish between cells that contain the vector and the
ones that do not. This is frequently an antibiotic resistance gene
(such as for beta-lactamase), as only cells containing the vector will
be able to grow on a media containing the corresponding
antibiotic [9].
Fig. 1 Recombinant DNA cloning. A pictorial overview of a typical molecular cloning experiment, in which a
chosen DNA sequence is amplified by PCR and ligated into a plasmid vector; the recombinant vector is then
transformed into bacterial cells. There are six distinct steps, and these are shown in Panels A and B. Panel A:
Molecular biology steps. Step 1: PCR amplification of a gene or region of interest to give a DNA insert for
cloning (light blue). Step 2: restriction enzyme digestion of both the DNA insert ends (red and purple) and the
chosen plasmid (green), to give compatible, cohesive (“sticky”) ends. Step 3: ligation reaction between the cut
DNA insert and cut plasmid; a new recombinant DNA molecule is born. Panel B: Microbiology steps. Step 4:
Transformation of recombinant plasmid (blue/green) into competent bacterial cells (orange) and growth of
transformed bacterial colonies. Step 5: Selection of successfully transformed cells via antibiotic resistance
(positive selection). Step 6: Screening of selected cells by colony-PCR, followed by DNA sequencing of the
plasmid and insert
Some vectors contain additional features that allow for specific

downstream purposes. For example, expression vectors contain
structural parts required for the transcription of a recombinant
DNA sequence to obtain the protein it encodes. These features
include an inducible promoter, a ribosomal binding site (RBS), a
termination codon, the recognition sequence for polyadenylation
tail addition, and often an N- or C- terminal tag for easier purifica-
tion [10]. For a comparison between sub-cloning and expression
vectors, see Fig. 2. As various vectors are nowadays available for a
Classical Cloning 5
Fig. 2 Types of plasmid vector: cloning vectors vs. expression vectors. A pictorial comparison between the
essential structural components of a standard cloning plasmid vector (such as pUC19) and an expression
plasmid vector (such as pET28b). Panel A: A standard cloning plasmid must contain an origin of replication
(blue), a selectable marker (ampicillin resistance in this example, purple), and a multiple cloning site, MCS
(red). The MCS contains a single recognition sequence for at least a dozen different restriction enzymes (to aid
flexibility when cloning) and is often found within the LacZ operon (green). Panel B: An expression plasmid
must contain all the structural parts of a standard cloning plasmid vector (origin of replication, a selectable
marker, and multiple cloning site) as well as additional sequences necessary for protein expression.
These are: a RNA polymerase promoter (yellow), ribosome binding site (dark pink), poly-A signal (orange),
and a terminator (brown) sequence. It may also contain N- or C- terminal tags, such as histidine- or
glutathione-S-transferase-tag (black lines) to aid recombinant protein purification
wide range of experimental purposes, careful consideration is

required to select an optimal vector for your research. For tradi-
tional cloning purposes, the most commonly used vectors are plas-
mids, more specifically pUC19 and pBR322, while for gene
expression purposes (e.g., to overexpress the protein product of a
cloned gene), pBlueScript or pET vectors are a frequent choice.
1.4 Restriction Deciding on a restriction endonuclease for your cloning experi-

Endonucleases ment goes hand-in-hand with the selection of a cloning vector. This
is because your experiment will not be successful unless the recog-
nition sequence for the chosen restriction endonuclease is present
within its multiple cloning sites. There are many different
restriction endonucleases available that can broadly be divided into

two distinct groups depending on the ends they produce on a cut
DNA molecule—blunt or cohesive. Blunt ends are made by the
action of restriction endonucleases that cleave the DNA sequence at
the same nucleotide position on both strands and do not produce
free overhangs. Conversely, restriction endonucleases that cleave
the double-stranded DNA at different nucleotide positions gener-
ate unpaired bases at the either 3′ or 5′ ends, which are called
cohesive, or “sticky,” ends. Cohesive ends of the complementary
sequences can associate by hydrogen bonding, and this facilitates
the incorporation of the DNA insert into a vector by increasing the
stability of the recombinant DNA molecule prior to the ligation
[11]. Moreover, cohesive ends ensure that the target DNA is
inserted into a vector in a desired orientation (directional cloning),
which is especially important for protein expression purposes.
Directional cloning can also be achieved by choosing two different
restriction endonucleases, one to digest each end of the target DNA
[12]. The gene cloning example we show in this method uses
directional cloning, utilizing BamHI and NdeI enzymes.
1.5 Recombinant After selecting the DNA sequence, the restriction endonuclease(s),
DNA Production and the cloning vector to be used in your experiment, the next step
of the molecular cloning method is to use the Polymerase Chain
Reaction (PCR) to amplify the gene of interest and combine it with
the plasmid, thus making a recombinant molecule (Fig. 1a). This
involves designing a PCR primer pair that specifically flanks the
region of DNA you wish to amplify. For good specificity and
stringency, the forward and reverse primers are typically ~20 bases
or more in length. Rarely will you find a restriction endonuclease
recognition site perfectly adjacent to the DNA sequence you wish
to clone. Therefore, each primer should also contain an extra
(non-binding) section with the desired restriction enzyme recogni-
tion sequence, as illustrated in Fig. 1a, Step 1. As an example, the
forward and reverse primers used for cloning the E. coli Ligase A
gene are shown in Fig. 3.
Following PCR amplification of the target DNA, the product
(often referred to as the “insert”) is purified and ready for cloning.
The next step is to enzymatically digest both the DNA insert and
the vector you wish to insert it into, using the restriction endonu-
clease enzymes you chose earlier (Fig. 1a, Step 2). This step creates
the complementary free ends on the two DNA molecules, which
are then combined in the final step, ligation. In this step, a recom-
binant DNA molecule is created by the action of DNA ligase
(Fig. 1a, Step 3). The most frequent choice of a DNA ligase for
this purpose is the T4 DNA ligase, which uses ATP as a cofactor and
is capable of ligating both sticky and blunt ends.
Although ligation protocol does not vary considerably between
cloning experiments, the possible resulting molecules do. A ligation
reaction can produce three different output molecules, as shown in
Classical Cloning 7
Fig. 3 Example of PCR primer pair for amplifying the E. coli Ligase A (LigA) gene. The target LigA gene is
depicted as a heteroduplex with the top strand in black and bottom strand in grey. The regions of the forward
primer (left) and reverse primer (right) that are complementary to the LigA gene are shown in blue. Hydrogen
bonding between gene and primer during PCR amplification is indicated by blue dots between the strands. The
recognition sequences for restriction endonucleases (NdeI, CATATG and BamHI, GGATCC) are shown in red.
Black bases on the primers’ 5′-ends are random-sequence bases added to ensure restriction enzyme binding
and cutting
Fig. 4: DNA insert can be joined with the cloning vector resulting
in a recombinant DNA molecule, a vector can self-ligate without
the inclusion of the target DNA sequence, or two target DNA
sequences can be joined in tandem [13]. The undesired vector
self-ligation and tandem insert DNA forms will be more likely to
form if blunt-ended restriction endonucleases are used. However,
the type of restriction endonuclease used is not the only contribut-
ing parameter. The output of the ligation reaction will also depend
on other properties of the DNA molecules utilized, such as length/
size of the insert or vector, length of the cohesive ends (1, 2, 3, or
4 nucleotide overhangs), and the concentration ratio of the DNA
insert to the vector in the reaction. The latter is an important
parameter, and often ligation reactions require oversaturation
with the DNA insert compared to the vector to ensure
incorporation.
Fig. 4 Potential outcomes of a ligation reaction in molecular cloning. During any ligation reaction, the DNA
insert and cloning vector are first digested with the relevant restriction enzymes (top image). DNA strand
joining by a DNA ligase can then produce different outcomes: (1) the two ends of the linearized plasmid re-join
since the ends are close together in 3D space and more likely to meet each other and be resealed (undesired
outcome); (2) an insert and linearized vector meet and are joined successfully (desired outcome), or (3)
depending on the length of the inserts, free ends of the DNA insert join up to produce tandem (or more) repeats
(undesired outcome). The trick to cloning is to try a few different ratios of insert: linearized vector to favor
outcome (2)
1.6 Transformation The final steps of a typical cloning protocol aim to multiply the
synthesized recombinant DNA molecule in host cells (bacteria) and
to exploit various methods for the selection of the obtained colo-
nies. To multiply the recombinant DNA molecule, it must first be
introduced into the selected host cells in the fourth step of the
standard cloning protocol, transformation (Fig. 1b, Step 4). Simi-
lar to deciding on the appropriate restriction endonucleases and a
compatible vector, the choice of host cells in which you aim to
multiply your recombinant DNA molecules is also crucial for the
success of the experiment. This decision should be made early on
when designing the experiment and selecting the cloning vector, as
not all vectors can be taken up by all host cells.
In our case, using a plasmid vector, the most common choice is
to transform it into a bacterial cell. The available bacterial cells are
most often strains of Escherichia coli or Lactococcus lactis. These are
frequently engineered for protein expression, but some strains are
Classical Cloning 9
Fig. 5 Flowchart for selection of competent cells. This decision tree may help you select the best bacterial
strain for your cloning reaction. Work from left to right, and you can choose the bacterial strain best suited to
your downstream application. The cells used in our example method for cloning and expressing the LigA gene
(BL21 (DE3)) are underlined
not, so pay attention when selecting those you wish to use in your
experiment [14]. A useful flowchart to help you choose the right
cells is provided in Fig. 5. Other than the genetic constitution of
the bacterial cells used, the success of transformation will also
depend on the transformation method performed. The two distinct
methodological approaches are transformation by electroporation
or chemical transformation [15]. Transformation by electropora-
tion (also known as electropermeabilization) is achieved by apply-
ing a short, high-voltage pulse to bacterial cells. The electric shock
makes the cell membrane more permeable and susceptible to the
DNA uptake. This method is simple, fast, and gives high transfor-
mation efficiency for E. coli cells [16]. Alternatively, chemical trans-
formation is achieved by heat-shocking bacterial cells at 42 °C to
allow for the vector uptake. Prior to the heat shock, cells must be
treated with high salt concentrations to increase the cell membrane
permeability, and these are known as “competent” cells. Nowadays,
competent bacteria can be bought pre-treated and ready for trans-

formation. Once transformed, the host cells need to be grown on
plates of nourishing media and incubated under optimal conditions
before they can be examined for the presence of the recombinant
DNA molecule.
1.7 Selection and Whether the host cells will take up the recombinant DNA molecule
Screening can never be guaranteed, therefore, numerous methods have been
developed to assess the success of the steps carried out so far.
However, even with these methods developed, testing each indi-
vidual colony would be a laborious task if not for a selection step.
Selection is the fifth step of the standard cloning protocol (Fig. 1b,
Step 5), in which successfully transformed bacterial cells are
selected for the phenotype they exhibit (positive selection) or lack
(negative selection). The principle of positive selection is that cells
are selected for the presence of a property encoded by the vector, as
only cells containing the vector will be able to form colonies. The
examples are auxotrophy and the aforementioned antibiotic selec-
tion test, where only bacterial cells that have obtained an antibiotic
resistance gene carried by the vector will grow on a media contain-
ing the same antibiotic [17]. In contrast, the principle of negative
selection is based on successfully transformed bacterial cells not
exhibiting a property encoded by the vector and, therefore, being
unable to grow and form colonies. The examples are SacB-counter
selection or toxin-antitoxin system. By performing the selection
step, the number of obtained colonies is limited only to the ones
that have been successfully transformed and contain the vector.
This enables you to focus on assessing the smaller number of
colonies for the presence of the target recombinant DNA
molecule [18].
The purpose of the sixth and last step of a standard cloning
protocol is screening (Fig. 1b, Step 6). Often, selection and screen-
ing tests can be performed simultaneously, as in the case of the well-
known blue-white test exploiting the lactose (X-gal) metabolism
pathway and β-galactosidase enzyme activity. This test offers a fast
and simple way of assessing bacterial colonies for the presence of
the target recombinant DNA molecule through observation of the
plates with the naked eye. Alternatively, colony PCR is a rapid
screening method in which primers used in the first step of the
cloning experiment are repurposed for the detection of recombi-
nant DNA molecules. However, these and many other methods
(reporter gene or lethal gene assays) can be erroneous and give a
false-positive result [19]. Therefore, the best practice is always to
send samples of your grown colonies to be sequenced using Sanger
dideoxy sequencing or other available sequencing methods. We
provide an example of a standard cloning experiment in Fig. 6 for
the cloning of the E. coli Ligase A and Ligase B genes.
Classical Cloning 11
A M 1 2 B
3000 bp
2000 bp
1500 bp
M 1 2 3 4 5
1000 bp
C
3000 bp
2000 bp
500 bp 1500 bp
1000 bp
500 bp
Fig. 6 Example cloning results. The genes for DNA Ligase A and B were amplified from E. coli strain K-12,
cloned into plasmid pET28b, transformed into BL21(DE3) cells, checked by colony PCR, and sequenced. Panel
A: 1% (w/v) agarose gel with 1 kb marker (lane M) and samples of amplified Ligase A gene (lane 1, green
arrow) and Ligase B gene (lane 2, blue arrow). Panel B: Agar plates showing transformants for Ligase A (left
plate) and Ligase B (right plate). Panel C: 1.5% (w/v agarose gel with 1 kb marker (lane M) and samples of
colony-PCR reactions for five separate colonies from the Ligase A plate in Panel B. A positive result is visible in
lane 1. Panel D: Sanger dideoxy sequencing showing that the Ligase A gene is successfully cloned, without
mutations; the green arrow indicates the methionine start codon for Ligase A
1.8 Current and Since its first application in 1973, molecular cloning has become an
Future Applications essential technique utilized in every area of biological studies
including genetics, molecular cell biology, developmental biology,
neurobiology, neuroscience, and immunology. Its importance is
highlighted by the fact that nowadays, for a simple molecular
cloning experiment, you may choose between 240 available proto-
cols exploiting more than 3000 restriction endonucleases that rec-
ognize 230 different sequences, at least 1000 different cloning
vectors, and hundreds of available host cells [20]. Moreover, new
advances of this technology are continuously being developed, such
as TA cloning, TOPO cloning, sequence and ligation independent
cloning (SLIC), Gateway cloning, Gibson assembly, type IIS clon-

ing such as Golden Gate and modular cloning (MoClo), and many
others [21]. Some of these methods are covered in other chapters in
this book.
2 Materials
Ensure your laboratory is suitably registered and set up for molec-

ular microbiology work. Wear a lab coat, gloves, and appropriate
PPE at all times to avoid contamination and minimize the risk of
nuclease degradation of samples. Use molecular biology-grade
reagents and distilled, deionized, water for buffers.
2.1 Polymerase 1. DNA containing the target sequence, region, or gene that you
Chain Reaction (PCR) wish to clone. This can be in many different forms, including
and Agarose Gel intact cells, purified genomic DNA, plasmid preparations,
Electrophoresis DNA libraries, mitochondrial preparations, chloroplast pre-
parations, or previous PCR products (see Note 1). You will
need a ~20 μL stock containing 10 ng of the DNA in
nuclease-free water (0.5 ng/μL).
2. PCR primers that flank the DNA target sequence and that
contain the recognition sequence(s) of the chosen restriction
enzyme(s) (see Note 2). You will need a working stock of
10 μM in ~20 μL of nuclease-free water each.
3. PCR buffer (10× stock): 100 mM Tris–HCl, pH 8.6, 500 mM
KCl, 1.5 mM MgCl2, 50% (v/v) glycerol, 0.8% (w/v) IGEPAL
CA-630, 0.5% (w/v) Tween-20. Use 1× dilution.
4. Nucleotide mix: 10 mM dNTPs. Store at -20 °C.
5. Taq DNA Polymerase: 5 U/μL from a commercial supplier.
Store at -20 °C.
6. Thin-wall 0.2 mL polypropylene PCR tubes.
7. PCR thermocycler set with the following program: For the
selection of the annealing temperature (see Note 3).
8. Microcentrifuge tubes (1.5 mL).
9. DNA size ladder: a 500 bp—10 kb ladder provided with a 6×
DNA Gel Loading Dye. Bought from a commercial supplier
and stored at -20 °C.
10. A sterilized conical flask.
11. An agarose gel electrophoresis system. This includes a power-
pack, gel cassette with removable end seals, combs, agarose
powder (low endo-osmosis form), 10× TBE buffer stock,
10 mg/mL ethidium bromide (EtBr), and distilled water.
12. TBE buffer (10× stock). For 1 L add: 108 g Tris base, 55 g
boric acid, 900 mL distilled water, 40 mL 0.5 EDTA solution,
pH 8.0. To obtain the 1× TBE running buffer, dilute the 10×
TBE stock 10-fold in distilled water.
13. TBE running buffer (1×). For 1 L, add: 10 mL 10× TBE stock
to 900 mL distilled water. Add 50 μL of 10 mg/mL ethidium
bromide stock (0.5 μg/mL final concentration).
14. Small microwave oven.
15. An ultraviolet (UV) transilluminator capable of excitation at
302/312 nm (UV-B) or 365 nm (UV-A) for visualizing
DNA-ethidium bromide complexes in agarose gels. It should
be equipped with an LED camera for photo capture. Here we
use a G:BOX gel doc.
16. A commercial spin-column PCR purification kit. Use per man-
ufacturer’s instructions.
17. A small-volume UV spectrophotometer (e.g. a NanoDropTM
or PicoDropTM device).
2.2 Restriction 1. A cloning vector containing the same restriction enzyme rec-
Enzyme Digestion ognition sites that were introduced at the ends of the DNA
insert by the PCR primer pairs. Here we use the pET28b(+)
5368 bp expression plasmid vector with NdeI and BamHI
recognition sites with a kanamycin resistance gene. For the
guidance on vector selection (see Note 4).
2. NdeI restriction enzyme: 20 U/μL from a commercial sup-
plier. Store at -20 °C (see Note 5).
3. BamHI restriction enzyme: 20 U/μL from a commercial sup-
plier. Store at -20 °C (see Note 5).
4. Restriction enzyme buffer (10× stock), for example, rCutS-
martTM buffer: 200 mM Tris-acetate, 100 mM magnesium
acetate, 500 mM potassium acetate, 1 mg/mL recombinant
bovine serum albumin (BSA), pH 7.9 at 25 °C. Store at -20 °
C (see Note 6).
5. A water bath set to 37 °C.
2.3 Ligation 1. T4 DNA Ligase enzyme: 5 U/μL from a commercial supplier.

Store at -20 °C.
2. T4 DNA Ligase buffer (10× stock): 500 mM Tris–HCl,
100 mM MgCl2, 10 mM ATP, 100 mM DTT, pH 7.5 at 25 °
C. Obtained from a commercial supplier. Store at -20 °C.
3. Benchtop cooled-centrifuge capable of 13,000 rpm (15,100 ×
g) and chamber temperature of 0 °C.
2.4 Transformation Ensure your laboratory is prepared for the microbiology work.
While handling bacterial cells, you should be working using aseptic
techniques.
1. Competent bacterial cells. Selection depends on the down-
stream applications of the cloning experiment (for guidance
see Note 7). Here we used BL21-DE3 competent cells from
E. coli that can be used for protein expression. Cells are usually
obtained from a commercial supplier; refer to the manufac-
turer’s instructions for storing and avoid freeze/thawing until
being used. You may make your own competent cells, recipes
are available online for this.
2. Ice and ice bucket.
4. Freshly prepared SOC broth: 0.5% (w/v) yeast extract, 2%
(w/v) tryptone, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2,
10 mM MgSO4, 20 mM glucose, pH 7.0 (see Note 8). To
prepare 1 L of SOC media combine 20 g tryptone, 5 g yeast
extract, and 0.5 g NaCl. Stir the ingredients in 950 mL of
distilled water until they dissolve. Add 10 mL of 250 mM
KCl and adjust the pH to 7.0 with NaOH. Adjust the volume
to 1 L with distilled water. Transfer 250 mL to four clean Pyrex
bottles. Sterilize each by autoclaving at 121 °C (and 15 psi) for
20 min on liquid cycle with the cap loosely attached by auto-
clave indicator tape. Before using the media add 5 mL of sterile
2 M MgCl2 solution and 20 mL of sterile 1 M glucose solution,
gently mix.
2.5 Selection 1. Freshly prepared and pre-warmed (37 °C) SOC media selec-
tion plates (see Note 9). To prepare 1 L of SOC media combine
20 g tryptone, 5 g yeast extract, and 0.5 g NaCl. Stir the
ingredients in 950 mL of distilled water until they dissolve.
Add 10 mL of 250 mM KCl and adjust the pH to 7.0 with
NaOH. Adjust the volume to 1 L with distilled water. Add
1.5 g of bacto agar. Transfer 250 mL to four clean Pyrex
bottles. Sterilize each by autoclaving at 121 °C (and 15 psi)
for 20 min on liquid cycle with the cap loosely attached by
autoclave indicator tape. Once cooled to ~60 °C, add 5 mL of
sterile 2 M MgCl2 solution, 20 mL of sterile 1 M glucose
solution, and 50 mg/mL kanamycin (see Note 10), gently
mix. Pour approximately 15 mL into each labeled petri dish
(final concentration of 50 μg/mL kanamycin). Label, seal, and
store inverted at 4 °C until needed.
3. Sterile 50-mL polypropylene tubes for liquid media growth.
4. Sterile, disposable plastic spreader.
5. Microbiology incubator-shaker set to 37 °C.
2.6 Screening by 1. Sterile 50-mL polypropylene tubes for liquid media growth.
PCR 2. The same number of sterile microcentrifuge tubes.
3. SOC liquid broth.
4. Nuclease-free water: high-quality molecular biology grade;
stored at 4 °C.
5. Benchtop cooled-centrifuge capable of 13,000 rpm (15,100 ×
g) and chamber temperature of 0 °C.
6. Taq PCR master-mix (1×): 10 mM Tris-HCl, pH 8.6, 50 mM
KCl, 1.5 mM MgCl2, 0.2 mM dNTPs (50 μM each), 5% (v/v)
glycerol, 0.08% (w/v) IGEPAL CA-630, 0.05% (w/v) Tween-
20, 2 μM forward primer, 2 μM reverse primer, 25 Units/mL
Taq DNA Polymerase. Prepare for the final reaction volume of
25 μL. For multiple PCR reactions (see Note 11). Keep on ice.
7. A laboratory vortex mixer.
8. PCR thermocycler set with the same program as used for PCR
amplification of the DNA insert. Increase the number of cycles
to 40.
9. Agarose gel electrophoresis equipment; same as in
Subheading 2.1.
10. A commercial spin-column plasmid purification kit. Use per
manufacturer’s instructions.
3 Methods
Order and prepare all the materials and reagents in advance. Con-
duct all steps at room temperature unless otherwise specified. Wear
lab coat, gloves, and appropriate PPE at all times to avoid contami-
nation and minimize the risk of nuclease degradation of samples.
3.1 Polymerase 1. Prepare a single 25 μL PCR reaction by adding the following

Chain Reaction (PCR) components in a 0.2 mL PCR tube: 1 μL of 0.5 ng/μL DNA
and Agarose Gel insert, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse
Electrophoresis primer, 2.5 μL of 10× PCR buffer, 1 μL of 10 mM dNTPs,
17.5 μL nuclease-free water. Mix gently by pipetting.
2. To the prepared PCR mix in Step 1 above, add 1 μL of the Taq
DNA Polymerase.
3. Close the lid of the PCR tube and place it in the thermocycler.
Run the 3-step standard PCR cycling under the previously set
program outlined in Table 1.
4. Prepare 100 mL of 1% agarose gel. In a conical flask, add 1 g of
powder agarose to 10 mL of 10× TBE and bring up to 100 mL
with distilled water (see Note 12). Bring the solution to the boil
by heating it up in the microwave for 2–3 min, checking every
Table 1
PCR cycle conditions
PCR step Temperature (°C) Time (s)

Denaturation 95 60
9
Melting 95 = 30
Annealing 59 30 cycles 30
;
Elongation 72 30
Final elongation 72 300
Hold 4 1
30 s. Take care to wear a padded glove—molten agarose can

give nasty burns. Let the solution cool down to ~50 °C on the
benchtop, then add 5 μL of 10 mg/mL ethidium bromide and
mix by swirling.
5. Slowly pour the gel mix into a gel casting cassette and add
comb(s). Leave the gel to set for ~30 min.
6. Once the gel has set, remove the end seals of the cassette and
place it into the gel tank so that the comb is at the negative
(black) electrode. Add 1× TBE running buffer (with 0.5 μg/
mL EtBr) to the tank until the buffer just covers the gel (see
Note 13), then remove the comb(s) and clean the wells.
7. Take two microcentrifuge tubes and label them “S” for sample
and “L” for the DNA size ladder.
8. In each of the two separate 0.5 mL microcentrifuge tube, add
1 μL of the 6× DNA gel loading dye and 8 μL of nuclease-free
water.
9. Following the PCR, transfer 1 μL from the PCR tube into the
“S” microcentrifuge tube—this is your amplified DNA insert.
Mix gently by pipetting, take care not to introduce bubbles.
10. Prepare the DNA ladder by adding 1 μL of the DNA ladder to
the “L” microcentrifuge tube. Mix gently by pipetting, take
care not to introduce bubbles.
11. Load all of the 10 μL prepared DNA ladder and 10 μL of the
PCR sample into separate wells of the gel.
12. Run the gel at 130 V for 30 min.
13. Visualize the gel using an ultraviolet (UV) transilluminator.
Examine the gel to determine if the PCR amplification of
your DNA insert has worked and is the correct size. Save an
electronic copy of the gel image.
14. Use the commercial microspin column purification kit to purify

the dsDNA from the PCR samples for which a positive result
was observed. Refer to manufacturer’s instructions.
15. Use a small-volume UV spectrophotometer to obtain the con-
centration of the dsDNA in the purified PCR sample by pipet-
ting 2 μl of the sample onto the bottom optical surface and
taking the reading.
3.2 Restriction 1. Take a clean microcentrifuge tube and label it “Vector” or “V.”
Enzyme Digestion To the tube add 1 μg of the plasmid vector, 1 μL of the NdeI
enzyme, 1 μL of the BamHI enzyme, 3 μL of the rCutSmartTM
buffer, and bring up to 30 μL with nuclease-free water.
2. Take a clean microcentrifuge tube and label it “DNA” or “D.”
To the tube, add 1 μg of the purified DNA sample from the
PCR reaction, 1 μL of the NdeI enzyme, 1 μL of the BamHI
enzyme, 3 μL of the rCutSmartTM buffer, and bring up to
30 μL with nuclease-free water.
3. Incubate both tubes in a water bath at 37 °C for 1 h.
3.3 Ligation 1. Take a clean microcentrifuge tube and label it “Ligation” or

“L.” To the tube add 100 ng of the restriction enzyme treated
vector from the “V” tube, 112 ng of the insert DNA from the
“D” tube, 1 μL of T4 DNA Ligase, 1 μL of the 10× T4 DNA
Ligase buffer, and bring up to 10 μL with nuclease-free water
(see Notes 14–16).
2. Mix the “L” tube reaction gently, and ensure it is all at the
bottom of the tube by pulsing it in a centrifuge at 11,000× g for
7 s.
3. Incubate the “L” tube at room temperature for 3 h or at 4 °C
overnight (see Note 17).
3.4 Transformation 1. Thaw the competent cells on ice for 10–30 min. Thaw as many
single-use competent cell tubes as transformation reactions you
aim to conduct. Label them “T1,” “T2,” etc.
2. Transform the cells by adding 5 μL of the “L” reaction mix to
each of the competent cell mixtures thawed (“T1,” “T2,”
etc.). Mix by gently flicking the tube 4–5 times.
3. Incubate the tubes labeled “T” on ice for 30 min (see Note 18).
4. Heat shock the cells by placing the “T” tubes in water bath at
exactly 42 °C for exactly 45 s (see Note 19). Do not mix or
shake.
5. Immediately place the “T” tubes back on ice for another 2 min.
3.5 Selection 1. To each “T” tube add 250 μL of the pre-warmed SOC liquid
media and cap the tube.
2. Incubate the “T” tubes in water-bath at 37 °C for 1 h. Shake
vigorously (225 rpm) or rotate (see Note 20).
3. Mix the cells by flicking and inverting the “T” tubes. In the
clean microcentrifuge tubes, perform several 10-fold serial
dilutions of the “T” tube contents in the SOC liquid media.
We recommend three 10-fold dilutions.
4. Using a disposable plastic spreader, spread 50–100 μL of each
dilution onto a separate SOC selection plate, labeled with the
same number as the transformation reaction tube, by using a
spread plate technique. Work using aseptic techniques. You
should also include two control plates (see Note 21).
5. Incubate the inverted plates overnight at 37 °C. Carefully
examine the plates the next day for colonies.
3.6 Screening by 1. Depending on how many colonies have grown on your selec-
PCR (Colony PCR) tion plate(s) and how many you wish to screen, take the same
number of universal (20 mL) and microcentrifuge (1.5 mL)
tubes. Label them “A,” “B,” “C,” etc., so that each universal
tube matches one microcentrifuge tube.
2. To each universal tube add 5 mL of the liquid SOC media.
3. To each microcentrifuge tube add 10 μL of nuclease-free water.
4. Using a sterile pipette tip, pick a single colony from the selec-
tion plate. Dip the tip into the labeled microcentrifuge tube
containing 10 μL nuclease-free water and swirl for 10 s. Take
the pipette tip out of the microcentrifuge tube and drop it into
the universal tube containing liquid SOC media with the
matching label. Repeat this step for every colony you wish to
screen using a different set of labeled microcentrifuge/univer-
sal tubes (see Note 22). Set the universal tubes on the side of
your bench.
5. Collect all of the used microcentrifuge tubes and spin them in a
centrifuge for 2 min at maximum speed (15,000× g). You
should observe a pellet and supernatant.
6. Label the same number of PCR tubes to match one of the
microcentrifuge tubes as “A,” “B,” “C,” etc. To each PCR
tube add 2.5 μL of the supernatant from the corresponding
microcentrifuge tube.
7. To each PCR tube add 22.5 μL of the previously prepared PCR
master-mix.
8. Close the lid of PCR tubes and place them in the thermocycler.
Run the 3-step standard PCR cycling under the previously set
program outlined in Table 1 with the number of cycles
increased to 40.
9. To visualize the PCR samples on an agarose gel, refer to

Subheading 3.1.
10. A positive colony-PCR result with a single clear band of the
expected size means you have successfully cloned your gene—
congratulations! For the example of results (see Note 23).
11. To confirm that the insert is correct and that there are no
unforeseen mutations in it, you must send a sample of the
cloned plasmid for sequencing. So, for PCR samples where a
positive result was observed, collect the corresponding univer-
sal tubes (with the tip and SOC media) and incubate them
overnight at 37 °C with constant shaking at 225 rpm (see
Note 24).
12. Use a plasmid minipreparation kit to purify your plasmid con-
taining the cloned DNA; use the manufacturer’s instructions.
4 Notes
1. Before any wet lab work decide on the purpose of your cloning
experiment. Selection of the cloning vector, restriction
enzymes, and competent bacterial cells will depend upon the
further applications of the cloned sequence of interest. Here we
aim to clone Escherichia coli DNA ligase A (ligA) gene
(2016 kb) using directional cloning (two restriction enzymes)
into an expression vector (pET-28b), which will be trans-
formed into competent cells capable of protein production
(BL21(DE3)) to obtain the 671aa monomer. For guidance
on choosing a vector and competent cells appropriate for
your experimental purpose (see Notes 4 and 7).
2. When designing your primers refer to the guidelines outlined
in Table 2. You can also use Fig. 1 as a visual aid.
3. Annealing temperature depends on the melting temperature
(Tm) of the primers used. You should aim for 5 °C below the
calculated Tm and for it to be in the range of 45–68 °C.
Annealing temperature can be optimized by performing an
annealing screen: a temperature gradient PCR starting 5 °C
below the calculated Tm.
4. When selecting a cloning vector consider the following
qualities:
(i) It must possess an origin of replication.
(ii) A high replication rate is desirable to obtain a high copy
number per cell cycle of a transformed cell.
(iii) It should possess a range of restriction enzyme recognition
sites to clone into. It must possess the restriction site for the
selected restriction enzymes to be used for target DNA
Table 2
Primer design instructions
Recommended (Do) Not recommended (Do not)

Make primers 15–30 bases in length Multiple di-nucleotide repeats or long runs of
single bases (maximum of 4 bases)
Aim for 40–60% GC content with uniform Long stretches of G or C repeats
distribution
Include one C or G base at the 3′ end No more than three Cs or Gs in a row at the 3′ end
Tm of 55–70 °C, as close as possible between the Restriction site on the very end of the primer
two primers and within 5 °C range. Use websites sequence: add a few bases before/after it to allow
(such as OligoCalc [22]) to calculate the Tm of enzyme binding
each primer
Check if primers form any secondary structures
(hairpins, etc.)
Add restriction enzyme recognition sequences.
Check that these sequences are not, by any
chance, also within your DNA target
sequence insertion. Most cloning or expression vectors

possess multiple cloning sites for this purpose. Selecting
two different restriction enzymes ensures the DNA insert
to be ligated is inserted in a predetermined direction (direc-
tional cloning).
(iv) It should be comparatively small to the bacterial cells it will
be transformed into. This allows for easier manipulation
and cell transformation.
(v) It needs to have one or more selectable marker genes, one
of which must code for an enzyme (such as beta-lactamase)
that inactivates the antibiotic added to the selection plates.
(vi) Consider the purpose of your experiment. If you aim to
express the protein encoded by the DNA insert, your vector
must contain both a promoter sequence (T7 is the most
common) and a ribosome binding site (RBS). Consider
whether you will require a C- or N-terminal tag for later
purification.
5. Both NdeI and BamHI introduce “sticky” (cohesive or asym-
metric) ends, as opposed to the “blunt” (flush) ends. However,
if you work with restriction enzymes that introduce “blunt”
ends, dephosphorylate the vector to avoid a high background
level of plasmid self-ligation. This can be done by adding CIP
(calf alkaline phosphatase) or SAP (shrimp alkaline phospha-
tase) to the reaction following the restriction enzyme digestion
step. The alkaline phosphatases can be inactivated by heating
once their reaction is completed.
6. If you wish to use a different buffer for the restriction digestion

reactions, ensure it is compatible with both of the restriction
enzymes used.
7. When deciding on the competent cells to be used, you should
consider the downstream applications of the experiment, the
transformation method you wish to perform
(electroporation vs. chemical), the efficiency of the transforma-
tion method, and the genotype of the cell. Refer to Fig. 5 for
guidance; this shows you a flowchart of which competent cells
would be the most appropriate for your experiment.
8. Standard LB media can also be used, however, SOC media
gives 2-fold higher transformation efficiency.
9. Selection plates can be used either warm or cold, wet or dry
without affecting the transformation efficiency. However, it is
easier to spread the bacterial colonies on warm, dry plates
which allow for more rapid colony formation.
10. Here we add fresh kanamycin since that is the antibiotic against
which pET-28b(+) vector carries a resistance gene. If you are
using a different vector, add the same amount of the antibiotic
that your vector is carrying the resistance gene against.
11. When preparing a PCR master-mix for multiple PCR reactions,
multiply the volume of every component apart from the DNA
template by the number of PCR reactions you wish to perform
and add 1 μL to obtain the total volume of each component to
be added in the master-mix. In this way, you will prepare a
sufficient amount of the PCR master-mix for all the reactions
you wish to perform and a small spare volume to allow for
pipetting error.
12. To obtain a high-quality gel and avoid crystal formation in the
gel, filter the 10× TBE as you are adding it to the conical flask
by using a 15-mL syringe and a sterile 0.22 μM polyethersul-
fone (PES) filter.
13. Before pouring the 1× TBE buffer into the gel tank, add
ethidium bromide to it. DNA is negatively charged, while
ethidium bromide is positively charged. Therefore, EtBr will
run in the opposite direction of the DNA when you run the
gel. As a result, your gel will be differentially intense, with
bright bands at the top (where the concentration of EtBr is
high) and faded at the bottom. Adding EtBr to the buffer levels
the intensity of the DNA bands on the resolved gel. If you do
not add EtBr to the running buffer, you can soak the gel for an
hour in the EtBr solution after it has been run and rinse with
water. This will even out the staining and it can also be per-
formed to stain the gel if you forgot to add EtBr to your gel in
the first place.
14. The recommended molar ratio of vector:insert DNA is 3:1

when cloning a typical-size insert into a plasmid vector that is
larger than the insert DNA. However, the ratio varies on type
of the vector and can be between 3:1 or 1:3. To calculate the
amount of insert DNA to be added to achieve the desired ratio,
use the following equation:
ng of vector × kb size of insert insert
× molar ratio of = ng of insert
kb size of vector vector
The recommended amount of DNA is 100–200 ng per ligation

reaction.
15. Use the DNA concentration in the PCR sample reading taken
by the spectrophotometer to calculate the volume of your
sample that contains the target ng of the DNA insert. You
can do so by applying the Beer-Lamber Law.
16. If the obtained amount of DNA insert from the PCR reaction
is too low to achieve 100 ng of DNA in the 10 μL ligation
reaction, scale up the reaction volume as necessary. Increase
the volume of buffer added appropriately to achieve 1×. It is
not necessary to increase the volume of T4 DNA ligase added,
as 1 μL should be sufficient for larger volume reactions.
17. It is optional to heat-inactivate the T4 DNA ligase following
the incubation step; if you do, heat it up to 65 °C for 10 min
in a hot block, before cooling on ice.
18. A 2-fold loss in transformation efficiency should be expected
for every 10 min you shorten this step.
19. Timing of this step is very important and can vary for the
competent cells used. Refer to manufacturer’s instructions
and perform this step exactly as instructed.
20. These are the optimal conditions for outgrowth to occur and
achieve best cell recovery and expression of antibiotic resis-
tance. Shaking or rotating gives a 2-fold increased transfor-
mation efficiency. For every 15 min you shorten this step,
expect 2-fold loss in transformation efficiency.
21. Two control plates should be present: one that has competent
cells only (which should not grow if the antibiotic is working)
and another that has competent cells transformed with a
positive control plasmid. A positive control plasmid is a widely
used plasmid (pUC19, pBR322, or pBlueScript) that contains
the same antibiotic resistance gene that is present in your
media but does not contain your target DNA insert. If the
competent cells transformed with a positive control plasmid
grow, this confirms the cells are working.
22. Performing this step creates a stock of bacterial cells contain-

ing only the cells identical to the picked colony. If the screen-
ing test shows a positive result, i.e., cells of this colony contain
a plasmid with the DNA insert, you have successfully cloned
your target DNA sequence and have a bacterial culture that
can serve as a stock for further experiments.
23. An example of a positive colony PCR experiment conducted
following the outlined protocol is shown in Fig. 6.
24. Screening the bacterial colonies by PCR amplification is the
fastest method of verifying if the competent cells have success-
fully been transformed with a vector containing the insert.
Alternatively, positive (expression of a lethal gene) or negative
(blue-white screening) selection tests could be used. The most
accurate screening method, and a step you should always
include, is to send your cloned plasmid samples to be
sequenced by Sanger dideoxy sequencing. When your sequenc-
ing results come back, carefully check every nucleotide position
in your cloned insert to ensure you do not have unexpected
mutations.
References
1. Linn S, Arber W (1968) Host specificity of 8. Cohen SN, Chang ACY, Boyer HW, Hellingt
DNA produced by Escherichia coli, in vitro RB (1973) Construction of biologically func-
restriction of phage fd replicative form. Proc tional bacterial plasmids in vitro. Proc Natl
Natl Acad Sci U S A 59(4):1300–1306 Acad Sci U S A 70(11):3240–3244
2. Danna K, Nathans D (1971) Specific cleavage 9. Preston A (2003) Choosing a cloning vector.
of Simian Virus 40 DNA by restriction endo- Methods Mol Biol 235:19–26
nuclease of hemophilus influenzae. Proc Natl 10. Carter M, Shieh J (2015) Chapter 10 – Molec-
Acad Sci U S A 68(12):2913–2917 ular cloning and recombinant DNA
3. Kellenberger G, Zichichi ML, Weigle JJ (1961) technology. In: Carter M, Shieh J (eds) Guide
Exchange of DNA in the recombination of to research techniques in neuroscience, 2nd
bacteriophage λ. Proc Natl Acad Sci U S A edn. Academic, New York, pp 219–237
47(6):869–878 11. Mertz JE, Davis RW (1972) Cleavage of DNA
4. Meselson M, Weigle JJ (1961) Chromosome by R1 restriction endonuclease generates cohe-
breakage accompanying genetic recombination sive ends. Proc Natl Acad Sci U S A 69(11):
in bacteriophage. Proc Natl Acad Sci U S A 3370–3374
47(6):857–868 12. Green MR, Sambrook J (2020) Cloning in
5. Jackson DA, Symons RH, Berg P (1972) Bio- plasmid vectors: directional cloning. Cold
chemical method for inserting new genetic Spring Harb Protoc 2020(11):485–488
information into DNA of Simian Virus 40: 13. Upadhyay A, Upadhyay K (2009) Recombi-
circular SV40 DNA molecules containing nant DNA technology. In: Basic molecular
lambda phage genes and the galactose operon biology. Himalaya Publishing House, Global
of Escherichia coli. Proc Natl Acad Sci U S A Media, pp 452–506
69(10):2904–2909 14. Fakruddin M, Mohammad Mazumdar R, Bin
6. Griffith F (1928) The significance of pneumo- Mannan KS, Chowdhury A, Hossain MN
coccal types. J Hyg 27(2):113–159 (2013) Critical factors affecting the success of
7. Cohen SN, Chang ACY, Hsu L (1972) Non- cloning, expression, and mass production of
chromosomal antibiotic resistance in bacteria: enzymes by recombinant E. coli. ISRN Bio-
genetic transformation of Escherichia coli by technol 2013:1–7
R-factor DNA. Proc Natl Acad Sci U S A 15. Hanahan D, Jessee J, Bloom FR (1991) Plas-
69(8):2110–2114 mid transformation of Escherichia coli and
other bacteria. Methods Enzymol 204 and preventing false positives. In: Brown G
(C):63–113 (ed) Molecular cloning – selected applications
16. Dower WJ, Miller JF, Ragsdale CW (1988) in medicine and biology. In Tech, Rijeka
High efficiency transformation of E. coli by 20. Sambrook J, Russell DW (2001) Molecular
high voltage electroporation. Nucleic Acids cloning: a laboratory manual, vol 1, 3rd edn.
Res 16(13):6127–6145 Cold Spring Harbor Laboratory Press,
17. Manna S, Harman A, Accari J, Barth C (2013) New York
Altering the selection capabilities of common 21. Plasmids 101 A Desktop Resource Plasmids
cloning vectors via restriction enzyme 101: A Desktop Resource (3rd edn) (2017).
mediated gene disruption. BMC Res 6(1):1–9 Retrieved November 13, 2021, from www.
18. Nicholl DST (2002) Selection, screening and addgene.org
analysis of recombinants. An introduction to 22. Kibbe WA (2007) OligoCalc: an online oligo-
genetic engineering. Cambridge University nucleotide properties calculator. Nucleic Acids
Press, Cambridge, pp 132–150 Res 35. (Web Server issue)
19. Padmanabhan S, Banerjee S, Mandi N (2011)
Screening of bacterial recombinants: strategies
Chapter 2
A Sequence- and Ligation-Independent Cloning (SLIC)

Procedure for the Insertion of Genes into a Plasmid Vector
Robert A. Holland
Abstract
Molecular cloning is a routine technique for many laboratories with applications from genetic engineering
to recombinant protein expression. While restriction-ligation cloning can be slow and inefficient, ligation-
independent cloning uses long single-stranded overhangs generated by T4 DNA polymerase’s 3′ exonu-
clease activity to anneal the insert and plasmid vector prior to transformation. This chapter describes a fast,
high-efficiency protocol for inserting one or more genes into a vector using sequence- and ligation-
independent cloning (SLIC).
Key words SLIC, PCR, Cloning, T4 polymerase, Genetic engineering, Protein expression
1 Introduction
The generation of recombinant DNA by molecular cloning is

widely performed in biotechnology laboratories for applications
such as heterologous protein expression and genetic engineering.
Traditional cloning involves generation of “sticky ends” on the
vector and insert using restriction enzymes, removal of 5′ phos-
phate by alkaline phosphatase, and ligation, making it time-
consuming and inefficient [1]. With the widespread use of poly-
merase chain reaction (PCR) beginning in the early 1990s, a num-
ber of ligase-free techniques of were developed [2–4]. Ligation-
independent cloning (LIC) specifically utilizes the 3′ exonuclease
(proofreading) ability of T4 DNA polymerase and complementary
primers designed to lack one of dATP, dTTP, dCTP, or dGTP for a
sequence of 10–12 bp. Once amplified by PCR, the vector and
insert are treated separately with T4 polymerase and just the dNTP
which is missing from the sequence, generating single-stranded
complementary overhangs of fixed length, which can then be
annealed and transformed directly into E. coli, which repair the
“nicked” DNA backbone.
https://doi.org/10.1007/978-1-0716-3004-4_2,
25
26 Robert A. Holland
Fig. 1 General concept of SLIC. The gene of interest is amplified using primers with 5′ sequences (typically
15–40 bp) complementary to the insertion site within the vector. Incubation of the resulting PCR product with
T4 DNA polymerase generates complementary overhangs. Similarly, the vector is linearized either by
restriction digestion or PCR and overhangs generated by T4 DNA polymerase. When mixed, the insert and
vector anneal to form a nicked plasmid which can be transformed directly into competent cells where gaps in
the sequence are repaired
A progression of LIC procedure is sequence- and ligation-

independent cloning (SLIC) [5–7], whereby specific sequences
are replaced by longer complementary overhangs (15–40 bases).
Following exonuclease treatment, the resulting insert-vector con-
structs contain gaps in the sequence which are subsequently
repaired inside the host cell by recombination machinery (Fig. 1)
[8, 9]. The flexibility, directionality, and high efficiency of SLIC and
similar techniques have been used for the linking together of mul-
tiple fragments into chimeric sequences several kilobases long or
the insertion of affinity tags for downstream protein purification
[1, 6, 10]. While several proprietary enzyme mixes are available
commercially, they can often be prohibitively expensive for produc-
tion of large number of clones. This chapter details our cost-
effective and high-efficiency protocol for the cloning of a plasmid
construct containing one or more inserts using 15 bp complemen-
tary overhangs.
Sequence and Ligation-Independent Cloning 27
2 Materials
2.1 Molecular 1. Thermocyler.

Biology 2. Primers – (sense & antisense) for each insert and vector (see
Note 1).
3. NanoDrop 2000 spectrophotometer.
4. Thin-walled 200 μL PCR tubes.
5. Deoxynucleotide triphosphate mix (dNTPs) – 2.5 mM each
(see Note 2).
6. Nuclease-free H2O.
7. Phusion High-Fidelity DNA Polymerase & 5× HF buffer.
8. Template DNA for insert.
9. Plasmid vector (see Note 3).
10. MinElute PCR cleanup kit (Qiagen).
11. Fast digest DpnI (Thermo Scientific).
12. T4 DNA polymerase (NEB) (see Note 4).
2.2 Gel Analysis 1. Tris-acetate EDTA (TAE) 50× stock: dissolve 242 g tris base,
57.1 mL glacial acetic acid, and 100 mL 0.5 M EDTA pH 8.0,
topped up to 1 L with deionized H2O.
2. 1% agarose gel: TAE, 10 g/L agarose.
3. Ethidium Bromide.
4. 6× DNA loading dye.
5. DNA ladder (1 kbp/100 bp).
6. Gel tank.
7. UV transilluminator suitable for agarose gel visualization.
2.3 Plasmid 1. Water bath.

Preparation 2. Ultracompetent E. coli DH5α cells.
3. Lysogeny broth (LB): 10 g/L tryptone, 5 g/L yeast extract,
10 g/L NaCl, pH 7.0.
4. LB agar plates: LB, 10 g/L agar, 1/1000 dilution antibiotic
stock (see Note 5).
5. Antibiotics: kanamycin (50 mg/mL) or ampicillin (100 mg/
mL) or chloramphenicol (34 mg/mL).
6. Shaking incubator.
7. Qiaprep Spin Miniprep Kit (Qiagen).
3 Method
3.1 PCR See Note that unless specified, all steps should be carried out on ice.
Amplification of Insert
1. Dissolve the primers in nuclease-free H2O, aiming for a final
and Vector
concentration of 50–100 μM. Measure the exact concentration
using the NanoDrop 2000 spectrophotometer.
2. In 200 μL PCR tubes (one for each insert or vector), prepare
150 μL reaction mixture for the insert(s): 30 μL 5× Phusion
buffer, 0.5 μM forward primer, 0.5 μM reverse primer, 200 μM
dNTPs (each), 0.2–0.5 ng/μL DNA template, 0.02 U/μL
Phusion polymerase, topped up with nuclease-free H2O, and
mix thoroughly by pipetting. Split each reaction mixture
between 6× 25 μL reactions in separate PCR tubes. Reactions
can be overlaid with mineral oil (see Note 6).
3. Place each of the six reaction tubes (see Note 7) containing
insert or vector with equal spacing across the thermocycler and
program the thermocycler as follows:
1 cycle Initial denaturation, 98 °C, 10 s, 1 cycle
25 cycles Denature, 98 °C, 10 s
Anneal, 50–70 °C gradient, 30 s.
Extension, 72 °C, 15–30 s per kb (see Note 8).
1 cycle Final extension, 72 °C, 5 min.
4. While the PCR amplification is running, set up the gel tank
with a 1% agarose gel with TAE buffer. Load 5 μL from each
reaction tube, each mixed with 1 uL 6× DNA loading dye, into
separate wells of a 1% agarose gel, flanked by DNA ladder, and
run at 100 V, 30 min (for 100 mL gel). Visualize the gel using a
UV transilluminator and decide on the optimal annealing tem-
perature for vector and insert (see Note 9).
5. Scale up the amplification by repeating steps 2 and 3, except
with all 25 μL reactions at the optimal annealing temperature
decided on in step 4.
6. Pool reactions from each amplicon and remove 10 μL for
further analysis. Add DpnI and 10× fast digest buffer (5 μL
each per 50 μL) and incubate in the thermocycler at 37 °C for
10 min, followed by 4 °C (see Note 10).
7. Purify the amplicons using a PCR reaction cleanup kit, follow-
ing the manufacturer’s instructions, ensuring the product is
eluted in nuclease-free H2O. Measure DNA concentration
using a Nanodrop 2000 spectrophotometer.
8. Mix insert and vector in a molar ratio of 2.5:1 (0.0625 pmol
insert & 0.025 pmol vector), 1× T4 polymerase buffer and
0.5 U T4 polymerase, topped up 10 μL with nuclease-free
H2O. Incubate for 10 min at 25 °C then place on ice. Use

immediately for transformation and store the remainder at -
20 °C.
3.2 Transformation 1. In separate 15 mL polypropylene tubes, mix 2.5 μL of each

and Sequencing ligation reaction with 50 μL chemically competent DH5α cells
and incubate 10 min on ice. Meanwhile, pre-warm a water bath
to 42 °C and LB to 37 °C.
2. Heat shock the transformation mixtures by incubating at 42 °C
for 45 s then immediately transfer to ice.
3. Add 1 mL warm, sterile LB to each transformation mixture and
incubate in an orbital shaking incubator at 37 °C, 220 rpm,
60 min.
4. Pipette 100 μL of each transformation mixture onto LB agar
plates with appropriate antibiotics and spread evenly (see Note
11). Incubate overnight (16 h) at 37 °C.
5. Count the number of colonies on the plates and calculate the
transformation efficiency (see Note 12). Pick a number of
colonies (at least four) from each plate and use to inoculate
10 mL sterile LB containing appropriate antibiotics. Incubate
in an orbital shaking incubator at 37 °C, 220 rpm, overnight
(16 h).
6. Transfer cultures to 15 mL polypropylene centrifuge tubes and
pellet cells at 3000 g, 10 min, 4 °C in a benchtop centrifuge.
Being careful not to disturb the pellet, pour off the
supernatant.
7. Purify plasmids from the cell pellet using the QIAprep Mini-
prep Kit. Check concentrations using a spectrophotometer and
send a sample of each for sequencing (see Note 13).
8. Run an agarose gel to compare samples from each cloning step
from PCR amplification to final plasmid. Ensure plasmid and
vector are linearized to properly compare sizes (Fig. 2).
4 Notes
1. Primers should be approximately 40 bp, including a minimum

of 15 bp overlap with its complementary primer. To maximize
annealing of insert and plasmid, ensure melting temperature
(Tm) for each overhang is between 60–75 °C. Free-to-use
primer design tools are available on the websites and provide
information on melting temperature and GC content.
2. Aliquot dNTPs and store at -20 °C to avoid multiple freeze
thaw cycles.
Fig. 2 Example gel visualizing cloning steps. This 8 kb vector had two bands
corresponding to circular and supercoiled plasmid. Vector linearization by PCR
removed a 500 bp sequence, resulting in a band of a lower molecular weight.
Recombination of linearized vector with a molar excess of 600 bp insert yielded
a high cloning efficiency, indicated by a single band at approximately 8 kb. The
low molecular weight contaminant was the same size as the insert, so it would
not affect transformation
3. Vector propagated in a laboratory E. coli cloning strain such as

DH5α is preferable in order for removal of the template after
PCR amplification (see Note 10).
4. Kits commercially available for the annealing step however
most rely on T4 polymerase exonuclease activity.
5. Check antibiotic resistance genes conferred by the chosen vec-
tor before preparing plates, e.g., KanR (kanamycin), AmpR
(ampicillin), pp-cat (chloramphenicol).
6. Prior pre-linearization of the vector outside of the sequence to
be amplified by restriction digest reduces the likelihood of
sense and antisense primers annealing and forming a circular
primer-vector PCR product. Ensure that the chosen restriction
enzyme has no other sites within the vector sequence to be
amplified; otherwise, the amplification will fail. An additional
purification step using a reaction cleanup kit such as MinElute
(Qiagen) may be required to remove enzyme activity and
exchange the template DNA to an appropriate buffer for PCR.
7. Mineral oil can be used to stop evaporation; however, this can
be minimized by using a thermocycler with a heated lid.
8. If not using Phusion polymerase, refer to the manufacturer’s
instructions for the recommended amplification parameters.
Extension times increase with length of template to be ampli-

fied so it is crucial to perform amplifications for vector and
insert(s) separately.
9. Optimal annealing temperatures may vary from the melting
temperatures of each primer. Lower temperatures are more
likely to result in incorrect product formation from nonspecific
annealing of primers to the template or primer-dimers. As a
rule of thumb, the highest temperature which yields a high
level of amplification at the correct size should be used to
minimize nonspecific interactions.
10. DpnI specifically digests methylated DNA.
11. If number of transformants is low, the number of transfor-
mants can be increased by plating the whole transformation
mixture. Immediately prior to plating, centrifuge the transfor-
mation mixtures in a 1.5 mL microcentrifuge tube at
13,000 rpm, remove the supernatant and resuspend the pellet
in a smaller volume, i.e., 100 μL LB.
12. The transformation efficiency is defined as the number of
colony forming units on a plate per unit of DNA (cfu/μg
DNA).
13. Sequencing is extremely important to determine whether the
insert has been correctly cloned into the vector. Sanger
sequencing is sufficient for inserts up to ~1000 bp, after
which the quality is poor; in this case, reverse sequencing is
recommended. Check with your sequencing provider that they
stock a sequencing primer for your chosen plasmid, e.g., the
T3 RNA polymerase promoter used in many expression vec-
tors; otherwise, you may need to order one to send with your
plasmid constructs.
References
1. Celie PH, Parret AH, Perrakis A (2016) academic.oup.com/nar/ar ticle-lookup/
Recombinant cloning strategies for protein doi/10.1093/nar/18.20.6069
expression. Curr Opin Struct Biol 38:145– 4. Tillett D, Neilan B (1999) Enzyme-free clon-
154. Available from: https://linkinghub. ing: a rapid method to clone PCR products
elsevier.com/retrieve/pii/S0959440X16300 independent of vector restriction enzyme
677 sites. Nucleic Acids Res 27(19):26e–26.
2. Shuldiner AR, Scott LA, Roth J (1990) Available from: https://academic.oup.com/
PCR-induced (ligase-free) subcloning: a rapid nar/article-lookup/doi/10.1093/nar/27.1
reliable method to subclone polymerase chain 9.e26
reaction (PCR) products. Nucleic Acids Res 5. Li MZ, Elledge SJ (2007) Harnessing homol-
18(7):1920–1920. Available from: https:// ogous recombination in vitro to generate
academic.oup.com/nar/ar ticle-lookup/ recombinant DNA via SLIC. Nat Methods
doi/10.1093/nar/18.7.1920 4(3):251–256. Available from: http://www.
3. Aslanidis C, de Jong PJ (1990) Ligation- nature.com/articles/nmeth1010
independent cloning of PCR products 6. Stevenson J, Krycer JR, Phan L, Brown AJ
(LIC-PCR). Nucleic Acids Res 18(20): (2013) A practical comparison of ligation-
6069–6074. Available from: https:// independent cloning techniques. PLoS One
8(12):e83888. Available from: http://www. multiple DNA fragments with short end
pubmedcentral.nih.gov/articlerender.fcgi? homologies. PLoS One 10(9):e0137466
artid=3871625&tool=pmcentrez& 9. Jeong J-Y, Yim H-S, Ryu J-Y, Lee HS, Lee J-H,
rendertype=abstract Seen D-S et al (2012) One-step sequence- and
7. Scholz J, Besir H, Strasser C, Suppmann S ligation-independent cloning as a rapid and
(2013) A new method to customize protein versatile cloning method for functional geno-
expression vectors for fast, efficient and back- mics studies. Appl Environ Microbiol 78(15):
ground free parallel cloning. BMC Biotechnol 5440–5443. Available from: https://journals.
1 3 ( 1 ) : 1 2 . A v a i l a b l e f r o m : h t t p s : // asm.org/doi/10.1128/AEM.00844-12
bmcbiotechnol.biomedcentral.com/ar ti 10. Gibson DG, Young L, Chuang R-Y, Venter JC,
cles/10.1186/1472-6750-13-12 Hutchison CA, Smith HO (2009) Enzymatic
8. Kostylev M, Otwell AE, Richardson RE, assembly of DNA molecules up to several hun-
Suzuki Y (2015) Cloning should be simple: dred kilobases. Nat Methods 6(5):343–345.
Escherichia coli DH5á-mediated assembly of Available from: http://www.nature.com/arti
cles/nmeth.1318
Chapter 3
Molecular Cloning Using In Vivo DNA Assembly

Sandra Arroyo-Urea, Jake F. Watson, and Javier Garcı́a-Nafrı́a
Abstract
Here we describe the in vivo DNA assembly approach, where molecular cloning procedures are performed
using an E. coli recA-independent recombination pathway, which assembles linear fragments of DNA with
short homologous termini. This pathway is present in all standard laboratory E. coli strains and, by
bypassing the need for in vitro DNA assembly, allows simplified molecular cloning to be performed without
the plasmid instability issues associated with specialized recombination-cloning bacterial strains. The
methodology requires specific primer design and can perform all standard plasmid modifications (inser-
tions, deletions, mutagenesis, and sub-cloning) in a rapid, simple, and cost-efficient manner, as it does not
require commercial kits or specialized bacterial strains. Additionally, this approach can be used to perform
complex procedures such as multiple modifications to a plasmid, as up to 6 linear fragments can be
assembled in vivo by this recombination pathway. Procedures generally require less than 3 h, involving
PCR amplification, DpnI digestion of template DNA, and transformation, upon which circular plasmids are
assembled. In this chapter we describe the requirements, procedure, and potential pitfalls when using this
technique, as well as protocol variations to overcome the most common issues.
Key words Molecular cloning, In vivo DNA assembly, recA-independent recombination, IVA clon-
ing, Sub-cloning, Site-directed mutagenesis
1 Introduction
Molecular cloning is a cornerstone of biomedical research and has

been continuously developed over recent decades to provide sim-
pler and more efficient methodologies. Here we describe the use of
the in vivo DNA assembly approach for molecular cloning, which
relies on an endogenous E. coli DNA recombination pathway capa-
ble of joining linear DNA fragments with short homology regions
at their termini [1]. This pathway is independent of recA and is
present in all laboratory E. coli strains. The “recA-independent”
recombination pathway has been exploited for molecular cloning,
facilitating cloning procedures with minimal handling but having
the advantages of recombination-based methodologies (scarless,
sequence-independent, single-base precision, and directional) [1–
https://doi.org/10.1007/978-1-0716-3004-4_3,
33
34 Sandra Arroyo-Urea et al.
7]. Using in vivo DNA assembly, all standard plasmid DNA mod-
ifications can be performed, including sequence insertions, dele-
tions, point-mutagenesis, and sub-cloning of large fragments
between vectors. When employed as a cloning tool, linear DNA
fragments are generated in vitro, primarily by PCR, with homolo-
gous termini of around 15–30 bp that direct plasmid assembly
in vivo. After transformation, endogenous single-stranded exonu-
cleases (ExoIII/V) [8] degrade the termini of these linear frag-
ments to single-stranded DNA, which allows annealing between
homologous fragments in vivo, before DNA repair (LigA) assem-
bles a circular plasmid [9, 10].
Cloning protocols generally comprise the following: (1) primer
design, (2) PCR amplification, to introduce modifications and
homologous sequences, (3) digestion of the parental DNA using
the methylase-dependent restriction enzyme DpnI, and (4) trans-
formation into standard laboratory E. coli before subsequent col-
ony screening and selection. This protocol can be used to perform
all types of plasmid modifications, from inserting and deleting
sequences to site-directed mutagenesis and sub-cloning, each dic-
tated by primer design. Furthermore, up to six DNA fragments can
be assembled simultaneously, allowing complex cloning strategies
to be achieved in a single step; however, method efficiency
decreases as procedure complexity increases. Given the principal
requirement for cloning using recombination is linear DNA frag-
ments, in vivo DNA assembly can also be combined with restriction
enzyme-linearized plasmids or synthesized linear double-stranded
genes, which can overcome PCR amplification issues or further
simplify procedures (Fig. 1). Given that there are no requirements
for commercial kits or specialized bacteria, this approach is accessi-
ble to any molecular biology laboratory. Additionally, since the
homology requirements are similar to other enzyme or
recombination-based commercial approaches (e.g., Gibson assem-
bly [11]), primers designed for in vivo assembly cloning can also be
combined/used with such in vitro assembly methods as an alterna-
tive backup route. Here, we describe reagents and protocols to
perform in vivo DNA assembly for plasmidic DNA cloning and
modification as performed in our laboratory.
2 Materials
2.1 Polymerase 1. Premixed PCR master solution, prepared as 23 μL premixed

Chain Reaction reactions, stored at -20 °C (see Note 1): 250 μM each dNTP
nucleotide (dATP, dGTP, dCTP, and dCTP), 1 M betaine,
2.5% DMSO, Phusion Polymerase Buffer (1X), Phusion HF
Polymerase (1 μL per 25 μL reaction) (see Note 2), and deio-
nized H2O (we generally use 200 μL thin wall PCR tubes).
2. PCR Thermocycler.
Molecular Cloning Using In Vivo DNA Assembly 35
Fig. 1 General in vivo DNA assembly scheme. A DNA fragment of interest

resulting from PCR amplification or gene synthesis can be assembled in vivo
into a plasmid (linearized as a result of a PCR amplification or through
restriction-enzyme digestion) after transformation in standard E. coli
2.2 DNA Gel 1. Agarose powder (see Note 3).

Electrophoresis and 2. DNA stain (e.g., SYBR™ Safe DNA Gel Stain (Thermo Fisher)
Eliminating Parental or GreenSafe Premium (Nzytech)).
DNA
3. 10X TB agarose electrophoresis buffer: 440 mM Tris, 440 mM
Boric acid in water. Weigh 54 g of Tris and 27.5 g Boric acid,
and dissolve by stirring in 1 L H2O. We do not use EDTA in
the TB buffer as compared to the commonly used TBE recipe
(see Note 4).
4. DNA Gel Loading dye.
5. DNA Molecular Weight Marker Ladder.
6. DNA Gel Electrophoresis Tank and power supply.
7. UV/Blue light Transilluminator.
8. DpnI (FastDigest, Thermofisher) (see Note 5).
2.3 Transformation 1. Chemically competent bacteria: XL-10 Gold® Ultracompetent

cells (see Note 6).
2. Water bath (set to 42 °C).
3. Super Optimal Broth (SOB): 20 g bactotryptone, 5 g yeast
extract, 2 mL of 5 M NaCl, 2.5 mL of 1 M KCl, 10 mL of 1 M
MgCl2, 10 mL of 1 M MgSO4, and distilled H2O to 1 L.
4. Lysogeny Broth (LB): 7.5 g agar, 5 g tryptone, 5 g NaCl, 2.5 g
yeast extract, and distilled H2O to 500 mL.
5. LB agar plates with antibiotics as appropriate.
6. 37 °C incubator.
3 Methods
3.1 Primer Design We recommend using software for visualizing both the original and
target DNA sequences for the design of oligos, as well as software
for the calculation of annealing temperatures (Tm). We use the
freely accessible Snapgene Viewer program for primer sequence
design and the OligoCalc webserver (http://biotools.nubic.
northwestern.edu/OligoCalc.html) for annealing temperature cal-
culation [12]. All Tm values reported in this chapter are calculated
using this webserver. Accurate primer design is critical to the suc-
cess of in vivo DNA assembly. Regardless of the modification to be
made (insertion, deletion, mutagenesis, or sub-cloning), primers
consist of two regions: a 3′ region that anneals to the template
DNA (template binding region) and a 5′ homologous region that
drives in vivo recombination. First, design the template binding
region, which has the same requirements of standard PCR oligo
design (at least 18–22 bp and Tm values of ~60 °C). The homolo-
gous region is included 5′ to this sequence, and it should be ≥15 bp
and have a Tm ≥ 50 °C (see Note 7). As a rule of thumb, a
homologous region of ~20–25 bp is sufficient to ensure efficient
recombination (usually providing a Tm ≥ 50 °C), and lengths of up
to 35 bp can been used to enhance efficiency when assembling
≥5 DNA fragments simultaneously. Specific primer design require-
ments for each DNA modification are as follows:
3.1.1 Insertion We define an insertion as the introduction of a new segment of

DNA that can be fully included within a single pair of PCR primers
(independent of size) and are typically up to 200 bp. Using one pair
of PCR primers, the whole vector is amplified during PCR, and
recircularization occurs after transformation through a single
recombination event. To insert a DNA fragment to a plasmid,
design primers with the template binding regions binding astride
the insertion site and add the homologous regions at the 5′ ends. If
the length of the insertion is around ~20 bp, this new sequence can
form the homologous region by inclusion at the 5′ end of both
primers (Fig. 2a). If the insertion is significantly larger than a typical
homologous region (>30 bp), the desired sequence should be
divided in two, with each primer encoding half of the total insert.
Insert coding regions on each primer must be designed to overlap
(~20 bp) to act as the homologous region (Fig. 2b) (see Note 8). If
the new sequence is significantly shorter than ~20 bp, the 5′ end of
one primer will need to be extended to overlap with the annealing
region of other primer in order to create a larger homologous
region that guarantees an efficient recombination (Fig. 2c).
Fig. 2 Primer design to perform insertions. Primers must have template binding regions (grey) that bind either
side of the insertion site (red) and a homologous region at the 5′ end (orange box) that allows in vivo
recombination. Based on the length of the desired insertion (depicted in green), the homologous regions for
each of the primers could be: (a) the entire insert (when the insertion is ~20 bp), (b) a sub-region of the insert
(when the insertion is >25–30 bp), or (c) extended beyond the insert sequence alone (<18 bp).
3.1.2 Deletion A deletion occurs when a desired DNA sequence is removed from
the template plasmid. Primers for a deletion are designed such that
they have their template binding regions annealing either side of
the deletion site, amplifying outwards (i.e., amplifying the entire
plasmid aside from the fragment to remove). A 5′-DNA sequence is
added to one of the primers, which is homologous to the 5′ end of
the primer’s pair (Fig. 3a) (see Note 9).
3.1.3 Mutagenesis Mutagenesis involves the replacement of short DNA sequences,

typically a single base pair or triplet codon. It can therefore be
considered as a simultaneous deletion and insertion, with a
corresponding primer design. Template binding regions of muta-
tional primers bind astride the undesired sequence, with the novel
sequence included in primer 5′ ends. The required homologous
region should be added at the 5′ end of one of the primers,
upstream of the codon to be replaced (Fig. 3b) (see Note 10).
3.1.4 Sub-cloning Sub-cloning involves the incorporation of a larger DNA sequence

into a target vector, which is too long to be achieved by “insertion”
(see above). While previous modifications all involved recombina-
tion of termini from a single DNA fragment, sub-cloning requires
Fig. 3 Primer design to perform deletions, mutagenesis, and sub-cloning. (a) Deletions. Primers bind astride
the sequence to remove, with homologous regions at termini encoded in one primer. (b) Mutagenesis. Primers
flank the mutation site, similarly to deletions, with the new codon encoded in primer sequences. (c) Sub
cloning. Four primers are needed to add a DNA fragment to a target vector. Insert amplification primers are
designed to have specific homology to target vector termini (specific homologous regions for Fw (purple box)
and Rv primer (blue box) match vector sequence)
assembly of two separate linear fragments, through recombination

of two distinct homologous overlaps (driven by unique sequences
at each site). To perform sub-cloning, both an “insert” and “target
vector” are amplified, requiring two pairs of primers (four primers
total). Assembly requires homologous regions at both fragment
join sites; therefore, at least one primer at each site must be
designed to include a region homologous to the other DNA frag-
ment (Fig. 3c) (see Note 11). The inclusion of homologous
sequences in either “insert” or “vector” fragments, etc., is of no
significance to successful cloning, the only requirement being pro-
duction of linear DNA fragments with specific DNA sequences
shared between termini, which will be subsequently assembled.
3.2 Using PCR for In the vast majority of cloning approaches, PCR will be used to
DNA Modification and amplify and/or modify the DNA sequences involved. Employing
Amplification restriction enzyme-dependent DNA linearization or synthetic
genes are possible alternatives, which will be addressed in Subhead-
ing 3.5. PCR-based cloning proceeds as follows:
1. Prepare PCR Master Mix (see Materials) and freeze aliquots for
future use. Defrost on ice on the day of use.
2. If primers arrive desiccated, make up to 100 μM in deionized
water.
3. Prepare a solution containing 5 μM (in deionized water) of

each primer required for the cloning procedure in a single tube
(for minimal handling) (see Note 12).
4. Dilute template DNA to 1 ng/μL in deionized water (see
Note 13).
5. Add 1 μL of the 5 μM primer stock and 1 μL of 1 ng/μL
template DNA stock to the 23 μL PCR reaction mix (see Note
14).
6. Run the PCR according to the following cycling parameters
(shown as specified for the Phusion® HF polymerase—proto-
col should be adjusted according to manufacturer instructions
for alternative polymerases):
(a) Initial denaturation—2 min at 98 °C.
(b) Denaturation—30 s at 98 °C.
(c) Primer annealing—30 s at a Tm specific to primer template
binding region (approx. 60 °C).
(d) Extension—specific to sequence length (15–30 s/kb) at
72 °C.
(e) Run a total of 18 cycles of steps b–d (see Note 15).
(f) Final elongation—10 min at 72 °C.
7. Add DNA Gel Loading Dye to 5 μL of PCR samples and load
on a 1% agarose gel to confirm amplification of correctly sized
fragments (see Note 16).
8. Add 1 μL of DpnI enzyme to the remaining unpurified reaction
mix and incubate at 37 °C for 15 min to eliminate paren-
tal DNA (see Note 17).
3.3 Transformation 1. Transform 3–4 μL of the reaction mix to 100 μL of competent

and Colony Selection cells (see Note 18), and spread on an agar plate containing
appropriate antibiotics (corresponding to plasmid resistance)
and incubate overnight at 37 °C.
2. Select and grow individual colonies further in LB containing
antibiotics overnight.
3. Isolate plasmid DNA using standard DNA purification kits
(such a Qiagen Miniprep kit), and confirm new clones through
Sanger sequencing.
3.4 Performing Here, we have detailed how specific primers can be used to create a
Complex Procedures variety of individual plasmid modifications; however, multiple
modifications are often required and are historically carried out
sequentially, increasing the length of a cloning procedure. Using
in vivo DNA assembly, up to six fragments have been assembled
simultaneously [2, 5], where final assembly from individual frag-
ments is driven by their unique homologous sequences. This means
TE
V
3C V
TE
RFP
RFP
is G
H
FLAG
A
0X1 FL
Fig. 4 Example of in vivo DNA assembly for complex cloning procedures. By combining three pairs of primers,
a N-terminal HisTag (×10 HisTag, yellow) is exchanged for a FLAG tag (FLAG, pink) and a new coding
sequence (green) is added downstream of the Red Fluorescent Protein gene (RFP, red), while replacing 3C
cleavage site (3C, brown) for a TEV protease site (TEV, blue). These multiple modifications can be performed
simultaneously using standard in vivo assembly primers
that multiple modifications can be made to a plasmid template in a

single step. These modifications can be of the same or different
types, for example, performing multiple simultaneous mutations,
or insertion and deletion at two locations on a plasmid. An example
of such versatility is demonstrated in Fig. 4, where an original
plasmid containing a Red Fluorescent Protein (RFP) gene flanked
by a N-terminal Histag and a C-terminal 3C cleavage site is mod-
ified in a single step to contain a N-terminal FLAG tag followed by
the RFP, a TEV protease site, and a new coding region. These
multiple modifications can be achieved simultaneously using a
single PCR, using three pairs of primers (Fig. 4).
Experimentally, multiple modifications are achieved using pri-
mers designed exactly as previously described, but simply used in
combination to amplify multiple different fragments. Such proce-
dures can be performed in a single PCR tube (with variations to the
protocol found in Notes 12 and 13). If single-tube PCR poses
efficiency issues, each individual fragment can be amplified in a
separate tube, before combining all reactions after DpnI treatment
and prior to transformation. In this case, individual PCRs are
carried out by combining the Fw primer of one modification with
the Rv primer of the nearest downstream modification (see Note
17; Fig. 4).
3.5 Alternative In vivo DNA assembly can assemble any linear DNA fragment that
Routes for Linear contains homologous regions to another linear DNA. Although
Fragment Generation: the most common and practical route to obtaining such sequences
Restriction Enzymes is PCR, alternative routes are possible. Restriction enzymes can be
and Synthetic Genes used to linearize a vector at a desired site for modification, allowing
insertion of a fragment of interest without complete vector amplifi-
cation. The inserted fragment must be designed to contain termini
homologous to the vector sequence either side of the restriction
site, which typically involves PCR amplification of the insert.
Co-transformation of these fragments allows assembly of the
novel plasmid in vivo (see Note 19).
An increasingly useful and accessible route to obtain linear
DNA fragments is gene synthesis. Currently, linear double-
stranded synthetic DNAs (e.g., Gene Fragments or gBlocksTM)
can be designed and purchased to be readily used in transformation
for in vivo DNA assembly. Novel sequences must simply be
designed to include termini homologous to the vector insertion
location (as previously described). This approach can be used for a
multitude of purposes: new genes, synthetic proteins, DNA frag-
ments that are not amenable for PCR amplification or simply, a
DNA fragment with many modifications that would be trouble-
some to obtain from the parental DNA. For use in in vivo DNA
assembly cloning, synthetic genes are co-transformed with a linear-
ized vector (linearized through PCR or restriction enzymes) (see
Note 20).
4 Notes
1. Although higher volume PCR reactions will also work success-

fully (i.e., 50 μL), we find 25 μL suitable and cost-effective. We
generally prepare ~100 × 23 μL reactions with all components
(except for DNA template and primers) and store them at -
20 °C. We have stored PCR premixes for 1–1.5 years without
noticeable detrimental effects.
2. We generally use Phusion® HF Polymerase since it is the most
cost-effective polymerase currently accessible to us. There are
no essential requirements for polymerases used for PCR in
in vivo cloning; however, optimal cloning requires high effi-
ciency and low-error rate polymerases to produce sufficient
DNA and avoid point mutations when amplifying whole plas-
mids. For this reason, Taq/Pfu would be poor choices, while
Phusion or Q5® polymerase are the current best options. We
routinely use betaine and DMSO as default additives in our
PCR premixes to enhance DNA polymerization across high
GC-content regions.
3. Use low melting point agarose to make a 1% agarose gel. We

use GreenSafe Premium (Nzytech), but any other
DNA-binding dye should perform well enough for DNA
visualization.
4. EDTA is used to eliminate residual DNA nucleases which are
generally absent in our procedures. However, should these
present an issue, EDTA can also be included.
5. We recommend FastDigest or equivalent so that DpnI diges-
tion can proceed within 5–15 min of incubation. Standard
enzymes will perform sufficiently but will increase protocol
duration.
6. We use homemade competent cells generated by the Inoue
et al. method [13] and stored as 100 μL aliquots. In general,
procedures requiring single or double recombination events
require competent cells of a competency at least 106–
107 cfu/μg of DNA, while more complex procedures with
three or more recombination events require competent cells
of 107–109 cfu/μg. When performing multi-fragment assem-
blies, commercial competent cells can be used, and transforma-
tions typically use 2–3 μL DNA mixture in 30 μL cell
suspension.
7. Tm values referred to here are calculated with the Basic Melting
Temperature Calculations using the OligoCalc webserver.
8. Theoretically, this strategy could be used for the insertion of
fragments up to ~440 bp (current technology allows primer
synthesis up to 250 bp in length). However, for very large
fragments a sub-cloning of small (~500 bp) linear double-
stranded synthetic DNA would be more cost-effective (see
sub-cloning section) than through expensive long primers.
9. To avoid primer-dimer formation (and poor PCR amplifica-
tion), the Tm of template binding regions should be higher
than that of homologous regions, ensuring maximal PCR
efficiency.
10. Several variations in mutagenesis primer design can be used,
with no difference in efficiency. Either a single primer or both
primers may contain the new codon/base-pair, as long as this
region is taken into account during homologous region
calculations.
11. Although the homologous 5′ region can be added to either
insert or vector primers, we prefer to add them onto the insert
primers so the vector primers can be reused to clone different
target genes into the same vector. Please note that fragments
below 400 bp are not amenable for sub-cloning using in vivo
DNA assembly.
12. For multiple modifications performed in a single-tube PCR,

make a single stock with all required primers, each at 5 μM.
13. If more than one template DNA must be used, dilute each
plasmid in the same tube to 1 ng/μL.
14. Adding 1 ng of template DNA ensures that parental DNA is
eliminated during DpnI digestion; however, when PCR ampli-
fication becomes challenging, we use up to 5–10 ng of
template DNA.
15. 18 PCR cycles provides sufficient PCR product while minimiz-
ing the chances of polymerization errors. However, we use up
to 25 cycles when challenging cases are found.
16. Using 1 ng of template DNA and 18 PCR cycles should yield
obvious bands after agarose electrophoresis. If no bands are
found, it is better to optimize the PCR amplification than to
proceed with in vivo assembly. In such cases, we recommend
confirming primer sequences, testing PCR additives, and
adjusting annealing temperature during cycling. If contami-
nant bands are found from PCR, the desired products can be
isolated by gel extraction before proceeding with transforma-
tion (no DpnI treatment is required when gel extraction is
performed).
17. When performing fragment amplification in separate PCRs,
each product is mixed in equal ratios before by DpnI treatment
and transformation as per standard procedures. The ratio of
each fragment can be compensated if significant intensity dif-
ferences are found after agarose electrophoresis.
18. This is for homemade competent cells with 106–107 cfu/μg of
DNA. If commercial competent bacteria with 109 cfu/μg of
DNA competency are used, 25 μL of cell suspension is
sufficient.
19. Using in vivo DNA assembly with restriction enzymes is useful
for cases where plasmids are not amenable to PCR amplifica-
tion, for example strongly GC-rich promoters, or containing
repetitive sequence elements. In these cases, purify the digested
vector and co-transform 30–50 ng with 2 μL of the homology-
containing insert product after PCR. Efficiency can be
improved by using a restriction enzyme or combination of
enzymes which do not leave small complementary “sticky-
ends,” to limit vector recircularization in vivo.
20. When using gene synthesis, solubilize synthesized DNA frag-
ments in deionized water to obtain a 50 ng/μL stock solution
and transform 1 μL (50 ng) along with the PCR amplified,
DpnI-treated vector.
References
1. Watson JF, Garcı́a-Nafrı́a J (2019) In vivo mutagenesis by placing homologous ends on
DNA assembly using common laboratory bac- DNA using polymerase chain reaction. Bio-
teria: a re-emerging tool to simplify molecular techniques 10:62–66
cloning. J Biol Chem 294:jbc. 8. Nozaki S, Niki H (2018) Exonuclease III
REV119.009109 (XthA) enforces in vivo DNA cloning of Escher-
2. Garcı́a-Nafrı́a J, Watson JF, Greger IH (2016) ichia coli to create cohesive ends. J Bacteriol
IVA cloning: a single-tube universal cloning 201:20181210
system exploiting bacterial In Vivo Assembly. 9. Conley EC, Saunders VA, Saunders JR (1986)
Sci Rep 6:27459 Deletion and rearrangement of plasmid DNA
3. Beyer HM, Gonschorek P, Samodelov SL et al during transformation of Escherichia coli with
(2015) AQUA cloning: a versatile and simple linear plasmid molecules. Nucleic Acids Res 14:
enzyme-free cloning approach. PLoS One 10: 8905–8917
1–20 10. Yang Y, Wang T, Yu Q et al (2021) The path-
4. Jacobus AP, Gross J (2015) Optimal cloning of way of recombining short homologous ends in
PCR fragments by homologous recombination Escherichia coli revealed by the genetic study.
in Escherichia coli. PLoS One 10:e0119221 Mol Microbiol:1–14
5. Kostylev M, Otwell AE, Richardson RE et al 11. Gibson DDG, Young L, Chuang RR-Y et al
(2015) Cloning should be simple: Escherichia (2009) Enzymatic assembly of DNA molecules
coli DH5a-mediated assembly of multiple up to several hundred kilobases. Nat Methods
DNA fragments with short end homologies. 6:343–345
PLoS One 10:1–15 12. Kibbe WA (2007) OligoCalc: an online oligo-
6. Huang F, Spangler JR, Huang AY (2017) In nucleotide properties calculator. Nucleic Acids
vivo cloning of up to 16 kb plasmids in E. coli is Res 35:43–46
as simple as PCR. PLoS One 12:1–21 13. Inoue H, Nojima H, Okayama H (1990) High
7. Jones DH, Howard BH (1991) A rapid efficiency transformation of Escherichia coli
method for recombination and site-specific with plasmids. Gene 96:23–28
Chapter 4
Assembling Multiple Fragments: The Gibson Assembly

Luisana Avilan
Abstract
The Gibson Assembly is a popular method for molecular cloning which has been developed specifically to
join several fragments together in a specific order, without the constraint of restriction enzyme sites. This
method is based on the assembly of overlapping fragments, generally produced by PCR, and then
combining them using three enzymes: a 5′ exonuclease, a DNA polymerase, and a DNA ligase, in an
isothermal reaction. Here, we describe this method, including the design of primers for the generation of
the overlapping fragments and the assembly; to this end, we provide an example involving joining two
fragments in a single plasmid.
Key words Gibson Assembly, Cloning, Overlapping primers
1 Introduction
From the beginning of gene cloning using plasmids in the 1970s

[1, 2], “cutting” with classic Type II restriction endonuclease
enzymes and “pasting” into the target sequence with ligases
(restriction enzyme-based “classical cloning”) has been the stan-
dard method for molecular biology in laboratories around the
world. However, this “cut and paste” method is cumbersome if
multiple fragments are to be included and is constrained by the
availability of restriction enzyme sites.
In the last decade, a variety of methods have been developed to
make DNA constructs composed of multiple inserts easier and
faster to generate, allowing projects of greater complexity. These
assembly methods include amongst others, Golden Gate cloning
and its derivate the Modular Cloning system MoClo, that is widely
used by the synthetic biology community. However, one of the
most popular methods is the Gibson Assembly method developed
by Daniel Gibson at the Craig Venter Institute, USA [3, 4]. This
method does not use restriction enzymes but rather an overlap
assembly process which can be used for simple cloning of a frag-
ment into a plasmid for constructs of considerable size, such as
https://doi.org/10.1007/978-1-0716-3004-4_4,
45
46 Luisana Avilan
Fig. 1 Schema of the Gibson Assembly for two adjacent fragments. After including overlapping sequences by
PCR, the fragments are treated with a 5′ exonuclease, a thermophilic DNA polymerase, and a thermophilic
DNA ligase
synthetic genomes [4, 5]. As a consequence, this process does not

leave restriction enzyme site sequences in the construct which is
often an artifact of standard cloning methods, known as “scars.” To
make the construct, PCR generated fragments that share homolo-
gous sequences in their ends are put together in the assembly
reaction, which requires only one temperature and simultaneously
treatment with three enzymes (Fig. 1): (i) a 5′ exonuclease to yield
sticky ends among the fragments after exposition of single strand
overhangs, (ii) a thermophilic and proofreading polymerase to fill
the gaps in the annealed strands and, finally, (iii) a thermostable
ligase and dNTPs to complete the nicks of the annealed fragments.
This method allows inclusion of a DNA fragment in any position of
a construct and to join several fragments together at the same time
and at the same temperature. Indeed, this assembly method was
originally called the isothermal method [3]. Due to its wide uptake
within the Synthetic Biology community, commercial master mixes
of the required enzymes, tools and advice for design are all easily
available. The overlap sequences required for the assembly of the
fragment are generally added by PCR, including those overlap
sequences provided by the vector. Thus, the vector is not linearized
Gibson Assembly 47
by restriction enzyme digestion, rather via a PCR reaction.

Although cut plasmids may be used, but this should be considered
in the primer design stages. The design of all the primers for the
PCR amplification needed to prepare the fragment is an important
step in the Gibson method, key aspects are efficient annealing of the
primers to the template DNA and design of the 5′ and 3′ terminal
sequences added to the amplicon.
2 Materials
2.1 Enzymes and 1. T5 exonuclease (see Note 1).

Primers for Gibson 2. Phusion high-fidelity DNA polymerase (New England Biolabs)
Assembly (see Note 2).
3. Taq DNA ligase (New England Biolabs) (see Note 3).
4. 5X Assembly Mix: 25% PEG-8000, 500 mM Tris-HCl pH 7.5,
50 mM MgCl2, 50 mM DTT, 1 mM each of the four dNTPs,
and 5 mM NAD.
5. PCR primers, for each, you will need a stock of ~100 μL at
50 μM in nuclease-free water. Then make 100 μL of a working
stock of each at 20 μM in nuclease-free water.
6. Premix to create a 1.33X Master Mix by adding: 100 μL of 5X
Assembly mix plus 0.2 μL (2U) of T5 exonuclease, 6.25 μL
(12.5 U) of Phusion DNA Polymerase, and 50 μl (2000 U) of
Taq DNA ligase to a total volume of 375 μL (see Notes 4
and 5).
7. Aliquot 15 μL directly in PCR tubes and store at -20 °C until
required.
2.2 Generation of the 1. Q5 High-Fidelity DNA Polymerase (New England Biolabs).

Fragments 2. QIAquick PCR purification kit or QIAquick Gel Extraction Kit
(Qiagen).
3. dNTPs.
4. DpnI (New England Biolabs).
5. Nuclease-free water.
6. Thermocycler.
7. Electrophoresis system for agarose gels.
2.3 Bacterial 1. Water bath.

Plasmid 2. Ultracompetent E. coli DH5α cells.
Transformation
3. Lysogeny broth (LB): 10 g/L tryptone, 5 g/L yeast extract,
and 10 g/L NaCl, pH 7.0.
48 Luisana Avilan
4. LB agar plates: LB, 10 g/L agar, 1/1000 dilution antibiotic

stock.
5. Antibiotics: kanamycin (50 mg/mL) or ampicillin (100 mg/
mL) or chloramphenicol (34 mg/mL).
6. Shaking incubator.
3 Methods
The first step in a Gibson Assembly experiment is to design the final

construct in silico. Using suitable DNA sequence editing software,
display the different fragments in the desired order, including the
vector backbone. This editing is important not only to design the
overlapping primers required for the Gibson Assembly but also to
check all the properties of the construct, such as open reading
frames, ribosome binding sites, restriction enzymes, and other
desired parts. Several DNA sequence editors for plasmid construc-
tion and visualization are available. We use the editor ApE, which is
free to download (https://jorgensen.biology.utah.edu/wayned/
ape) and user friendly. This editor displays sequence in the conven-
tional 5′ to 3′ direction (see Note 6).
3.1 Design of The design of primers for the PCR amplification needed to prepare
Overlapping Primers the fragment is a critical step in the Gibson method. The primers
should anneal well with the targeted DNA (i.e., the complementary
region between the target and the primer should have a Tm greater
than 55 °C) and meet the standard requirements for optimal PCR
amplification of a gene-specific sequence primer. In addition, it
should have an overlapping extension from the adjacent fragment
(overlapping 3′ primer extension). After amplification, these ampli-
cons will include the overlap region which should be between
15 and 40 bp and have a Tm greater than 48 °C (as summarized
in Fig. 2 and see Note 7).
1. Primers can be designed using either freely available or com-
mercial DNA sequence editors or viewers. Sequences can be
visualized in either single or double strand format (for example,
SnapGene Viewer). For the example shown in Fig. 3a, the
editor ApE was used to design the primers for the assemble of
fragments A and B into a vector. The primers have an overlap
sequence between 36 and 38 bases; a Tm of the gene-specific
sequence should be around an optimal value of 57 °C (see
Note 8).
2. For the forward primer for the fragment A (Fig. 3), start at the
5′ end of fragment A and advance in a 3′ direction until the
sequence has the expected Tm; a G or C must be the final base
at the 3′ termini. To add the overlapping extension at this
Gibson Assembly 49
Fig. 2 Schema of overlapping primers used for the Gibson Assembly method.
Each primer is an oligonucleotide composed a single of gene-specific region and
a tail that provides the overlap to the next fragment. The forward primer for the
first fragment (purple) and reverse primer for the last fragment (light blue) have
been omitted as their design will depend on the method of linearization of the
plasmid into which the fragments will be inserted. However, we recommend the
same strategy as assembly of the fragments, i.e., these primers will also require
a gene-specific region and a tail which provides the overlap to the relevant
fragment
Fig. 3 Overlapping primers for the cloning of fragment A and B on a vector. (a) Construction displayed on the
gene editor ApE showing the different fragments and the primers for the vector (dark grey), fragment A (red),
and fragment B (yellow). (b) The sequences of the primers, their Tm, and the sizes of the overlap sequences
are shown
50 Luisana Avilan
primer, from the 3′ end of the vector advance in the 5′ direction

between 10 and 20 bp or depending of the size of the of the
preferred overlap sequence.
3. For the reverse primer for fragment A (Fig. 3), the principle is
the same. First design the gene-specific primer and then add
the overlap extension, but in this case, the complementary
reverse of the sequence is used. In the ApE editor, the reverse
primer can be designed in the displayed 5′ to 3′ sequence, but
using the function, paste the reverse complement after copy. It
is important to remember that by convention, when ordering
oligonucleotide primers, they are written 5′ to 3′, so they must
be in this format when the order is placed.
4. Check secondary structures of the generated primers by online
oligo analyzers (see Note 9); strong intramolecular secondary
structure within the primers can inhibit the PCR reaction and
give low yields of product.
5. Design the overlapping primers for the amplification of the
fragment B following the same rules. Figure 3b shows the
generated primers for the example cited in this chapter.
3.2 Obtaining the To prepare the fragments for the assembly, set up separate PCR
Fragments reactions containing the template DNA and the forward and
reverse primers.
1. Set up a standard PCR in a final volume of 50 μL. It is prefera-
ble to use a high-fidelity polymerase; we recommend Q5 high-
fidelity Taq from NEB. Use 5 ng of template, 0.5 μM of each
primer, and 0.2 μM of the dNTPs mix. For the buffer, follow
the instructions of the DNA polymerase manufacturer.
2. The cycling conditions are chosen according to the DNA poly-
merase manufacturer, In general, the annealing temperature is
chosen according to the Tm of the gene-specific sequence of
the primer. In the example shown in Fig. 2, the chosen anneal-
ing temperature for all the fragments was 57 °C; therefore, the
annealing temperature in the PCR profile should also be 57 °C.
However, this is only a guide and it may be necessary to
optimize the PCR by a trying several annealing temperatures
centered on 57. The extension time is chosen dependent on the
size of the fragment (see Note 10). In our example, we used:
1 min at 98 °C (initial denaturation), followed by 30 cycles of
98 °C for 45 s (cycle denaturation), 57 °C for 45 s (annealing),
1min at 72 °C (cycle extension), and finally a single tempera-
ture step of 10 min at 72 °C (final extension). The extension
time for the vector amplification was increased to 4 min due to
the length (see Notes 8 and 10).
3. If a vector is a template, add 1 μL of DpnI after the reaction and
incubate at 37 °C for 30 min.
Gibson Assembly 51
4. Run agarose electrophoresis to visualize the amplification of

the fragments with the expected size.
5. Purify the fragments by using a columns system and quantify
the DNA concentration (see Note 11).
3.3 Assembly 1. Thaw an aliquot (15 μL) of 1.33X Master Mix and maintain
in ice.
2. Mix 5 μL of the DNA solution containing 0.05 pmol of each
fragment with the Master mix 1.33X in the final reaction. For
DNA fragments less than 1 kb, increase the amount of DNA to
0.25 pmol (see Note 12).
3. Incubate at 50 °C for 60 min. Vortex briefly the tube and spin
down the reaction.
4. Transform the competent cells with 2 μL of the reaction.
5. Analise transformants by picking individual colonies.
6. Screen by colony PCR or isolate the plasmid to analyze by
restriction enzymes or sequencing.
4 Notes
1. T5 Exonuclease catalyzes the degradation of a strand of DNA

in the 5′ to 3′ direction, either from 5′ termini or at nicks of
dsDNA. This protein corresponds to the D15 gene of the T5
phage [6].
2. Phusion DNA polymerase is a fusion protein of the Pfu DNA
polymerase from the hyperthermophilic archeon Pyrococcus
furiosus, with the high affinity DNA binding protein, Sso7d,
from another archeon Sulfolobus solfataricus [7]. This enzyme
is a proofreading enzyme with an error rate 50-fold lower than
that of Taq DNA Polymerase and therefore preferred. Alterna-
tive thermophilic polymerases may be used, although they
should always be proofreading enzyme to reduce mutations.
3. Taq ligase from Thermus thermophilus HB8 [8] catalyzes the
binding of two DNA strands by the formation of a bond
between the 5′ phosphate and the 3′ hydroxyl ends.
4. The activities of the enzymes in the master mix do not interfere
with each other. Moreover, once the circular constructs are
produced, the enzymes cannot alter the final product. The
buffer of this mix uses PEG as macromolecular crowding
agent and NAD as cofactor of the Taq ligase. The polymerase
and the ligase in the mix are thermophilic enzymes. In contrast,
the 5′-exonuclease is not thermostable, and thus it is inacti-
vated during the incubation at 50 °C. Hence the importance of
maintaining the master mix on ice all the time. This heat-
52 Luisana Avilan
inactivation ensures that the DNA is not over digested and

allows linear assembly to form without being degraded for
the exonuclease.
5. Commercial Gibson Assembly kits are available i.e.: Codex
DNA and New England Biolabs that work efficiently and
have their own conditions. They can use master mix 2X and
optimized enzymes. In addition, they have support guides and
tools for the design of the experiments (useful websites:
https://international.neb.com/applications/cloning-and-syn
thetic-biology/dna-assembly-and-cloning/gibson-assembly;
https://codexdna.com/products/benchtop-reagents/gibson-
assembly-kits/).
6. The Gibson Assembly can be used for amplification of large
regions of DNA by amplifying overlapping fragments and
assembling them in a single reaction. This method can also be
used for simultaneous site-directed mutagenesis that includes
substitution, insertion, and deletion. Another use of Gibson
Assembly is insertion of a small fragment. This small fragment
can be synthetized as an oligonucleotide and used in the final
assembly reaction.
7. The overlap sequence has the bases from each of the adjacent
fragments. However, it can be designed with bases belonging
to one of the fragments. In the case of vectors, the primers can
be designed without the overlapping extension of the adjacent
fragment (only the adjacent fragment provide the overlap
sequence), and the same vector preparation can be used for
other cloning designs. The length of the overlap sequence
depends on the length and the number of the fragments in
the assembly reaction. In general, around 40 bp is an optimal
length for insertion of up to 5 fragments in a vector between
0.5 and 10 kb. For higher length than 10 kb, it is recom-
mended 80 bp of overlap sequence.
8. Plasmids cut by restriction enzymes can be used for the Gibson
Assembly if PCR of the vector is not suitable. In this case, it is
important to remember that if a 5′ overhang is produced by
digestion, it will be degraded by the 5′ exonuclease in the
reaction. Thus, it should be removed in the in silico construc-
tion map before the design of plasmids. Any 3′ overhangs will
not be affected.
9. We use the free online calculator from Eurofins (https://euro-
finsgenomics), but variety of other such calculators exist.
10. It is important to allow time for the polymerase to synthesize
the entire fragment in the elongation phase. The rate of syn-
thesis differs for different polymerases. In general, it can be
calculated as 1 min per each 1000 bp.
Gibson Assembly 53
11. PCR products can be used in the assembly reactions without

purification. However, the cloning yield will be better if the
fragments are purified by columns systems. If several bands are
amplified in the PCR reaction, it is recommended to purify
after gel electrophoresis using a gel extraction kit. It is impor-
tant to resuspend DNA in nuclease-free water.
12. When more than two fragments are being inserted, use from
0.2 to 1 pmol of fragments. Use the following formula to
calculate pmols from ng DNA: pmol DNA = ng
DNA/(660 × number of bases) × 1000. Use the same molar
ratio for all the fragments. For DNA fragments less than 1 kb, it
is recommended to use 5-fold molar excess of these fragments.
References
1. Jackson DA, Symons RH, Berg P (1972) Bio- 5. Hutchison CA 3rd, Chuang RY, Noskov VN,
chemical method for inserting new genetic Assad-Garcia N, Deerinck TJ, Ellisman MH,
information into DNA of Simian Virus 40: cir- Gill J, Kannan K, Karas BJ, Ma L, Pelletier JF,
cular SV40 DNA molecules containing lambda Qi ZQ, Richter RA, Strychalski EA, Sun L,
phage genes and the galactose operon of Escher- Suzuki Y, Tsvetanova B, Wise KS, Smith HO,
ichia coli. Proc Natl Acad Sci USA 69:2904– Glass JI, Merryman C, Gibson DG, Venter JC
2909 (2016) Design and synthesis of a minimal bacte-
2. Cohen SN (1973) Construction of biologically rial genome. Science 351:aad6253
functional bacterial plasmids in vitro. Proc Natl 6. Sayers JR, Eckstein F (1990) Properties of over-
Acad Sci USA 70:3240–3244 expressed phage T5 D15 exonuclease. Similari-
3. Gibson DG, Young L, Chuang RY, Venter JC, ties with Escherichia coli DNA polymerase I
Hutchison CA 3rd, Smith HO (2009) Enzy- 5′-3′ exonuclease. J Biol Chem 265:18311–
matic assembly of DNA molecules up to several 18317
hundred kilobases. Nat Methods 6:343–345 7. Ishino S, Ishino Y (2014) DNA polymerases as
4. Gibson DG, Glass JI, Lartigue C, Noskov VN, useful reagents for biotechnology–the history of
Chuang RY, Algire MA, Benders GA, Montague developmental research in the field. Front
MG, Ma L, Moodie MM, Merryman C, Microbiol 5:1–8. https://doi.org/10.3389/
Vashee S, Krishnakumar R, Assad-Garcia N, fmicb.2014.00465
Andrews-Pfannkoch C, Denisova EA, Young L, 8. Takahashi M, Yamaguchi E, Uchida T (1984)
Qi ZQ, Segall-Shapiro TH, Calvey CH, Parmar Thermophilic DNA ligase. Purification and
PP, Hutchison CA 3rd, Smith HO, Venter JC properties of the enzyme from Thermus ther-
(2010) Creation of a bacterial cell controlled by mophilus HB8. J Biol Chem 259:10041–10047
a chemically synthesized genome. Science 329:
52–56
Chapter 5
TA Cloning Approaches to Cloning DNA with Damaged

Ends DNA
Charlotte Ayling
Abstract
DNA ends can become damaged for various reasons making them unsuitable for TA cloning techniques,
the easiest and most common of the DNA cloning technologies. Examples of end-damaged DNA include
ancient DNA and those produced by laboratory methods such as sonication. In this chapter, we discuss how
to deal with end-damaged DNA prior to cloning with either the popular pGEM®-T Easy Vector Systems
Kit and TOPO™ TA Cloning™ Kits.
Key words End repair, TA cloning, Damaged DNA ends, Ligation, Blunt ends
1 Introduction
1.1 What Is TA Cloning of DNA sequences into plasmids allows researchers to

Cloning and Why Is It amplify DNA samples so they can be sequenced and/or manipu-
Important? lated in downstream applications. Although PCR can be used to
directly amplify DNA, it may introduce more mutations and be
more costly than an experimental strategy based upon PCR fol-
lowed by cloning into a vector, transformation and subsequently
growing the vector containing cells to amplify the DNA. Addition-
ally, PCR reactions often require optimization, and due to the
sensitive nature of PCR, it is easy to contaminate and amplify
non-target DNA [1]. PCR products may be cloned by several
different approaches, including classical cloning as described in
Chap. 1. However, one of the most popular methods for cloning
PCR products is TA cloning. TA cloning is a simple and effective
method of cloning DNA sequences into plasmid vectors and
requires little prior technical experience from the user. This method
is commonly used for PCR products, as Taq DNA polymerase often
adds a single 3′ adenine (A) overhang to the newly synthesized
strand, with this activity forming the basis of the technology. The
vector itself is bought pre-prepared from commercial suppliers and
https://doi.org/10.1007/978-1-0716-3004-4_5,
55
56 Charlotte Ayling
A
A
3’ adenine
overhang
T T
5’ thymine
overhang
Fig. 1 How TA cloning works. TA cloning is dependent on single base adenine 3′

overhangs on the sequence to be cloned; these are usually introduced by Taq
DNA polymerase. The adenine base hybridizes with single thymine base
overhangs on the vector, stabilizing the proximity of the ends of the two
sequences improving the efficiency of the ligation reaction
is provided with a single thymine (T) overhang; the A from the

insert and the T from the vector are complementary, increasing the
chances of a successful ligation event [2]. Ligation (sealing of the
nick in the phosphodiester backbone) of the insert into the vector
can be through either T4 DNA ligase or, in some commercially
available kits, Topoisomerase [3]. Although in both cases the key
aspect is the complementary nature of the adenine on the insert and
the thymine on the vector to bring the sequences together (Fig. 1).
The introduction of a 3′ adenine by Taq, the most common of the
high temperature polymerases used in PCR (see Note 1), makes the
TA approach ideal for cloning PCR amplicons. The two most
widely used TA cloning kits are pGEM®-T Easy Vector Systems
Kit (Promega) and the TOPO™ TA Cloning™ Kit (Thermo-
fisher); Table 1 outlines some of the key similarities and differences.
1.2 Cloning of Non- Sequences other than those produced by PCR can also be cloned
PCR-Generated via the TA approach, as Taq is able to add a 3′ adenine to extant
Sequences and End sequences (for instance, fragmented genomic DNA) when incu-
Damage bated in the presence of dATP. As such, pools of heterogenous
unknown sequences can be easily cloned compared to other tech-
niques which often require an exact knowledge of a homogenous
insert sequence. However, as a caveat to the general flexibility of the
approach, the target sequence must contain blunt ends prior to the
TA and Damage 57
Table 1
Similarities and differences between the pGEM®-T Easy Vector Systems Kit and TOPO™ TA
Cloning™ Kit
TOPO™ TA Cloning™
Specifications pGEM®-T Easy Vector Systems Kit Kit
Antibiotic resistance Ampicillin (AmpR) Ampicillin (AmpR),
Kanamycin (KanR)
Recommended Top10, DH5α, JM109 Top10, DH5α
bacterial strain
Directionality No No
Replication of origin F1 Origin F1 Origin, pUC origin
Ligation time 1 h at room temperature, may be extended to 5 min at room
increase the number of colonies temperature
Blue white screening Yes Yes
1 2 3
kb
3.0
1.0
0.5
0.1
Fig. 2 Sonicated chromatin from stage 15/16 Xenopus laevis embryos on a 1% agarose gel. Lane 1, 1 kb plus
DNA ladder. Sizes are indicated. Lanes 2 and 3 show sonicated chromatin samples. The DNA is fragmented
and of various sizes, generating a smear down the gel; these fragments can be cloned but require an end
repair and the addition of A’s before TA cloning
addition of the adenine by Taq and subsequent cloning, DNA

which has damaged ends cannot be cloned via TA cloning due to
the variety of end-types present, as the lack of a blunt end makes the
addition of 3′A-overhang, which is necessary for TA cloning,
impossible. There are multiple ways DNA ends can be damaged;
it may occur naturally through a range of environmental damage or
as a by-product of laboratory processes such as sonication (Fig. 2).
58 Charlotte Ayling
For instance, ancient DNA (DNA greater than 50 years old) tends
to be degraded to fragments between 40 and 500 bp; this fragmen-
tation is due to hydrolytic depurination and subsequent single-
strand breaks is particularly prevalent at the ends of the DNA
[1]. Such material must first be end repaired to form blunt ends
prior to the addition of adenine and ligation into the vector.
2 Materials
The laboratory must be suitable for microbiology and molecular

biology work; this includes wearing the appropriate PPE, including
gloves and lab coats. All buffers and materials required must be
prepared using deionized water and autoclaved before use to pre-
vent contamination. In many jurisdictions, there are regulatory
requirements in producing and handling genetically modified
microorganisms, and the researcher should make sure that they
are aware of these and that they have been suitably addressed
prior to starting work.
2.1 End Repair 1. Thermo Scientific™ Fast DNA End Repair Kit.
2. 1.5 mL microcentrifuge tubes.
3. 0.5–10 μL pipette and sterile pipette tips.
4. Ice box and ice.
5. Heat block set to 20 °C or thermocycler.
6. Damaged DNA sample (0.5–5 μg).
2.2 Adding the 3′ 1. 1.5 mL microcentrifuge tube.

Adenines 2. 0.5–10 μL pipette and sterile pipette tips.
3. Ice box and ice.
4. Heat block set to 72 °C or thermocycler.
5. 7 μL end repaired DNA.
6. Dream Taq and appropriate buffer (see Note 1).
2.3 Purification 1. QIAquick PCR purification kit.

2. Microcentrifuge capable of ~17,000× g.
3. 100–1000 μL pipette and sterile pipette tips.
4. 10–100 μL pipette and sterile pipette tips.
2.4 Ligation 1. pGEM®-T Easy Vector Systems Kit.

2. Microcentrifuge capable of ~17,900× g.
3. 1.5 mL microcentrifuge tubes with low DNA-binding capacity.
TA and Damage 59
4. 0.5–10 μL pipette and sterile pipette tips.

5. Ice box and ice.
6. Vortex.
2.5 Transformation 1. TOPO™ TA Cloning™ Kit/pGEM®-T Easy Vector

Systems Kit.
2. LB agar plates with kanamycin or ampicillin for the TOPO™
TA Cloning™ Kit and ampicillin for the pGEM®-T Easy Vec-
tor Systems Kit; these need to be freshly prepared: 35 g LB agar
per 1 L of deionized water. Heat the water up in the micro-
wave, add the LB agar powder, and stir with a glass rod to
ensure all of the powder has dissolved. Pour the media into 4X
Duran bottles and sterilize by autoclaving. When the media has
cooled to ~60 °C, add 100 μL of 50 mg/μL kanamycin or
ampicillin per 100 mL LB agar. Pour approximately 20 mL of
the media into each petri dish and dry at 37 °C for 30 min with
the lids slightly open.
3. DH5α E.coli cells (see Note 2).
4. Heat block set to 42 °C.
5. Incubator set to 37 °C.
6. Shaking incubator set at 37 °C and 220 rpm.
7. Fresh LB broth (25 g per 1 L) or SOC medium.
8. Microcentrifuge.
9. Bunsen burner and heat proof mat.
10. Ice box and ice.
11. Timer.
12. Microwave.
13. 1000 mL beaker.
14. Glass rod.
2.6 Screening for 1. EcoRI restriction enzyme and appropriate buffer.

Clones 2. Approximately 1 μg sample.
3. Molecular Biology grade nuclease-free water.
5. Ice and ice box.
2.7 Gel 1. 1 L measuring cylinder.

Electrophoresis 2. 100 mL measuring cylinder.
3. Ethidium bromide (10 mg/μL stock).
4. Agarose.
5. 250 mL conical flask.
60 Charlotte Ayling
6. Power pack.
7. Gel electrophoresis tank with lid comb, UV tray, and dams.
8. Digested sample.
9. Undigested sample.
10. 100 bp plus DNA ladder/1 kb plus DNA ladder.
11. Microwave.
3 Methods
3.1 End Repair The Thermo Scientific™ Fast DNA End Repair Kit is used per the
manufacturer’s instructions as follows:
1. Add the following components (keep on ice) to a sterile micro-
centrifuge tube to make up a total of 50 μL:
• 0.5–5 μg DNA fragments
• 5 μL 10X End Repair Reaction Mix
• 2.5 μL End Repair Enzyme Mix
• Up to 50 μL Nuclease-Free Water
2. Incubate the sample(s) in a heat block or thermocycler for
5 min (no longer than 20 min) at 20 °C (room temperature).
3. This can be stored at -20 °C indefinitely.
3.2 Adding the 1. Add the following to 7 μL of the end repaired sample:
Adenines • 0.7 μL 10 mM dATP
• 1 μL Dream Taq polymerase
• 1 μL Dream Taq buffer
2. Mix well and incubate at 72 °C for 8–10 min in a hot block or
thermocycler.
3. Place on ice.
3.3 Purification We generally use QIAquick PCR purification columns. All centri-
fuge steps are at ~16,000× g in a conventional benchtop microcen-
trifuge. The recommended size range for purification by these
columns is 100 bp to 10 kb (see Note 3).
1. Add 5 volumes of buffer PB to 1 volume of the PCR sample
and mix.
2. Place a QIAquick spin column in a provided 2 mL
collection tube.
3. To bind the DNA, apply the sample to the QIA quick column
and centrifuge for 60 s.
TA and Damage 61
4. Discard the flow through. Place the QIAquick column back

into the same tube.
5. To wash, add 0.75 mL Buffer PE to the QIAquick column and
centrifuge for 60 s.
6. Discard the flow-through. Place the QIAquick column back in
the same tube. Centrifuge the column for an additional 60 s (see
Note 4).
3.4 Ligation The pGEM®-T Easy Vector Systems Kit (keep on ice) is used using
the following directions as specified by the manufacturer:
3.4.1 Using the pGEM®-T
Easy Vector Systems Kit 1. Briefly centrifuge the pGEM®-T or pGEM®-T Easy Vector and
Control Insert DNA tubes to collect contents at the bottom of
the tube.
2. In general, a 3:1 Molar ratio of insert to vector is recom-
mended; therefore, the mass of DNA to add varies with the
average insert length. To calculate the amount of PCR prod-
uct/DNA sample to add into the reaction, we use the Biomath
calculator available from the supplier (www.promega.com/
biomath/).
3. Set up the ligation reactions in 1.5 ml LoBind microfuge tubes
as shown in Table 2. Vortex the 2X Rapid Ligation Buffer
vigorously before each use.
4. Mix the reactions by pipetting. Incubate the reactions 1 h at
room temperature. Alternatively, incubate the reactions over-
night at 4 °C for the maximum number of transformants (see
Note 5).
5. Proceed to the transformation; the reaction can be stored at
-20 °C overnight.
Table 2
Reagent volumes for use with the pGEM®-T or pGEM®-T Easy kits
Standard Positive Background

Reagents reaction control control
2X Rapid Ligation Buffer, T4 DNA Ligase 5 μL 5 μL 5 μL
® ®
pGEM -T or pGEM -T Easy Vector 1 μL 1 μL 1 μL
(50 ng)
PCR product/DNA samples X μL – –
Control Insert DNA – 2 μL –
T4 DNA Ligase (3 Weiss units/μL) 1 μL 1 μL 1 μL
Deionized water to a final volume of 10 μL 10 μL 10 μL
62 Charlotte Ayling
Table 3
Reagent volumes for use with the TOPO® kit
Reagent Volume (μL)

Fresh PCR product 0.5–4
Salt solution 1
Water To final volume of 6
®
TOPO vector 1
Final volume 6
3.4.2 Using the TOPO™ Alternatively, the TOPO™ TA Cloning™ Kit can be used; follow
TA Cloning™ Kit the directions as specified by the manufacturer:
1. Set up the ligation by adding the reagents shown in Table 3.
2. Mix the reaction gently by pipetting up and down, and then
incubate the reaction at room temperature (22–23 °C) for
5 min.
3. Proceed to the transformation step; the reaction can be stored
at -20 °C overnight.
3.5 Transformation 1. Prepare LB agar plates with the suitable antibiotic for the
vector used (see Notes 6 and 7).
2. Thaw the DH5α cells on ice.
3. Add 1–100 ng of the DNA sample to the microcentrifuge tube
containing the cells and gently stir with the pipette tip.
4. Incubate for 30 min on ice.
5. Heat shock the cells by placing the tubes in a heat block set at
42 °C for 45 s.
6. Place the samples on ice for 2 min.
7. Add 250 μL of fresh LB broth/SOC medium to the micro-
centrifuge containing the cells and gently pipette up and down.
Make sure to use aseptic technique.
8. Incubate the cells in a shaking incubator set to 37 °C, 220 rpm
for 30–60 min.
9. While incubating the DH5α cells, place the LB plates (with the
suitable antibiotic) in the incubator set at 37 °C in order to dry
the plates prior to spreading.
10. Spin the cells in the centrifuge at 1000× g for 10 min to form a
visible pellet.
11. Discard the supernatant and resuspend in 100 μL of fresh LB
broth.
TA and Damage 63
12. Pipette 100 μL of the cells onto a LB agar plate (with the
suitable antibiotic) from the incubator and spread using aseptic
technique.
13. Incubate the plates overnight at 37 °C.
3.6 Screening for 1. Add the following to a 1.5 mL microcentrifuge tube:

Clones • 1 μL EcoRI (see Note 8)
• 1 μL EcoRI buffer
• Approximately 1 μg sample
2. Make up to 10 μL total volume with nuclease-free water.
3. Incubate the sample for 90 min at 37 °C.
3.7 Gel 1. Electrophorese the sample on a 1.4% agarose gel; to make a

Electrophoresis 1.4% gel, add 0.98 g agarose to 70 mL 1X TBE in a conical
flask.
2. Place in the microwave on medium heat for 2–3 min until the
solution is bubbling and all the agarose has been dissolved (see
Note 9).
3. Once warm to touch, 2 μL of ethidium bromide was added.
4. Swirl to mix the ethidium bromide and then pour into the UV
tray with the dams on the end and the comb in place.
5. Once the gel has set (this takes approximately 20 min), carefully
take the dams off, being careful not to rip the gel.
6. Place the gel in the UV tray into the tank and fill the tank with
1X TBE buffer until the wells and gel are covered.
7. Gently remove the comb and load the gel.
8. Electrophorese for 45 min at 110 V. Make sure to include an
undigested sample and a digested sample along with a DNA
ladder.
9. A band on the gel should be visible corresponding to the size of
the insert.
4 Notes
1. Recently high-fidelity versions of Taq have become readily

available. Although these versions introduce fewer mutations
into the PCR amplico,n they do not possess the non-template
driven 3′ adenine addition activity important for TA cloning.
For addition of the adenine to extant sequences, it is important
to use a standard Taq. We use Dream Taq from Thermo Fisher.
2. Instead of of DH5α cells any standard maintenance E,coli strain
such as Top 10 can be used.
64 Charlotte Ayling
3. Alternative purification methods will be required for fragments

below 100 bp. We have had some success with “SigmaSpin”
columns for very small fragments, but this will need optimiza-
tion for the given sample.
4. During the elution step of the purification, yield may be
increased if you leave the elution buffer on the membrane for
5 min before centrifuging.
5. For most applications, 5 min will yield sufficient colonies for
analysis. The length of the TOPO®-cloning reaction can be
varied from 30 s to 30 min. For routine subcloning of PCR
products, 30 s may be sufficient. For large PCR products
(greater than 1 kb) or if you are TOPO®-cloning a pool of
PCR products, increasing the reaction time will yield more
colonies.
6. From a 50 mg/mL stock solution of ampicillin or kanamycin,
add 100 μL for every 100 mL of LB agar to make up the plates
for the transformation.
7. Do not use plates that are more than 1 month old for the
transformation as the antibiotics will begin to degrade; keep
plates with antibiotics in the dark at 4 °C to prevent
degradation.
8. Both the pGEM®-T Easy Vector System and the TOPO™ TA
Cloning™ Kit supplied vectors have EcoRI sites flanking the
cloning site. Restriction of the plasmid with the enzyme will
result in the release of a fragment that should be approximately
the size of the expected insert, which can be visualized by
agarose gel electrophoresis. However, if there are internal cut
sites, more than one fragment may be released, confusing the
interpretation.
9. When taking the conical flask out of the microwave, fold and
then wrap some white roll/tissue around the neck of the flask
to prevent burning yourself.
References
1. Garibyan L, Avashia N (2013) Polymerase chain 5:a012 567. https://doi.org/1 0.1101/

reaction. J Investig Dermatol 133:1–4. https:// cshperspect.a012567
doi.org/10.1038/jid.2013.1 3. Yao S, Hart D, An Y (2016) Recent advances in
2. Dabney J, Meyer M, Paabo S (2013) Ancient universal TA cloning methods for use in function
DNA damage. Cold Spring Harb Perspect Biol studies. Protein Eng Des Sel 29:551–556.
https://doi.org/10.1093/protein/gzw047
Chapter 6
PCR-Based Assembly of Gene Sequences by

Thermodynamically Balanced Inside-Out (TBIO) Gene
Synthesis
Timothy J. Ragan and Helen A. Vincent
Abstract
The ability to enzymatically assemble DNA oligonucleotides into longer DNA duplexes in a process known
as gene synthesis has wide-ranging applications in the fields of genetic engineering and synthetic biology.
Thermodynamically balanced inside-out (TBIO) gene synthesis is one of several PCR-based primer exten-
sion gene synthesis protocols that have been developed. In TBIO gene synthesis, overlapping primers with
equivalent melting temperatures (Tms) are designed so that the 5′ half of the DNA is encoded by sense
primers and the 3′ half of the DNA molecule is encoded by antisense primers. Primer extension is initiated
at the center of the DNA and continues bidirectionally to progressively elongate the DNA molecule. Here
we provide the protocols necessary for performing TBIO gene synthesis to generate a DNA molecule of
interest.
Key words Bidirectional elongation, DNA, Genetic engineering, Gene synthesis, Overlapping pri-
mers, PCR, Primer extension, Synthetic biology
1 Introduction
Gene synthesis is the enzymatic assembly of DNA oligonucleotides

into longer DNA duplexes. The first synthetic gene, a 77 nt alanine
tRNA, was produced over 50 years ago [1]. At the time, it took
5 years to chemically synthesize 17 oligonucleotides encoding the
gene and then assemble them into the full-length gene by ligation
[1]. Since then, advances in both oligonucleotide synthesis and
enzymatic assembly by PCR [2] have led to a situation where
gene synthesis is now considered to be a routine molecular biology
technique that can be completed at relatively low cost on a time-
scale on the order of days.
The applications for gene synthesis are wide-ranging within the
field of genetic engineering [2–5]. For example, gene synthesis is
useful for generating expression constructs for which natural PCR
https://doi.org/10.1007/978-1-0716-3004-4_6,
65
66 Timothy J. Ragan and Helen A. Vincent
templates are unavailable; it allows protein-coding DNA sequences

to be codon-optimized for use in a chosen expression system; it
allows for the modification of sequences in order to facilitate
downstream molecular cloning steps, e.g., through the insertion
or removal of restriction sites; and it allows for the generation of
mutants for structure-function studies. Furthermore, gene synthe-
sis is proving to be fundamental in the field of synthetic biology
[5, 6]. It has significantly reduced the sequence constraints placed
on construct design; and it allows for a rapid “build” phase within
the design-build-test cycle.
Although custom gene synthesis services, now offered by a
growing number of providers (e.g., Invitrogen GeneArt, Gen-
Script, Integrated DNA Technologies (IDT), and Eurofins), are
relatively inexpensive and efficient, it can be desirable and/or
necessary to perform gene synthesis in-house. A variety of gene
synthesis protocols are available and have been reviewed elsewhere
[2–6]. The majority of protocols are variations on PCR-based
primer extension assembly in which contiguous single-stranded
synthetic DNA oligonucleotides with overlapping sequences
between adjacent oligonucleotides are assembled into a double-
stranded DNA product. PCR-based protocols differ in how the
oligonucleotides are designed to be assembled together and the
reaction conditions under which assembly is carried out [2–6]. In
this chapter, we will focus on the thermodynamically balanced
inside-out (TBIO) PCR-based gene synthesis method developed
by Gao and co-workers [7].
TBIO gene synthesis is a PCR-based primer extension protocol
that uses overlapping primers [7]. The key features are that the
overlapping regions of the primers all have a comparable melting
temperature (Tm), and primer extension is initiated at the center of
the DNA sequence and progressively extends out in both directions
[7]. A schematic overview of TBIO gene synthesis is presented in
Fig. 1. Overlapping sense primers encode the 5′ half of the DNA
sequence to be synthesized and overlapping antisense primers
encode the 3′ half of the DNA sequence (Fig. 1a). Up to a maxi-
mum of six primer pairs can be combined in an increasing concen-
tration gradient, starting with the innermost primer pair, in a single
reaction mixture (Fig. 1bi) [7]. Starting with the innermost primer
pair and working outwards, the primers are serially extended, using
a thermostable proofreading DNA polymerase and a PCR-based
thermocycle protocol, to assemble the full-length DNA sequence
(Fig. 1bii). Since primer extension must be completed for the
innermost primer pair before the next round of primer extension
can take place, the generated DNA molecule becomes progressively
longer over successive thermocycles. If six or fewer primer pairs are
required to encode the whole DNA sequence, a single round of
TBIO gene synthesis is sufficient to yield the full-length DNA
molecule. However, if more than six primer pairs are required to
TBIO Gene Synthesis 67
a Primer design
Sense primers
DNA sequence to be synthesized
: Matched Tm
Antisense primers
b PCR-based assembly
i Reaction mix
Primer Concentration
ii Stepwise primer extension

Step 1
Step 2
Step 3
Step 4
Step 5
Step 6
Fig. 1 An overview of thermodynamically balanced inside-out (TBIO)Thermodynamically balanced inside-out

(TBIO) gene synthesis [7]
encode the entire sequence, the DNA molecule generated by the

initial round can be gel-purified and substituted for the innermost
primer pair in a second round of TBIO gene synthesis. This process
of substituting the DNA molecule generated in a round of TBIO
gene synthesis for the innermost primer pair in a subsequent round
can be repeated until the full-length DNA molecule is generated.
Once all of the rounds of TBIO gene synthesis have been
completed and the full-length DNA molecule has been generated,
the synthetic DNA can be amplified using the outermost primers in
a standard PCR reaction. The sequence of the synthetic molecule
should then be checked by DNA sequencing, either directly, or by
first cloning it into a suitable vector. Once the sequence has been
verified, the synthetic DNA molecule is ready for use in the desired
downstream application(s), e.g., sub-cloning into an expression
vector or for use as an in vitro transcription template.
In this chapter, we provide the protocols that are necessary to
successfully generate a DNA molecule of choice by TBIO gene
synthesis. Specifically, we include protocols for: primer design,
single-round TBIO gene synthesis, and multi-round TBIO gene
synthesis. We also briefly outline the steps that should/can be taken
immediately following TBIO gene synthesis.
2 Materials
1. DNA sequence to be generated by TBIO gene synthesis (see

Notes 1 and 2).
2. Tm calculator (see Note 3).
3. Primers (see Subheading 3.1) (see Note 4).
4. ddH2O.
5. KOD Hot Start DNA Polymerase Kit (includes KOD Hot
Start DNA Polymerase (1 U/μL), 10X Buffer for KOD Hot
Start DNA Polymerase, 25 mM MgSO4, and dNTPs (2 mM
each)) (Sigma-Aldrich) (see Note 5).
6. Thermocycler.
7. Horizontal agarose gel electrophoresis reagents and apparatus.
8. Gel-extraction kit (e.g., QIAquick Gel Extraction Kit, Qiagen).
3 Methods
The protocols provided below assume that the user is familiar with
standard molecular biology techniques, including measuring DNA
concentration, standard PCR primer design, PCR, PCR clean-up,
agarose gel electrophoresis, and gel-extraction of DNA.
3.1 Primer Design The following protocol outlines how to manually design TBIO
and Synthesis gene synthesis primers (see Note 6).
1. Take the sense-strand sequence of the DNA to be generated by
TBIO gene synthesis (see Note 1) and identify a region of
approximately 20 nt (see Note 7) at the center of the sequence
(see Note 8) which is predicted to have a Tm of 64 °C ± 2 °C
when double-stranded (see Note 3) (Fig. 2a). Designate this
region O1–2 (see Note 9).
2. Identify the 60 nt (see Notes 10 and 11) sequence immediately
upstream of the 3′ end of O1–2 (Fig. 2b). Designate this
region 1 (see Note 12).
downstream of the 5′ end of O1–2 (Fig. 2c). Designate this
4. Identify a region of approximately 20 nt (see Note 7) extending
downstream from the 5′ end of region 1 which is predicted to
have a Tm of 64 °C ± 2 °C when double-stranded (see Note 3)
(Fig. 2d). Designate this region O3–1 (see Note 14).
upstream of the 3′ end of O3–1 (Fig. 2e). Designate this region
3 (see Note 15).
6. Identify a region of approximately 20 nt (see Note 7) extending
upstream from the 3′ end of region 2 which is predicted to have
a Tm of 64 °C ± 2 °C when double-stranded (see Note 3)
(Fig. 2f). Designate this region O2–4 (see Note 16).
downstream of the 5′ end of O2–4 (Fig. 2g). Designate this
8. Extend outwards incrementally, essentially repeating steps 4–7,
until the entire DNA sequence has been covered (see Note 18)
(Fig. 2h).
9. Synthesize (see Note 19) the odd-numbered sequences (see
Note 20) as sense primers (Fig. 2i).
10. Synthesize (see Note 19) the reverse complement of the even-
numbered sequences (see Note 21) as antisense primers
(Fig. 2i).
3.2 Single-Round Single-round TBIO gene synthesis is sufficient to generate DNA

TBIO Gene Synthesis molecules that can be assembled by primer extension of six or fewer
primer pairs (see Notes 18 and 22). All primer pairs are combined
in an increasing concentration gradient, starting with the inner-
most primer pair, in a single PCR-based reaction (Fig. 1b) [7]. The
optimal final concentration for each primer pair depends on the
total number of primer pairs to be combined (Table 1) [7].
a
O1-2
Tm = 64º C
1
b
O1-2
60 nt
2
c
O1-2
60 nt
1
d
O3-1
Tm = 64º C
3
e 1
O3-1
2
f
O2-4
Tm = 64º C
4
g 2
O2-4
11 7 3 2 6 10
h 9 5 1 4 8 12
S6
i S5 S4 S3 S2 S1
AS1 AS2
AS3 AS4
AS5 AS6
Fig. 2 Primer design for TBIO gene synthesis
1. Prepare stock dilutions of each primer in ddH2O according to

Table 2 (see Note 23).
2. Prepare a primer mix by combining 1μL of each of the required
primer stock dilutions and making the total volume up to 15μL
with ddH2O (see Note 24).
Table 1
Optimal final primer concentrations
Number of primer pairs 2 3 4 5 6
Innermost primers 40 40 40 40 40
60 60 60 60
80 80
Final primer concentration (nM) Internal primers
100
120 120 120
Outermost primers 200 200 200 200 200
Final total primer concentration (nM) 480 600 840 1000 1200
Table 2
Primer stock dilutions for single-round TBIO gene synthesis and round one of multi-round TBIO gene
synthesis
Innermost primers 2 2 2 2 2
3 3 3 3
4 4
Primer concentration (µM) Internal primers
5
6 6 6
3. Assemble the TBIO gene synthesis reaction mixture according

to Table 3, in a PCR tube, on ice.
4. Perform TBIO gene synthesis using the following thermocycle:
1. Polymerase activation 95 °C for 2 min

2. Denature 95 °C for 20 s
3. Anneal 60 °C for 30 s (see Note 25)
4. Primer extension 68 °C for 30 s (see Note 26)
5. Repeat steps 2–4 25 cycles (see Note 27)
6. Hold 4 °C forever
Table 3
TBIO gene synthesis reaction mix
Component Volume Final concentration

Primer mix 15μL See Table 1 or 4
10X buffer for KOD hot start DNA polymerase 5μL 1X
25 mM MgSO4 3μL 1.5 mM
dNTPs (2 mM each) 5μL 0.2 mM each
ddH2O X μL
KOD hot start DNA polymerase (1 U/μL) 1μL 0.02 U/μL
Total reaction volume 50μL
5. Verify that a product of the correct length has been synthesized

using agarose gel electrophoresis (see Note 28).
3.3 Multi-Round DNA molecules that require primer extension and assembly of
TBIO Gene Synthesis more than six primer pairs (see Note 22) can be generated using
multi-round TBIO gene synthesis (Fig. 3). The first round follows
the protocol for single-round TBIO gene synthesis (see Subheading
3.2), using up to six of the innermost primer pairs (see Note 22) to
generate an inside fragment (Fig. 3bi and ii). This inside fragment is
gel-purified (Fig. 3biii) and substituted for the innermost primer
pair in a second round of TBIO gene synthesis utilizing up to five of
the adjacent outer primer pairs (see Note 22) (Fig. 3c). The product
from the second round of TBIO gene synthesis can similarly be
gel-purified and substituted for the innermost primer in a third
round. This process can be repeated until the full-length DNA
molecule has been synthesized.
1. Perform an initial round of TBIO gene synthesis using the
innermost six primer pairs by following the protocol for
single-round TBIO gene synthesis (see Subheading 3.2)
(Fig. 3bi).
2. Gel-purify the DNA inside fragment (Fig. 3bii) (see Notes 29
and 30).
3. Prepare a 2μM stock dilution of the DNA inside fragment (see
Note 31).
4. Prepare stock dilutions of each primer in ddH2O according to
Table 4 (see Note 23).
a Primer design
b PCR-based assembly: round one

i Reaction mix
Primer Concentration
iii Gel-purification of inside fragment
c PCR-based assembly: round two

i Reaction mix
Primer concentration
Fig. 3 An overview of multi-round TBIO gene synthesis [7]
5. Prepare a primer mix by combining 1μL of the 2μM stock

dilution of the DNA inside fragment, 1μL of each of the
required primer stock dilutions, and making the total volume
up to 15μL with ddH2O (see Note 32).
6. Assemble the TBIO gene synthesis reaction mixture according
to Table 3, in a PCR tube, on ice.
Table 4
Primer stock dilutions for round two and subsequent rounds of multi-
round TBIO gene synthesis
Inside fragment 2 2 2 2 2
3 3 3 3
4 4
Primer concentration (µM) Internal primers
5
6 6 6
7. Perform TBIO gene synthesis using the following thermocycle:
1. Polymerase activation 95 °C for 2 min

2. Denature 95 °C for 20 s
3. Anneal 60 °C for 30 s (see Note 25)
4. Primer extension 68 °C for 60 s (see Notes 26 and 33)
5. Repeat steps 2–4 25 cycles (see Note 27)
6. Hold 4 °C forever
8. Verify that a product of the correct length has been synthesized

using agarose gel electrophoresis (see Note 28).
9. Repeat steps 2–8 (see Note 34).
3.4 Recommended The following steps are optional, but are recommended to both
Steps maximize the yield of the full-length DNA molecule, and to verify
its sequence.
1. Amplify the full-length DNA molecule in a standard PCR
reaction using the reaction mixture following the final round
of TBIO gene synthesis as the template, and the outermost
primer pair as the primers.
2. Purify the full-length DNA molecule using a PCR clean-up kit
(e.g., QIAquick PCR Purification Kit, Qiagen).
3. Sequence the DNA molecule (see Notes 35–37).
4 Notes
1. The DNA sequence to be generated by TBIO gene synthesis

will be highly user-specific. Users should ensure that they
include all of the components that need to be synthesized.
The required components will depend on the intended down-
stream applications of the synthetic DNA sequence and may
include promoters, untranslated regions, protein coding
regions, flanking restriction sites, etc. Consideration should
also be given as to whether any protein coding regions should
be codon-optimized for use in a specific expression system or to
remove undesirable restriction sites.
2. It can be helpful to annotate features of the DNA sequence that
may become relevant when designing primers, e.g., repeat
sequences that could result in mispriming events, or regions
to be modified for structure-function studies. This can be
completed in a simple text editor or using specialist sequence
editor software (e.g., SeqBuilder Pro from DNASTAR).
3. The Tm homogeneity of the overlapping regions of the primers
is critical to the success of TBIO gene synthesis. Therefore, care
should be taken when calculating predicted Tms. A number of
web servers are available to calculate Tms. Suitable options
include Oligo Analysis Tool, Eurofins (https://
eurofinsgenomics.eu/en/ecom/tools/oligo-analysis), and
OligoAnalyzer, IDT (https://eu.idtdna.com/calc/analyzer).
Accurate calculations typically require inputs for primer con-
centration (Table 1), and the concentrations of certain buffer
components (e.g., Mg2+ and Na+ (Table 3), in addition to the
primer nucleotide sequence.
4. We typically prepare 1 mM stock solutions of each primer in TE
(10 mM Tris-HCl, pH 8, 1 mM EDTA (ethylenediaminete-
traacetic acid)). The concentration of the stocks is verified by
measuring the absorbance at 260 nm (A260). Stocks are stored
frozen at -20 °C.
5. A high-fidelity proofreading DNA polymerase should be used
to minimize the number of errors incorporated during gene
synthesis. We typically use KOD Hot Start DNA polymerase
(Sigma-Aldrich). Possible alternatives include Phusion High-
Fidelity DNA Polymerase (New England Biolabs (NEB)). If an
alternative polymerase is used, the TBIO gene synthesis reac-
tion mix and thermocycle protocol should be adapted for use
with the chosen polymerase.
6. Automated primer design can be performed using the
web-based application DNAWorks (https://hpcwebapps.cit.
nih.gov/dnaworks) [8, 9]. However, the developers of DNA-
Works themselves acknowledge that DNAWorks is a design
tool for the experienced user [8, 9]. Therefore, we advise users
to familiarize themselves with the TBIO gene synthesis primer
design process before relying on the output from an automated
design tool.
7. The length of this region should be adjusted to achieve a Tm of
64 °C ± 2 °C. 20 nt is a good starting point.
8. The exact position of this region with respect to the center of
the DNA sequence can be adjusted to aid the identification of a
region of approximately 20 nt with a Tm of 64 °C ± 2 °C, or to
avoid potentially problematic regions of the sequence such as
repeat sequences.
9. This region will be the overlap between the 3′ termini of the
innermost primer pair (S1 and AS1).
10. This will be the final length of each primer. The choice of a
length of 60 nt reflects a balance between primer purity, primer
cost, and the need for flexibility to adjust the length of overlap
regions. However, advances in solid phase DNA synthesis
mean that it is currently feasible to routinely use primers up
to 90 nt in length.
11. It can be helpful to position repeat sequences, or regions that
will be modified for structure-function studies, in the gaps that
occur between primer overlaps. This can be achieved by
increasing the final length of a primer.
12. This sequence will be synthesized as the innermost sense
primer (S1).
13. The reverse complement of this sequence will be synthesized as
the innermost antisense primer (AS1).
antisense strand of the inside fragment generated by primer
extension of the innermost primer pair (S1 and AS1) and the
adjacent outer sense primer (S2).
15. This sequence will be synthesized as the adjacent outer sense
primer (S2).
sense strand of the inside fragment generated by primer exten-
sion of the innermost primer pair (S1 and AS1) and the adja-
cent outer antisense primer (AS2).
17. The reverse complement of this sequence will be synthesized as
the adjacent outer antisense primer (AS2).
18. Approximately 500 nt can be covered with 12 60 nt overlap-
ping oligonucleotides or six primer pairs.
19. Custom DNA oligonucleotide synthesis services are widely
available (e.g., Eurofins, IDT, and Merck).
20. Those encoding the 5′ half of the DNA sequence.
21. Those encoding the 3′ half of the DNA sequence.

22. A maximum of six primer pairs can be extended in a single
round of TBIO gene synthesis [7].
23. Primer concentration is critical to the success of TBIO gene
synthesis. The increasing concentration gradient favors the
synthesis of increasingly longer products until the full-length
DNA molecule is produced. Stock dilutions should be
prepared for immediate use and their concentration should
be verified by measuring the A260.
24. For example, the primer mix for two primer pairs would con-
tain 1μL of each of four primers and 11μL ddH2O, and the
primer mix for six primer pairs would contain 1μL of each of
12 primers and 3μL ddH2O.
25. Due to the complexity of the primer component of the reaction
mixture, we advise increasing the length of the annealing step,
from the manufacturer-recommended 10 s for standard PCR,
to 30 s.
26. KOD Hot Start DNA Polymerase exhibits optimal proofread-
ing activity at 68 °C. To minimize the error rate during gene
synthesis, we recommend following the manufacturer’s advice
and decreasing the temperature for primer extension from 70 °
C for standard PCR to 68 °C. The reduced primer extension
temperature requires an increased extension time. We advise
increasing the extension time, from the manufacturer-
recommended 15 s/kbp for standard PCR, to 60 s/kbp.
27. In theory, 2n-1 thermocycles, where n is the number of primer
pairs, should be sufficient to generate the full-length DNA
molecule (11 thermocycles for six primer pairs). However, in
practice, 20–25 cycles are required to achieve the maximum
yield of the full-length DNA molecule to allow for mispriming
and/or incomplete extension events.
28. A predominant band should be visible that migrates at a posi-
tion consistent with the length of the expected full-length
DNA molecule. Additional bands and/or a smear will also
likely be visible due to the presence of non-extended primers
or extended intermediates.
29. To limit mutagenesis, we recommend using SYBR Safe DNA
Gel Stain (Invitrogen) and blue light illumination as alterna-
tives to ethidium bromide and UV light illumination.
30. This will replace the innermost primer pair in the second round
of TBIO gene synthesis.
31. This will replace the stock dilutions of the innermost primers in
the second round of TBIO gene synthesis.
32. For example, the primer mix for two primer pairs would con-
tain 1μL of the 2μM stock dilution of the DNA inside frag-
ment, 1μL of each of two primers, and 12μL ddH2O. The
primer mix for six primer pairs would contain 1μL of the
2μM stock dilution of the DNA inside fragment, 1μL of each
of 10 primers, and 4μL ddH2O.
33. When using 60 nt oligonucleotides, each round of TBIO gene
synthesis elongates the DNA molecule by approximately
500 bp (see Note 18). To maintain a primer extension time
of 60 s/kbp, the primer extension time for the second round
should be increased from 30 s to 60 s. The primer extension
time should then be increased by 30 s for each subsequent
round of TBIO gene synthesis.
34. If subsequent rounds of TBIO gene synthesis are necessary to
generate the full-length DNA molecule.
35. Although the use of a high-fidelity proofreading DNA poly-
merase and thermocycling conditions that minimize the error
rate (see Note 26) should result in few errors, mutations could
still occur. Therefore, we advise checking the sequence of the
DNA molecule.
36. The DNA molecule may be sequenced directly using an appro-
priately designed sequence-specific primer. Alternatively, the
DNA molecule could be cloned into a suitable vector allowing
for amplification and sequencing using standard universal
primers.
37. If errors are detected, they should be corrected (e.g., using
standard site-directed mutagenesis protocols) before proceed-
ing to downstream applications.
Acknowledgements
We thank Dr. Joanna Fox (University of Leicester, UK) for critical

reading of the chapter.
References
1. Agarwal KL, Büchi H, Caruthers MH, Gupta N, and applications. FEMS Microbiol Rev 32:522–
Khorana HG, Kleppe K, Kumar A, Ohtsuka E, 540
Rajbhandary UL, Van de Sande JH, 4. Czar MJ, Anderson JC, Bader JS, Peccoud J
Sgaramella V, Weber H, Yamada T (1970) (2009) Gene synthesis demystified. Trends Bio-
Total synthesis of the gene for an alanine transfer technol 27:63–72
ribonucleic acid from yeast. Nature 227:27–34 5. Hughes RA, Miklos AE, Ellington AD (2011)
2. Carr PA, Church GM (2009) Genome Engi- Gene synthesis: methods and applications.
neering. Nat Biotechnol 27:1151–1162 Methods Enzymol 498:277–309
3. Xiong AS, Peng RH, Zhuang J, Gao F, Li Y, 6. Hughes RA, Ellington AD (2017) Synthetic
Cheng ZM, Yao QH (2008) Chemical gene DNA synthesis and assembly: putting the
synthesis: strategies, softwares, error corrections,
synthetic in synthetic biology. Cold Spring Harb 8. Hoover DM, Lubkowski J (2002) DNAWorks:
Perspect Biol 9:a023812 an automated method for designing oligonu-
7. Gao X, Yo P, Keith A, Ragan TJ, Harris TK cleotides for PCR-based gene synthesis. Nucleic
(2003) Thermodynamically balanced inside-out Acids Res 30:43e
(TBIO) PCR-based gene synthesis: a novel 9. Hoover D (2012) Using DNAWorks in design-
method of primer design for high-fidelity assem- ing oligonucleotides for PCR-based gene syn-
bly of longer gene sequences. Nucleic Acids Res thesis. Methods Mol Biol 852:215–223
31:143e
Chapter 7
Random Mutagenesis by PCR

F. A. Myers
Abstract
Random mutagenesis of DNA sequences has the advantage of generating DNA sequences with novel
properties, either directly in the case of aptamers or through subsequent transcription/translation of the
mutated sequence in the case of proteins. In both cases no prior structural or mechanistic knowledge of the
molecule is required. For sequences greater than 100 bp, one of the easiest methods to introduce the
mutations is to use Error-prone PCR (EP-PCR) as discussed in this chapter. When coupled with an
appropriate selection or high throughput screening methodology, PCR-based random mutagenesis can
provide a powerful tool for modern molecular biologists.
Key words Random mutagenesis, PCR, Error-prone
1 Introduction
Enzymatic approaches to random mutagenesis utilize the inherent

Error-prone (EP) nature of DNA polymerases during PCR. These
methods are applied to starting sequences to generate a library pool
of random mutations, scattered across the whole length of the
subject sequence. Standard Taq DNA polymerase, which is widely
used in PCR applications, is particularly error prone as it lacks a 3′
to 5′ proofreading exonuclease (see Note 1). The fidelity of Taq can
be further modulated by changing the PCR reaction conditions,
originally in the method of Leung et al. [1], this was through a
variety of modifications to standard PCR protocols such as increas-
ing the concentration of Taq enzyme, increasing dNTP concentra-
tions, and increasing the MgCl2 ions in the reaction and
introducing MnCl2 ions to the reaction as a supplement. These
modifications promote the mis-incorporation of nucleotides into
the nascent strand and increase the number of randomly mutated
products. Using these strategies, the yield of random mutagenesis
can be as high as 2% per nucleotide per reaction, although the final
degree of mutagenesis can largely be controlled by manipulating
the number of EP-PCR cycles performed in the reaction. An
https://doi.org/10.1007/978-1-0716-3004-4_7,
81
82 F. A. Myers
important consideration is that although an EP-PCR reaction may

produce all types of substitution mutations, the distribution of the
type of mutations may not be uniformly random, and there have
been reports of preferential accumulation of specific substitutions
[2]. Later methods included unbalanced concentrations dNTPs;
this reduced the mutation rate but showed no bias in the amplified
products [3]. The method was further modified by McCullum et al.
[4] to introduce several dilution steps. The McCullum protocol
starts with a higher template amount but then has dilution stages in
which after every 4 cycles 10% of the amplified product is trans-
ferred to a fresh tube containing the PCR reaction components,
allowing some control over the mutagenesis rate. In general, the
EP-PCR method has several key benefits for producing pools of
mutants with rates in the 0.5–4% per base per nucleotide range:
1. The protocol is quite simple and does not require any unusual
or difficult-to-obtain reagents.
2. No prior knowledge of the mechanistic requirements of the
final mutant is required.
3. The protocol if all steps are followed can usually yield the
desired level of mutagenesis in days (see Note 2).
4. A wide spectrum of mutations is generated.
2 Materials
2.1 General 1. 100 mM Tris-HCl, pH 8.3.

Requirements 2. 2 M KCl.
3. 200 mM MgCl2.
4. 25 mM dCTP, pH 7.
5. 25 mM dTTP, pH 7.
6. 5 mM dATP, pH 7.
7. 5 mM dGTP, pH 7.
8. 100 μM each 5′ and 3′ primers.
9. DNA template.
10. 25 mM MnCl2.
11. 5 U/μl Taq DNA polymerase.
12. 100 μl PCR tubes.
13. PCR ThermoCycler.
14. TOPO T/A cloning kit (Invitrogen).
15. QIA prep kit (Qiagen).
16. Nanodrop UV and agarose gel electrophoresis facilities.
PCR Mutagenesis 83
2.2 Planning The first step once the sequence of DNA to be mutagenized is
chosen is to decide on the level of changes best suited to that
specific project. A mutation rate that is too low may result in
missing important variants of interest. Conversely, if the rate is
too high, this could generate a library which contains molecules
carrying many multiple mutations confusing downstream interpre-
tation. For instance, if an enzyme with a modified function is
required, a high mutation rate will result in many mutant proteins
but few that retain any function. If a very high mutation rate is
required (for example, in order to alter catalytic activity or generate
a novel binding site), a downstream screening method capable of
selection from a large number of variants would be required. In
general, we recommend a final mutation rate of 0.5–1% per base per
PCR.
2.3 Pilot EP-PCR Prior to running the ER-PCR, it is important to run a pilot reaction
Experiment to determine the amplification efficiency. The main key point is to
monitor the yield per amplification cycle; if too low (< 1.7 fold
increase in DNA product), this can lead to DNA fragments which
contain only one or both of the primer sites which can lead to
shorter amplicon fragments, and these will be selectively amplified,
skewing the end pool of products. The other key point is to
calculate the number of EP-PCR cycles necessary to achieve the
required mutation rate. The average number of mutations per
DNA template starting length is shown below in Table 1 as a
function of EP-PCR doublings versus template length. To deter-
mine this, the starting template should be diluted and then ampli-
fied by the basic method outlined below. After every few cycles, a
sample should be taken for analysis on agarose gel. This should
show a yield of >1.7 fold amplification per cycle, should this not be
the case (see Note 3).
Table 1
Average number of mutations per DNA template as function of length and number of doublings
Template length
EP-PCR doublings Mutations per nucleotide position 100 bp 200 bp 400 bp 800 bp 1600 bp
5 0.0033 0.33 0.66 1.3 2.6 5.3
10 0.0066 0.66 1.3 2.6 5.3 11
20 0.013 1.3 2.6 5.3 11 21
30 0.020 2.0 4.0 7.9 16 32
50 0.0033 3.3 6.6 13 26 53
84 F. A. Myers
3 Method
3.1 Mutagenesis of This protocol is based on the Caldwell & Joyce Method and uses a
Homogenous Starting 500 bp homogenous DNA template region which is run through
Sequences 15 PCR cycles.
1. Make up the following PCR reaction mixture in 100 μl PCR
tube on ice:
– 10 μl 100 mM Tris-HCl, pH 8.3 (10 mM final)
– 2.5 μl 2 M KCl (50 mM final)
– 3.5 μl 200 mM MgCl2 (7 mM final)
– 4 μl 25 mM dCTP, pH 7 (1 mM final)
– 4 μl 25 mM dTTP, pH 7 (1 mM final)
– 4 μl 5 mM dATP, pH 7 (0.2 mM final)
– 4 μl 5 mM dGTP, pH 7 (0.2 mM final)
– 2 μl 100 mM 5′ primer (2 mM final)
– 2 μl 100 mM 3′ primer (2 mM final)
– X μl DNA template (3 nM of target site, final) (see Notes 3
and 4).
– 2 μl 25 mM MnCl2 (0.5 mM final) (see Note 5)
– 1 μl 5 U/μl Taq DNA polymerase (0.05 U/μl final).
Make up to 100 μL with DNAse free water (Molecular
Biology Grade).
2. Place the tube into the thermocycler and perform ~15 PCR
cycles (see below). The cycling conditions will vary depending
on the template and the primers, but generic conditions are:
94 °C for 1 min (denaturation), 60 °C for 1 min (annealing),
and 72 °C for 3 min (extension) (see Note 6).
3. The final PCR product should be run on an ethidium bromide
agarose gel with a suitable size marker to check that the correct
sized amplicon has been achieved.
4. Clone and sequence a sample of the PCR DNA to determine
frequency of mutations in the amplicon products using the
TOPO T/A cloning kit and a commercial sequencing company
(see Notes 7, 8, and 9).
3.2 Mutagenesis of Sometimes, it may be desirable to mutate a whole collection of

Heterogenous Starting sequences, for example, in a library, at the same time. In such cases,
Sequences the method should be modified as below (see Note 10).
1. Make up the following EP-PCR reaction on ice:
– 150 μl 100 mM Tris-HCl, pH 8.3 (10 mM final)
– 37.5 μl 2 M KCl (50 mM final)
PCR Mutagenesis 85
– 52.5 μl 200 mM MgCl2 (7 mM final)

– 60 μl 25 mM dCTP, pH 7 (1 mM final)
– 60 μl 25 mM dTTP, pH 7 (1 mM final)
– 60 μl 5 mM dATP, pH 7 (0.2 mM final)
– 60 μl 5 mM dGTP, pH 7 (0.2 mM final)
– 30 μl 100 μM 5′ primer (2 μM final)
– 30 μl 100 μM 3′ primer (2 μM final)
– 960 μl DNase free water
2. Divide the EP-PCR reaction mixture into 16 (90 μl aliquots)
labeled PCR tubes.
3. Add 7 μl of 30 ng/μl DNA library to tube 1 to give ~2 ng/μl.
Place tube 1 in the thermal cycler. Once it has reached the
annealing temperature add the following and mix:
– 2 μl 25 mM MnCl2 (0.5 mM final)
– 1 μl 5 U/μl Taq DNA polymerase (0.05 U/μl final)
4. Run the reaction for four cycles of the EP-PCR (use conditions
described in basic protocol above). During the final extension
at 72 °C, place a second tube with fresh EP-PCR into the PCR
block to warm. Transfer 10 μl from the first tube into the
second tube and then add the following and mix to the
second tube:
– 2 μl 25 mM MnCl2 (0.5 mM final)
– 1 μl 5 U/μl Taq DNA polymerase (0.05 U/μl final).
5. Repeat step 4 for the remaining 14 tubes. Analyze the PCR
reactions on agarose gel electrophoresis after every transfer and
quantitate the bands in successive PCR amplifications.
4 Notes
1. There are now many high-fidelity alternatives to standard Taq;

although preferred for many molecular biology applications,
these must not be used for Error-prone PCR protocols.
2. The initial optimization step can take anywhere between 1 and
2 days. The actual EP-PCR experiment takes up to 1 day to
perform depending on how many cycles are being used. Clon-
ing steps take 2–3 days. Preparing the samples for sequencing a
further day and the sequencing data is obtained between 5 and
10 days, depending on the sequencing provision used. Analysis
of the sequencing data takes 1–2 days.
3. Low PCR efficiency is most often the consequence of poor
primer design. Both 5′ and 3′ primers should be designed
with Tm’s 60 °C, a length of between 20 and 25 base pairs
the 3′ end should be a C or a G.
86 F. A. Myers
4. In general, higher concentrations of starting template will

reduce the mutation rate.
5. The amount of template DNA should be calculated in terms of
PCR target site. Assuming the template was just the target
sequence, then in our example, this would equate to 100 ng
total in the reaction. However, often the target sequence is part
of a plasmid, and this should be taken into consideration.
6. Manganese salts can precipitate out of solution. It is critical to
add the MnCl2 just prior to the initiation of the PCR reaction.
7. The oligonucletide primers should be designed so that the
annealing temperature is in the region of 60 °C to avoid
mis-priming, which has an enhanced likelihood in this protocol
due to the high divalent cation concentration. The longer
3-min extension reduces the selection of shorter sequences
produced by mis-priming.
8. There are a number of different cloning approaches; the sim-
plest for this application is one of the commercially available TA
cloning kits. We use either TOPO TA from Thermofisher or
pGEM-T Easy from Promega.
9. There are numerous suppliers of out-sourced Sanger sequenc-
ing; we use either Sigma or Genewiz and costs are normally in
the £5 per reaction range. Information on how to send the
samples varies with providers but can be found on their specific
websites. To view the raw data, you will need a chromatogram
viewer such as the free download FinchTV (https://
digitalworldbiology.com/FinchTV).
10. If lower levels of mutagenesis are observed than desired, more
EP-PCR cycles will be performed. If these need to go
>15 cycles, a fresh aliquot of Taq should be added after the
15th cycle is complete.
11. The basic protocol requires a small volume of starting tem-
plate. However, this may be insufficient to preserve the initial
library complexity if this is the starting material. In this case to
avoid any losses, start with a large template concentration and
perform four cycles of EP-PCR. The product should then be
taken and 10% of this used in a fresh EP-PCR reaction. This
serial transfer approach should be performed until the desired
number of doublings has taken place.
References
1. Leung DW, Chen E, Goeddel DV (1989) A 3. Cadwell RC, Joyce GF (1992) Randomization
method for random mutagenesis of a defined of genes by PCR mutagenesis. PCR Methods
DNA segment using a modified polymerase Appl 2:28–33
chain reaction. Technique 1:11–15 4. McCullum EO, Williams BAR, Zhang J, Chaput
2. Wilson DS, Keefe AD (2000) Random muta- JC (2010) Random mutagenesis by error-prone
genesis by PCR. Curr Protoc Mol Biol PCR. Methods Mol Biol 634:103–109
2000(8):3
Chapter 8
In Vitro Site Directed Mutagenesis

Michael J. McClellan
Abstract
Site-Directed Mutagenesis (SDM) allows for changes in the DNA sequence of plasmids using polymerase
chain reaction (PCR). It is a reliable, accessible, and rapid method which is the common initial step of many
biochemial or genetic experiments. Here we describe the various different forms of SDM before giving a
detailed method for the introduction of substitutions, insertions, or deletions using a fast, ligation-free
protocol, followed by colony PCR to screen for mutated sequences.
Key words Site-directed mutagenesis, Polymerase chain reaction, Mutation, Genetic alteration,
Plasmid manipulation, Colony PCR
1 Introduction
Site-Directed Mutagenesis (SDM) describes a number of methods

which modify the DNA sequence of plasmids. SDM, in one form or
another, has existed from the late 70s [1], after which a wide array
of modified protocols arose to introduce varying types of mutation,
and improving the speed and efficiency of the protocol, such as the
addition of steps to deplete unmodified DNA from the reaction as
pioneered by Kunkel [2] amongst others. In common, all methods
that bear the name use primers to target a specific sequence and
introduce a mutation, followed by PCR cycling to fix and amplify
those mutations, which can include one or multiple base substitu-
tions, deletions, and insertions. In this regard it is a distinct method
from more modern forms of site-directed mutagenesis such as
CRISPR [3–5], the development of which in no way obsoletes
classic SDM. The applications of SDM are truly vast. Almost any
manipulation of plasmid DNA outside of restriction and cloning
can be performed by SDM, from inactivating resistance genes to
creation or deletion of restriction sites [6–8]. The introduction of
point mutations or deletions into proteins in expression vectors is a
common first step in studying the phenotype of many genetic
https://doi.org/10.1007/978-1-0716-3004-4_8,
87
88 Michael J. McClellan
perturbations, be it structural or functional [9–14]. Outside of

coding regions, the manipulation of enhancers or promoters in
reporter plasmids by SDM allows the study of transcriptional con-
trol, via removing, modifying, or creating transcription factor bind-
ing sites [15, 16].
The major steps are the selection of the desired mutation, the
design of primers to effect and target the mutation, the introduc-
tion and amplification of the mutation by PCR, the repair of the
plasmid either by transformation into bacteria or ligation, and
finally the selection of the correct sequence by cloning and sequenc-
ing. There are a number of highly reliable SDM kits provided by
numerous suppliers, including NEB and Agilent, each coming with
their own excellent set of instructions and aids. Here we will
describe a fast SDM method which uses PCR to introduce point
mutations, deletions, or insertions and staggered nicks to allow for
transformation into bacteria without ligation. To improve the effi-
ciency of the reaction, wild type template DNA carrying methylated
dam sites is digested by DpnI (therefore the plasmid to mutate
must be purified from dam+ bacteria). Colony PCR is used to
accelerate the protocol further such that a purified, mutated plas-
mid can be obtained within 24 h.
2 Materials
2.1 SDM PCR 1. Q5 DNA polymerase and buffer (New England Biolabs) (see
Note 1).
2. SDM primers (see Subheading 3.2).
3. Plasmid purified from dam+ bacteria and eluted in water or
elution buffer.
4. 10 mM dNTP mix.
2.2 Digestion and 1. DpnI and rCutsmart buffer (New England Biolabs).
Transformation 2. XL-10 GOLD ultracompetant cells (Agilent) (see Note 1).
3. 14-mL snap cap Falcon polypropylene round-bottom tubes.
4. S.O.C. medium (ThermoFisher).
5. Water bath at 42 °C.
6. Agar plates with Antibiotic appropriate for plasmid.
2.3 Colony PCR and 1. Q5 DNA polymerase and buffer (New England Biolabs) (see
Sequencing Note 1).
2. Primers designed to amplify mutated region.
3. 10 mM dNTP mix.
4. LB broth with appropriate antibiotic.
SDM 89
3 Methods
Carry out all procedures at room temperature unless otherwise

specified.
3.1 Selection of 1. Select bases to mutate; as many as three can be easily changed in
Mutations and Design one reaction, above which efficiency may start to drop off.
of Primers 2. Bases to mutate should all be within 30 bp of each other. Short
deletions or insertions may also be introduced; however, any
more than three bases begins to reduce the yield of mutated
plasmid, as does deleted/inserted bases being
non-consecutive. If multiple changes of this type are required,
it may be best to do sequential rounds of mutagenesis.
3. Design primers, which are the direct complements of each
other, targeting the region of plasmid you wish to mutate.
4. Primers do not require 5′ phosphorylation, and standard
desalting purification is sufficient.
5. The melting temperature of primers should be high, >~75°, to
allow for mismatches and should possess G or C “clamps” at
either end, although this is not essential (see Note 2).
6. The primers should be complimentary to the plasmid sequence
except at the bases which are to be mutated (Fig. 1). No
mutated base should be less than 10 bp away from one end of
the primer.
7. The minimum size of the primers should be 30 bp to allow
sufficient distance between staggered nicks on the plasmid
(Fig. 2) to facilitate annealing. Both primers should contain
all mutated bases.
8. Larger primers can be used when targeting multiple sites,
although this increases the risk of secondary structure
formation.
3.2 SDM PCR 1. Make a 50 μL PCR mix containing the following:

10 μL 5× Q5 buffer
X μL (1–50 ng) of dsDNA template (see Note 3)
1 μL 10 mM dNTP mix (see Note 4)
0.5 μL (1U) Q5TM High Fidelity DNA Polymerase
2.5 μL of 10 μM Forward SDM primer
2.5 μL of 10 μM Reverse SDM primer
X μL H2O to make up to 50 μL
2. Cycle the reaction in a thermocycling PCR machine as per
Table 1.
Fig. 1 Schematic of primer design for the three basic forms of SDM, substitution, insertion, and deletion. In
each case, the primers are the exact complement of each other, and both primers contain the desired change
in sequence. Primers are also long, with a high Tm, and the mutations are central
Fig. 2 Introduction of mutation by PCR and the depletion of unmutated plasmid by DpnI digestion. Plasmid,
isolated from dam+ bacteria, will carry methylated adenine on both strands at all GATC sequences (blue DNA),
whereas newly synthesized DNA, extended from primers carrying the mutated sequence will not possess any
methylated bases (black DNA). Multiple rounds of PCR will enrich DNA carrying the mutation relative to the
methylated parental DNA. Four possible products exist after the final round of extension, all, excepting plasmid
with a staggered nick and carrying the desired mutation on both strands, will be digested by DpnI, which
selectively targets methylated and hemi-methylated GATC sequences
SDM 91
Table 1
Thermocycling conditions for SDM PCR
Stage Cycles Temperature Time

1 1 98 °C 30 s
2 98 °C 10 s
15–25 55–60 °C 10 s
72 °C 30 s/kb
3 1 72 °C 1 min/kb
3.3 Digestion of 1. Add 1 μL (20 U) of DpnI, 6 μL of rCutsmart buffer and 3 μL

Template DNA and H2O. Mix by pipetting and incubate reaction at 37 °C for 1 h.
Transformation This step eliminates plasmid that does not contain mutated
bases on both strands (Fig. 2).
2. Pre chill 14 mL snap cap Falcon polypropylene round-bottom
tubes (1 per reaction).
3. Gently thaw XL-10 GOLD ultracompetent cells on ice (50 μL
per reaction).
4. Prewarm S.O.C. medium and Agar plates with appropriate
antibiotic to 37 °C (see Note 5).
5. Mix 50 μL of XL-10 GOLD ultracompetent cells with 2–10 μL
of DpnI digested DNA in a prechilled 14 mL round bottom
falcon tube, mix by pipetting, and incubate on ice for 10 min
(see Note 6).
6. Submerge the bottom half of each falcon tube in 42 °C water
for 40 s, transfer back into ice, and incubate for 2 min (see
Note 7).
7. Add 500 μL prewarmed S.O.C. medium to each falcon and
incubate shaking (225 rpm) at 37 °C for 1 h to allow bacteria to
recover (see Note 8).
8. To ensure that there are isolated colonies to pick the next day,
add 5 μL, 50 μL, and 500 μL of the transformation mix to
prewarmed Agar plates with the appropriate antibiotic for the
plasmid. For 5 μL and 50 μL, pipette the transformation mix
into a pool of 495 μL and 450 μL, respectively, of prewarmed
S.O.C. medium to facilitate spreading (see Note 9).
9. Spread the liquid evenly across the plate using a cell spreader or
plating beads and invert the plate before incubating overnight
at 37 °C.
3.4 Colony PCR and 1. Select primers to amplify (and later sequence) the region con-
Sequencing taining the introduced mutation. These should not be more
than 500 bp apart, and neither primer should be within 20 bp
of the mutated bases to ensure high sequencing quality at the
critical point in the read (see Note 10).
Table 2
Thermocycling conditions for colony PCR
Stage Cycles Temperature Time

1 1 98 °C 30 s
2 98 °C 10 s
30 55–60 °C 10 s
72 °C 30 s/kb
3 1 72 °C 2 min
2. Prepare one 25 μL PCR mix for each colony to sequence

containing the following:
5 μL 5× Q5 buffer
0.5 μL 10 mM dNTP mix
0.25 μL (0.5 U) Q5TM High Fidelity DNA Polymerase
2.5 μL of 10 μM Forward sequencing primer (see Note 11)
2.5 μL of 10 μM Reverse sequencing primer (see Note 11)
39.25 μL high purity water to make up to 50 μL
3. Pick 3–6 large and isolated colonies from any of the 3 plates.
Attach a pipette tip to a P20 pipette and, using the tip, scrape
half of the colony off the plate and submerge in 25 μL of PCR
mix, pipette up and down, and move tip around the inside of
the tube to dislodge the colony into solution. Clearly annotate
and circle each colony chosen on the back of the plate and store
at 4 °C (see Note 12).
4. Cycle the reaction in a thermocycling PCR machine as per
Table 2.
5. Either purify PCR product or directly send PCR mix for purifi-
cation and sequencing depending on your sequencing
provider.
6. Once the correctly mutated colony is identified, pick the other
half of the appropriate colony using a pipette tip and drop it
into LB broth to inoculate. Grow overnight ready for mini- or
midi-scale plasmid preparation.
4 Notes
1. Many polymerases are appropriate for SDM but must lack

strand displacement or 5′–3′ exonuclease activity and must
use a buffer that is compatible with DpnI activity (information
which can be found on the New England Biolabs website). Q5
is listed here as it is an economical and high-fidelity polymerase
SDM 93
exhibiting the required characteristics. Pfu polymerases are also

appropriate. Likewise, XL-10 GOLD are an example of an
abundance of possible dam+ competent cells.
2. GC clamps are short sequences of G and/or C bases at the ends
of primers, which, due to their higher melting temperature,
have been shown to improve PCR efficiency. If it is not possible
to achieve this at both ends of the primer, the 3′ end, from
which extension will occur, has priority. There are also plenty of
online SDM primer design tools which reliably produce work-
ing primers.
3. The amount of plasmid DNA to use can be modified depend-
ing on the size of the plasmid. Between 1 and 50 ng is appro-
priate for plasmids under 5 kb; for larger plasmids, up to
100 ng can be used. Multiple reactions can be set up each
with a different amount of template plasmid to ensure colonies
are obtained.
4. As with any PCR reaction, it is possible to optimize the amount
of primer to dNTP to template ratio; however, in SDM PCR
reactions, it is recommended that primers be kept in constant
excess. Cycle number can also be optimized but usually
between 15 and 25 cycles will produce colonies.
5. The following steps can be performed next to a Bunsen burner
(to provide updraft) or in a lateral flow hood to minimize the
chances of contamination; however, with antibiotic resistance
in the plate, this is not strictly necessary. To control for con-
tamination, add an extra sample to which no DpnI treated
SDM PCR reaction is added. If a similar number of colonies
are obtained on this plate as those that received plasmid, stop
the experiment and repeat but prepare all reagents fresh.
6. To control for transformation efficiency, transform 2–20 ng of
the unmodified plasmid alongside the mutated plasmids. If no
colonies are obtained on SDM transformed plates and colonies
are seen on the control plate, it is most likely due to inefficient
PCR amplification as a result of primer mispriming or second-
ary structure. To avoid unnecessary delays, we usually design
multiple primer pairs per mutation, varying length, and posi-
tion of the primers. PCR conditions and input amount of DNA
can also be altered to improve SDM PCR efficiency.
7. If the number of transformations is limited, it is possible to heat
shock bacteria without a water bath. Take a thermometer and
fill a beaker with hot water from the tap. Slowly run cold water
into it whilst stirring with the thermometer until it reads 42 °C,
stop the tap, and heat shock the bacteria in the beaker. Do not
transform bacteria in a heat block as transformation efficiency
will dramatically decrease.
8. This recovery incubation step is not necessary if the resistance

gene is for Ampicillin.
9. As the plasmid is nicked rather than supercoiled, transforma-
tion efficiency will be variable and much lower than usual,
hence the wide range of plating volumes. Plating can also be
performed next to a Bunsen or in a hood (see Note 5), but
usually being quick with replacing the plate lid and the antibi-
otic embedded in the agar will suffice to prevent contamina-
tion. To reduce the number of plates used it is also possible to
recover in a smaller volume of S.O.C. and add to a single plate
then spread to single colonies by streaking.
10. It is possible that the plasmid gains additional mutations apart
from the desired ones, either from unrepaired DNA damage or
Polymerase error. Depending on the downstream application,
it may be necessary to sequence the entire plasmid.
11. It is not necessary to use the same primers to amplify the
mutated region as for sequencing, but sequencing primers
must always be within the region amplified during colony PCR.
12. If the next day sequencing is available, simultaneously inocu-
late LB broth (plus antibiotic) with each colony chosen for
colony PCR. The next day, when sequencing results arrive, a
mini- or-midi prep may be performed directly from the culture
grown from the appropriate colony, discarding the rest.
References
1. Gillam S, Smith M (1979) Site-specific muta- directed mutagenesis of large amplified mole-
genesis using synthetic oligodeoxyribonucleo- cules. Nucleic Acids Res 21(9):2277–2278
tide primers: II. In vitro selection of mutant 7. Liu H, Ye R, Wang YY (2015) Highly efficient
DNA. Gene 8(1):99–106 one-step PCR-based mutagenesis technique
2. Kunkel TA, Roberts JD, Zakour RA (1987) for large plasmids using high-fidelity DNA
Rapid and efficient site-specific mutagenesis polymerase. Genet Mol Res 14(2):3466–3473
without phenotypic selection. Methods Enzy- 8. Luna S, Mingo J, Aurtenetxe O, Blanco L,
mol 154:367–382 Amo L, Schepens J, Hendriks WJ, Pulido R
3. Jinek M, Chylinski K, Fonfara I, Hauer M, (2016) Tailor-made protein tyrosine phospha-
Doudna JA, Charpentier E (2012) A program- tases: in vitro site-directed mutagenesis of
mable dual-RNA-guided DNA endonuclease PTEN and PTPRZ-B. Methods Mol Biol
in adaptive bacterial immunity. Science 337: 1447:79–93. https://doi.org/10.1007/978-
816–821 1-4939-3746-2_5. PMID: 27514801
4. Cho SW, Kim S, Kim JM, Kim JS (2013) Tar- 9. Adereth Y, Champion KJ, Hsu T, Dammai V
geted genome engineering in human cells with (2005) Site-directed mutagenesis using Pfu
the Cas9 RNA-guided endonuclease. Nat Bio- DNA polymerase and T4 DNA ligase. Biotech-
technol 31:230–232 niques 38(6):864, 866, 868
5. Doudna JA, Charpentier E (2014) Genome 10. Wu D, Guo X, Lu J, Sun X, Li F, Chen Y, Xiao
editing. The new frontier of genome engineer- D (2013) A rapid and efficient one-step site-
ing with CRISPR-Cas9. Science 346(6213): directed deletion, insertion, and substitution
1258096 mutagenesis protocol. Anal Biochem 434(2):
6. Marini F 3rd, Naeem A, Lapeyre JN (1993) An 254–258
efficient 1-tube PCR method for internal site-
SDM 95
11. Liu H, Naismith JH (2008) An efficient 14. Emruzi Z, Aminzadeh S, Karkhane AA,
one-step site-directed deletion, insertion, sin- Alikhajeh J, Haghbeen K, Gholami D (2018)
gle and multiple-site plasmid mutagenesis pro- Improving the thermostability of Serratia mar-
tocol. BMC Biotechnol 4(8):91 cescens B4A chitinase via G191V site-directed
12. Monchietti P, López Rivero AS, Ceccarelli EA, mutagenesis. Int J Biol Macromol 116:64–70
Catalano-Dupuy DL (2021) A new catalytic 15. Liang Q, Chen L, Fulco AJ (1995) An efficient
mechanism of bacterial ferredoxin-NADP+re- and optimized PCR method with high fidelity
ductases due to a particular NADP+binding for site-directed mutagenesis. PCR Methods
mode. Protein Sci 30(10):2106–2120 Appl 4(5):269–274
13. Harrison JJEK, Tuske S, Das K, Ruiz FX, Bau- 16. Nishizawa-Yokoi A, Yamaguchi N (2018)
man JD, Boyer PL, DeStefano JJ, Hughes SH, Gene expression and transcription factor bind-
Arnold E (2021) Crystal structure of a retrovi- ing tests using mutated-promoter reporter
ral polyprotein: prototype foamy virus lines. Methods Mol Biol 1830:291–305
protease-reverse transcriptase (PR-RT).
Viruses 13(8):1495
Chapter 9
Xenopus Transgenesis Using the pGateway System

Liliya Nazlamova
Abstract
Transgenic approaches using I-SceI are powerful genome modification methods for creating heritable
modifications in eukaryotic genomes. Such modifications are ideal for studying putative promoters and
their temporal and spatial expression patterns in real time, in vivo. Central to this process is the initial
engineering of a plasmid construct containing multiple DNA modules in a specific order prior to the
integration into the target genome. One popular way of doing this is based upon the pGateway system, the
modular form of which described in this chapter is known as pTransgenesis. We will initially describe the
protocol of obtaining the plasmid construct containing the required sequence modules, and then the
process of integrating the construct into the genome of a Xenopus embryo via co-injection with I-SceI and
subsequent screening for transgenics.
Key words Site-specific recombination, Plasmid cloning, Transgenesis, Xenopus
1 Introduction
1.1 Transgenesis as The term transgenic was first introduced in 1981 by John Gordon
a Tool for Reporter and Frank Ruddle when they successfully inserted exogenous
Gene Assays genetic material into the genome of fertilized mouse eggs
[1]. Since then, transgenesis has evolved into a widely used method,
across a number of species for both commercial and academic
purposes. Examples include the “spider goat” for spider silk pro-
duction in goat milk and golden rice, which is fortified for the
precursor to vitamin A [2, 3]. The first reported transgenic frog
was made in 1984 by Laurence Etkin when he introduced, via
microinjection, DNA constructs into one cell Xenopus laevis
embryos [4]. In these early experiments, various constructs were
injected as either linear or circular pieces of DNA into model
organisms, such as Xenopus, Drosophila, and Sea Urchins. Circular
plasmids were found to be integrated into the embryo genome less
often than the linearized genetic material, but the main problem
with the method was the highly mosaic expression pattern, where
the plasmid was integrated into the genomes of only patches of
https://doi.org/10.1007/978-1-0716-3004-4_9,
97
98 Liliya Nazlamova
cells. Further, gene expression often displayed mis-regulation,

likely due to positional epigenetic influence [4]. However, since
then Xenopus transgenesis has undergone extensive development,
successful examples include the introduction of the Gal4/UAS
system [5], ubiquitous expression of GFP [6], and specific eye
expression under control of the γ-crystallin [7]. A modern method
for creating transgenic frogs utilises the restriction meganuclease,
I-SceI, avoiding many of the problems associated with the early
experiments. In particular, the I-SceI method is not restricted by
the DNA insert size and has a high survival rates of modified
embryos.
1.2 The I-SceI In order to produce a transgenic frog using the I-SceI technique,
Technique and the one-cell stage embryos are injected with a plasmid clone (Fig. 1),
pGateway System containing the insert of interest and a marker gene for indicating a
successful transgenesis event. I-SceI is an endonuclease isolated
from the yeast Saccharomyces cerevisiae that recognizes an 18-bp
non-palindromic sequence that does not occur within the genomes
of animal species but will linearize the plasmid within the cell,
preventing recircularization by endogenous ligases. In our hands
this method can give approximately 30% efficiency in generating F0
transgenic Xenopus.
Key to the I-SceI transgenesis protocol is the assembly of the
final injectable plasmid. In this chapter, we use a recombinase
approach based upon the commercially available pGateway system
to construct the initial plasmid and subsequently use this plasmid to
generate a transgenic frog for characterization of a previously
unknown promoter. The recombinase approach involves four vec-
tors, each of which carries one of the modules (such as a putative
promoter, GFP reporter) that will be combined to build the final
cassette (Fig. 2). These vectors are based upon the pGateway
plasmids which form the pGateway system [8, 9]. This is a modular
system and is transferable between different species such as Dro-
sophila, Zebrafish, Xenopus, and mammalian cells. An interesting
aspect of the pGateway plasmids is the inclusion of the ccdB gene
which encodes a gyrase inhibitor that is toxic to most E. coli strains.
However, after successful recombination, this gene is removed
from the plasmids as a by-product. Therefore, after bacterial trans-
formation, only the bacterial clones containing the successful
recombinants will survive, drastically reducing the background.
Although the pGateway system provides non-recombinant
plasmids, versions of the plasmids containing the required gene
modules can be obtained easily from a number of sources. The
ones in our example are available from European Xenopus Resource
Center (EXRC) (https://www.port.ac.uk/research/research-pro
jects/european-xenopus-resource-centre) and obviate the need for
insertion of genes into the base plasmid; the relationship between
the base plasmids and the ones obtained from the EXRC is shown
pGateway Transgenesis 99
I-SceI γ-Crys/ GFP Putat. promoter Katushka SAR-cHS4 I-SceI

Expression vector (p4)
Amp r
+ I-SceI
I-SceI γ-Crys/ GFP Putat. promoter Katushka SAR-cHS4 I-SceI
Injecng the mix of I-SceI and

the expression vector into
one-cell Xenopus embryos
n= 100
• Injected embryos le to develop

• Screen for the presence of green
eyes
Fig. 1 Outline of the I-SceI transgenic procedure. A mix of I-SceI and an expression clone is injected into
one-cell Xenopus laevis embryos. The expression vector carries internal control modules. These include
flanking I-SceI restriction sites and 5′ and 3’ insulators (Tol2). A γ-crystalline promoter driving a GFP reporter
gene (indicated in green) is used as a marker for later identification of successful transgenics. A second set of
modules within the expression clone consists of the putative promoter to be tested (dark blue) and a second
reporter gene Katushka (red). Depending on the properties of the putative promoter, red fluorescence may be
observed at developmental stages
100 Liliya Nazlamova
attB1 PCR product attB1
attP1 ccdB Cm r attP2

pDonr221 vector
Kan r
attL1 Putat. promoter attL2

Entry clone p2
Kan r
attL4 Γ-crys/ GFP attR1 attR2 Katushka attL3
Entry clone p1 Entry clone p3
Kan r Kan r
I-SceI Tol2 attR4 ccdB Cm r attR3 Tol2 I-SceI

Destination vector p4
Amp r
I-SceI Tol2 B4 γ-crys/ GFP B1 Putat. promoter B2 Katushka B3 Tol2 I-SceI
Expression vector
Amp r
Fig. 2 MultiSite gateway 3-fragment recombination reaction. An overview of the pGateway cloning procedure
where the first step is PCR-amplification of a putative promoter construct to be recombined with the pDONR
vector. The resulting new plasmid designated entry clone p2 (putative promoter) is recombined with p1
(Y-crystalline/GFP), p3 (Katushka), and destination vector p4 in order to produce the expression vector. The
crossed lines represent recombination events between the designated att-sites and segments B1, B2, B3, and
B4 represent the positions of the resulting recombination sites. The selected recombination att-sites in all of
the plasmids allow for specific order of the cassette elements
in Table 1. In our example, vectors P1(γ-crystalline/GFP), P2

(putative promoter), and P3(Katushka) are recombined with
pDest by LR Clonase® II in order to produce the final expression
clone, pDest(final). The final product pDest(final) will possess all
the necessary modules and elements required for transgenesis. The
γ- crystallin promoter driving GFP expression will act as a marker
for transgenic tadpoles and is adjacent to the promoter to be
characterized which is itself driving the Katushka module. In the
final plasmid construct, these modules will be flanked by a SAR-
CH4 insulator and I-SceI meganuclease sites. When this plasmid is
injected into Xenopus embryos, successful transgenesis will be con-
firmed by the frog’s eyes glowing green, as the γ-crystallin pro-
moter will drive GFP expression specifically in the eye lens. If the
putative regulatory element is functional, it will drive Katushka
expression at defined developmental stages, and therefore, red
Table 1
Plasmid nomenclature
Non-recombinant Derived recombinants carrying the

Non-recombinant (commercial) short designation cassette modules
pDONR™ P1 P1 (γ-crystalline/GFP)
™
pDONR 221 P2 P2 (putative promoter)
pDONR™ P2R-P3 P3 P3 (Katushka)
pDEST™ R4-R3 Vector II pDest pDest (final)
A list and nomenclature of the plasmids used in the pGateway system—P1 (γ-crystalline/GFP) module serves as a
selectable marker to allow for screening of successful transgenesis as GFP will be specifically expressed in the eye lens. P2
(putative promoter) contains the DNA sequence to be analyzed, and P3 (Katushka) carries the reporter gene Katushka.
pDest is the destination vector, which carries the elements required for successful transgenesis: I-SceI sites, Tol2 sites,
SAR- cHS4 insulators. SAR-CH4 insulator will isolate the integrated cassette from nearby functional elements that could
potentially non-specifically regulate the expression of the reporter genes
fluorescence will be detected using a fluorescent microscope. The

transgenic embryos can be monitored throughout the develop-
mental stages and examined for fluorescent expression to determine
temporal and spatial expression patterns of the unknown promoter
in vivo.
2 Materials
Ensure your laboratory is suitably registered and set-up for molec-

ular biology work and wear a lab coat, gloves, and appropriate PPE
at all times to avoid contamination and minimize the risk of nucle-
ase degradation of samples. Use of live animals is strictly regulated
at a national level jurisdiction; please be aware that you will require
relevant regulatory permissions. Use molecular biology grade
reagents and distilled, deionized water for preparing buffers.
2.1 Plasmid 1. pGateway kit (see Note 1).

Recombination and 2. P1(γ-crystalline/GFP) and P3(Katushka) constructs contain-
Screening ing γ-crystalline and Katushka, respectively, are available upon
request from EXRC https://xenopusresource.org/.
3. High-fidelity PCR mastermix.
4. Primers (see Note 2).
6. DNAse, RNAse-free 1.5 mL tubes.
7. PCR thermocycler set with the following program (Table 1).
8. DNA size ladder: a 100 base DNA ladder from a commercial
supplier. Store at 4 °C.
9. Sanger sequencing (see Note 3).

10. A commercial DNA gel extraction kit.
11. Ice and ice bucket.
12. Endofree Plasmid purification kit such as those available from
Qiagen (see Note 4).
13. Competent bacteria. One Shot® TOP10 and ccdB resistant
strains (see Note 5)—thaw on ice.
14. Agarose gel electrophoresis apparatus, reagents, and gel imag-
ing system.
15. Microbiology designated bench and bacterial incubator set to
37 °C.
16. Freshly autoclaved LB broth, agar plates, and appropriate anti-
biotics (see Note 6).
17. Sterile 50 mL polypropylene tubes for liquid media growth.
19. Spectrophotometer or optical-density reader set to 600 nm.
20. Sterile plastic 3 mL cuvettes for measuring OD600.
22. Benchtop refrigerated cooled-centrifuge capable of 16,000 × g
and chamber temperature of 4 °C.
23. Appropriate restriction enzymes.
24. Molecular biology grade, nuclease-free water.
2.2 Transgenesis in 1. Ice and ice bucket.

Xenopus and Selection 2. 50 mL Falcon tubes.
of Transgenic Embryos
3. Nuclease-free 1.5 mL tubes.
4. Microinjector such as the equipment made by Harvard appara-
tus and calibration capillary tubes.
5. I-SceI and associated buffers (see Note 7).
6. Petri dishes.
7. Fertilized Xenopus embryos (see Note 8).
8. Modified Barth’s Saline (MBS) 10× stock (see Note 9).
9. 4% Ficoll—4 g Ficoll in 100 mL 1× MBS and stir until
dissolved.
10. 2% Cysteine—2 g in 100 mL distilled water, then pH to 7.8
with 5M NaOH.
11. Light and fluorescent microscope.
12. A small-volume UV spectrophotometer (for example, a Nano-
DropTM or PicoDropTM device).
3 Methods
3.1 Plasmid 1. PCR amplify the promoter of interest to be recombined with

Recombination and pDONR 221. Typically, we would use 10 μM each forward and
Screening reverse primers and 50 ng fosmid template (see Note 10). 2×
PCR mastermix of a high-fidelity DNA Polymerase; however,
for amplifying DNA fragments ≥3 kb, we use Platinum SuperFi
II PCR master mix (Thermofisher). A suggested PCR program
is shown in Table 2, although this will need to be optimized for
the specific DNA template and Polymerase used (see Note 11).
2. Once the PCR is completed, analyze 5 μL on 1% agarose gel
and compare to a suitable sized DNA marker to confirm the
size of expected amplicon (see Note 12).
3. Gel extract the PCR amplicon using a suitable gel extraction kit
such as those from Qiagen or NEB following manufacturer’s
instructions (see Note 13).
4. The purified DNA was again analyzed by an agarose gel elec-
trophoresis and its concentration measured by UV spectros-
copy, prior proceeding with the BP recombination set up (see
Note 14).
5. The BP recombination is set up with an equimolar amount of
attB PCR product and donor vector (P2) as follows: 50 fmoles
P2 vector, 50 fmoles putative promoter element, 1 μL BP
Clonase II, complete with TE buffer, pH 8 to 8 μL final volume
and incubate overnight at 25 °C.
6. On the following day, add 1 μL Proteinase K and incubate the
reaction at 37 °C for 10 min.
7. Transform 1–5 μL (approx. 50 ng/μL) of the BP reaction into
DH5α competent cells and grow overnight on kanamycin
(100 ng/μL) containing agar plates.
Table 2
PCR Step Temperature (°C) Time (s)

Denaturation 95 60
Melting 95 30
30
Annealing 55–70 °C
Elongation 72 30 40 cycles
Hold 4 1
8. Pick colonies and inoculate in 3–5 mL of L-Broth containing

Kanamycin (100 ng/μL) and incubate overnight in a shaking
incubator at 250 rpm, 37 °C for approx. 16 h.
9. Purify plasmid DNA from each of the grown bacterial colonies
using a Mini-scale DNA plasmid prep kit such as Qiagen fol-
lowing the manufacturer’s instructions.
10. Screen for correct recombinant clones ideally using restriction
enzymes which cut uniquely to the internal cloned sequence
and also to the plasmid backbone. Cut in the region of 1 μg
purified plasmid DNA.
11. Analyze the restriction digest reaction with Agarose gel
electrophoresis.
12. Compare the observed fragment sizes to the predicted restric-
tion fragment map using suitable plasmid analysis software
such as ApE (https://jorgensen.biology.utah.edu/wayned/
ape/).
13. Once the successful recombinant is confirmed perform a Maxi-
scale DNA plasmid preparation kit such as Qiagen following
the manufacturer’s instructions.
14. Perform sequencing analysis to validate the correct DNA
sequence.
15. Once you have obtained P1(γ-crystalline/GFP) and p3, per-
form a Maxi-scale DNA plasmid preparation using a kit such as
Qiagen following the manufacturer’s instructions.
16. Use pDest readily available from the kit.
17. The LR reaction is set up at 10 μL final volume with equal
molar concentration of each recombinant plasmid-10 fmol of
P1, P2(putative promoter) and P3(Katushka), and 20 fmol of
the destination vector pDest. To calculate the precise DNA
concentrations, use the equation shown previously (see Note
15).
18. On the next day, add 1 μL Proteinase K to the reaction and
incubate at 37 °C for 10 min.
19. Transform 1–5 μL (approx. 50 ng/μL) of the LR reaction into
ccdB-sensitive competent cells (such as One Shot® TOP10
supplied with the kit) and grow overnight on Ampicillin
(100 ng/μL) containing agar plates.
20. Once you have the final recombinant destination vector
re-transform the confirmed plasmid clone and perform an
Endo-free Maxi preparation kit from Qiagen following the
3.2 Transgenesis in 1. Dilute the plasmid pDest(final) to 1 μg/μL with nuclease-free

Xenopus water, and confirm the concentration by UV spectroscopy. If
incorrect adjust to 1 μg/μL. Then perform a second dilution
with nuclease-free water to a final concentration of 100μg/μL,
which is the working stock of the pDest(final).
2. Prepare a restriction digest reaction using I-SceI to linearize the
plasmid as this ensures the cassette integrity prior integrating
into the genome. The reaction is set up 40 min before the
embryo injection begins (see Note 16). Mix 2 μL I-SceI buffer
(10×), 7 μL plasmid DNA (100 ng/μL) (so total of 700 ng),
2 μL 10× BSA, and complete to 18 μL with nuclease-free water.
3. Transfer the 18 μL mix to a tube containing 2 μL I-SceI aliquot
taken fresh out from the -80-storage freezer.
4. Incubate the reaction at 37 °C for 40 min.
5. Prepare 0.3× MBS buffer and set up microinjector needle, look
at reference [10]. Adjust the microinjector to inject 5 nL total
per injection over a 0.5–1 s range.
6. Dejelly(remove) embryos’ vitaline membrane with approx.
40 mL 2% L-Cysteine solution, pH 7.8–8 in a 50 mL falcon
tube. Mix by very gentle inversion of the tube until the
embryos pack tightly together for 5 to 10 min.
7. Wash with 40 mL 0.3× MBS at least 3 times and then return to
a fresh petri dish filled with 0.3× MBS.
8. Pour 4% Ficoll in MBS to a dish layered with indented agarose
or plastic mesh in order to hold the embryos in evenly arranged
position for injections.
9. Transfer between 20 and 30 of the dejellied embryos using a
Pasteur pipette with the end cut off (see Note 17) to the dish
prepared in step 7.
10. Inject 5 nL linearized plasmid solution, into 1-cell stage Xeno-
pus embryos. To obtain non-mosaic transgenesis, it is critical to
start injecting as soon as possible before the first cell division
and definitely before 2-cell stage.
11. After completing the injections, keep the embryos in a fresh
petri dish with 4% fresh Ficoll solution at 12 °C for 2–4 h to
allow them to recover.
12. Transfer embryos to a fresh petri dish containing 0.3× MBS
and keep at 18 °C until the stage of interest.
13. Use a fluorescent microscope to check for Katushka fluorescent
reporter expression. If positive, red glow should be observed
within the appropriate tissue.
14. Final confirmation of a successful insertion can be obtained by
tissue restricted green fluorescence in the eye at stage 40.
4 Notes
1. The pGateway kit is available from Life Technologies and pro-

vides the required enzyme mixes, plasmids, and chemically
competent cells. However, in the example given, P1 contains
both γ-crystalline and GFP and P3 contains Katushka, which
are available separately from the European Xenopus Resource
Center upon request (https://xenopusresource.org/).
Store LR and BP Clonases™ at -80 °C. After use return
immediately back to -80 °C storage.
2. Gene-specific complementary regions of the primers can be
designed according to standard rules. However, at the 5′ end,
they would need to contain the correct recombination sites
(tails) for each plasmid. In our example, successful recombina-
tion with entry vector pDONR221 would require primer tails
-aatB1 (forward) and attB2 (reverse) sequences.
pDONR221 specific primers:
attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTNN[gene specific sequence]
attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTN[gene specific sequence]
3. Sequencing can be done in house if you have access to capillary

electrophoresis equipment. If not a number of commercial
companies provide this service, for example, such as Source
Bioscience, UK.
4. Endofree maxi prep kit contains an additional step where you
treat the plasmid sample with a reagent that neutralizes any
residual endotoxin carry over from E.coli. Endofree maxi prep
kit is required for increased survival of the injected Xenopus
embryos. This is strongly recommended when introducing
plasmids into live model organisms.
5. The ccdB gene is toxic for most E.coli competent bacterial
strains; to propagate the ccdb containing vectors, a ccdB resis-
tant E.coli strain is required, which must be purchased sepa-
rately from Life technologies. However, this is only required if
you wish to make stocks of the non-recombinant entry and
destination plasmids, as opposed to using the finite quantities
of plasmid supplied. Once the ccdB gene is replaced by the
target sequence after successful recombination, standard One
Shot® TOP10 top or DH5α can be used.
6. Weight out 25 g of LB broth powder (10 g/L tryptone, 5 g/L
yeast extract, 10 g/L NaCl) in l L beaker. Make up to 1 L with
distilled water and stir until fully dissolved. Transfer 250 mL to
four clean Pyrex bottles. Sterilize each by autoclaving at 121 °C

for 15 min with the cap loosely attached by autoclave indicator
tape. Once cooled to ~60 °C, add appropriate antibiotic to final
concentration. To grow bacterial clones after BP recombina-
tion, add Kanamycin to a final concentration of 50 μg/mL. To
grow bacterial clones after LR recombination, add Ampicillin
to a final concentration of 50 μg/mL. Flame the neck of each
bottle when used. Label and store at 4 °C until needed.
7. To preserve the integrity of I-SceI, upon delivery aliquot into
2 μl stocks and keep at -80 °C until needed. Do not keep
enzymes on ice for long periods of time.
8. Xenopus colonies require specialist husbandry, information and
protocols or use of Xenopus for embryological experiments can
be found in reference [10].
9. To make 10× MBS solution, mix the following chemicals to the
concentration shown below:
– 88 mM NaCl
– 1 mM KCL
– 10 mM HEPES
– 2.4 mM NaHC03
– 0.82 mM MgS04.7H2O
– 0.33 mM Ca (N03)2.2H2O
– 0.41 mM CaCl2.6H2O
First weigh and dissolve NaCl, KCl, and HEPES in 800 mL
distilled water. Then adjust the pH to 7.6 with 5 M NaOH.
Finally, add the salts—MgS04.7H2O, Ca (N03)2.2H2O, and
CaCl2.6H2O. Keep MBS 10× stock at 4 °C up to 30 days and
check for salts precipitation before use. When needed dilute
with distilled water to 0.1× MBS working solution and add
1 mL Pen/strep to final concentration of 5 U/mL penicillin
and 5 μg/mL streptomycin. MBS salt concentrations are criti-
cal to embryo survival and proper development; the salt con-
centrations must be weighed precisely, and care should be
taken when making MBS solution.
10. In this protocol, fosmid, containing the Xenopus putative
promoter of interest, was used as a PCR template. European
Xenopus Resource Center stores stock of fosmid Xenopus
genome libraries which can be supplied upon request.
11. PCR primers need to be optimized to find optimal annealing
temperatures according to standard PCR protocols. A range
of polymerases are available, it is important to select a high-
fidelity polymerase, and if the target sequence is greater than
3 kb, it must also possess high processivity.
12. Set up two 50 μL PCR reactions to be able to recover sufficient

amount of PCR product after subsequent agarose gel extrac-
tion. Once confirmed PCR has produced correct size ampli-
con, load the left over 45 μL PCR reactions + gel loading buffer
on a new 0.8–1% Agarose gel. To load ≥45 μL of reaction
volume in a single well, use a 2 mm thick gel comb when
casting 10 mm thick gel.
13. After melting the gel pieces, mix the 2 samples prior loading on
the purification column from the gel extraction kit. Alterna-
tively, tape 2 wells of the gel and load the 90 μL PCR in a single
well composed of two taped wells.
14. DNA concentration and molar ratios are critical for the success
of all the recombination reactions in this protocol. Extra care
must be taken in the calculations and pipetting at this step. Do
not exceed 250 ng total DNA mass per 10 μL of BP recombi-
nation reaction. Return BP Clonases™ back to -80 °C (ide-
ally temporarily store Clonases on dry ice once you finish using
them to preserve enzyme integrity).
15. Adjust the plasmid concentrations so you can add 1 μL of each
plasmid per LR reaction. Do not exceed more than 300 ng of
total plasmid mass in 10 μL LR reaction. Return the LR
Clonases™ back to -80 °C storage or keep on dry ice.
16. Make sure the reaction is set up immediately before the embryo
injections, this is a critical step and timings must be exact.
Ideally start the I-SceI reaction 5 min before obtaining the
embryos from the female frog. The best integration of DNA
into the genome occurs during the first 20 min after fertiliza-
tion; hence, the injections were done during this window
of time.
17. Cut off the end of a 1 mL (blue) tip with a sterile sharp scalpel,
do not use scissors as this will leave a jagged edge. Alternatively,
you can use glass Pasteur pipette.
References
1. Gordon JW, Ruddle FH (1981) Integration 4. Etkin L et al (1984) Replication, integration,
and stable germ line transmission of genes and expression of exogenous DNA injected
injected into mouse pronuclei. Science into fertilized eggs of Xenopus laevis. Differen-
(New York, NY) 214(4526):1244–1246 tiation 26(3):194–202
2. Tang G et al (2009) Golden rice is an effective 5. Hartley KO, Nutt SL, Amaya E (2002) Tar-
source of vitamin A. Am J Clin Nutr 89(6): geted gene expression in transgenic Xenopus
1776–1783 using the binary Gal4-UAS system. Proc Natl
3. Williams D (2003) Sows’ ears, silk purses and Acad Sci 99(3):1377–1382
goats’ milk: new production methods and 6. Kroll KL, Amaya E (1996) Transgenic Xenopus
medical applications for silk. Med Device Tech- embryos from sperm nuclear transplantations
nol 14(5):9–11 reveal FGF signalling requirements during
gastrulation. Development (Cambridge, Eng- 9. Love NR et al (2011) pTransgenesis: a cross-

land) 122(10):3173–3183 species, modular transgenesis resource. Devel-
7. Smolich BD et al (1993) Characterization of opment 138(24):5451–5458
Xenopus laevis γ-crystallin-encoding genes. 10. Guille M (1999) Chapter 10: Molecular meth-
Gene 128(2):189–195 ods in developmental biology: Xenopus and
8. Hartley JL, Temple GF, Brasch MA (2000) Zebrafish. Zebrafish 127
DNA cloning using in vitro site-specific recom-
bination. Genome Res 10(11):1788–1795
Chapter 10
CRISPR/Cas9 Gene Disruption Studies in F0 Xenopus

Tadpoles: Understanding Development and Disease
in the Frog
Anita Abu-Daya and Annie Godwin
Abstract
CRISPR/Cas9 has become the favorite method for gene knockouts in a range of vertebrate model
organisms due to its ease of use and versatility. Gene-specific guide RNAs can be designed to a unique
genomic sequence and used to target the Cas9 endonuclease, which causes a double-stranded break at the
desired locus. Repair of the breaks through non-homologous end joining often results in the deletion or
insertion of several nucleotides, which frequently result in nonsense mutations. Xenopus frogs have long
been an excellent model organism in which to study gene function, and they have proven to be useful in
gene-editing experiments, especially the diploid species, X. tropicalis. In this chapter, we present our
protocols for gene disruption in Xenopus, which we regularly use to investigate developmental processes
and model human genetic disease.
Key words CRISPR/Cas9, Xenopus tropicalis, Xenopus laevis, Disease modeling, Gene knockout,
MicroCT
1 Introduction
Gene knockouts are a powerful tool for loss of function studies in

development and disease. A mutation in a specific gene can be
achieved by a double stranded break in a unique DNA sequence,
which triggers cellular DNA repair mechanisms. Although
homology-directed repair will reproduce the wild-type state [Chap-
ter 11: A CRISPR/Cas-Based Method for Precise DNA Integra-
tion in Xenopus leavis Oocytes Followed by Intracytoplasmic
Sperm Injection (ICSI) Fertilization], non-homologous end join-
ing is far more common and frequently causes insertions or dele-
tions (indels) of several bases, resulting in frame shift mutations and
the degradation of the transcribed mRNA by nonsense-mediated
decay [1–3]. In the past decade, several methods for digesting a
specific genomic sequence in vivo have been developed, including
https://doi.org/10.1007/978-1-0716-3004-4_10,
111
112 Anita Abu-Daya and Annie Godwin
zinc-finger nucleases [4–6], transcription activator-like effector

nucleases [7, 8], and CRISPR/Cas9 [9, 10]. Whereas the first
two methods rely on designing a nuclease that specifically binds
to the target DNA sequence, CRISPR/Cas9 uses the same endo-
nuclease, the Cas9 protein, which is targeted to the desired geno-
mic locus by specific guide RNAs. As it is significantly easier and
cheaper to synthesize guide RNAs rather than proteins specific to
the region, CRISPR/Cas9 has become the dominant technique for
genome editing.
Xenopus embryos are particularly well suited for gene-editing
experiments. Injection of mRNA or DNA into the large, robust,
externally developing eggs has long been used for overexpression
experiments, and injections of Cas9 protein and guide RNAs is just
as efficient [11, 12]. One potential complication of studying the F0
crispant generation is that cell division begins two hours after
fertilization and goes on at the same time as the Cas9 endonuclease
function, potentially resulting in highly mosaic mutant embryos.
However, we have found that the method is so efficient in Xenopus
that knockout phenotypes can be analyzed in founder embryos.
This approach has recently been applied to understanding the
function of genes involved in development and human disease
[10, 13–15], as reviewed in [1, 16–18].
Two Xenopus species are commonly used in laboratories, X.
laevis and X. tropicalis. Although the former is more established
and easier to work with, its allotetraploidy genome complicates
genetic analysis. X. tropicalis is a true diploid with one of the
smallest tetrapod genomes and is the preferred model system for
genetic analysis [19–24]. However, not all of X. laevis genes are
duplicated, some are singletons, making genetic analysis of certain
loci possible in the larger, more robust species [25]. The genomes
of both species have been sequenced and are well annotated
[25, 26]. The methods described here work in either species.
In this chapter we describe the complete process involved in
creating gene knockouts in Xenopus embryos. We will explain how
to design guide RNAs to target the Cas9 endonuclease to the gene
of interest, how to prepare single guide RNAs (sgRNAs) from
oligonucleotides, and the injection of sgRNAs and Cas9 protein
into fertilized eggs. We provide a rapid method for genotyping
embryos to assess whether gene-editing was successful. Finally, we
describe the application of MicroCT using the contrast reagent
Phosphotungstic Acid to quickly assess tadpole morphology, as a
first step in phenotyping mutant embryos.
CRISPR Knockout 113
2 Materials
Ensure your laboratory is suitably registered and set-up for molec-

ular biology work and wear a lab coat, gloves, and appropriate PPE
at a national level jurisdiction, please be aware that you will require
2.1 Target 1. Software facilitating the planning, visualization, manipulation,

Identification, and simulation of DNA fragments (for example, SnapGene).
Oligonucleotide Design 2. Oligonucleotides for sgRNA synthesis: the CRISPR Univer-
and Guide RNA sal (AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA
Synthesis GTT GAT AAC GGA CTA GCC TTA TTT TAA CTT GCT
ATT TCT AGC TCT AAA AC) and Target specific oligonu-
cleotide stocks, made up to 100 μM in nuclease-free water (see
Note 1). Store at -20 °C.
3. Taq PCR mix (2×): 10 mM Tris–HCl, pH 8.6, 50 mM KCl,
1.5 mM MgCl2, 0.2 mM dNTPs, 5% (v/v) glycerol, 0.08%
(w/v) IGEPAL CA-630, 0.05% (w/v) Tween-20, 25 Units/
ml Taq DNA Polymerase. It is usually bought from a commer-
cial supplier (for example, GoTaq G2 DNA Polymerase, Pro-
mega). Store at -20 °C.
4. Nuclease-free water, molecular biology grade.
6. PCR thermocycler.
7. A commercial spin-column PCR purification kit, the SigmaS-
pinTM Sequencing Reaction Clean-Up Kit (Sigma-Aldrich) is
recommended. Use as per the manufacturer’s instructions and
store at 4 °C.
DropTM device).
9. DNA size ladder: a 1 kb plus DNA ladder from a commercial
supplier (for example, New England BioLabs Ltd) is recom-
mended. Store at 4 °C.
11. 1× Tris-Borate-EDTA (89 mM Tris-HCl, 89mM Boric Acid,
2mM EDTA, pH 8.3).
12. Agarose, from a commercial supplier.
13. Ethidium bromide or an alternative DNA gel stain for
electrophoresis.
14. A gel-visualization system with image acquisition software for

visualizing DNA in agarose gels, for example, the G:BOX F3
gel doc system (Syngene, Synoptics Ltd.) with GeneSys image
acquisition software.
15. An in vitro transcription kit, the MEGAshortscriptTM T7 Tran-
scription Kit (Invitrogen—ThermoFisher Scientific) is recom-
mended. Store at -20 °C.
16. DNase and RNase free 1.5 mL microcentrifuge tubes.
2.2 Injection Delivery 1. Fertilised Xenopus eggs. The in vitro fertilization of eggs for
of CRISPR/Cas9 microinjection can be achieved using either fresh crushed testes
Constructs or frozen sperm.
2. A controlled temperature incubator (ideal range: 14–28 °C).
3. 2% L-Cysteine solution (Recommended: non-hydrochloride
(168149), Sigma-Aldrich), pH 7.8 for dejellying eggs. Store
the solution at 4 °C and use until precipitates are visible.
4. A 1× stock of Marc’s Modified Ringers (MMR) solution
(0.1 M NaCl, 2 mM KCl, 1 mM MgSO4, 2 mM CaCl2,
5 mM HEPES, and pH 7.4) is used to prepare the 0.05×
MMR (X. tropicalis) and 0.1× MMR (X. laevis) working
stocks. OPTIONAL: Commercially available penicillin
(10,000 U/mL) and streptomycin (10 mg/mL) solution can
be added to improve the survival of early staged embryos
(Nieuwkoop and Faber (NF) stages 1–41) [27]. Store at 4 °C.
5. Plastic petri-dishes lined with 1% agarose (in 0.05× MMR,
Store at 4 °C) or glass dishes should be used to house early-
staged (NF1 – NF10) X. tropicalis embryos. It is further
recommended at these stages that glass Pasteur pipettes are
used for embryo manipulation.
6. A picoinjector (for example, Medical Systems PLI-100 Picoin-
jector (Harvard Apparatus)), air compressor (for example, PT5
Bambi Air Compressor), a stereomicroscope (for example, 2×
magnification Nikon Stereomicroscope (SMZ800, C-W 10× B
Eyepieces)), with reticule micrometer and a cold light source
(for example, KL 2500 LED Lightsource (Schott)) are
required for microinjection.
7. Borosilicate glass capillaries (Harvard Apparatus), used to make
needles for microinjection.
8. Micropipet puller (for example, Sutter instrument, Model P-87
Flaming Brown Micropipette Puller) with an appropriate pro-
gram (for example, 801 ms (Heat), 250 ms (Pull), 190 ms
(Velocity), 160 ms (Time), adjust as required) to prepare
microinjection needles from capillaries.
9. Fine watchmaker’s forceps (for example, Dumont no.5) to cut
the end of needles.
CRISPR Knockout 115
10. It is recommended users have an injection grid. These injection

grids are created in 60 mm Petri dishes, with 8 mm nylon mesh
sealed using chloroform.
11. 3% (w/v) Ficoll® (GE Healthcare) in 0.05× MMR (for Xenopus
tropicalis) or 0.1× MMR (for Xenopus laevis). Store the solu-
tion at 4 °C, for up to 1 week.
12. Cas9 protein obtained from a commercial supplier (recom-
mended: EnGen® Spy Cas9 NLS protein (M0646), New Eng-
land Biolabs Ltd.). Store at -20 °C.
14. DNase and RNase free 1.5 mL tubes.
15. Tabletop microcentrifuge.
2.3 Analysis of 1. DNase and RNase free 1.5 mL tubes.

Crispant Tadpoles: 2. Heat block set to 56 °C.
Genotyping
3. Lysis Buffer: 50 mM Tris-HCl (pH 8.5), 1 mM EDTA, 0.5%
[v/v] Tween-20 and Store at 4 °C. Add 100 μg/mL Proteinase
K prior to each use.
4. Tabletop microcentrifuge.
6. PCR thermocycler.
7. Taq PCR mix (2×): 10 mM Tris-HCl, pH 8.6, 50 mM KCl,
ml Taq DNA Polymerase. Usually bought from a commercial
supplier (for example, GoTaq G2 DNA Polymerase, Promega).
Store at -20 °C.
9. Target specific primers, designed in steps 2.1-2.2 and 3.1-3.6,
made up to 100 μM in nuclease-free water. Store at -20 °C.
10. 1× Tris-Borate-EDTA (89 mM Tris-HCl, 89 mM Boric Acid,
2 mM EDTA, pH 8.3).
12. Ethidium bromide or an alternative DNA gel stain for
electrophoresis.
13. A gel-visualization system with image acquisition software for
visualizing DNA in agarose gels.
14. T7 Endonuclease I enzyme and reaction buffer commercially
available from New England BioLabs Ltd.: 10 U. Store at
-20 °C.
2.4 Analysis of 1. 0.2% (w/v) Ethyl-m-aminobenzoate (also known as tricaine or

Crispant Tadpoles: MS222), pH 7.
Phenotyping 2. Plastic petri-dishes lined with 1% agarose (in 0.05x MMR,
Store at 4 °C).
3. MEMFA (0.1 M MOPS pH 7.4, 2 mM EGTA, 1mM MgSO4,
4% Stabilized Formaldehyde (Acros Organics)).
4. Laboratory grade Methanol.
6. Phosphotungstic acid (PTA), commercially available, used at a
working concentration of 1% PTA in nuclease-free molecular
grade water.
8. Hot melt glue and glue gun.
9. A stereomicroscope (for example, 2× magnification Nikon Ste-
reomicroscope (SMZ800, C-W 10× B Eyepieces) and a cold
light source (for example, KL 2500 LED Lightsource
(Schott)). OPTIONAL: A high-resolution microscope (for
example, Zeiss Axio Zoom.V16 Stereomicroscope and
CL9000LED light source (Carl Zeiss Microscopy)).
10. Zeiss Xradia Versa 520 (Carl Zeiss Microscopy), imaged using
the manufacturer’s software (Scout and Scan Reconstructor,
Carl Zeiss Microscopy) and visualized using TXM3DViewer
(Carl Zeiss Microscopy).
3 Methods
Ensure all work complies with local ethical and animal scientific
requirements. Conduct all steps at room temperature and use
double-distilled water in solutions unless otherwise specified.
Wear lab coat, gloves and appropriate PPE at all times to avoid
nuclease degradation of samples and injury. The following protocol
is broken down into a series of steps to guide the creation and
analysis of mutant Xenopus tadpoles:
1. Designing guide RNAs.
2. Generating guide RNA from ssDNA templates.
3. Microinjection of guide RNA into Xenopus embryos.
4. Genotyping strategies to understand indel formation in cris-
pant embryo genomic DNA samples.
5. General phenotyping strategies for gross morphological
changes in crispant tadpoles.
CRISPR Knockout 117
3.1 Target The first and most important step in CRISPR/Cas9 gene disrup-
Identification and tion studies is designing guide RNAs which will target Cas9 to the
Oligonucleotide Design sequence of interest. There are many approaches to standardize the
design and improve the efficiency of prospective gene-editing con-
structs; we successfully use the freely available CRISPRscan and
inDelphi browser applications. CRISPRscan identifies appropriate
sgRNAs in a given sequence, estimates the efficiency of cutting
in vivo, and checks that the sequence is unique to minimize the
possibility of off-target effects [28, 29]. On the other hand, the
inDelphi mESC model has been shown to reliably predict frame-
shift frequency and precision events (range of indels) resulting from
CRISPR/Cas9 genome editing [30–32].
1. The gene of interest is first identified through the gene-pages
presented on Xenbase [33] using the most up to date genome
assembly (presently, X. tropicalis: v10 and X. laevis: v9.2). The
features of each gene’s structure can be identified in JBrowse
and modeled in a DNA analysis software facilitating annotation
(for example, SnapGene®5.2.4).
2. Any chromosomal or gene duplication should be considered in
the experimental design. See Note 2 for more details including
how to approach rare situations where the gene is poorly
annotated. When considering the CRISPR/Cas9 target
sequence it is best to choose a coding region not located within
20 bp of the end of the exon due to the potential for splicing
effects. If many sgRNAs are possible, we choose those pre-
dicted to have high mutagenic activity (CRISPRscan score
>30), with no viable off-target events (test in Xenbase blast
using the latest genome assembly version to make sure the
sequence is unique), and a high frameshift frequency (inDelphi
frameshift score >75% (mESC model)) [28, 30]. See Notes 3
and 4 for how to approach small exon genes, splice variants,
highly repetitive regions of the genome, large deletions, and
for recommended CRISPR/Cas9 experimental controls.
3. Species conservation (between Xenopus sp. and for example,
H. sapiens) and key protein domains can be mapped from
protein sequences stored in the National Centre for Biotech-
nology Information (NCBI) databases using a freely available
multiple sequence alignment tool (for example, Clustal Omega
(EMBL-EBI)). This information may guide targeting an
appropriate region in the protein (5′UTR, first exon, early
exon, key protein domain, patient variant site). See Notes 3
and 4 for more details.
4. It is recommended that three sgRNAs are designed from geno-
mic DNA sequences encompassing the target region
(c. 500 bp) to test in a preliminary experiment. This approach
allows the selection of the most effective sgRNA and minimizes
the likelihood the phenotype is due to off-target changes.
5. The next point for consideration in the experimental design is

the biological target. It is possible to gene-edit both the Xeno-
pus egg (generation of mosaic homozygotes, as described in
this chapter) and the Xenopus oocyte (if generation of
non-mosaic heterozygotes is required, Chapter 11: A
CRISPR/Cas9-Based Method for Precise DNA Integration
in Xenopus leavis Oocytes Followed by Intracytoplasmic
Sperm Injection (ICSI) Fertilization). Further, gene-editing
in the egg makes it is possible to mutate the whole embryo or
restrict editing to individual blastomeres (using the fate-map)
up to the 32-cell stage (see Note 5).
6. Primers to amplify 500–800 bp of the genomic DNA sur-
rounding the target region must be designed, using a freely
available online tool, for example, Primer3 or PrimerBlast (see
Note 6). These primers will be used in genotyping the poten-
tial mutant embryos.
3.2 Guide RNA For sgRNA synthesis we have had good success using the method
Synthesis described in Nakayama et al. [34] This relies on annealing two
single-stranded oligonucleotides, the gene-specific nucleotide sug-
gested by CRISPRscan, which contains a 5′ T7 promoter, and a
Universal CRISPR Oligonucleotide, which contains the Cas9 bind-
ing sequence. The two oligonucleotides have an overlapping seg-
ment and can be annealed and extended by Taq polymerase to
generate a DNA template from which the sgRNA can be tran-
scribed with T7 polymerase.
1. Set up the annealing and extension reaction to convert ssDNA
to dsDNA by mixing a 50 μL Taq PCR mix, 46 μL nuclease-
free water, 2 μL Universal CRISPR oligonucleotide (100 μM),
and 2 μL target-specific oligonucleotide (100 μM) in a thin-
walled PCR tube on ice.
2. Mix gently, remove 3 μL of the mixture and keep on ice as a
negative control. Run the annealing and extension reaction in a
thermal cycler as detailed in Table 1.
3. Following the annealing and extension reaction, take a 3 μL
sample from each tube and run each sample alongside the
negative control on a 1.2% agarose gel to assess the formation
of the dsDNA template (Fig. 1). The ssDNA and dsDNA
templates visualized using the intercalating reagent Ethidium
Bromide. dsDNA templates show no increase in size following
the annealing and extension reaction, however the dsDNA
bands are much brighter and tighter than ssDNA, indicating
that the procedure was successful.
4. sgRNA can now be transcribed from the dsDNA template
using the MEGAshortscriptTM T7 Transcription Kit
(Invitrogen – ThermoFisher Scientific) or a similar kit.
CRISPR Knockout 119
Table 1
CRISPR annealing and extension reaction
Stage Temperature (°C) Time (s)

1 Denaturation 95 300
Annealing 65 20
Elongation 68 15
Annealing 58 20
Elongation 68 15
1 Final elongation 68 300
1 Hold 4 1
Fig. 1 ssDNA and dsDNA templates visualized using the intercalating reagent
Ethidium Bromide
5. MEGAshortscriptTM T7 Transcription Kit: Add 2 μL T7 10×

Reaction Buffer, 2 μL T7 ATP Solution (75 mM), 2 μL T7
CTP Solution (75 mM), 2 μL T7 GTP Solution (75 mM), 2 μL
T7 UTP Solution (75 mM), 8 μL template dsDNA template,
and 2 μL T7 Enzyme mix, into a single 1.5 mL RNase and
DNase free tube. It is important to set up the reaction at room
temperature and add the reagents in the order specified to
prevent precipitation of the DNA by components in the tran-
scription buffer.
6. Incubate the transcription reaction at 37 °C for at least 2 h. In
our hands overnight (12–16 h) incubation leads to significantly
improved yield.
7. To remove any residual DNA template, add 1 μL TURBO
DNase I to each tube and gently mix by pipetting.
Fig. 2 sgRNA constructs visualized by agarose gel electrophoresis
8. Incubate all tubes on the heat block for a further 15 min at

37 °C.
9. Use the SigmaSpinTM Sequencing Reaction Clean-Up Kit
(Sigma-Aldrich) or an equivalent commercial micro spin col-
umn purification kit (see Note 7) to purify the RNA. Prespin
the SigmaSpin columns for 2 min at 750 × g to remove excess
buffer. Load the RNA mixture into the raised column. Centri-
fuge for 4 min at 750 × g to collect the purified RNA. The final
elution volume is typically 20–30 μL.
10. Measure the concentration and purity of each sgRNA preparation
on a small-volume UV spectrophotometer. The RNA concentra-
tion can range from <100 ng/μL to >2000 ng/μL (typically
expect around 1000 ng/μL from an overnight incubation); to
proceed with this protocol, it is recommended that the RNA
concentration be at least 300 ng/μL.
11. It is important to visualize the sgRNA by running 200–500 ng
of the sgRNA preparation on a 1.5% agarose gel to ensure it is
not degraded, a smear will indicate degradation. Due to sec-
ondary structure RNA often runs as two bands on
non-denaturing gels (Fig. 2).
12. Store sgRNAs as single-use aliquots at -80 °C at a concentra-
tion of 300–500 ng/μL.
3.3 Injection of The third step in CRISPR/Cas9 gene disruption studies is gener-
CRISPR/Cas9 ating the crispant animals. The protocol presented is an adaptation
Constructs into of Molecular Methods in Developmental Biology—Chapter 10:
Xenopus Embryos Microinjection into Xenopus Oocytes and Embryos [12].
1. Prepare fertilized eggs for injection by removing the outer jelly
coats in 2% L-Cysteine (non-hydrochloride solutions should be
used when handling X. tropicalis embryos) solution
(pH 7.8–8.0) with gentle rocking.
CRISPR Knockout 121
2. When satisfactorily de-jellied, remove the Cysteine solution

over five 30-s washes in MMR (0.05× MMR for X. tropicalis
or 0.1× MMR for X. laevis).
3. Transfer batches of 100 embryos, into a petri dish containing
an injection grid and 3% Ficoll solution.
4. Calibrate needles by droplet size, using nuclease-free water.
Needles should be cut, and injection apparatus set up to deliver
4 nL injections over a 50 ms period. If 4 nL droplets are
produced in less than 50 ms the needle is too big and will
damage the eggs, this is especially important for X. tropicalis
eggs which are smaller and less robust. The droplet volume is
measured using a graticule or by drawing the liquid into a glass
capillary by surface tension and measuring the length of the
fluid column. Once the apparatus is set up satisfactorily, expel
the water from the needle and draw in, or backfill, with the
CRISPR injection mix.
5. CRISPR injection mix: Prepare 300–1500 pg sgRNA (see Note
8 for steps to improve efficiency), 2.6 ng Cas9 protein in a
1.5 mL DNase- and RNase-free tube, make up to 4 μL using
nuclease-free water. Mix by pipetting up and down, centrifuge
(1 min, RT, 1000 × g) and maintain on ice.
6. Using the manipulation settings on the picoinjector, gently
lower the needle into the animal pole of a single cell embryo
or the blastomere(s) of interest (see Note 5 for more details
concerning cellular targets).
7. Following RNA injection, embryos should be transferred into
fresh 3% Ficoll solution and maintained in agarose-lined Petri
dishes at a species-specific temperature (14–18 °C X. laevis and
21–28 °C X. tropicalis) until NF stage 1027.
8. At late blastula stages, it is recommended that embryos are
washed in MMR to remove the Ficoll solution and transferred
into a fresh dish containing either 0.05× (X. tropicalis) or 0.1×
MMR (X. laevis) solution.
9. Culture embryos/tadpoles in petri dishes until the desired
stage, removing dead embryos daily. At free-feeding stages,
move tadpoles to large dishes and incorporate 50% media
changes alternate days (see Note 9 for further details) until
tadpoles reach the stage of experimental interest.
3.4 Genotyping The next step in CRISPR/Cas9 gene disruption studies is genotyp-
Embryos ing the crispant animals. The success of genome editing can be
judged using the T7 endonuclease I assay, or by Sanger sequencing
of amplicons containing the target site and tracking of indels by
decomposition (TIDE or Synthego ICE).
1. Collect whole embryo or partial (tail, toe, organ-specific)

Xenopus tissue samples (see Note 10) in 1.5 mL DNase and
RNase free-tubes and freeze the samples at -80 °C.
2. Thaw samples at room temperature and add 60 μL Lysis buffer,
vortex the samples, and incubate for 2 h at 56 °C.
3. Using a heat block, incubate samples at 95 °C for 15 min to
inactivate Proteinase K.
4. Centrifuge samples briefly (1000 × g for 1 min, RT) and
proceed with PCR amplification. Alternatively, gDNA samples
can be stored at -20 °C (see Note 11 for sample preparations
requiring high-purity gDNA extracts).
5. Prepare a PCR master mix to amplify control and test samples.
Into a single tube, add 12.5 μL Taq PCR mix, 8.5 μL nuclease-
free water, 50–80 ng gDNA extract, 1 μL Target-FWD primer
(10 μM), and 1 μL Target-REV primer (10 μM). It is recom-
mended that an initial temperature gradient (54–64 °C) be
performed, particularly in instances where primer pairs are
located in non-coding regions.
6. Mix samples gently by pipetting up and down and maintain the
mixture on ice before running the Genotyping PCR reaction
detailed in Table 2.
7. Following the Genotyping PCR reaction, take a 3 μL sample
from each tube and run each sample on a 1.2% agarose gel to
assess the amplicon.
8. The efficiency of each sgRNA can be rapidly assessed by the T7
endonuclease I assay [35]. Mix 200 ng PCR product from step
3.4.(6.), 2 μL NEB Buffer 2, and nuclease-free water to 19 μL
in a thin-walled PCR tube. Denature the DNA, at 95 °C for
5 min, then re-anneal by ramping down the temperature to
Table 2
PCR amplification of genomic target region

Annealing 58a 30
Elongation 72 60b
1 Final elongation 72 360
1 Hold 4 1
a
Annealing temperature is primer specific. bExtension times for products over 1000 bp are adjusted, the extension time
increased 30 s for every additional 500 bp
CRISPR Knockout 123
Table 3
Thermocycler conditions for T7 endonuclease I assay

Ramp to 85 -2 °C/s
Ramp to 25 -1 °C/s
Hold 4 1a
1 Incubation 37 900
1 Hold 4 1
a
Add T7 Endonuclease I after this step. NB Please note the denaturation ramp may vary between different thermocyclers
Fig. 3 Genotype analysis of F0 mosaic tadpoles. The target locus is amplified from genomic DNA preparations
of injected (crispant) and uninjected (control) tadpoles. Amplicons are digested with T7 Endonuclease I, which
reveals a second band unique to crispant tadpoles that correspond to the location of the CRISPR target site (A).
Sanger sequencing is used to confirm the presence of indels in these crispant samples. Analysis of the Sanger
sequencing trace files by Synthego ICE revealed the editing efficiency of the target domain is around 50% (B)
85 °C at -2 °C/s then to 25 °C at -1 °C/s (Table 3). Add

1 μL T7 endonuclease I (10 U) and incubate at 37 °C for
15 min. The T7 Endonuclease I assay cleaves DNA mis-
matches. The CRISPR/Cas9 process occurring at the same
time as rapid cell division in the embryo usually results in
high mosaicism of indels, and if the gene-editing process was
successful, the re-annealed amplicons should form heterodu-
plexes which will be cleaved by the nuclease.
9. Digested amplicons are assessed on a 1.2% agarose gel. DNA
fragments corresponding to cleavage at the CRISPR cut site
should be visible (Fig. 3a). See Note 12 for troubleshooting.
10. Sequence gene-edited samples to confirm the presence of
indels. If the CRISPR/Cas9 was successful, the sequence
should become mixed around the Cas9 cleavage site due to
mosaicism. The resulting chromatogram/ab1 trace files can be
uploaded to freely available online platforms (for example,
TIDE [36] or Synthego ICE [37]) to examine the predicted
indel burden of samples. See Fig. 3b, for example, and Note 13
for troubleshooting and additional analyses of gene-edited
samples.
Fig. 4 Detailed structural differences are examined in Xenopus tadpoles using high-resolution Micro Computed
Tomography. The imaged volumes show a whole tadpole with a 3D reconstruction of the cardiovascular
system and gut visualized using TXM3DViewer (Carl Zeiss Microscopy) that can be exported as cross-section
high-resolution TIFF image files
3.5 Phenotyping The final step in CRISPR/Cas9 gene deletion studies is phenotyp-
Mutant Embryos ing the crispant animals. There are many strategies to explore the
effects of knockouts, here we report MicroCT as a broad and
extremely useful technique to investigate comprehensive or unex-
pected phenotypes (Fig. 4).
1. Gross morphological assessment can be performed under stan-
dard bright-field microscopy. For best results, image embryos/
tadpoles on agarose lined dishes. See Note 14 for considera-
tions where an unexpected phenotype presents in the F0 cris-
pant model.
2. Detailed structural differences can be examined using high-
resolution Micro Computed Tomography (MicroCT) in fixed
specimens contrast stained in Phosphotungstic acid (PTA,
Sigma-Aldrich) [38]. The recommended stage of analysis is
NF42-50. Resolution below NF30 is poor and penetrance of
the contrast reagent, using this methodology, above NF50 is
highly variable.
3. Fix terminally anaesthetized (0.2% MS222) tadpoles in glass
vials containing 5 mL MEMFA for 2 h and dehydrate in a series
of Methanol washes: 25%, 50%, 75%, and 100%. Replace the
100% Methanol once more, and store embryos at -20 °C.
4. Rehydrate fixed samples in a series of methanol washes: 100%,
75%, 50%, and 25% and replace the final methanol concentra-
tion with 1% PTA for 48 h (NB it is essential that no salts are
introduced after this step).
5. Remove the solution containing 1% PTA and wash all tadpoles
in nuclease-free water.
6. Embed specimens in 0.7% agarose. Dissolve the agarose in
nuclease-free water and maintain it at 60 °C on a heat block
until use. Cool the agarose solution to 30 °C, immerse the
tadpole in agarose and quickly transfer the tadpole into the
CRISPR Knockout 125
imaging vessel. It is recommended that X. tropicalis tadpoles

are embedded in a 20 μL pipette tip, and X. laevis tadpoles are
embedded in a 200 μL pipette tip. After the agarose has soli-
dified, seal the open ends with glue.
7. Run all samples in line with the recommended settings: The
Zeiss Xradia Versa 520 (Carl Zeiss Microscopy) is set to operate
at a voltage of 50 kv and a current of 75 mA. The 4× objective
lens is used to provide an effective isotropic voxel size of
3.1 μM, with 1601 projections collected over 360° under an
exposure time of 2.0 s per projection.
8. Reconstruct the tomograms to 16-bit grey-level images using
the manufacturer’s software (Scout and Scan Reconstructor,
Carl Zeiss Microscopy) which employs a filtered back-
projection algorithm.
9. Visualise the imaged volumes using an image viewer capable of
opening microscope image files (for example, TXM3DViewer
(Carl Zeiss Microscopy)). MicroCT analysis of this nature pro-
vides a reference for crispant models and can guide downstream
analysis.
4 Notes
1. It is possible to buy commercial sgRNAs as an alternative to

generating the template in-house.
2. Identify the number of homologs in X. laevis, any gene dupli-
cation events (affecting both X. laevis and X. tropicalis) and
where relevant, the number of isoforms of each gene. The
integrated RNAseq data available in v9 of the Xenopus genome
can guide understanding of the expression pattern of each gene
of interest. Where genes are not well annotated or cannot be
found in Xenopus, blast the H. sapiens protein sequence to
search the Xenopus genome and consider looking at synteny
of the surrounding genes (using, for example, Genomicus or
PANTHER).
3. The overall success of CRISPR/Cas9 experiments depends on
the experimental design and target identification. Historically,
initial CRISPR/Cas9 gene-editing experimental designs tar-
geted the first exon of a gene. Following the discovery that
cryptic promoters in the first non-coding region hold the
potential to rescue protein expression, this approach quickly
moved to target early exons (exon 2 or exon 3) in the gene.
Creating premature stop codons near the beginning of the
transcript often results in nonsense-mediated decay of the tran-
script. Genotyping analysis revealed that many experiments
resulted in a high proportion of in-frame mutations, which
are often silent. The implementation of machine learning algo-

rithms can minimize the proportion of in-frame mutations (for
example, the inDelphi mESC model can predict frameshift
frequency, precision, and indel locations). In recent years,
research using CRISPR/Cas9 has focused on targeting an
essential functional domain of the protein. Here the occurrence
of both in-frame and out-of-frame mutations facilitates the
study of protein dysregulation by interrupting protein func-
tion. Building on this idea, variant-directed crispant models of
human disease are founded on the understanding that deleteri-
ous changes in the human sequence indicate a site within the
protein that is not tolerant to change due to functional or
structural consequences. Always check previously published
oligonucleotide templates against the most recent predictive
algorithms and blast sequences against the latest version of the
Xenopus genome.
4. In cases where the exons of a gene are small and prove difficult
to target, consider removing the coding region within a key
functional domain by targeting CRISPR to the relevant splice
donor or splice acceptor. Unless intending to disrupt the splice
site, do not situate CRISPR/Cas9 constructs within 20 bp of
the end of the exon. Similarly, unless intentional, avoid target-
ing regulatory elements. In cases where genomic regions are
known to contain large, highly repetitive regions consider
using a dual nicking approach and design two sgRNAs to use
with Cas9 nickase. In addition, two sgRNAs can be injected
simultaneously with Cas9 protein to remove a large region of
the gene (>500 bp). Unless using the Cas9 nickase or deletion
approach, it is not recommended that researchers co-inject
multiple sgRNAs simultaneously within one embryo, as it
complicates the downstream analysis of the line. Further, to
circumvent limitations of the sgRNA position, different Cas
enzymes possessing different PAM specificities can be consid-
ered. When gene-editing an allotetraploid X. laevis locus (or a
duplicated gene), it is recommended that a conserved region of
both genes is targeted using a single sgRNA. There are increas-
ing reports of the unaccounted effects of CRISPR/Cas9
off-target consequences, making it important to implement
effective experimental controls. In CRISPR/Cas9 experi-
ments, the recommended controls for the delivery of con-
structs vary greatly, from non-coding or scrambled sgRNA
templates to the use of positive control genes, including
housekeeping genes or those with known phenotypes. In addi-
tion, it is possible to incorporate the use of multiple sgRNAs
targeted to one region within the experimental design and
demonstrate phenotype specificity or rescue the effects of
gene knock-out experiments with the re-introduction of the
WT allele.
CRISPR Knockout 127
5. Taking advantage of the well-defined Xenopus fate map, gene-

editing can be restricted to specific blastomeres to target the
desired organ systems of interest (for example, the kidney
primordia). This technique is largely implemented to circum-
vent lethality in the F0 generation. Building on this, the most
recent approach implementing this technique to generate a
genetically altered line targets the four vegetal cells at 32-cell
stage to generate a highly mosaic animal bearing edited germ
cells.
6. Online tools do not always hold the most up to date version of
the Xenopus genome assemblies. It is recommended that all
primer sequences be blasted using the local blast tool located
within Xenbase. Where possible, it is recommended that pri-
mers are located within coding regions or the first 20 bases of
the intron, and the CRISPR/Cas9 cut site is centrally located
within the amplicon. Here, it is also suggested that the ideal
amplicon size should be approximately 500–800 bp. Larger
amplicons (>1 kb) can prove problematic as increasingly geno-
mic regions that are associated with the disease are found to
occur in regions of the genome where there is a lot of second-
ary DNA structures, and smaller amplicons (<300 bp) can
hinder the analysis of Sanger sequencing trace files. When
working with an allotetraploid locus in X. laevis or a duplicated
gene in either species, try to identify a region unique to each
gene to ensure efficient gene-editing of both genes.
7. When using equivalent commercially available micro spin col-
umn purification kits, ensure the elution buffer will not contain
chemicals, which could affect downstream embryological
development.
8. Overall, for best gene-editing results, aim to complete injec-
tions within 40minutes of fertilization. To further improve
efficiency, it is recommended that preliminary experiments
test the efficacy of each sgRNA considering a concentration
gradient between 300 pg and 1500 pg sgRNA per embryo. It is
recommended that experiments are repeated in the offspring
from three different females, and embryos are incubated
at 25 °C for the first 24 h following gene-editing.
9. In our hands the survival of pre-metamorphic juvenile Xenopus
is much improved in a fill and dump set up with regular media
changes when compared to recirculating systems.
10. It is recommended that comparison of individual CRISPR/
Cas9 sgRNA indel efficiency is performed on batches of 10 gas-
trula staged embryos (although reliable gDNA recovery is
possible at Nieuwkoop and Faber stage 10 embryos) with
downstream analysis of the crispant genotype performed on
single animals at a stage in-line with phenotypic analysis.
11. We routinely use gDNA preparations after lysis with no purifi-

cation to PCR amplicons. Samples for preparations requiring
high-purity gDNA extracts with minimal contaminants can be
prepared using commercially available kits, for example,
DNeasy Blood & Tissue Kit (QIAGEN). Alternatively,
gDNA samples extracted using the lysis buffer can be purified
following a phenol-chloroform or column purification method
(for example, SigmaSpinTM Sequencing Reaction Clean-Up
Kit (Sigma-Aldrich)), although final yield can be variable.
12. T7 endonuclease I (T7EI, New England Biolabs Ltd) is a
mismatch detection assay. CRISPR/Cas9 sgRNAs with a
high precision score (inDelphi) indicates a tendency to result
in one predominant indel in gene-edited samples. When these
samples are digested with T7E1 this will result in one visible
band identical to the PCR amplicon and indistinguishable from
uninjected control samples because similarly to the wild-type
there are very few mismatches. Alternatively, when samples
have multiple bands present in both the control and gene-
edited samples, this can indicate the presence of SNPs in the
genomic region of interest.
13. Where Sanger sequencing trace files suggest inefficient cutting,
consider the following recommendations. Check the sequence
trace for the occurrence of SNPs affecting the sgRNA binding
site or PAM, ensure the injection technique and delivery of
gene-editing constructs is effective (consider using a tracer dye
to examine dissemination of construct during early develop-
ment), consider increasing the amount of RNA injected (it is
not recommended to exceed 1500 pg) and review the experi-
mental design with a view to re-designing the sgRNA. In
addition, predicted indel burdens (for example, those delivered
by inDelphi) are documented in some instances to differ from
experimental outcomes both in the efficiency and type (inframe
or out-of-frame) of indels. It is likely these differences largely
represent survival pressures in vivo, and so it is further sug-
gested that researchers also analyze the survival of the gene-
edited group. Increasingly, demonstrating the gDNA burden
(range of indels within the target region) following CRISPR/
Cas9 gene-editing is insufficient due to the reporting of
off-target gene-editing, large on-target deletions and alterna-
tive splice variants affecting the gene of interest. In addition to
the analyses described in Subheading 3.4, it is strongly recom-
mended that researchers consider the effects on the cDNA,
protein, and off-target genomic locations.
14. If no phenotype is visible in the model and the phenotype is
expected to arise early in development, review the RNA-seq
data and consider maternal carryover of protein. In cases where
there is maternal carry over, it is possible to generate a
CRISPR Knockout 129
genetically altered line to study the phenotype. If an amelio-

rated phenotype is visible in the model, consider both the
genotype (the ratio of in and out-of-frame mutations) and
mosaicism. Where the phenotype is different from the expected
effect, compare the outcome of multiple sgRNAs and consider
any differences between species of interest for disease
modeling.
References
1. Naert T, Vleminckx K (2018) CRISPR/Cas9 human disease genes in Xenopus. Dev Biol
disease models in zebrafish and Xenopus: the 408:196–204
genetic renaissance of fish and frogs. Drug Dis- 14. Hassnain Waqas SF et al (2017) Adipose tissue
cov Today Technol 28:41–52 macrophages develop from bone marrow–
2. Doudna JA, Charpentier E (2014) The new independent progenitors in Xenopus laevis
frontier of genome engineering with and mouse. J Leukoc Biol 102:845–855
CRISPR-Cas9. Science (80-) 346:1258096 15. McQueen C, Pownall ME (2017) An analysis
3. Shalem O et al (2014) Genome-scale CRISPR- of MyoD-dependent transcription using
Cas9 knockout screening in human cells. Sci- CRISPR/Cas9 gene targeting in Xenopus tro-
ence 343:84 picalis embryos. Mech Dev 146:1–9
4. Carroll D (2011) Genome engineering with 16. Blum M, Ott T (2018) Xenopus: an under-
zinc-finger nucleases. Genetics 188:773–782 valued model organism to study and model
5. Bibikova M, Golic M, Golic KG, Carroll D human genetic disease. Cells Tissues Organs
(2002) Targeted chromosomal cleavage and 205:303–313
mutagenesis in Drosophila using zinc-finger 17. Hwang WY, Marquez J, Khokha MK (2019)
nucleases. Genetics 161:1169–1175 Xenopus: driving the discovery of novel genes
6. Nakajima K, Nakajima T, Takase M, Yaoita Y in patient disease and their underlying patho-
(2012) Generation of albino Xenopus tropicalis logical mechanisms relevant for organogenesis.
using zinc-finger nucleases. Dev Growth Differ Front Physiol 10:953
54:777–784 18. Sater AK, Moody SA (2017) Using Xenopus to
7. Miller JC et al (2011) A TALE nuclease archi- understand human disease and developmental
tecture for efficient genome editing. Nat Bio- disorders. Genesis 55:e22997
technol 29:143–148 19. Grainger RM (2012) Xenopus tropicalis as a
8. Ishibashi S, Cliffe R, Amaya E (2012) Highly model organism for genetics and genomics:
efficient bi-allelic mutation rates using past, present, and future. In: Methods in
TALENs in Xenopus tropicalis. Biol Open 1: molecular biology (Clifton, NJ), vol 917.
1273–1276 Humana Press, pp 3–15
9. Jinek M et al (2012) A programmable dual- 20. Abu-Daya A, Sater AK, Wells DE, Mohun TJ,
RNA-guided DNA endonuclease in adaptive Zimmerman LB (2009) Absence of heartbeat
bacterial immunity. Science (80-) 337:816– in the Xenopus tropicalis mutation muzak is
821 caused by a nonsense mutation in cardiac myo-
10. Nakayama T et al (2013) Simple and efficient sin myh6. Dev Biol 336:20–29
CRISPR/Cas9-mediated targeted mutagenesis 21. Abu-Daya A et al (2011) The secreted integrin
in Xenopus tropicalis. Genesis 51:835–843 ligand nephronectin is necessary for forelimb
11. Sive HL, Grainger RM, Harland RM (2010) formation in Xenopus tropicalis. Dev Biol 349:
Microinjection of Xenopus embryos. Cold 204–212
Spring Harb Protoc 5:pdb.ip81 22. Goda T et al (2006) Genetic screens for muta-
12. Guille M (1999) Microinjection into Xenopus tions affecting development of Xenopus tropi-
oocytes and embryos. Methods Mol Biol (Clif- calis. PLoS Genet 2:e91
ton, NJ) 127:111–123 23. Abu-Daya A, Khokha MK, Zimmerman LB
13. Bhattacharya D, Marfo CA, Li D, Lane M, (2012) The hitchhiker’s guide to Xenopus
Khokha MK (2015) CRISPR/Cas9: an inex- genetics. Genesis 50:164–175
pensive, efficient loss of function tool to screen
24. Macken WL et al (2021) Biallelic variants in modeling of editing outcomes in Xenopus and
COPB1 cause a novel, severe intellectual dis- zebrafish embryos. Sci Rep 10:14662
ability syndrome with cataracts and variable 32. Shen MW et al (2018) Predictable and precise
microcephaly. Genome Med 13:1–19 template-free CRISPR editing of pathogenic
25. Session AM et al (2016) Genome evolution in variants. Nature 5637733(563):646–651
the allotetraploid frog Xenopus laevis. Nature 33. Xenbase. http://www.xenbase.org/entry/
538:336–343 34. Nakayama T et al (2014) Cas9-based genome
26. Hellsten U et al (2010) The genome of the editing in xenopus tropicalis. In: Methods in
western clawed frog xenopus tropicalis. Science enzymology, vol 546. Academic, pp 355–375
(80-) 328:633–636 35. T7 Endonuclease I assay – CRISPR fly design.
27. Nieuwkoop PD, Faber J (1994) Normal table https://www.crisprflydesign.org/t7-endo-i-
of Xenopus Laevis (Daudin): a systematical & assay/.
chronological survey of the development from 36. Brinkman EK, Chen T, Amendola M, van
the fertilized egg till the end of metamorphosis. Steensel B (2014) Easy quantitative assessment
Garland Pub of genome editing by sequence trace decompo-
28. CRISPRscan: Welcome. https://www. sition. Nucleic Acids Res 42:e168–e168
crisprscan.org/ 37. Industrialized CRISPR Platforms for Acceler-
29. Moreno-Mateos MA et al (2015) CRISPRs- ated Discovery to Clinic. https://www.
can: designing highly efficient sgRNAs for synthego.com/platforms.
CRISPR-Cas9 targeting in vivo. Nat Methods 38. Metscher BD (2009) Micro CT for compara-
12:982–988 tive morphology: simple staining methods
30. Indelphi. https://indelphi.giffordlab.mit.edu/ allow high-contrast 3D imaging of diverse
31. Naert T et al (2020) Maximizing CRISPR/ non-mineralized animal tissues. BMC Physiol
Cas9 phenotype penetrance applying predictive 9:11
Chapter 11
A CRISPR/Cas-Based Method for Precise DNA Integration

in Xenopus laevis Oocytes Followed by Intracytoplasmic
Sperm Injection (ICSI) Fertilization
Sian Angela Martin
Abstract
Xenopus has long had a reputation for being a powerful model organism for use in developmental cell and
biochemistry research. With the advent of gene-editing technologies, and the full genome sequencing of
Xenopus genomes revealing the extent of the genetic conservation between Xenopus and humans, Xenopus
has the potential to become an ideal model for human genetic disease. However, the inability to produce
non-mosaic, precise DNA insertions through homology directed repair has limited the strength of Xenopus
this field. Furthermore, it has prevented researchers from taking full advantage of fusion tagging, a method
for directly tagging genes with either epitope or fluorescent tags, allowing the visualization, quantification,
and tracking of proteins without the use of protein-specific antibodies. Here, we describe a method for
precise DNA insertion into oocytes using CRISPR/Cas9, followed by in vitro maturation and fertilization
by intracytoplasmic sperm injection (ICSI), culminating in the production of embryos carrying a
non-mosaic, heterozygous insertion.
Key words CRISPR, Xenopus, Precise insertion, Oocytes, ICSI, Sperm nuclei, Disease model, Epi-
tope tag
1 Introduction
The Xenopus research community has endeavored to develop a

high-throughput, consistent method for precise DNA insertion
for many years, providing new research opportunities in patient-
specific disease modeling as well as a precise method for fusion
tagging, a powerful tool in developmental and cell biology research
that allows researchers to visualize, quantify, and track protein
expression in real time. However, many approaches to make precise
insertions using CRISPR/Cas9 injections in 1-cell embryos have
resulted in inefficient insertion rates with extreme mosaicism,
meaning that only a small number of cells in the frog contain the
edited DNA which results in very low to no germline transmission,
https://doi.org/10.1007/978-1-0716-3004-4_11,
131
132 Sian Angela Martin
preventing genetic lines being made [1]. These issues, however,

have not solely been found in frogs but also in all vertebrate model
organisms where precise integration into the genome has been
attempted using double stranded break generating enzymes such
as Cas9. For example, in 2017, a review of attempts to achieve
precise knock-ins in zebrafish was published [2]. Nine publications
were analyzed, and the highest generation rate of founder animals
reported was 14.7%, with an average of 4%. The fact that, where
tested, only half of these expressed the expected phenotype sug-
gests that even this success rate was an overestimation. In mice, the
difficulty has been reflected in the number of different methods
attempted; five different approaches have succeeded to some
degree but with limited size capacity for the integrated DNA, and
errors incorporated in many animals [3–5]. Some of the methods
used successfully in cultured cells were also attempted in zygotes,
but none of the early ones worked efficiently [6–8]. Recently, an
improved homology directed repair (HDR) strategy using long
homologous flanking sequences has been demonstrated to provide
an improvement in insertion efficiency in Xenopus; however, the
issues of mosaicism remain [9]. Furthermore, recent work in zebra-
fish has revealed that the most efficient current approaches may be
locus-specific, for example, maximum correct integration at the
sox3 locus was 29%, but at the pax6a locus, it was 5% and at
sox11a, it was 12% using the same approach [10]. Mosaicism
found in Xenopus crispants has two main causes; HDR events in
fertilized eggs are much rarer than its less precise counterpart,
non-homologous end joining (NHEJ) [11], and the rapid devel-
opment of Xenopus embryos post fertilization often results in the
gene-editing event (including both the cutting of the DNA and its
repair) occurring after cell division. Both factors can be circum-
vented through gene editing in oocytes, rather than fertilized eggs.
Not only are HDR events much more common in oocytes than in
fertilized eggs [11], but oocytes can be cultured for days before
fertilization [12], increasing efficiency by giving the gene-editing
machinery ample time to generate the targeted edit.
However, matured oocytes cannot be fertilized by the same
in vitro method as eggs, since it requires the oocytes to be pro-
cessed in the oviduct of the frog, altering the coelomic envelope
and coating them in a protein-rich jelly [13, 14]. Attempts have
been made to recreate the effects of this processing in vitro; how-
ever, the methods are largely inconsistent [15, 16]. Another strat-
egy, known as the host transfer method, uses the natural process by
transferring in vitro matured oocytes into the body cavity of an
ovulating female frog. The frog then processes and lays them as her
own [12, 16]. This method, although impressive, is technically very
demanding and causes significant suffering to the host frog. There
is, however, a third option in ICSI, a method that involves the
injection of sperm nuclei directly into the matured oocyte, forcing
A CRISPR/Cas-Based Method for Precise DNA Integration in Xenopus laevis. . . 133
fertilization. ICSI has been shown to work in both unfertilized eggs

and oocytes [17–19]. Very few labs have replicated successful fertil-
ization of matured oocytes using ICSI in the past; however, using
the optimized method described in this chapter, we feel confident
that the method could be replicated by any lab with access to fresh
oocytes.
2 Materials

ular biology work, and wear a lab coat, gloves, and appropriate PPE
at a national level jurisdiction, please be aware that you will require
2.1 BAC Cloning 1. LB agar.

2. LB broth.
3. 100 mg/mL Ampicillin stock solution (add to LB agar and
broth to 100 μg/mL final concentration).
4. BAC lysis buffer: 50 mM glucose, 10 mM EDTA pH 8.0,
25 mM Tris–HCl pH 8, autoclaved; RNase A added to
450 μg/mL final concentration.
5. Detergent solution: 200 mM NaOH, 1% SDS.
6. 1M Potassium acetate KOAc (pH 5) WHAT MOLARITY
IS THIS?
7. Isopropanol.
8. 70% ethanol.
9. Molecular grade water.
2.2 Long Single 1. puC19 vector (New England Biolabs).

Stranded DNA 2. EcoRI restriction enzyme (New England Biolabs).
Synthesis
3. HindIII restriction enzyme (New England Biolabs).
2.2.1 Gibson Assembly 4. Q5 high-fidelity polymerase and master mix (New England
Biolabs).
5. dNTP mix.
7. Gibson assembly cloning kit (New England Biolabs).
8. LB agar.
9. LB broth.
10. 100 mg/mL Ampicillin stock solution (add to LB agar and

broth to 100 μg/mL final concentration).
11. QIAprep Spin Miniprep Kit (Qiagen).
2.2.2 Long Single 1. Q5 high-fidelity polymerase and master mix (New England
Stranded DNA Synthesis Biolabs).
2. dNTP mix.
4. Guide-it long ssDNA Production System v2 kit (Takara Bio).
2.3 Oocyte 1. 10× Marc’s modified ringer’s (MMR) buffer: 1 M NaCl,

Preparation and 20 mM KCL, 10 mM MgSO4, 20 mM CaCl2 dihydrate,
Culture 50 mM HEPES, dH2O to 1 L. Adjust pH to 7.4 using 10 M
NAOH and sterilize by autoclaving. Use at a 1× working
concentration and add 100 U/mL gentamycin.
2. Oocyte culture medium (OCM): 70% Leibovitz’s L-15
medium with L-glutamine, 0.4 mg/mL Bovine serum albu-
min, 100 U/mL Gentamicin. Adjust pH to 7.7 using NAOH
and filter sterilize. Store at 4 °C for a maximum of 4 days.
3. Watchmakers’ forceps.
4. Liberase TM (Sigma Aldrich).
5. Culture plates coated with 2% agarose.
6. Incubator set to 16 °C.
2.4 CRISPR Injection 1. Ficoll 400.

2. EnGen Spy Cas9 NLS (New England Biolabs).
4. Injection plates made with 2% agarose in 1X MMR (see
Note 1).
5. Glass micro-injection needles.
6. Micro-injector
2.5 Sperm Nuclei 1. 1× MMR: 100 mM NaCl, 1 mM MgSO4, 2 mM CaCl2, 5 mM

Preparation Hepes pH 7.8, 0.1 mM EDTA, 1 mL in 1 L Penicillin-
Streptomycin.
2. Nuclei prep buffer (NPB): 250 mM Sucrose, 15 mM Hepes
pH 7.7, 0.5 mM Spermidine, 0.2 mM Spermine, 1 mM DTT.
3. Razor blades.
4. Cheesecloth.
5. Digitonin.
6. Bovine serum albumin (BSA).
7. Nuclei dilution buffer (NDB): 250 mM Sucrose, 75 mM KCl,

0.2 mM HEPES pH 7.7, 0.5 mM Spermidine, 0.2 mM
Spermine.
8. DAPI nucleic acid stain.
9. Haemocytometer.
2.6 Intracytoplasmic 1. Injection dishes made with 2% agarose in 0.4× MMR (see
Sperm Injection (ICSI) Note 1).
2. Glass micro-injection needles pre-cut to 40 μm.
3. Tygon tubing (see Note 2).
4. Ficoll 400.
5. 0.4× MMR with penicillin-streptomycin (1 mL/L).
6. Syringe pump.
3 Methods
3.1 Designing sgRNA When designing sgRNA for an insertion, first you must identify
and lssDNA Inserts where in the gene it should be inserted, for instance, when tagging
a gene with an epitope tag or fluorescence tag, the insertion should
be directly downstream of the 3′ stop codon or directly upstream of
the 5′ ATG. Whereas, if you want to make a specific mutation
within the open reading frame by insertion, the location of the
cut site is dictated by the location of the desired mutation. How-
ever, the location of the cut site (sgRNA site) can be up to 30 bp
away from the desired insertion site, so there is some leeway when
finding an efficient sgRNA site. Once a region (30 bp either side of
your desired insertion point) has been identified the region
sequence can be inputted into scoring algorithms designed to
predict cutting efficiency and find the best sgRNA sites in your
sequence. Many sgRNA tools are available on the Internet, our tool
of choice is CRISPRscan (https://www.crisprscan.org/). Once a
suitable sgRNA is found, it can be tested for cutting efficiency by
embryo injection followed by T7 endonuclease assay. The insertion
design includes the sequence to be inserted with 500 bp sequences
flanking upstream and downstream that are homologous to the
genomic sequence to be targeted for insertion.
3.2 BAC Cloning BAC libraries are used to gain access to gene sequences which will
be used to make the homology portion of your long single stranded
DNA insert. These BAC libraries are available at the European
Xenopus resource center (EXRC).
1. Streak BAC culture onto LB agar plates containing 50 μg/mL
ampicillin and grow over night in a 37 °C incubator.
2. Pick single colonies and place in 10 mL of LB broth containing

50 μg/mL ampicillin. Culture for a further 20 h in a 37 °C
shaking incubator.
3. Centrifuge the culture for 10 min at 1500 × g at 4 °C and
discard the supernatant.
4. Resuspend the BAC pellet in 100 μL of lysis buffer and incu-
bate on ice for 5 min.
5. Add 400 μL of detergent solution to the lysate and mix by
inversion. Incubate on ice for 5 min.
6. Add 300 μL of KOAc (pH 5) and incubate on ice for 15 min.
7. Centrifuge for 15 min at 2800 × g and transfer the supernatant
to a fresh tube.
8. Add an equal volume of 100% isopropanol to the supernatant
and mix.
9. Centrifuge for 5 min at 12,000 × g and discard supernatant.
10. Wash pellet with 70% ice cold ethanol and centrifuge for 2 min
at 12,000 × g.
11. Remove excess ethanol and allow the pellet to air dry.
12. Resuspend the DNA pellet in 40 μL molecular grade water or
TE buffer.
3.3 Long Single Using Gibson assembly cloning, we can amplify multiple fragments
Stranded DNA of our insert DNA and fuse them together whilst also inserting the
(lssDNA) Insert complete insert DNA sequence into a pUC19 vector ready for
Synthesis cloning. When inserting a short DNA sequence such as an epitope
tag, this can be achieved by designing two sets of primers to make
3.3.1 Gibson Assembly two fragments. The first fragment will include a 5′ 20 bp overlap
Cloning with the 5′ end of the linearized pUC19 vector and the 500 bp
homology arm upstream from the insert sequence (epitope tag or
specific mutation). The second fragment will include the 500 bp
homology arm downstream from the insert sequence with a 20 bp
overlap with the 3′ end of the linearized pUC19. Both fragments
will include a 20 bp overlap at the insert sequence where they will
be fused during Gibson assembly. Included in the primers compris-
ing of the cut site, three or more silent mutations should be
included in the primers over the cut site to prevent secondary
cutting of the insert by Cas9.
1. Amplify your fragments by PCR using high-fidelity polymer-
ase. The PCR protocol will need to be optimized for each set of
primers to produce a clean product.
2. Linearize the pUC19 vector using EcoRI and HindIII restric-
tion enzymes.
3. Perform the ligation using the Gibson assembly cloning kit

(New England Biolabs) according to the manufacturer’s
instructions.
4. Transform E. coli cells provided with the Gibson assembly
cloning kit (New England Biolabs) with the ligation reaction.
5. Spread the transformed cells onto an LB ampicillin plate and
grow overnight at 37 °C.
6. Grow single colonies further in LB broth with ampicillin over-
night at 37 °C.
7. Extract the DNA from the cultured E. coli using QIAprep Spin
Miniprep Kit (Qiagen).
3.3.2 Single Stranded 1. Amplify the whole insert including the homology arms
DNA Synthesis through PCR using primers with a phosphate modification at
the 5′ end of one of the primers and a phosphothioate modifi-
cation at the 5′ end of the other (see Note 3).
2. Denature one of the DNA strands using Guide-it long ssDNA
Production System v2 kit (Takara Bio) following the manufac-
turer’s instructions.
3. Check the single stranded DNA on a 1% agarose gel against the
double stranded template.
4. Aliquot and store the single stranded DNA at -30 °C.
3.4 Oocyte All oocyte work, apart from Liberase defolliculation should be
Preparation carried out in a dedicated 18 °C room.
1. On the day of the experiment, clean the work area thoroughly
with ethanol (see Note 4).
2. On the day of the experiment, collect the ovary of one or two
female frogs and wash thoroughly but gently in 16 °C MMR
(see Note 5).
3. Snip off a small piece of ovary and check the quality and stage of
the oocytes under a microscope (see Note 6).
4. If the quality is satisfactory, fill a 90 mm dish with 1×
MMR + gentamycin and tear the ovary into small ~2 cm pieces
using clean forceps.
5. Transfer 5 mL of ovary pieces into a 50 mL Falcon tube and
add 1× MMR + gentamycin to 12 mL.
6. Add 7 units of Liberase TM to the tube and incubate at room
temperature on a rocker set to 12 RPM for 1 h.
7. Gently wash the defolliculated oocytes 7 times in 1X MMR +
gentamycin, then once with OCM. After the last wash, pour
the oocytes into a 90 mm agarose dish and let them rest for 1 h
in a 16 °C incubator.
8. Remove any damaged or underdeveloped oocytes from the

dish and discard. Using a cut and flame polished glass pasture
pipette, transfer desirable stage VI oocytes to a fresh agarose
dish filled with OCM. For a standard experiment we recom-
mend injecting 2000 oocytes.
3.5 CRISPR/Cas9 1. Prepare an 8 μL injection mix comprising of 200 ng of ssDNA

Injection in Oocytes insert, 300 ng of sgRNA, and 600 ng Cas9 protein. Spin the
injection mix down and store on ice.
2. Inject 4 nL of injection mix into each oocyte loaded onto an
agarose injection dish filled with 3% Ficoll in 1× MMR (see
Note 7).
3. Let the injected oocytes recover in an agarose dish filled with
3% ficoll in OCM for 4 h at 16 °C.
4. Transfer the oocytes to a fresh agarose dish with OCM and
culture in a 16 °C incubator.
3.6 Oocyte Culture 1. Culture the oocytes for 72 h in 90 mm agarose dishes (100 per
and Maturation dish) filled with OCM at 16 °C. Once every 24 h clean out any
dying oocytes and transfer the remainder to a fresh dish
of OCM.
2. Incubate a 30 mM stock solution of progesterone at room
temperature for 1 h with occasional vortexing.
3. Vortex the stock solution then add to OCM at a final concen-
tration of 3 μM and mix thoroughly.
4. Pour the maturation solution into 90 mm dishes and transfer
the oocytes to the dishes (see Note 8).
5. Incubate the oocytes at room temperature for 3–4 h or until a
white maturation spot appears on the top of the oocyte, signal-
ing germinal vesicle breakdown (GVBD).
6. Incubate the oocytes at 18 °C for a further 3–4 h or until a
small white dot can be seen in the middle of the white spot (see
Note 9).
7. Check for prick activation by puncturing the matured oocyte
with a microinjection needle. Activation is characterized by the
contraction and subsequent relaxation of the animal pole. We
check for activation in 5 oocytes every half an hour after the
appearance of the white dot until at least 4 out of 5 oocytes
activate.
3.7 Sperm Nuclei 1. On the day of the experiment, collect testes from a male frog.
Preparation 2. Wash testes in ice cold 1× MMR and clean of any blood vessels
by rolling them gently on tissue. If there are any blood vessels
which cannot be removed by this method, use watchmaker’s
forceps to gently remove the remaining vessels under a micro-

scope. Be careful not to puncture or tear the testis at this point
as sperm will be lost.
3. Wash the testes a further 3 times in ice cold 1X MMR.
4. Wash the testes 2 times in Ice cold NPB.
5. Pour off the NPB and in a dry 90 mm dish macerate each testis
using a clean razor blade or forceps. Macerate until no clumps
remain.
6. Suspend the macerated testis in 4 mL of ice cold NPB and filter
it through a funnel lined with 4 layers of cheese cloth into a
15 mL Falcon tube (see Note 10).
7. Rinse the maceration dish and razor blade/forceps with
another 4 mL of ice cold NPB and filter it in to the same
15 mL Falcon tube. Squeeze the remainder of the suspension
from the cheese cloth into the tube with a gloved hand.
8. Centrifuge the sperm suspension at 14,000 × g for 10 min at 4 °
C.
9. Discard the supernatant and resuspend the sperm pellet in
8 mL ice cold NPB.
10. Repeat step 8.
11. Discard the supernatant and resuspend pellet in 1mL room
temperature NPB.
12. Add 500 ng of digitonin and mix gently by flicking the tube.
13. Incubate for 5 min at room temperature.
14. Add 8 mL of 3% BSA in ice cold NPB.
15. Centrifuge at 7000 × g for 20 min at 4 °C.
16. Remove the supernatant and resuspend the sperm nuclei pellet
in 8 mL of 0.3% BSA in NPB.
17. Repeat step 15.
18. Remove the supernatant and resuspend the sperm nuclei pellet
in 1 mL of ice cold NPB.
19. Check the concentration of the nuclei by diluting 2 μL of
nuclei suspension in 200 μL NDB.
20. Add 100 pg of DAPI to the dilution and mix gently.
21. Load 2 μL of the dilution onto a haemocytometer and view the
nuclei under a fluorescence microscope.
22. Check stained nuclei for quality and count the sperm nuclei
3 separate times. Take the average number of the three counts,
this represents the number of nuclei in 1 nL of undiluted nuclei
suspension.
23. Work out the dilution needed for 1–1.5 nuclei per 10 nL
injection using the following calculation:
– n × 10 = undiluted count per injection (UC)
– Dilution = 1 μL in UC μL of SDB
3.8 ICSI Fertilization 1. Set the syringe pump to 0.6 μL/min and run it for 1 min to
in Oocytes ensure that it is pumping mineral oil through the Tygon
tubing.
2. Cut glass needles (1 for every 100 oocytes) to 40 μm, measur-
ing with a stage graticule, and cutting with watchmaker’s
forceps.
3. Once the oocytes are prick activating, start loading the oocytes
on to injection dishes filled with 6% Ficoll in 0.4× MMR and let
them sit in Ficoll for 30 min to 1 h before the first injection.
4. Back fill one of the pre-cut needles with diluted sperm nuclei
suspension until it is completely full and push the back end of
the needle into the Tygon tubing running from the
syringe pump.
5. Attach the needle with Tygon tubing to the needle holder next
to the microscope and lower the tip of the needle into your first
injection dish.
6. Check that sperm nuclei suspension is flowing through the
needle by turning the syringe pump on and looking for the
trail of suspension exiting the needle. This can be seen due to
the difference in viscosity between the suspension and the
ficoll. Try moving the needle from side to side and up and
down to see the flow-through more clearly.
7. Inject each oocyte for 1 second, inserting the needle at the edge
of the maturation spot on the animal pole. Change the needle
and sperm nuclei dilution every 100 oocytes.
8. After sperm nuclei injection leave the injected oocytes in their
injection dishes and incubate at 18 °C. Do not disturb them
until they reach blastula stage (see Note 11).
9. At stage 8–9, select all developing embryos and transfer them
into a fresh dish of 0.1× MMR and incubate at 18 °C.
10. Check on the embryos periodically throughout gastrulation,
removing any dying embryos and freezing for genotyping.
Embryos fertilized by ICSI are particularly sensitive during
this period.
11. Grow the embryos on as normal.
4 Notes
1. Injection plates are made by pouring 2% agarose into a small

culture dish to 0.5–1 cm depth and using a well mold or a
bicycle reflector to create indented wells in the agarose before
setting. Once the agarose is set, the mold can be carefully
pulled away from the dish.
2. Tygon tubing will react with mineral oil over time, becoming
stiff and brittle. We recommend changing the tygon tubing on
your syringe pump every 6 months.
3. The phosphate and phosphothioate modifications on each end
of the template DNA serve two different purposes. The phos-
phate directs strandase to denature the modified strand of
DNA, leaving a single strand. This single strand of DNA will
be modified with phosphothioate, which stabilizes the single
stranded DNA.
4. Bacterial infection in oocytes can be an issue during handling
and culture. We found that handling oocytes in a busy room
increases the chances of infection considerably. Ideally oocyte
work that includes extended culturing should be carried out in
a dedicated temperature-controlled room with one user at
a time.
5. Over many comparison experiments, we have found that frogs
which have been previously ovulated (between 3 and 6 months
before) produce much better oocytes than virgin frogs.
6. Oocyte quality is key to the success of this method. What may
normally pass as a good quality oocyte won’t necessarily be
adequate for this method, the quality needs to be near perfect.
Good quality oocytes will have an even, solid pigment, without
any graininess. If any blemishes are present on the pigmented
half of the oocyte such as dark spots or light spots, this is a sign
of less than perfect quality.
7. We recommend backloading the injection needle with 8 μL of
injection mix, rather than sucking it up through the needle to
save time.
8. When fertilizing a large number of oocytes by ICSI, it is
recommended to mature the oocytes in 800 oocyte batches
every 30–45 min. This prevents oocytes from over maturing
before fertilization.
9. Whilst the oocytes are incubating in the maturation media,
start the sperm nuclei preparation so that the sperm nuclei are
ready for the end of maturation.
10. When using a pipette to resuspend or transfer sperm suspen-
sions or nuclei suspensions, it is important to use wide bore
pipette tips. We use clean razor blades to cut the ends off our
tips for sperm work. This prevents mechanical damage to the
sperm or nuclei.
11. Comparison experiments performed in our lab have shown
that embryos fertilized by ICSI have a 100% higher survival
rate past gastrulation when they are not moved or disturbed
during pre-gastrula development. Removal of dead unfertil-
ized eggs may be beneficial; however, in our experience, we
have found that, in this setting, neighboring dead cells do not
appear to affect developing embryos.
References
1. Piccinni M, Sharpe C, Guille M (2019) Using Genome Res 24(1):142–153. https://doi.

HDR and a template to introduce an in-frame org/10.1101/gr.161638.113
HA tag on the 3’ end of the Xenopus laevis 9. Nakayama T, Grainger RM, Cha S-W (2020)
gata2.L open reading frame. microPublication Simple embryo injection of long single-
Biol 2019. https://doi.org/10.17912/micro stranded donor templates with the CRISPR/
pub.biology.000170 Cas9 system leads to homology-directed repair
2. Albadri S, Del Bene F, Revenu C (2017) in Xenopus tropicalis and Xenopus laevis. Gen-
Genome editing using CRISPR/Cas9-based esis 58(6):e23366. https://doi.org/10.1002/
knock-in approaches in zebrafish. In: Methods, dvg.23366
vol 121–122. Academic, pp 77–85. https:// 10. Ranawakage DC et al (2021) Efficient
doi.org/10.1016/j.ymeth.2017.03.005 CRISPR-Cas9-Mediated Knock-In of Com-
3. Inui M et al (2014) Rapid generation of mouse posite Tags in Zebrafish Using Long ssDNA
models with defined point mutations by the as a Donor. Front Cell Dev Biol 8:1926.
CRISPR/Cas9 system. Sci Rep 4. https://doi. https://doi.org/10.3389/fcell.2020.598634
org/10.1038/srep05396 11. Hagmann M et al (1996) Dramatic changes in
4. Quadros RM et al (2017) Easi-CRISPR: A the ratio of homologous recombination to
robust method for one-step generation of nonhomologous dma-end joining in oocytes
mice carrying conditional and insertion alleles and early embryos of xenopus laevis. Biol
using long ssDNA donors and CRISPR ribo- Chem Hoppe Seyler. https://doi.org/10.
nucleoproteins. Genome Biol 18(1). https:// 1515/bchm3.1996.377.4.239
doi.org/10.1186/s13059-017-1220-4 12. Aslan Y, Tadjuidje E, Zorn AM, Cha SW
5. Yoshimi K, Kunihiro Y, Kaneko T, (2017) High-efficiency non-mosaic CRISPR-
Nagahora H, Voigt B, Mashimo T (2016) mediated knock-in and indel mutation in F0
SsODN-mediated knock-in with CRISPR-Cas Xenopus. Development. https://doi.org/10.
for large genomic regions in zygotes. Nat 1242/dev.152967
Commun 7(1):1–10. https://doi.org/10. 13. Grey RD, Working PK, Hedrick JL (1977)
1038/ncomms10431 Alteration of structure and penetrability of the
6. Hendel A et al (2015) Chemically modified vitelline envelope after passage of eggs from
guide RNAs enhance CRISPR-Cas genome coelom to oviduct in Xenopus laevis. J Exp
editing in human primary cells. Nat Biotechnol Z o o l . h t t p s : // d o i . o r g / 1 0 . 1 0 0 2 / j e z .
33(9):985–989. https://doi.org/10.1038/ 1402010109
nbt.3290 14. Olson JH, Chandler DE (1999) Xenopus laevis
7. Suzuki K et al (2016) In vivo genome editing egg jelly contains small proteins that are essen-
via CRISPR/Cas9 mediated homology- tial to fertilization. Dev Biol. https://doi.org/
independent targeted integration. Nature 10.1006/dbio.1999.9281
540(7631):144–149. https://doi.org/10. 15. Elinson RP (1973) Fertilization of frog body
1038/nature20565 cavity eggs enhanced by treatments affecting
8. Auer TO, Duroure K, De Cian A, Concordet the vitelline coat. J Exp Zool 183(3):
JP, Del Bene F (2014) Highly efficient 291–301. https://doi.org/10.1002/jez.
CRISPR/Cas9-mediated knock-in in zebrafish 1401830303
by homology-independent DNA repair.
16. Heasman J, Holwill S, Wylie CC (1991) 18. Kroll KL, Amaya E (1996) Transgenic Xenopus
Chapter 11: Fertilization of cultured Xenopus embryos from sperm nuclear transplantations
oocytes and use in studies of maternally inher- reveal FGF signaling requirements during gas-
ited molecules. Methods Cell Biol 36 trulation. Development
(C):213–218. https://doi.org/10.1016/ 19. Miyamoto K, Simpson D, Gurdon JB (2015)
S0091-679X(08)60279-4 Manipulation and in vitro maturation of xeno-
17. Amaya E, Kroll KL (1996) A method for gen- pus laevis oocytes, followed by intracytoplasmic
erating transgenic frog embryos. In: Molecular sperm injection, to study embryonic develop-
embryology: methods and protocols, 97th ment. J Vis Exp 96(96):52496. https://doi.
edn, pp 393–414 org/10.3791/52496
Chapter 12
A Lambda-Exonuclease SELEX Method for Generating

Aptamers to Bacterial Targets
Robert Gowland and Darren M. Gowers
Abstract
Nucleic acid aptamers are short sequences of single-stranded (ss) DNA or RNA that fold into a three-
dimensional shape with useful binding properties. Traditionally, these properties have included specific
recognition and binding of ions, small-molecules, proteins, and enzyme targets. Increasingly though,
aptamers are being raised against complex subcellular or cellular targets. These broader-affinity aptamers
can be usefully employed for detection, labeling, or therapeutic targeting of intact/living cells, whether
prokaryotic or eukaryotic. Aptamers are usually developed from a random-sequence oligonucleotide library
by repeated rounds of selection and amplification, a process named “systematic evolution of ligands by
exponential enrichment” (SELEX). We describe here a widely applicable cell-SELEX method for raising
aptamers against bacteria, using Escherichia coli strain HB101 as an example. Our cell-SELEX method uses
a cycle of four stages: (1) incubation of a fluorescently labeled random-sequence ssDNA library with
bacterial cells; (2) separation of cell-associated ssDNA from free ssDNA; (3) amplification of bound
ssDNA by PCR, and (4) use of lambda-exonuclease to selectively regenerate ssDNA for further rounds
of selection.
Key words SELEX, Aptamer, Oligonucleotide library, Lambda exonuclease, E. coli
1 Introduction
Nucleic acids are versatile molecules. As well as their roles in genetic

storage and epigenetic regulation, they can adopt complex 3D
shapes with specific structural or functional properties. Similar to
protein folding, physicochemical forces such as hydrogen bonding,
electrostatic interactions, aromatic stacking, and van der Waals
contacts can guide the formation of folded DNA or RNA struc-
tures. Such structures include helices, hairpins, loops, knots, and
bulges. Single-stranded RNA is especially amenable to folding into
compact shapes due to the extra hydrogen bonding potential from
its 2′-OH group—good examples include tRNAs, rRNAs, ribos-
witches, and ribozymes. Double-stranded DNA can form the famil-
iar double helix (an intermolecular structure), but base-pairing
https://doi.org/10.1007/978-1-0716-3004-4_12,
145
146 Robert Gowland and Darren M. Gowers
rules also allow stable loops, mismatches, and hairpins to form in

single-stranded regions. Indeed, ssDNA molecules can fold into
specific 3D shapes, and many interesting intramolecular DNA
structures are known, including hairpins, triplexes, quadruplexes,
and i-motif structures.
Some of these ssRNA or ssDNA structures have the ability to
recognize and bind other molecules with high specificity, and the
collective term “aptamer” is usually applied to them. Some func-
tional aptamers have arisen naturally by evolution (tRNA, rRNA,
riboswitches, and ribozymes for example), but in the last 30 years,
huge efforts have gone into developing novel sequences of RNA or
DNA that fold into shapes with specific functions. The field of
aptamer research could be said to start in 1989, with a paper from
Gerald Joyce on directed RNA evolution [1], followed in 1990,
when the labs of Jack Szostak [2] and Larry Gold [3] harnessed the
growing availability and ease of oligonucleotide synthesis to make
populations of random-sequence RNA (later, DNA) oligos. They
selected RNA sequences that were able to specifically bind small dye
molecules or large proteins like a DNA polymerase from phage T4.
The systematic evolution of ligands by exponential enrichment
(SELEX), originally invented by Tuerk & Gold (1990), is now the
name for a large family of related molecular methods for directed
molecular evolution of randomized nucleic acid sequences with
specific binding, recognition, or even catalytic, properties. Aptamer
research is now a mature field, with many detailed reviews and
methods available, for example [4–11]. Aptamers can in some
ways be compared to antibodies, since both exhibit 3D folding
and specific recognition of and binding to an “epitope” or ligand
of interest. Aptamers (particularly DNA aptamers) have the advan-
tage of being easier and cheaper to synthesize at scale, are more pH
and heat-stable, can be chemically modified with additional func-
tional groups against chemical or enzymatic attack, and can be
selected for binding to a given target over a wide range of physio-
logical conditions. Aptamers have been developed against all kinds
of molecular and cellular targets, ranging from divalent cations,
small-molecules and cofactors, to antibiotics, proteins, enzymes,
and cells. A small number have so far been registered as therapeutics
[12]. Most aptamers have found uses in biotechnology applica-
tions, and a wide array of assays use them for detection, binding,
labeling, regulation, or visualization of molecules or cells.
So how does SELEX work? First, a naı̈ve starting library con-
taining many millions of different nucleotide (nt) sequences is
synthesized. This is usually as a continuous block of 30–60 nucleo-
tides (nt), with each position having an equal 1-in-4 probability of
being A, G, C, or T (U, in RNA). Importantly, either side of this
block is a defined primer-binding region, used to amplify the
sequence during each round of selection. The random selection is
carried out automatically during oligonucleotide synthesis by
Aptamers and SELEX 147
specifying an N (for aNy nucleotide). Among the billions of gen-

erated random sequences, local intramolecular folding (hairpins,
bulges, loops) will give rise to DNA secondary structures. This pool
of unfolded/partly-folded/folded DNA structures is challenged to
bind a molecular or cellular target. The vast majority of sequences
do not possess the right combination of shape or charge to effect
target binding, but a very small number of DNA (or RNA)
sequences do. The single most important step in SELEX is that
target-bound ssDNA is separated—usually by fractionation, filtra-
tion, or washing—from the unbound ssDNA. The bound ssDNA
sequences are then amplified by PCR and a sample taken for clon-
ing and sequencing. The ds sequences are then returned to ss form
by either biotin-streptavidin pull-down, asymmetric PCR, electro-
phoresis and band excision or (as in this method) exonuclease
digestion. The candidate aptamer sequences are then subject to
another round of target binding, partitioning, and amplification.
In this way, a starting (random) pool of ssDNA starts to show
selection for non-random sequence motifs that generate structures
that interact with the target.
In this chapter, we describe a general SELEX method for
selecting aptamers that bind to bacteria, and use E. coli HB101
cells as an example. This is a form of cell-SELEX and can in fact be
used for prokaryotic or eukaryotic cells. We use a 100 nt SELEX
library oligo, which contains a central 50 nt random-sequence
cassette flanked by 25 nt PCR primer sequences; a single fluoro-
phore group is present at the 5′-end for visualization. The 100 nt
library oligo is heated to 95 °C and cooled slowly, before being
exposed to E. coli HB101 and mixed gently. We use centrifugation
and washing to separate unbound ssDNA from any cell-associated
ssDNA. Cell-associated ssDNA is released by phenol-chloroform
extraction and ethanol precipitation. We use twelve parallel rounds
of PCR (30 cycles each) to amplify the selected ssDNA and lambda
exonuclease to return the dsDNA to ssDNA form. We recommend
4–8 complete SELEX cycles, cloning and sequencing 10–20 sample
sequences per round, which can be analyzed for emerging sequence
motifs. At the end of the cell-SELEX process, aptamer candidates
can be taken on for synthesis and validation.
A few practical words about SELEX. First, it is a very involved
process and planning is essential. Each complete cycle of SELEX
can take many hours to complete, so a full SELEX experiment will
likely take several days. Second, it is also quite expensive, with the
main costs being in oligonucleotide synthesis and DNA sequenc-
ing. The oligos, which should be HPLC- or PAGE-purified,
include the 100 nt SELEX starting library (labeled with a 5′-
-fluorophore such as hexachlorofluorescein, HEX); the “Top”
and “Bot” 25 nt SELEX PCR primers, the 25 nt cloning primers,
sequencing primers and any candidate aptamer oligos for testing.
Third, in this method, we assume a working familiarity with some
common molecular biology protocols. These include basic micro-

biology techniques such as handling agar, liquid culture, and bac-
terial stocks; molecular cloning techniques like PCR, restriction
digestion, ligation, transformation, and colony-PCR; lab techni-
ques such as making and running denaturing and non-denaturing
(native) polyacrylamide gel electrophoresis (PAGE) gels, and famil-
iarity with using simple online webserver tools for sequence align-
ment and analysis.
2 Materials

ular microbiology work and wear lab coat, gloves, and appropriate
PPE at all times to avoid contamination and minimize the risk of
nuclease degradation of samples. Use molecular biology grade
reagents and distilled, deionized, water for buffers. Note that
when planning and purchasing materials, you will need to order
the SELEX oligonucleotides early on, since these will likely take the
longest to arrive from synthesis. Subheadings 2.1, 2.2, 2.3, 2.4,
2.5, 2.6 and 2.7 below mirror the Methods Subheadings 3.1, 3.2,
3.3, 3.4, 3.5, 3.6 and 3.7 so you can easily see what you will need
for each section.
2.1 Preparation of 1. Target bacteria: either in liquid culture or as a glycerol stock or

Bacterial Target as a frozen scrape-stock (see Note 1).
2. Freshly prepared LB-agar plates: weigh out 40 g of LB agar
powder (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl
and 15 g/L agar) in a 1 L beaker. Make up to 1 L with distilled
water and stir until fully dissolved. Transfer 250 mL to four
clean Pyrex bottles. Sterilize each by autoclaving at 121 °C (and
15 psi) for 15 min with the cap loosely attached by autoclave
indicator tape. Once cooled to ~60 °C, add 1 mL of 50 mg/
mL ampicillin, gently mix and pour ~twelve plates (each with a
final concentration of 50 μg/mL ampicillin). Label, seal, and
store inverted at 4 °C until needed.
3. Disposable sterile loops.
4. Microbiology incubator set to 37 °C.
5. Freshly prepared LB broth: weigh out 25 g of LB powder
(10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl) in a
1 L beaker. Make up to 1 L with distilled water and stir until
fully dissolved. Transfer 250 mL to four clean Pyrex bottles.
Sterilize each by autoclaving at 121 °C for 15 min with the cap
loosely attached by autoclave indicator tape. Once cooled to
~60 °C, add 1 mL of 50 mg/mL ampicillin (to give a final
concentration of 50 μg/mL ampicillin). Flame the neck of each
bottle when used. Label and store at 4 °C until needed.
6. Sterile 50 mL polypropylene tubes for liquid media growth.

8. Spectrophotometer or optical-density reader set to 600 nm.
9. Sterile plastic 3 mL cuvettes for measuring OD600.
11. Benchtop cooled-centrifuge capable of 13,000 rpm
(15,100 × g) and chamber temperature of 0 °C.
12. Microfuge tube storage boxes—you will need one per SELEX
round for the tubes and samples.
2.2 SELEX Round 1. Phosphate-buffered saline (PBS) 10 mM Na2HPO4, 2 mM

One: Binding KH2PO4, 2.7 mM KCl, 137 mM NaCl, pH 7.2. This is best
bought either as tablets or as a pre-mixed 10× stock solution; a
fresh 1× working solution can be made as required.
2. Single-stranded DNA oligonucleotide pool. This is the SELEX
starting library, comprising a central 50 nt random-sequence
DNA cassette with a 25 nt primer binding site on each side and
a 5′-HEX group. You will need a 100 μM stock in ~100 μL of
nuclease-free water. Make a 100 μL working stock of 30 μM in
a selection buffer of your choice (here, 1× PBS). For details, see
Figs. 1a and 2 below (see Note 2).
3. Nuclease-free water: high-quality molecular biology grade;
stored at 4 °C.
2.3 SELEX Round 1. Heat block set to 95 °C.

One: Purifying Bound 2. Ice and ice bucket.
DNA
3. “Phase-lock” gel in microfuge tubes, for enhanced organic-
aqueous phase-separation. We use the “PLG Light” version
from Eppendorf or ThermoFisher.
4. Phenol:Chloroform:Isoamyl-alcohol (PCI): prepared in a 25:
24:1 ratio. Usually brought ready-mixed from a supplier;
100 mL is sufficient. Store at 4 °C.
5. 10 M Ammonium acetate stock; 10 mL is sufficient. Store at 4 °
C.
6. 100% (v/v) and 70% (v/v) ethanol; 100 mL of each is enough.
Store at -20 °C.
2.4 SELEX Round 1. PCR primers for SELEX: these are called SELEX-Top and
One: Amplification and SELEX-Bot, and for each, you will need a stock of ~100 μL
Regeneration of ssDNA at 50 μM in nuclease-free water. Then make 100 μL of a
working stock of each at 20 μM in nuclease-free water. See
Fig. 1b above for sequences (see Note 3).
2. Taq PCR mix (2×): 10 mM Tris-HCl, pH 8.6, 50 mM KCl,
Cell-SELEX Oligonucleotides
A Single-stranded DNA oligonucleotide pool (100 nt)
5’-(HEX)GCGACCCAAGGAATTCTGCTGAAGG (N)50 CATCGTACCGGATCCGTCACCAGCC-3’

25 nt random 25 nt
sequence
B SELEX-Top primer (25 nt) SELEX-Bot primer (25 nt)
5’-(HEX)GCGACCCAAGGAATTCTGCTGAAGG-3’ 5’-(PHOS)GGCTGGTGACGGATCCGGTACGATG-3’
C TOP cloning primer (25 nt) BOT cloning primer (25 nt)
5’-GCGACCCAAGGAATTCTGCTGAAGG-3’ 5’-GGCTGGTGACGGATCCGGTACGATG-3’
EcoRI BamHI
D pJET1.2 forward seq primer (23 nt) pJET1.2 reverse seq primer (24 nt)
5’-CGACTCACTATAGGGAGAGCGGC-3’ 5’-AAGAACATCGATTTTCCATGGCAG-3’
Fig. 1 Cell-SELEX oligonucleotides. The nucleic acid sequences of oligos used in this cell-SELEX method are
shown. (a) The 100 nt starting library sequence (top) contains a 5′-hexachlorofluorescein group (pink) for
visualization and steric inhibition of lambda exonuclease digestion, along with two 25 nt flanking sequences
and a central 50 nt random-sequence cassette (N = A/T/C/G). (b) The two SELEX primers for use in amplifying
the purified cell-associated sequences. The TOP SELEX primer contains a 5′-HEX group (pink) and the BOT
SELEX primer contains a 5′-phosphate group, essential for lambda exonuclease specificity (orange). (c) The
two cloning primers are identical to the SELEX primers above, but lack any 5′-modification. The TOP cloning
primer contains a single EcoRI site (green) and the BOT cloning primer contains a single BamHI site (blue). (d)
The forward and reverse sequencing primers for the pJET series of cloning vectors are shown

ml Taq DNA Polymerase. Usually bought from a commercial
supplier. Store at -20 °C.
4. PCR thermocycler set with the following program (Table 1).
5. A commercial spin-column PCR purification kit. Use as per the
DropTM or PicoDropTM device).
7. Lambda Exonuclease Reaction Buffer (10×) 670 mM Glycine-
KOH, pH 9.4, 25 mM MgCl2, 500 μg/mL BSA.
Fig. 2 Aptamer selection by Cell-SELEX. The starting pool of random-sequence single-stranded DNA (colored
strands, top left) is mixed with bacterial cells (top right). Three rounds of cell resuspension and centrifugation
remove weakly-bound ssDNA sequences. The remaining steps round the Cell-SELEX clock involve purifying
the bound ssDNA sequences, PCR-amplifying them to dsDNA, returning the dsDNA to ss form (using lambda
exonuclease digestion), and then reincubating the enriched pool for another round of cell binding and selection
Table 1
PCR step Temperature (°C) Time (s)

Denaturation 95 60
30
Melting 95 30 30 cycles
Annealing 62 30
Elongation 72
Hold 4 1
8. Lambda exonuclease enzyme: 5 U/μL from a commercial

supplier. Store at -20 °C.
9. DNA size ladder: a 100 base DNA ladder from a commercial
supplier. Store at 4 °C.
10. Denaturing PAGE (D-PAGE) gel-loading buffer: 80% (v/v)
formamide, 10 mM EDTA, 2 mM NaOH, ~0.01% (w/v)
Bromophenol blue. A fresh stock of 10 mL will be plenty;
store at room temperature.
11. Non-denaturing PAGE (N-PAGE) gel-loading buffer: 40%
(w/v) sucrose, 10 mM Tris-HCl, pH 7.4, 10 mM EDTA,
~0.01% (w/v) Bromophenol blue. A fresh stock of 10 mL
will be plenty; store at room temperature.
12. A polyacrylamide gel electrophoresis (PAGE) system. This
includes a power-pack, gel plates, combs, polyacrylamide:bisa-
crylamide stock and suitable buffers for making and running
non-denaturing (native) or denaturing PAGE gels. For details
of how to run PAGE gels, please see the manufacturer’s
instructions.
13. A gel-visualization system capable of excitation at ~533 nm for
visualizing HEX-labeled DNA in native or denaturing PAGE
gels. LED camera systems are widely used; we use a scanning
fluorescence-phosphorimager (Fujifilm FLA5000).
2.5 Further SELEX 1. Sufficient microfuge boxes: one per round. Label clearly and
Rounds keep all samples at 4 °C.
2.6 Cloning and 1. Cloning materials and methods as per your laboratory’s pre-
Sequencing of ferred method. See Fig. 1c for cloning primers (see Notes 4
Aptamer Candidates and 19).
2. Sequencing materials and methods as per your laboratory’s
preferred method. Most labs send batches of plasmids for
sequencing to a commercial company. See Fig. 1d for sequenc-
ing primers for pJET1.2 vectors (see Notes 5 and 20).
2.7 Analyzing and 1. Internet-enabled computer. For recommended DNA

Ordering Aptamer sequence-analysis website addresses, see Subheading 3.7.
Candidates 2. Common spreadsheet packages (like Microsoft Excel) and
graphing-packages (like GraphPad Prism) are very useful for
processing, storing and visualizing sequence data.
3. Local DNA sequence software packages (if available) can
be used.
4. Chosen aptamer-candidate oligos for further testing (see Note
6).
3 Methods
Order and prepare all the materials and reagents in advance. Con-
duct all steps at room temperature unless otherwise specified. Wear
lab coat, gloves, and appropriate PPE at all times to avoid contami-
nation and minimize the risk of nuclease degradation of samples.
3.1 Preparation of 1. Use a sterile loop to streak a fresh LB-amp plate with your
Bacterial Target target bacteria (here, HB101 freshly transformed with
pAT153) and grow inverted overnight at 37 °C (see Note 7).
2. Pick a single well-spaced colony to inoculate 10 mL LB-amp
broth and start growing aerobically at 37 °C, shaking at
200 rpm; note the time.
3. Measure the OD600 in a spectrophotometer or cell-density
reader every 40 min by taking a 2 mL sample to a sterile plastic
cuvette; blank against a separate 2 mL sample of sterile LB-amp
media. It can be useful to plot the growth curve as you go.
4. Once the optical density reaches ~0.4 (about 4 h), take a 1 mL
sample to a fresh microcentrifuge tube and, with a balance
tube, centrifuge at 8000 × g for 3 min to pellet the cells (see
Note 8).
5. Remove the liquid media from each by first decanting it away
and then using a pipette to remove any residual LB media.
Label this tube “EC1” (E. coli pellet 1) and store in a box at
room temperature until required (see Note 9).
3.2 SELEX Round 1. Using a hot-block, heat the tube containing 100 μL of 30 μM
One: Binding SELEX library oligonucleotide (in your selected buffer, here
1×PBS) to 95 °C for 5 min, then allow it to cool slowly to room
temperature. This allows any ssDNA secondary structures
to form.
2. Add 1 mL of 1×PBS to tube EC1 and gently resuspend the
E. coli pellet by pipetting slowly; avoid introducing air bubbles.
3. To the resuspended cells, add 50 μL of the cooled 30 μM
SELEX library oligonucleotide dissolved in 1×PBS (giving
~1.4 μM final), mix gently, and leave to incubate at room
temperature for 30 min (see Note 10).
4. Centrifuge at 8000 × g for 3 min to collect the cells.
5. Take a 5 μL sample of the supernatant, add to 10 μL D-PAGE
loading buffer and label this “S1-1” (Sample 1, round 1) (see
Note 11).
6. Remove and dispose of all the remaining supernatant (~1 mL)
by pipette.
7. Gently resuspend the cell pellet in 1 mL 1×PBS, centrifuge at

8000 × g for 3 min, and take a 5 μL supernatant sample and add
to 10 μL D-PAGE loading buffer; label this sample “S2-1” (see
Note 12).
8. Remove all the remaining supernatant (~1 mL) by pipette.
9. Repeat steps 7 and 8 two further times, taking samples labeled
“S3-1” and “S4-1.”
10. Gently resuspend the washed cell pellet in 100 μL nuclease-free
water (see Note 13).
3.3 SELEX Round 1. Heat-kill the resuspended cells at 95 °C for 5 min (with the cap
One: Purifying Bound on and a weight on top) then cool on ice for 5 min. Briefly
DNA centrifuge to collect all liquid at the bottom of the tube.
2. Transfer the contents (~100 μL) to a “Phase-lock gel” tube,
add 100 μL of PCI, and mix (do not vortex).
3. Centrifuge at 16,000 × g for 3 min to separate the organic and
aqueous phases.
4. Pipette the top (aqueous) layer into a fresh tube and add 25 μL
of 10 M ammonium acetate (to give a final concentration of
2 M).
5. Add two-volumes (250 μL) of freezer-cold 100% (v/v) etha-
nol, mix and store at -20 °C for 30 min before centrifuging at
16,000 × g for 20 min at 0 °C (with the microfuge hinge facing
“up” in the centrifuge rotor).
6. Remove all the ethanolic supernatant by pipette, taking care
not to disturb the precipitated DNA on the side under the
hinge.
7. Wash the precipitated DNA by adding 500 μL of freezer-cold
70% (v/v) ethanol down the side of the tube opposite the pellet
and centrifuge at 16,000 × g for 5 min at 0 °C.
8. Remove all the ethanolic supernatant by pipette and air dry
with the cap open for 5 min at room temperature.
9. Resuspend the DNA pellet in 50 μL nuclease-free water, taking
care to resuspend the DNA under the hinge as well. Label this
tube “Bound DNA” (see Note 14).
10. Take a 5 μL sample of Bound DNA and add to 10 μL D-PAGE
loading buffer and label “S5-1.”
3.4 SELEX Round 1. Prepare a PCR master-mix. Into a single tube (on ice) add
One: Amplification and 330 μL nuclease-free water, 15 μL of SELEX-Top primer,
Regeneration of ssDNA 15 μL of SELEX-Bot primer, and 375 μL of 2×Taq PCR mix.
Mix gently and keep on ice until ready; the total volume is
735 μL (see Note 15).
2. Label 14 separate thin-walled (0.2 mL) PCR tubes “1” to

“14.” To tubes 1–12, add 1 μL of Bound DNA from step 9
in Subheading 3.3 above. To Tube 13, add 1 μL of a 30 nM
working dilution of the oligonucleotide library (as a positive
PCR control), and to tube 14, add 1 μL nuclease-free water
(as a no-template PCR control).
3. Aliquot 49 ul of the PCR master-mix from step 1 into each
tube, mix gently and change pipette tip each time.
4. Close the lids and run the PCR reactions according to the
details in Table 1.
5. Following PCR, take a 5 μL sample from each PCR tube and
mix with 10 μL N-PAGE loading buffer. Label these tubes
“S6-1” to “S19-1.” Thus the 5 μL sample from PCR tube
1 goes into S6-1 and so on.
6. Pool the remaining volumes of PCR tubes 1–12
(12×45 μL = 540 μL) and use a commercial microspin column
purification kit to purify the PCRs, eluting the pooled dsDNA
in a final volume of 80 μL elution buffer (via 2× 40 μL elution
washes).
7. Take three samples at this stage: a 5 μL sample to 10 μL
N-PAGE loading buffer (label “S20-1”); a 2 μL sample for
concentration and purity determination on a small-volume UV
spectrophotometer, and a 10 μL sample for cloning (label
“Round One Cloning”; see Subheading 3.6).
8. To the remaining pooled DNA (~63 μL), add 26 μl nuclease-
free water, 10 μL of lambda exonuclease buffer and 1 μL
lambda exonuclease (5 U), mixing well by gentle pipetting
(see Note 16).
9. Incubate at 37 °C for 2 h to digest the 5′-phosphate-labeled
strand and regenerate ssDNA.
10. Incubate at 70 °C for 10 min to denature the lambda exonu-
clease enzyme.
11. Use a commercial microspin column purification kit to purify
the ssDNA, eluting the DNA in a final volume of 80 μL elution
buffer (via 2× 40 μL elution washes).
12. Take two samples at this stage: a 5 μL sample to 10 μL D-PAGE
loading buffer (label “S21-1”) and 2 μL for concentration and
purity determination on a small-volume UV
spectrophotometer.
13. Label the remaining eluted DNA (~73 μL) “R2I” (Round
Two Input). These ssDNA molecules will be the input
sequences for binding to E. coli in the next SELEX round.
14. Check that you have twenty-one 15 μL samples (S1-1 to S21-
1), as shown in Table 2.
Table 2
SELEX samples per round and PAGE type to run them on
Sample no. Contents Denaturing gel Non-denaturing gel

S1-1 Unbound ssDNA library Y
S2-1 PBS wash 1 Y
S3-1 PBS wash 2 Y
S4-1 PBS wash 3 Y
S5-1 Purified-Bound ssDNA Y
S6-1 to S19-1 14× PCRs Y
S20-1 Purified-Pooled PCRs Y
S21-1 Purified ssDNA for Round Two input Y
15. Run and visualize the 21 samples (“S1-1” to “S2-1”), along

with a suitable DNA size ladder, on either a 15% (w/v) dena-
turing PAGE gel (S1-S5+S21, see Table 2 above), or a 15%
(w/v) non-denaturing, native PAGE gel (S6-S20) (see Note
17).
3.5 Further SELEX 1. To refine the evolving pool of aptamers, you may proceed with
Rounds as many further rounds of SELEX as you like by repeating
Subheadings 3.1, 3.2, 3.3 and 3.4. Use a fresh bacterial pellet
for each round and remember to update the names of each
sample (“EC2,” “S1-1,” “S2-2,” etc.).
2. To start Round Two, repeat Subheadings 3.1, 3.2, 3.3 and 3.4,
but in place of using 50 μL of the starting oligonucleotide pool
(as you did in Round One), use 50 μL of the ssDNA R2I
(Round Two Input) from Subheading 3.4, step 13. Remember
to heat the R2I sample to 95 °C for 5 min, then allow to cool
slowly to room temperature. This allows any ssDNA secondary
structures to form.
3. Continue as required for Round Three, Round Four, and so on
(see Note 18).
3.6 Cloning and 1. For each round of SELEX, check that you have a 10 μL sample
Sequencing of from Subheading 3.4, step 7 (labeled “Round One Cloning,”
Aptamer Candidates “Round Two Cloning,” and so on).
2. Clone a sample (10 to 20) of the aptamer candidates from each
round. Use your laboratory’s preferred cloning, transformation
and recombinant plasmid purification protocols. Figure 1c
shows the cloning primers we use, and these contain restriction
sites for EcoRI and BamHI, respectively (see Note 19).
3. It is essential that you then sequence the resulting plasmid

clones. Use your laboratory’s preferred method of doing so,
whether in-house or by commercial dideoxy sequencing (see
Note 20).
3.7 Analyzing and 1. Align the sample of nucleotide sequences within each round
Ordering Aptamer using a multiple sequence alignment (MSA) tool. We recom-
Candidates mend using the EBI Clustal Omega, MUSCLE, or MAFFT
online tools (www.ebi.ac.uk/tools/msa/).
2. Use Weblogo (www.weblogo.berkeley.edu) to create a nucleo-
tide frequency histogram of the central 50 nt cassette for each
SELEX round.
3. Compare the predicted secondary structure for the individual
sequences in each round using either the University of Vienna
RNAfold webserver (http://rna.tbi.univie.ac.at/) or mFold
tool on the UNAfold server (www.unafold.org).
4. Construct a list of ssDNA aptamer sequences that you would
like to test. We recommend screening several from each round,
though those from later rounds are likely to show greater
affinity. Order your chosen sequences from an oligonucleotide
supplier, ensuring they are HPLC- or PAGE-purified (see Note
21).
5. Conduct further biochemical, biophysical and microscopy
experiments as required. The 5’-HEX group is very useful to
have for visualizing and quantitating binding. An important
control experiment is to test the binding of a scrambled version
of you best-binding aptamer sequence. This scrambled control
has the same number of A, G, C and T nucleotides as your
candidate aptamer, but in a random order. Another control is
to test your best putative aptamer sequences against a sample of
the starting random pool. Finally, you can explore how chang-
ing the backbone to nuclease-resistant linkages (such as PNA,
LNA) affects binding and so on.
4 Notes
1. Before any wetwork, first decide the bacterial genus against

which you wish to raise aptamers. As an example cellular target
here, we used Escherichia coli strain HB101 freshly trans-
formed with plasmid pAT153 (to give an antibiotic-resistant
strain via beta-lactamase expression). You can, in theory,
choose any gram negative or positive bacterial species, or even
a eukaryotic cell line.
2. This is a commercially purchased 100 nt single stranded oligo-
nucleotide containing a central cassette of 50 random nucleo-
tides flanked by two 25-nt primer-binding sequences. It should
be covalently labeled with a fluorescent dye (for example, hex-

achlorofluorescein, HEX) at the 5′-end. You can of course
change the length of the flanking primers sequences and the
central random cassette if you wish. Therefore, you will need to
decide on the design of your single-stranded SELEX library
oligonucleotide (and SELEX primers, Subheading 2.4) early
on. For the library oligo, the three factors to consider are:
(i) Length of flanking primers. We use 25 nt here to ensure
primer specificity to the library oligo and avoid accidental
amplification of E. coli genome sequences.
(ii) Restriction enzyme sites within the flanking primer
sequences (we use EcoRI and BamHI here).
(iii) Length of the central random cassette. We use N = 50 nt
here, where N is A, C, T, or G. In theory, a 50 nt cassette
gives a potential pool of 450 = 1.2 × 1030 unique sequences.
One other aspect to note is that it is good practice to clone
and sequence several dozen copies of the random starting
oligonucleotide, to check for any sign of accidental synthesis
bias; that is, to check that all nucleotides are represented evenly.
3. These are commercially purchased 25 nt single stranded oligo-
nucleotides. These primers are designed to specifically amplify
the SELEX library oligo and not amplify any bacterial genome
sequences. SELEX-TOP has a 5′-HEX group (and internal
EcoRI site), and SELEX-Bot has a 5′-phosphate group (and
internal BamHI site) essential for lambda exonuclease to be
able to bind and selectively digest the non-aptamer strand.
They each contain a different restriction enzyme
(RE) recognition site (for later cloning) and you can choose
any RE pair you like. Just ensure that you match the melting
temperature (Tm) values for the pair. We suggest a synthesis
scale of 0.2 μmol. Ensure both oligos are HPLC- or PAGE-
purified. Make a careful record of their synthesis details and
suspend each at 20 μM. (The working concentration is 0.4 μM
in the PCR reaction).
4. For example, sufficient purified cloning vector, restriction
enzymes (EcoRI and BamHI here) as well as buffers, DNA
ligase, transformation buffer, competent cells, and growth
media. We use the CloneJET cloning kit and colony PCR as a
rapid way to clone and detect successful recombinants. You
may need a commercial spin-column plasmid-purification kit.
5. The most common method is to send cloned plasmid samples
off for Sanger dideoxy sequencing. Be aware you may need to
send sequencing primers with your plasmid samples. Figure 1d
gives the sequences of the primers we use for the pJET
cloning kit.
6. You (obviously) will not know the sequence for these until you
have completed Stage 3.7, so there is inevitably a short hiatus
between finishing SELEX and ordering aptamer candidates.
We recommend these oligos are HPLC- or PAGE-purified; it
is always best to order the full 100 nt length (i.e. including the
primer sites) and not just the 50 base central cassette.
7. Use a freshly grown culture from a single colony every round.
As mentioned earlier, you may choose any bacterial species to
study; transformation with a plasmid for antibiotic selection
makes plating and growth easier.
8. In LB-amp, we find that an E. coli culture with an OD600 of
0.45 has approximately 107 cells/mL.
9. It is important to remove as much of the LB growth media as
possible. In the next round, label the pellet “EC2” and so on.
10. This is the SELEX binding step. You can increase or decrease
the binding duration and/or temperature. In fact, the more
stringent the binding conditions, the greater the likelihood of
obtaining aptamers with an improved Kd. Note though that in
the early few rounds, you may like to have less-stringent con-
ditions and increase binding stringency in later rounds.
11. This 15 μL sample, along with other samples taken throughout
the round, is run on a gel later, at the end of Subheading 3.4
and corresponds to unbound oligo sequences.
12. This is the first of three SELEX wash steps to remove any
ssDNA that is not tightly bound to the bacteria.
13. At this stage, only ssDNA that is able to bind to the bacteria
will remain. In the next stages, this is purified from the bacteria
(Subheading 3.3), amplified by PCR (Subheading 3.4), cloned
(Subheading 3.5), and input for another round of SELEX
(Subheading 3.6).
14. The tube Bound DNA contains purified ssDNA molecules
from the starting aptamer pool that were able to bind to the
bacteria.
15. The PCR master-mix contains every PCR component except
template. Enough is made for fifteen 50 μL PCR reactions,
though only fourteen PCR reactions are run; the extra volume
is spare, to allow for pipetting error, though can be run as a
further no-template control if required.
16. This is the step at which the dsDNA pool is converted back to
ssDNA, due to the lambda exonuclease preferentially hydro-
lysing the “lower” 5′-phosphate-labelled strand; the “upper”
strand remains intact due to chemical protection by the
5′-HEX group. You may use 10 or 20 units of lambda exonu-
clease, though we have found that 5 units is easily sufficient to
accomplish bottom strand digestion.
17. Running the samples is very useful, and you will need one
denaturing (D-PAGE) gel and one native (N-PAGE) gel per
round. This is to check for the presence or absence of DNA at
each stage, and especially for correct amplicon sizes and PCR
controls. This completes one full round of SELEX.
18. We have found that 4–8 rounds of binding and selection is
sufficient to evolve a pool of cell-binding aptamers. For each
subsequent SELEX round, remember to modify all the sample
labels to match the correct round number; for example, “S1-
2,” “S2-2,” “Round Two Cloning,” and so on.
19. For example, cutting the PCRs with EcoRI and BamHI and
ligating into your cloning vector of choice (such as pUC19,
2686 bp) before transforming and sequencing a sample of the
recombinant plasmids. In our lab, we use the CloneJET PCR
cloning kit and the pJET1.2/Blunt vector (2974 bp) for rapid
cloning. For this method, follow the supplied kit protocol. In
brief, this involves cutting 1 μL of the PCR sample with EcoRI
and BamHI, blunting the product and blunt-end cloning into
pJET1.2/Blunt, followed by transformation into competent
DH5α cells. Transformants are grown on LB-amp plates and
subject to colony PCR with the SELEX PCR primers; clones
showing a 100 bp fluorescent product are grown on in 5 mL
LB-amp broth, a plasmid minipreparation performed and a
sample sent for sequencing. It is possible to sequence.
20. We recommend sequencing at least 10–20 (or more) different
clones per round, to give a statistically useful picture of the
evolving aptamer pool. Some labs routinely use next-genera-
tion sequencing (NGS) rather than cloning and transformation
and this allows a greater number of sequencing reads per
round. Interestingly, it is occasionally observed through
sequence analysis that after extended rounds of selection
(5+), amplicons with additional Bot primer sequences at the
3′ terminus can be generated. These additional sequences can
be removed using the appropriate endonuclease (BamH1)
digestion. It may also be that these additional primer sequences
are accumulated during PCR or molecular cloning.
21. It is best practice to ensure they have the same format as the
100 nt ssDNA library pool, with a 5′-HEX group and the two
flanking 25 nt primer sequences, but with the 50 nt random
central cassette replaced with the defined sequence to be
tested. For economy, you can omit the 25 nt flanking regions.
Acknowledgments
We kindly thank Dr. Banushan Balansethupathy for comments on

this chapter.
References
1. Joyce GF (1989) Amplification, mutation and 8. Kim YS, Song MY, Jurng J, Kim BC (2013)
selection of catalytic RNA. Gene 82:83–87 Isolation and characterization of DNA apta-
2. Ellington AD, Szostak JW (1990) In vitro mers against Escherichia coli using a bacterial
selection of RNA molecules that bind specific cell-systematic evolution of ligands by expo-
ligands. Nature 346:818–822 nential enrichment approach. Anal Biochem
3. Tuerk C, Gold L (1990) Systematic evolution 436:22–28
of ligands by exponential enrichment: RNA 9. Stoltenburg R, Reinemann C, Strehlitz B
ligands to bacteriophage T4 DNA polymerase. (2007) SELEX – a (r)evolutionary method to
Science 249:505–510 generate high-affinity nucleic acid ligands. Bio-
4. Chai C, Xie Z, Grotewold E (2011) SELEX mol Eng 24:381–403
(Systematic Evolution of Ligands by EXponen- 10. Gooch J, Tungsirisurp S, Costanzo H,
tial Enrichment) as a powerful tool for deci- Napier R, Frascione N (2021) Generating apta-
phering the protein-DNA interaction space. mers towards human sperm cells using mas-
Methods Mol Biol 754:249–258 sively parallel sequencing. Anal Bioanal Chem.
5. Lakhin AV, Tarantul VZ, Gening LV (2013) (Epub ahead of print)
Aptamers: problems, solutions and prospects. 11. Kolm C, Cervenka I, Aschl UJ, Baumann N,
Acta Naturae 5:34–43 Jakwerth S, Krska R, Mach RL, Sommer R,
6. Davydova A, Vorobjeva M, Pyshnyi D, DeRosa MC, Kirschner AKT, Farnleitner AH,
Altman S, Vlassov V, Venyaminova A (2016) Reischer GH (2020) DNA aptamers against
Aptamers against pathogenic microorganisms. bacterial cells can be efficiently selected by a
Crit Rev Microbiol 42:847–865 SELEX process using state-of-the art qPCR
and ultra-deep sequencing. Sci Rep 10:20917
7. Darmostuk M, Rimpelova S, Gbelcova H,
Ruml T (2015) Current approaches in 12. Keefe AD, Pai S, Ellington AD (2010) Apta-
SELEX: an update to aptamer selection tech- mers as therapeutics. Nat Rev Drug Discov 9:
nology. Biotechnol Adv 33:1141–1161 537–550
Chapter 13
Generation of Functional-RNA Arrays by In Vitro

Transcription and In Situ RNA Capture for the Detection
of RNA-RNA Interactions
Helen A. Vincent, Charlotte A. Henderson, Daniela Lopes Cardoso,
and Anastasia J. Callaghan
Abstract
RNA performs a wide variety of vital cellular functions. These functions typically require interactions with
other biological macromolecules, often as part of an intricate communication network. High-throughput
techniques capable of analyzing RNA-based interactions are therefore essential. Functional-RNA arrays
address this need, providing the capability of performing hundreds of miniature assays in parallel. Here we
describe a method to generate functional-RNA arrays using in vitro transcription of a DNA template array
and in situ RNA capture. We also suggest how functional-RNA arrays could be applied to investigating
RNA-RNA interactions.
Key words Binding partner, Functional-RNA, In situ capture, In vitro transcription, Microarray,
RNA array, RNA-RNA interactions, Surface immobilization
1 Introduction
RNA is a structurally and functionally diverse molecule. Our under-

standing of its function(s) has transitioned from it playing relatively
passive roles in translation (mRNA, rRNA, and tRNA) to it
performing a myriad of catalytic and/or regulatory activities (e.g.,
ribozymes, snRNAs, snoRNAs, miRNAs, riboswitches, sRNAs,
lncRNAs, CRISPR) [1]. In many cases, it is known that regulatory
activity of an RNA depends on interactions between the RNA and
other molecules, for example, complementary base-pairing with
nucleic acids (RNA and DNA), formation of ribonucleoprotein
complexes, or binding of small molecules [2]. These interactions,
either in isolation or as part of a wider network, typically affect
transcription, translation and/or RNA processing. Understanding
the mechanistic details of the regulatory activities of RNA is critical
https://doi.org/10.1007/978-1-0716-3004-4_13,
163
164 Helen A. Vincent et al.
for understanding both normal cellular function and disease and

has implications for therapeutic and synthetic biology applications.
This in turn requires high-throughput techniques that are capable
of detecting RNA-based interactions and analyzing their functional
outputs at the molecular level.
Microarray technology [3], which can allow thousands of min-
iature assays to be performed in parallel on a single surface, has
immense potential in this regard. RNA microarrays are in their
infancy compared to DNA microarrays but, recently, a number of
methods have been developed for generating RNA microarrays
[4]. These can be broadly classified into spotting, “on-array” tran-
scription and in situ chemical synthesis [4]. Applications such as
detecting RNA-RNA [5], small molecule-RNA [5, 6] and protein-
RNA [7–9] interactions; monitoring regulatory outputs, e.g., pro-
tein expression [10]; and assaying RNA cleavage [11] are beginning
to be explored.
“On-array” transcription methods for producing RNA arrays
[4] are especially useful when arrays of longer, structured, func-
tional RNAs are required rather than arrays of shorter oligonucleo-
tides. In this chapter, we provide the detailed protocols that are
necessary for generating functional-RNA microarrays through an
“on-array” method that involves in vitro transcription of a DNA
in vitro transcription template array and in situ surface capture of
the RNA on a facing surface [5] (Fig. 1). As shown schematically in
Fig. 1, this method first involves producing a DNA in vitro tran-
scription template array by spotting custom-designed DNA in vitro
transcription templates onto a microarray slide. A DNA in vitro
transcription template array—in vitro transcription reagent mix—
RNA capture surface “sandwich” is then assembled. As in vitro
transcription proceeds, RNA synthesized from each DNA in vitro
transcription template is captured in situ on an RNA capture surface
to generate a corresponding functional-RNA array. The specific
protocols that we include here are: in vitro transcription template
design, generation of the DNA in vitro transcription template array
by spotting, and generation of the functional-RNA array by in vitro
transcription and in situ capture of the RNA.
We have utilized functional-RNA arrays that were generated
following these protocols to detect regulatory RNA-RNA interac-
tions [5, 10] and have investigated both RNA-RNA binding [5]
and the functional consequence of RNA-RNA interactions on pro-
tein expression [10]. Since these applications have been reported
elsewhere, and because the application of a functional-RNA array
will be highly user-specific, we will not discuss the applications of
RNA arrays in detail here. However, as an example, we will include
a basic protocol for probing a functional-RNA array with a single
binding partner in order to evaluate the specificity of an RNA-RNA
binding interaction. This could be useful if a particular RNA has
many RNA binding targets. For example, the regulatory
Generation of Functional-RNA Arrays 165
Fig. 1 Generation of functional-RNA arrays by in vitro transcription and in situ RNA capture. Custom DNA
in vitro transcription templates are designed and synthesized. These are spotted onto a microarray slide to
produce a DNA in vitro transcription template array. A DNA in vitro transcription template array—in vitro
transcription reagent mix (IVT)—RNA capture surface “sandwich” is assembled. As in vitro transcription
proceeds, RNA is captured in situ to produce a corresponding functional-RNA array
RNA-RNA binding interactions between mRNAs and sRNAs,

where a functional-RNA array of mRNA binding targets could be
probed with an sRNA. Alternatively, it could be useful to investi-
gate the importance of key nucleotides within a binding site, where
a functional-RNA array of RNA binding target mutants could be
probed with the binding partner.
2 Materials
To minimize the risk of RNA degradation, gloves should be worn

when handling reagents, materials, and equipment, and all solu-
tions should be prepared using nuclease-free water (ultrapure water
(18.2 MΩ/cm) filtered through a 0.22 μm filter).
2.1 In Vitro 1. RNA secondary structure prediction software (see Note 1).
Transcription
Template Design and
Synthesis
2.2 Generation of the 1. Streptavidin-coated glass microarray slide (see Notes 2–4).
DNA In Vitro 2. 20–500 nM 5′-biotinylated DNA in vitro transcription tem-
Transcription plate(s) in phosphate-buffered saline (PBS), pH 7.4 (see Notes
Template Array 5–7).
3. Automated arrayer (see Note 8) or a micropipette.
4. PBST: PBS, pH 7.4 supplemented with 0.05% (v/v) Tween
20.
5. PBS.
6. H2O.
7. Microarray slide scanner (see Notes 9 and 10).
2.3 Generation of the 1. DNA in vitro transcription template array (see Subheading 3.2).
Functional-RNA Array 2. Streptavidin-coated glass microarray slide (see Notes 2–4).
3. Parafilm.
4. T7 in vitro transcription reagent mix (see Note 11): 1X MEGA-
script T7 Transcription Reaction Buffer, 1X MEGAscript T7
Transcription Enzyme Mix, 0.4 mM ATP, 0.4 mM CTP,
0.4 mM GTP, 0.4 mM UTP.
5. PBST.
6. PBS.
7. H2O.
8. 50–100 nM linker probe (a fluorescently labeled DNA oligo-
nucleotide with a sequence complementary to the unstruc-
tured linker between the RNA of interest and the
immobilization aptamer (see Subheading 3.1 and Fig. 2) in
2X saline-sodium citrate (SSC) supplemented with 0.1% w/v
sodium dodecyl sulphate (SDS) (see Notes 12–14).
9. LifterSlip (Thermo Fisher Scientific) (see Note 15).
2.4 Application of 1. Functional-RNA array (see Subheading 3.3).

Functional-RNA Arrays 2. Fluorescently labeled binding partner probe in hybridization
to the Evaluation of buffer (see Notes 16–18).
RNA-RNA Binding
3. LifterSlip (Thermo Fisher Scientific) (see Note 15).
Specificity
3 Methods
The protocols provided below assume that the user has experience
working in a molecular biology laboratory and is familiar with
standard molecular biology techniques. The protocols are intended
to provide a starting point when generating functional-RNA arrays
for the first time. It is anticipated that the user will bring their
system-specific knowledge to these protocols and will adapt them
where appropriate.
Subheading 3.1 involves the custom design and synthesis of
in vitro transcription templates. This will require forward planning.
Once this step is complete, Subheadings 3.2–3.4 can be completed
in one day or they can be split over two days with Subheading 3.2
completed on the first day and Subheadings 3.3 and 3.4 completed
on the second day.
3.1 In Vitro Each custom DNA in vitro transcription template should be

Transcription designed to have the general architecture depicted in Fig. 2 (see
Template Design and Note 19).
Synthesis 1. Generate the DNA in vitro transcription template sequence by
linking the DNA sequence for each of the following compo-
nents in order from 5′ to 3′: immobilization linker (see Note
20)—promoter (see Note 21)—transcription system-specific
sequence (see Note 22)—RNA of interest (user-defined)—
unstructured linker (see Note 23)—immobilization aptamer
(see Notes 24 and 25)—fluorophore (see Note 26). A sug-
gested starting DNA sequence for each component, except for
the user-defined RNA of interest, is given in Fig. 2.
2. Generate RNA sequences for (1) the full-length transcribed
RNA (transcription system-specific sequence—RNA of
interest—unstructured linker—immobilization aptamer) (see
Note 27), (2) the RNA of interest and (ii) the immobilization
aptamer.
3. Use RNA secondary structure prediction software (see Note 1)
to predict the secondary structure for each of the RNA
sequences generated in Step 2 (see Fig. 3 for an example).
4. Compare the predicted secondary structures for the RNA of
interest and the immobilization aptamer within the full-length
Fig. 2 Design of the in vitro transcription template. A schematic of the in vitro transcription template which
consists of a short immobilization linker (see Note 20), a promoter (see Note 21), transcription system-specific
sequence (see Note 22), sequence encoding the RNA of interest, an unstructured linker (see Note 23),
sequence encoding an immobilization aptamer (see Notes 24 and 25) and an optional fluorophore (see Note
26). A suggested starting DNA sequence for each component of the in vitro transcription template is indicated,
except for the user-specified RNA of interest sequence which is represented by . . .(N)n. . .
transcript to their predicted secondary structures when they are

in isolation to ensure that they are equivalent (see Fig. 3 and
Note 28).
5. Synthesize/source the DNA in vitro transcription templates
(see Note 29).
3.2 Generation of the 1. Allow a streptavidin-coated glass microarray slide to equilibrate

DNA In Vitro at room temperature for 30 min (see Notes 4 and 30).
Transcription 2. Spot the DNA in vitro transcription templates onto a
Template Array streptavidin-coated microarray slide in the desired array layout
(see Notes 31, 32 and Fig. 4).
3. Incubate in a humidified environment for 30 min at room
temperature (see Notes 33 and 34).
4. Dip the DNA in vitro transcription template array into a 50 mL
Falcon tube containing PBST (see Note 35).
5. Transfer the DNA in vitro transcription template array to a
50 mL Falcon tube containing 45 mL PBST (see Note 35)
and rotate the tube on a rolling platform for 5 min at room
temperature.
50 mL Falcon tube containing 45 mL PBS (see Note 35) and
rotate the tube on a rolling platform for 5 min at room
temperature.
Fig. 3 Example RNA secondary structures predictions. (a) The sequence of the full-length RNA transcript (RNA)
which consists of GGG (T7 transcription system-specific sequence; grey), MicA (a small regulatory RNA of
interest; blue), an unstructured linker (magenta) and the streptavidin-binding RNA aptamer (SAapt; immobili-
zation aptamer; gold). The RNA secondary structures, predicted by RNAfold (rna.tbi.univie.ac.at) [12], for the
full-length RNA transcript (FL), MicA and the streptavidin-binding RNA aptamer (SAapt) are shown below the
RNA sequence in dot-bracket notation. (b–d) The RNA secondary structures, predicted by RNAfold, visualized
in forna [16]. The predicted secondary structures for MicA and the streptavidin-binding aptamer are the same
in the context of the full-length transcript and in isolation
Fig. 4 Spotting and visualization of the DNA in vitro transcription template array. The DNA in vitro transcription
template array is prepared by spotting 5′-biotinylated DNA in vitro transcription templates onto a streptavidin-
coated microarray slide. Spotting can be performed manually using a micropipette, or it can be automated
using an arrayer (see Note 31). Both methods result in discrete spots containing multiple molecules of the
immobilized DNA in vitro transcription template. Following spotting, the DNA in vitro transcription template
array is washed. If the DNA in vitro transcription templates are also fluorescently labeled (see Note 26), the
DNA in vitro transcription template array can be visualized using a microarray scanner and quantified (see
Note 37)

50 mL Falcon tube containing 45 mL H2O (see Note 35)
temperature.
8. Dry the microarray slide by centrifugation at 500 × g for 5 min
at room temperature (see Note 36).
9. If the DNA in vitro transcription templates are fluorescently
labeled, visualize the array using a microarray slide scanner (see
Notes 26 and 37).
10. Use the DNA in vitro transcription template array immediately
for Subheading 3.3 or store at -20 °C (see Note 38).
3.3 Generation of the 1. Equilibrate a streptavidin-coated glass microarray slide (see

Functional-RNA Array Notes 4 and 30) and the DNA in vitro transcription template
array generated in Subheading 3.2 (see Notes 35 and 38) at
room temperature for 30 min.
Fig. 5 In vitro transcription and in situ RNA capture. (a) Assembly of the DNA in vitro transcription template
array—in vitro transcription reagent mix (IVT mix)—RNA capture surface “sandwich.” The RNA capture
surface (a streptavidin-coated microarray slide) is positioned surface-side up. A small piece of parafilm is
positioned at each of the short edges of the RNA capture surface to act as spacers (see Note 40). In vitro
transcription reagent mix is pipetted onto the RNA capture surface and the DNA in vitro transcription template
array, array-side down, is carefully lowered onto the RNA capture surface to complete the “sandwich”
assembly. (b) The “sandwich” assembly is incubated at 37 °C for 30–90 min during which time RNA is
synthesized by in vitro transcription and captured in situ by the RNA capture surface. (c) The DNA in vitro
transcription template array and the newly generated corresponding functional-RNA array are carefully
separated
2. Assemble a DNA in vitro transcription template array—in vitro

transcription reagent mix—RNA capture surface “sandwich” as
shown in Fig. 5. First place a streptavidin-coated RNA capture
microarray slide surface-side up (see Notes 30 and 39). Place
small pieces of parafilm on the short edges of the streptavidin-
coated RNA capture microarray slide (see Note 40 and Fig. 5)
and pipette 90 μL in vitro transcription reagent mix onto the
RNA capture surface (see Notes 39 and 41). Carefully place the
DNA in vitro transcription template array (see Note 35) on top
of the RNA capture slide array surface-side down.
3. Incubate at 37 °C for 1 h in a humidified environment (see
Note 42).
4. Separate the DNA in vitro transcription template array slide
and the functional-RNA array slide (see Notes 43 and 44).
5. Discard the DNA in vitro transcription template array (see

Note 45).
6. Transfer the functional-RNA array slide to a 50 mL Falcon tube
containing 45 mL PBST (see Note 44) and rotate the tube on a
rolling platform for 5 min at room temperature.
containing 45 mL PBS (see Note 44) and rotate the tube on a
containing 45 mL H2O (see Note 44) and rotate the tube on a
9. Dry the functional-RNA array slide by centrifugation at 500 × g
for 5 min at room temperature (see Note 36).
10. Probe the functional-RNA array immediately (see Subheading
3.3, Steps 11–17 or Subheading 3.4).
11. Place the functional-RNA array with the array surface-side up
(see Note 44) and pipette 90 μL linker probe (see Notes 12–14
and 46) onto the functional-RNA array and cover with a
24 × 60 mm LifterSlip (Fig. 6).
Fig. 6 Probing the functional-RNA array with linker probe. The functional-RNA array can be probed with a
fluorescently labeled DNA oligonucleotide with a sequence complementary to the unstructured linker region
between the RNA of interest and the streptavidin-binding RNA aptamer (see Note 12). This allows visualization
and quantification of the RNA levels on the functional-RNA array (see Note 46). A solution of fluorescently
labeled linker probe is pipetted over the functional-RNA array (see Note 13). This is covered with a LifterSlip
and incubated at room temperature for 30 min in the dark (see Note 47). During incubation, the linker probe
binds to the unstructured linker on the immobilized functional-RNAs. Following incubation, the LifterSlip is
removed, the functional-RNA array is washed, and linker probe fluorescence is detected using a microarray
scanner and quantified (see Note 48)
12. Incubate at room temperature for 30 min in the dark (see

Note 47).
13. Remove the LifterSlip, transfer the functional-RNA array slide
to a 50 mL Falcon tube containing 45 mL PBST (see Note 44),
temperature.
14. Transfer the functional-RNA array slide to a 50 mL Falcon
tube containing 45 mL PBS (see Note 44) and rotate the tube
on a rolling platform for 5 min at room temperature.
15. Transfer the functional-RNA array slide to a 50 mL Falcon
tube containing 45 mL H2O (see Note 44) and rotate the tube
on a rolling platform for 5 min at room temperature.
16. Dry the functional-RNA array slide by centrifugation at
500 × g for 5 min at room temperature (see Note 36).
17. Visualize the functional-RNA array using a microarray slide
scanner (see Note 48).
3.4 Application of 1. Design the functional-RNA array layout (see Notes 32, 49 and
Functional-RNA Arrays Fig. 7).
to the Evaluation of 2. Design each DNA in vitro transcription template that will be
RNA-RNA Binding needed to generate the functional-RNA array (see
Specificity Subheading 3.1).
3. Generate the DNA in vitro transcription template array (see
Subheading 3.2).
4. Generate the functional-RNA array (see Subheading 3.3) and
use immediately.
5. Probe the functional-RNA array with the RNA binding partner
probe (see Notes 16–18, 50–55). (1) Place the functional-
RNA array with the array surface-side up (see Note 44) and
pipette 90 μL RNA binding partner probe (see Notes 16–18,
50 and 52) onto the functional-RNA array and cover with a
24 × 60 mm LifterSlip (see Note 53). (2) Incubate for 30 min
at room temperature in the dark (see Note 54). (3) Remove the
LifterSlip, transfer the functional-RNA array slide to a 50 mL
Falcon tube containing 45 mL hybridization buffer (see Note
44) and rotate on a rolling platform for 5 min at room temper-
ature. (4) Repeat step 3 two more times (see Note 56). (5) Dry
the functional-RNA array slide by centrifugation at 500 × g for
5 min at room temperature (see Note 36).
6. Visualize the functional-RNA array using a microarray slide
scanner (see Note 55).
7. Quantify and analyze the data (see Fig. 7).
Fig. 7 Application of functional-RNA arrays to the evaluation of RNA-RNA binding specificity. Functional-RNA
arrays can be used to detect RNA-RNA interactions [5, 10]. (a) A functional-RNA array is designed with
appropriate positive (+) and negative (-) control RNAs and a variety of test RNAs (T1-T7) (see Note 49). (b) A
DNA in vitro transcription template array is generated (see Notes 5–7). (c) A functional-RNA array is generated
by in vitro transcription and in situ RNA capture and probed with linker probe (see Notes 12–14, 32 and 46).
(d) The functional-RNA array is probed with RNA binding partner probe (see Notes 16–18, 32 and 51).
Fluorescence should be clearly detected for the positive control and not for the negative control. The presence
or absence of fluorescence for the test RNAs can give a yes-no output for binding or the relative intensity of the
RNA detected may be able to give an indication of the relative binding affinity
4 Notes
1. We use RNAfold from the ViennaRNA Package 2.0 (rna.tbi.

univie.ac.at) [12] which is freely available online as a web
interface.
2. Streptavidin-coated glass microarray slides are commercially
available, e.g., Nexterion HS slides (Schott). However, we
covalently immobilize streptavidin to a Nexterion H slide
(Schott) using amine coupling to generate our streptavidin-
coated surface. This allows us to control the density of strepta-
vidin on the surface, and we achieve better results when we
have a lower density of streptavidin on the DNA capture sur-
face than on the RNA capture surface. A protocol for generat-
ing streptavidin-coated surfaces in this manner is provided in
Note 3.
3. (1) Place a Nexterion H microarray slide (Schott) surface-side

up, taking care not to touch the activated surface when
handling the slide. Pipette 90 μL of 1 μM streptavidin
(Sigma) in PBS, pH 7.4 (DNA capture surface) or 16.7 μM
streptavidin in PBS, pH 7.4 (RNA capture surface) onto the
slide. Cover with a 24 × 60 mm LifterSlip (Thermo Fisher
Scientific) and incubate at 37 °C for 1 h in a humidified
environment (we use a mini incubator (9.2 L) and a Petri
dish containing 25 mL H2O). (2) Remove the LifterSlip,
place the microarray slide in a 50 mL Falcon tube containing
45 mL PBST and rotate the tube on a rolling platform for
5 min at room temperature. (3) Transfer the microarray slide
to a 50 mL Falcon tube containing 45 mL PBS and rotate the
tube on a rolling platform for 5 min at room temperature.
(4) Transfer the microarray slide to a 50 mL Falcon tube
containing 45 mL H2O and rotate the tube on a rolling plat-
form for 5 min at room temperature. (5) Transfer the micro-
array slide to a 50 mL Falcon tube containing 45 mL 50 mM
ethanolamine-HCl, pH 8.5 (to block any unreacted NHS
functional groups) and rotate the tube on a rolling platform
for 30 min at room temperature. (6) Repeat the washes in steps
2–4. (7) Dry the microarray slide by centrifugation at 500 × g
for 5 min at room temperature (we place the slide in a 50 mL
Falcon tube and use a swing bucket centrifuge). (8) Use the
prepared capture surface immediately (see Subheadings 3.2 and
3.3) or store at -20 °C for up to 12 months (see Note 4).
4. Streptavidin-coated glass microarray slides are typically stored
at -20 °C and should be equilibrated at room temperature for
30 min prior to use.
5. The DNA in vitro transcription template(s) must be custom
designed and synthesized (see Subheading 3.1 and Fig. 2).
6. When working with a DNA in vitro transcription template for
the first time, we typically prepare it, and test it, at a range of
concentrations between 20 nM and 500 nM to determine the
optimal concentration. If it is only possible to test a single
concentration, 200 nM is a good starting point.
7. If the DNA in vitro transcription templates are labeled at the 3′
end with a fluorophore (see Subheading 3.1 and Fig. 2), they
should be kept in the dark, either by using opaque tubes or
wrapping the tubes in foil.
8. We use a Qarray2 (Genetix).
9. We use a GenePix 4300A microarray scanner with integrated
GenePix Pro 7 image analysis software (Molecular Devices).
The scanner has three lasers that allow excitation at 488 nm,
532 nm, or 635 nm and three emission filters: Standard Blue
(534/42 nm), Standard Green (579/34 nm), and Standard
Red (676/29 nm).
10. Ensure that the fluorescence properties (excitation and emis-

sion wavelengths) of the chosen fluorophore(s) are compatible
with the excitation and emission capabilities of the available
microarray slide scanner.
11. We use the MEGAscript T7 Transcription Kit (Invitrogen) to
assemble the T7 in vitro transcription reagent mix. However,
alternative kits could be substituted or the reagent mix could
be assembled from individually sourced components.
12. For the 5′-ACA CAC ACA CAC ACA CAC AC-3′ linker we
use a 5′-Dy649-GTG TGT GTG TGT GTG TGT GT-3′ DNA
oligonucleotide linker probe. When designing the linker probe
and selecting the fluorophore, care should be taken to ensure
that its fluorescence properties are compatible with the excita-
tion and emission capabilities of the available microarray slide
scanner.
13. We typically prepare and use the linker probe at a concentration
between 50 nM and 100 nM, but optimization may be
required.
14. The fluorescently labeled linker probe should be kept in the
dark, either in opaque tubes or in tubes wrapped in foil.
15. We routinely use 24 × 60 mm LifterSlips to cover the full
microarray slide or 22 x22 mm LifterSlips to cover approxi-
mately 1/3 of the microarray slide.
16. The functional binding interaction to be detected will be
highly user-specific. For RNA-RNA interactions the RNA
binding partner probe should be a fluorescently labeled RNA
containing the required elements for binding (e.g., a specific
nucleotide sequence and/or a specific RNA structural ele-
ment). The RNA binding probe should be labeled with a
fluorophore with orthogonal fluorescence properties to that
used for the linker probe (see Note 12). This will allow simul-
taneous/serial binding and detection of both the linker probe
and the RNA binding partner. We use a standard method to
produce internally fluorescently labeled RNA binding partner
probes by in vitro transcription, supplementing the in vitro
transcription mix with Cy3/5-UTP (GE Healthcare Life
Sciences). When using the Dy649 linker probe (see Note 12),
we would label our RNA binding partner probe with Cy3.
17. For the RNA-RNA interactions that we have experience with,
we have found that 40 mM Tris-HCl, pH 7.8, 6 mM MgCl2,
20 mM NaCl is a good hybridization buffer. However, the
hybridization buffer composition should be adjusted to
accommodate any system-specific requirements.
18. The required RNA binding partner probe concentration is

likely to be system- and/or experiment-specific. For a yes/no
output, we usually select an RNA binding partner probe con-
centration well above the expected Kd for the interaction in the
first instance. If the Kd is unknown, a range of RNA binding
partner probe concentrations spanning several orders of mag-
nitude (e.g., 1 nM, 10 nM, 100 nM, 1 μM) should be tested.
19. This protocol should be followed for each custom DNA
in vitro transcription template that is required.
20. We typically use a 5′-biotinylated linker to facilitate surface
immobilization of the in vitro transcription template when it
is spotted onto a streptavidin-coated glass microarray slide.
Alternative immobilization chemistries, e.g., amine coupling,
and/or surfaces could be employed with the appropriate mod-
ification(s) to these protocols [3].
21. We typically use the T7 promoter, which facilitates transcrip-
tion by T7 RNA polymerase. The T7 in vitro transcription
system is routinely used by molecular biologists and T7
in vitro transcription kits are commercially available at a rea-
sonable cost. Alternative promoters and transcription systems
could be employed with the appropriate modifications(s) to
these protocols.
22. T7 RNA polymerase requires a G to be in the +1 position, and a
G in the +2 and + 3 positions are further required for optimal
transcription efficiency [13]. Depending on the sequence of
the RNA of interest, we insert between 0 and 3 Gs between the
T7 promoter and the RNA of interest to ensure that there is a
G in positions +1, +2, and +3. On rare occasions, the addition
of these nucleotides can adversely affect the structure of the
RNA of interest (see Note 28). In this case, it is possible to omit
the G from positions +2 and +3.
23. An unstructured linker is used to physically separate the RNA
of interest and the immobilization aptamer in order to pro-
mote the independent folding of each of these RNA modules
(see Note 28). The linker can also be utilized as a binding site
for a fluorescently labeled complementary DNA oligonucleo-
tide linker probe. This enables visualization of the RNA array
and quantification of the relative RNA level at each position of
the array [6, 10].
24. We typically use the streptavidin-binding RNA aptamer (SAapt)
to facilitate in situ capture of the in vitro transcribed RNA on a
streptavidin-coated glass microarray slide. Alternative immobi-
lization systems may be employed with the appropriate modifi-
cation(s) to these protocols, e.g., the tobramycin-binding
RNA aptamer and a tobramycin-coated surface [5].
25. The immobilization aptamer should always be incorporated 3′

to the RNA of interest to ensure that only fully-transcribed,
full-length RNAs are captured.
26. Inclusion of a 3′ fluorophore is optional. However, we typically
include a Dy549 fluorophore at the 3′ end of our DNA in vitro
transcription templates to allow visualization and quantifica-
tion of the relative levels of DNA at each position on the
in vitro transcription template array. This can be a useful quality
control checkpoint when generating the DNA in vitro tran-
scription template array, and it can be used subsequently to
calculate RNA transcription/capture efficiencies [6, 10]. Alter-
native fluorophores to Dy549 may be employed (see Note 10).
27. RNA polymerase will begin transcribing from the system-
specific sequence (GGG for T7 RNA polymerase) and continue
to transcribe the RNA of interest, the unstructured linker and
the immobilization aptamer. The immobilization linker and
the promoter will not be transcribed.
28. Both the RNA of interest and the immobilization aptamer
must fold correctly to generate a functional-RNA array. Mis-
folding of the RNA of interest can result in a non-functional
RNA that may be unsuitable for downstream applications and
misfolding of the immobilization aptamer can result in the
failure of in situ RNA capture by the surface even if the RNA
of interest is folded correctly. Therefore, it is critical to check
that linking the RNA of interest to an immobilization aptamer
does not affect the folding of either RNA. Where secondary
structure predictions indicate that correct folding of both
RNAs within the context of the full-length transcript is likely,
we accept the DNA in vitro transcription template design.
However, where RNA secondary structure predictions indicate
that misfolding of the immobilization aptamer and/or the
RNA of interest is likely, we typically repeat the design process
with alternative linker and/or modified immobilization apta-
mer sequences until RNA secondary structure predictions sug-
gest that both are likely to fold correctly. The linker sequences
and modified streptavidin aptamer sequences that we have
successfully utilized are listed in Table 1.
29. DNA in vitro transcription templates can be synthesized using
a variety of standard molecular biology methods, e.g., gene
synthesis, primer extension, or annealing of complementary
oligonucleotides, and the choice of method will depend pri-
marily on the length of the RNA of interest. We typically
perform gene synthesis in-house. We use DNAWorks v3.2.4
(https://hpcwebapps.cit.nih.gov/dnaworks; [14]) to design
gene synthesis primers and follow standard gene synthesis
protocols [15] to first produce a double-stranded
Table 1
Validated alternative unstructured linker RNA-streptavidin-binding RNA aptamer (SAapt) conjugate sequences
Unstructured linker RNA sequence Streptavidin-binding RNA aptamer (SAapt) RNA sequence Reference
ACACACACACACACACACAC GCAUGCAUACCGACCAGAAUCAUGCAAGUGCGUAAGAUA [5, 6, 10]
GUCGCGGGCCGGGAUGCAUGC
UUUUUUUUUUUUUUUUUUUU UGUGUGACCGACCAGAAUCAUGCAAGUGCGUAAGAUAGU [5]
CGCGGGCCGGGCACACA
UUUUUUUUUUUUUUUUUU UAGAGACCGACCAGAAUCAUGCAAGUGCGUAAGAUAGUCG [5]
CGGGCCGGGCUCUA
GUGUGACCGACCAGAAUCAUGCAAGUGCGUAAGAUAGUC [5]
GCGGGCCGGGCACAC
AUGCAUGCACCGACCAGAAUCAUGCAAGUGCGUAAGAUA [5]
GUCGCGGGCCGGGGCAUGCAU
CGAUCGAUACCGACCAGAAUCAUGCAAGUGCGUAAGAUAG [6]
UCGCGGGCCGGGAUCGAUCG
AAUAAUAAUAAUAAUAAUAAU AUGCAUGCACCGACCAGAAUCAUGCAAGUGCGUAAGAUA [5]
GUCGCGGGCCGGGGCAUGCAU
The SAapt RNA sequences consist of a core sequence (regular text) [17] and a variable sequence at the 5′ and 3′ ends (bold and underlined) that extends a duplex and stabilizes the
aptamer [17]
Generation of Functional-RNA Arrays
179
non-biotinylated and non-fluorescently labeled template. We

then amplify this template in a standard PCR reaction with a
5′-biotinylated forward primer and a 5′-Dy549 fluorescently
labeled reverse primer to produce the final 5′-biotinylated,
3′-Dy549 fluorescently labeled DNA in vitro transcription
template [6]. DNA in vitro transcription template preparation
could also be outsourced to commercial gene synthesis ser-
vices, e.g., GeneArt (Thermo Fisher Scientific) or custom oli-
gonucleotide manufacturers, e.g., Integrated DNA
Technologies.
30. Take care not to touch the streptavidin-coated surface when
handling the microarray slides.
31. Spacing of the DNA spots on the DNA in vitro transcription
template array may need to be optimised. As in vitro transcrip-
tion and in situ capture proceeds, there will be some level of
diffusion prior to RNA capture which results in larger spots on
the functional-RNA array compared to the DNA in vitro tran-
scription template array [5]. This is impacted by factors includ-
ing in vitro transcription efficiency and incubation time, and
spacing/volume between the slides. We typically use an auto-
mated Qarray2 arrayer (Genetix) fitted with a 200 μm pinhead
to spot the DNA in vitro transcription template onto a
streptavidin-coated glass microarray slide at a spot separation
of 1250 μm. This allows us to achieve a spot density of ~400
spots per slide. It is also possible to spot the DNA in vitro
transcription template manually using a micropipette. If we
manually pipette 0.2 μL per spot, we can achieve a spot density
of 24 spots per slide.
32. Note that the array layout of the functional-RNA array will be
the mirror-image of the DNA in vitro template array layout.
33. If spotting is performed using an automated arrayer, the
arrayer can provide the humidified environment. If spotting is
performed manually with a micropipette, a humidified envi-
ronment can be created using a mini incubator (9.2 L) and a
Petri dish containing 25 mL H2O.
34. If the DNA in vitro transcription templates are fluorescently
labeled (see Note 26), they should be kept in the dark as much
as possible during spotting. The Qarray2 automated arrayer
has a tinted cover or, when manually spotting, we cover the
window panel in the mini incubator with foil during the
incubation step.
35. Take care not to touch the DNA in vitro transcription template
array surface when handling the microarray slides.
36. We place the slide in a 50 mL Falcon tube and use a swing
bucket centrifuge.
37. We visualize our array of 3′-Dy549 labeled DNA in vitro tran-

scription templates using an excitation wavelength of 532 nm
and a Standard Green (579/34 nm) emission filter with a
GenePix 4300A microarray scanner (Molecular Devices) (see
Note 9).
38. We typically store the DNA in vitro transcription template array
at -20 °C overnight although it can be stored at -20 °C for at
least 7 days. The DNA in vitro transcription template array
should be equilibrated at room temperature for 30 min prior
to use.
39. It is important to assemble the DNA in vitro transcription
template array—in vitro transcription reagent mix—RNA cap-
ture surface “sandwich” with the RNA capture surface as the
lower layer so that the in vitro transcription reagent mix is
pipetted onto this surface. This ensures that transcription is
not initiated until the DNA in vitro transcription template
array is added to complete the “sandwich” assembly. This in
turn helps to confine the in vitro transcription and in situ RNA
capture to a discrete volume (see Note 31).
40. The use of parafilm as spacers helps with the separation of the
DNA in vitro transcription template array and the functional-
RNA array following in vitro transcription and in situ RNA
capture. However, using spacers also increases the distance that
the RNA must diffuse between synthesis and capture and can
result in larger RNA spots (see Note 31). If a high spot density
is required, it may be beneficial to omit the spacers and reduce
the volume of in vitro transcription mix that is used.
41. We have used in vitro transcription mix volumes between
12 and 150 μL. 90 μL allows for good coverage of the array
and for the use of spacers (see Note 40) to assist slide separation
following in vitro transcription and in situ RNA capture.
42. We typically incubate at 37 °C for between 30 and 90 min in a
mini-incubator (9.2 L) that has been humidified using a Petri
dish containing 25 mL H2O. For most applications, this is
sufficient for in vitro transcription and in situ RNA capture.
Longer incubation times may result in larger spots (see Note
31).
43. The increased surface tension of the in vitro transcription mix,
as the DNA in vitro transcription template array and the
functional-RNA array are pulled apart, can make it difficult to
separate the arrays, especially if parafilm spacers have not been
used (see Note 40). It can be helpful to submerge the “sand-
wich” assembly in PBS when separating the arrays.
44. Take care not to touch the functional-RNA array surface when
handling the microarray slides.
45. In theory, the DNA in vitro transcription template array slide

could be washed and reused. We do not currently reuse the
DNA in vitro transcription template array.
46. Probing the functional-RNA array with linker probe provides a
quality control checkpoint when generating the functional-
RNA array and it can be used to calculate RNA transcrip-
tion/capture efficiencies [6, 10].
47. Since the linker probe is fluorescently labeled, the incubation
should be performed in the dark. We cover the assembly
with foil.
48. We visualize Dy649 labeled linker probe bound to our
functional-RNA array using an excitation wavelength of
635 nm and a Standard Red (676/29 nm) emission filter
with a GenePix 4300A microarray scanner (Molecular Devices)
(see Note 9).
49. The functional-RNA array will be an array of functional-RNAs
that will be probed with a single RNA binding partner probe
(see Notes 16 and 50). The functional-RNA array should
include a positive control RNA that the RNA binding partner
probe is known to bind, a negative control RNA that the RNA
binding partner probe is known not to bind, and test RNAs (see
Note 51) that may or may not be bound by the RNA binding
partner probe (Fig. 7). We typically design a single field of
between 9 and 16 spots. This field may contain a single RNA
at different concentrations, with each field containing a differ-
ent RNA, or multiple RNAs at the same concentration. It is
good practice to include replicate spots of each RNA and/or
replicate fields.
50. It is possible to simultaneously probe with more than one RNA
binding partner probe provided that each RNA binding part-
ner probe can be labeled with an orthogonal fluorophore [5].
51. The test RNAs may be potential binding targets of the RNA
binding partner probe (e.g., in the case of an sRNA that has
multiple mRNA targets) or they may be a series of binding-site
mutants designed to evaluate the key residues required for a
specific RNA-RNA interaction.
52. The probing conditions needed for the RNA binding partner
probe may be highly system-specific. For example, it may be
necessary to test different hybridization buffers (see Note 17),
different RNA binding partner probe concentrations (see Note
18), different incubation temperatures and/or times.
53. Different conditions and/or different RNA binding partner
probes can be tested on the same array by using 20 μL RNA
binding partner probe (see Notes 16–18 and 52) and
22 × 22 mm LifterSlips to cover a smaller area of the array.
Up to three conditions can be tested per array in this manner.
54. Since the RNA binding partner probe is fluorescently labeled,

the incubation should be performed in the dark. We cover the
assembly with foil.
55. We visualize Cy3 labeled RNA binding partner probe bound to
our functional-RNA array using an excitation wavelength of
532 nm and a Standard Green (578/34 nm) emission filter
with a GenePix 4300A microarray scanner (Molecular Devices)
(see Note 9).
56. Depending on the affinity of the RNA-RNA interaction and
the non-specific binding observed, fewer or more wash steps
may be desirable.
Acknowledgements
We thank members of A.J.C.’s research group (University of Ports-

mouth, UK) between 2014 and 2021 for helpful discussions and
technical support. We thank Dr. TJ Ragan (University of Leicester,
UK) for helpful discussions and critical reading of the chapter. This
work was supported by funding from the Biotechnology and
Biological Sciences Research Council (BB/I532988/1 to
A.J.C. and BB/L017628/1 to A.J.C.) and a University of Ports-
mouth bursary (to D.L.C.). Funding for the open access charge
was from the Biotechnology and Biological Sciences Research
Council.
Conflict of Interest Statement A.J.C. is a named inventor on

patents that relate to aspects of the work reported here. University
of Portsmouth has been granted the following patents:
US9777268B2 (US patent) and EP2732047B1 (European pat-
ent). C.A.H., D.L.C. and H.A.V. have no conflicts of interest to
declare.
References
1. Cech TR, Steitz JA (2014) The noncoding the fabrication of RNA microarrays. Comput
RNA revolution – trashing old rules to forge Struct Biotechnol J 17:862–868
new ones. Cell 157:77–94 5. Phillips JO, Butt LE, Henderson CA,
2. Marz M, Stadler PF (2011) RNA Devonshire M, Healy J, Conway SJ,
interactions. In: Collins LJ (ed) RNA Infra- Locker N, Pickford AR, Vincent HA, Calla-
structure and Networks, Advances in Experi- ghan AJ (2018) High-density functional-RNA
mental Medicine and Biology, vol 722. arrays as a versatile platform for studying
Springer, New York RNA-based interactions. Nucleic Acids Res
3. Li PCH, Sedighi A, Wang L (eds) (2016) 46:e86
Microarray technology, Methods in Molecular 6. Henderson CA, Rail CA, Butt LE, Vincent
Biology, vol 1368. Humana Press, New York HA, Callaghan AJ (2019) Generation of small
4. Lietard J, Somoza MM (2019) Spotting, tran- molecule-binding RNA arrays and their
scription and in situ synthesis: three routes for
application to fluorogen-binding RNA apta- 12. Lorenz R, Bernhart SH, Höner zu

mers. Methods 167:39–53 Siederdissen C, Tafer H, Flamm C, Stadler
7. Buenrostro JD, Araya CL, Chircus LM, Layton PF, Hofacker IL (2011) ViennaRNA package
CJ, Chang HY, Snyder MP, Greenleaf WJ 2.0. Algorithms Mol Biol 6:26
(2014) Quantitative analysis of RNA-protein 13. Imburgio D, Rong M, Ma K, McAllister WT
interactions on a massively parallel array reveals (2000) Studies of promoter recognition and
biophysical and evolutionary landscapes. Nat start site selection by T7 RNA polymerase
Biotechnol 32:562–568 using a comprehensive collection of promoter
8. She R, Chakravarty AK, Layton CJ, Chircus variants. Biochemistry 39:10419–10430
LM, Andreasson JO, Damaraju N, McMahon 14. Hoover DM, Lubkowski J (2002) DNAWorks:
PL, Buenrostro JD, Jarosz DF, Greenleaf WJ an automated method for designing oligonu-
(2017) Comprehensive and quantitative cleotides for PCR-based gene synthesis.
mapping of RNA-protein interactions across a Nucleic Acids Res 30:e43
transcribed eukaryotic genome. Proc Natl Acad 15. Gao X, Yo P, Keith A, Ragan TJ, Harris TK
Sci U S A 114:3619–3624 (2003) Thermodynamically balanced inside-
9. Tome JM, Ozer A, Pagano JM, Gheba D, out (TBIO) PCR-based gene synthesis: a
Schroth GP, Lis JT (2014) Comprehensive novel method of primer design for high-fidelity
analysis of RNA-protein interactions by high- assembly of longer gene sequences. Nucleic
throughput sequencing-RNA affinity profiling. Acids Res 31:e143
Nat Methods 11:683–688 16. Kerpedjiev P, Hammer S, Hofacker IL (2015)
10. Norouzi M, Pickford AR, Butt LE, Vincent Forna (force-directed RNA): simple and effec-
HA, Callaghan AJ (2019) Application of tive online RNA secondary structure diagrams.
mRNA arrays for the production of mCherry Bioinformatics 31:3377–3379
reporter-protein arrays for quantitative gene 17. Leppek K, Stoecklin G (2014) An optimized
expression analysis. ACS Synth Biol 8:207–215 streptavidin-binding RNA aptamer for purifi-
11. Wu H-C, Holden MT, Smith LM (2014) cation of ribonucleoprotein complexes identi-
Enzymatic fabrication of high-density RNA fies novel ARE-binding proteins. Nucleic Acids
arrays. Angew Chem Int Ed 53:13514–13517 Res 42:e13
Chapter 14
Chemical Synthesis of Oligonucelotide Sequences:

Phosphoramidite Chemistry
John Brazier
Abstract
Oligonucleotides are used in a variety of molecular biology techniques, from next-generation sequencing to
genetic testing. Maintaining the sequence fidelity of synthetic oligonucleotides is critical to their use. This
chapter describes the steps of solid phase oligonucleotide synthesis and purification, which enables the
synthesis of oligonucleotides with specific sequences and high purity.
Key words Solid-phase synthesis, Oligonucleotide synthesis, Oligonucleotide purification,

Phosphoramidite
1 Introduction
Solid phase phosphoramidite chemistry has been used to synthesize

oligonucleotides for decades. The chemistry behind solid phase
phosphoramidite oligonucleotide synthesis was developed in the
1970s and 1980s and has reached a level where it is robust and
efficient and routinely used in commercial settings to produce large
quantities of synthetic DNA and RNA. Phosphoramidite oligonu-
cleotide synthesis is used to produce oligonucleotides from 5 to
150 bases, including both DNA and RNA, with the opportunity to
include a large variety of modifications.
Solid phase oligonucleotide synthesis uses a robust synthesis
cycle to build up an oligonucleotide one base at a time, providing
complete control over the oligonucleotide sequence (Fig. 1). Syn-
thesis starts with deprotection of the 5′-hydroxyl group of the
nucleoside attached to the solid support. This is followed by the
coupling step, addition of the phosphoramidite of the next nucleo-
side in the sequence along with an activator, which is used to
increase the reactivity of the phosphoramidite. Next comes the
important capping step, which acetylates any remaining 5′-
-hydroxyl groups that have not reacted in the coupling step,
https://doi.org/10.1007/978-1-0716-3004-4_14,
185
186 John Brazier
Fig. 1 The phosphoramidite synthesis cycle
thereby maintaining control of the oligonucleotide sequence.

Finally, the phosphate is oxidized, ready to form the phosphodie-
ster bond once the final oligonucleotide is complete and fully
deprotected. At this point, the cycle starts again with deprotection
of the growing oligonucleotide chain, followed by coupling with
the next phosphoramidite in the sequence.
2 Materials
2.1 Standard 1. Diluent: Anhydrous Acetonitrile.

Synthesis (See Note 1) 2. ETT activator (see Note 2): 0.5 M 5-Ethylthio-1H-tetrazole in
anhydrous acetonitrile.
3. Oxidizer: 0.02 M Iodine in 0.4% v/v Pyridine/
tetrahydrofuran.
4. Deblock mix: 3% Trichloroacetic acid in dichloromethane.
5. Cap mix A: 10% Acetic anhydride in tetrahydrofuran.
6. Cap Mix B: 10% Methylimidazole in THF.
7. Anhydrous wash: Anhydrous acetonitrile.
Phosphoramidite Chemistry 187
8. Unmodified DNA phosphoroamidite solutions: 0.1 M solu-

tion in anhydrous acetonitrile (diluent) (see Note 3).
(a) Dissolve 0.5 g of 5′-(4,4′-Dimethoxytrityl)-N-acetyl-2′-
-deoxycytidine, 3′-[2-cyanoethyl)- N,N-(diisopropyl)]-
phosphoramidite (Ac-dC) in 6.48 mL of diluent or dis-
solve 0.5 g of 5′-(4,4′-Dimethoxytrityl)-N-benzoyl-2′-
-deoxycytidine, 3′-[(2- cyanoethyl)-(N,N-diisopropyl)]-
phosphoramidite (Bz-dC) in 6 mL of diluent.
(b) Dissolve 0.5 g of 5′-(4,4′-Dimethoxytrityl)-N-isobutyryl-
2′-deoxyguanosine, 3′- [(2-cyanoethyl)-N,N-diisopro-
pyl]-phosphoramidite (iBu-dG) in 5.95 mL of diluent or
dissolve 0.5 g of 5′-(4,4′-Dimethoxytrityl)-N-dimethyl-
formamidine-2′-deoxyguanosine (dmf-dG) in 6.06 mL of
diluent.
(c) Dissolve 0.5 g of 3′- [(2-cyanoethyl)-N,N-diisopropyl]-
phosphoramidite, 5′-(4,4′-Dimethoxytrityl)-N-benzoyl-
2′-deoxyadenosine, 3′-[(2- cyanoethyl)-(N,N-diisopro-
pyl)]-phosphoramidite (Bz-dA) in 5.83 mL of diluent.
(d) Dissolve 0.5 g of 5′-(4,4′-Dimethoxytrityl)-thymidine,
3′-[(2-cyanoethyl)-N,N-diisopropyl]- phosphoramidite
(dT) in 6.71 mL of diluent.
9. Solid phase oligonucleotide columns (see Note 4).
10. Cleavage and deprotection: Concentrated ammonium hydrox-
ide (28–33% in water).
2.2 Oligonucleotide 1. C8 or C18 reverse phase HPLC column suitable for oligonu-
Purification Using cleotide purification and compatible with your HPLC
Reverse-Phase HPLC instrument—For a 1 μmole scale synthesis a 250 × 4.60 mm
(RP-HPLC) column would be an appropriate size.
2. Buffer A: 0.1 M aqueous triethyl ammonium acetate pH 6.5.
Add 14 mL of triethylamine (HPLC grade) to 900 mL of water
(HPLC grade). Adjust to pH 6.5 by addition of acetic acid
(HPLC grade) and make up total volume to 1 L with water
(HPLC grade).
3. Buffer B: 0.1 M triethylammonium acetate in 65% (v/v) Ace-
tonitrile/ water at pH 6.5. Add 14 mL of triethylamine (HPLC
grade) to 300 mL of water (HPLC grade) and 650 mL of
acetonitrile (HPLC grade). Adjust to pH 6.5 by addition of
acetic acid (HPLC grade) and make up total volume to 1 L with
water (HPLC grade) (see Note 5).
4. 5′-DMT deprotection: 20% v/v acetic acid in water.
188 John Brazier
2.3 Final Desalting of 1. C8 or C18 reverse phase HPLC column suitable for oligonu-
the Oligonucleotide cleotide purification and compatible with your HPLC
Solution Using RP- instrument—for a 1 μmole scale synthesis a 250 × 4.60 mm
HPLC column would be an appropriate size.
2. 1 M aqueous triethyl ammonium bicarbonate at pH 7.8. Add
140 mL of triethylamine (HPLC grade) to 860 mL of water
(HPLC grade). Using a sintered filter, bubble CO2 gas (usually
produced from sublimation of solid CO2) through the aqueous
triethyl ammonium hydroxide solution until the solution
reaches pH 7.8.
3. Buffer C: 0.1 M aqueous triethyl ammonium bicarbonate. Add
100 mL of 1 M aqueous triethyl ammonium bicarbonate,
pH 7.8 to 900 mL of water (HPLC grade).
4. Buffer D: 0.1 M triethyl ammonium bicarbonate 65:35 v/v
acetonitrile/ water. Add 100 mL of 1 M aqueous triethyl
ammonium bicarbonate, pH 7.8 to 250 mL of water (HPLC
grade), and 650 mL of acetonitrile (HPLC grade).
3 Methods
3.1 Automated 1. Install each of the synthesis reagents onto the instrument:
Oligonucleotide activator, oxidizer, de-block, capping mix, and anhydrous
Synthesis wash (see Note 6).
2. Install each of the nucleotide phosphoramidite solutions (see
Note 6).
3. Prime the instrument with each reagent (see Note 7).
4. Select the synthesis cycle and the synthesis scale on your
instrument.
5. Input your desired sequence into the instrument (see Note 8).
6. Choose whether to remove the 5′-DMT group from your final
oligonucleotide (see Note 9).
7. Install the correct solid phase synthesis column (see Note 10).
8. If your instrument allows, check that the reagent quantities are
sufficient for the sequence, scale, and synthesis cycle that you
have chosen.
9. Start the synthesis.
10. Once the synthesis is complete, and if present on your instru-
ment, you should check the trityl monitor to make sure that
each coupling step was successful (see Note 11).
3.1.1 Cleavage and Some oligonucleotide synthesis instruments will automatically

Deprotection cleave the oligonucleotide from the solid support using concen-
trated ammonium hydroxide. It is also possible to perform this
action manually using two syringes.
Cleavage from the solid support:
1. In a suitably sized syringe, draw up enough concentrated
ammonium hydroxide solution (see Note 12) to fill the synthe-
sis column you have used (see Note 13).
2. Attach the syringe containing the ammonium hydroxide solu-
tion to the bottom of the synthesis column.
3. Attach an empty syringe to the top of the synthesis column
(Fig. 2a).
4. Push the bottom syringe, containing the ammonium hydrox-
ide solution, to fill the synthesis column with ammonium
hydroxide. This can be achieved by ensuring that a small vol-
ume of the ammonium hydroxide solution appears in the top
syringe (see Note 14 and Fig. 2b).
5. Leave the ammonium hydroxide solution in the synthesis col-
umn for 15 min.
6. Push the remaining ammonium hydroxide solution through
the synthesis column until it is all in the top syringe (Fig. 2c).
7. Invert the synthesis column and syringes so that the top syringe
is now at the bottom (Fig. 2d).
Fig. 2 Manual cleavage of the oligonucleotide from solid support using an

ammonium hydroxide solution
190 John Brazier
8. Once again, Push the ammonium hydroxide solution bock into

the synthesis column from the bottom syringe and leave for
15 min.
9. Repeat the process a further two times so that the ammonium
hydroxide has been in the synthesis column for a total of 1 h.
10. After 1 h, push all the ammonium hydroxide solution into the
top syringe.
11. Finally, invert the synthesis column and ensure all the ammo-
nium hydroxide solution is now in the bottom syringe (see
Note 15).
12. Empty the ammonium hydroxide solution into a suitably sized
vial and securely seal the vial.
13. Clearly mark the vial with the level of the solution so this can be
checked after heating to ensure no evaporation has occurred.
14. For standard protecting groups (see Note 16), heat the ammo-
nium hydroxide solution, obtained from the deprotection step,
to 55 °C and keep at this temperature for 5–6 h.
15. Allow the vial to cool to room temperature.
16. Using the mark you made beforehand, check the level of
ammonia solution has not changed during the heating process
(see Note 17).
17. Once the bases are deprotected, the oligonucleotide is ready
for purification.
18. If purification is by RP-HPLC, as outlined below, the oligonu-
cleotide will need to be dried by gentle evaporation of the
ammonium hydroxide solution and resuspended in water.
3.2 Oligonucleotide 1. Install the HPLC column, buffer A: 0.1 M aqueous triethyl
Purification Using ammonium acetate pH 6.5, and buffer B: 0.1 M triethylam-
Reverse Phase-HPLC monium acetate in 65% (v/v) Acetonitrile/ water at pH 6.5,
(RP-HPLC) (See using the instructions supplied with your HPLC instrument
Note 18) (see Note 19).
2. Run an analytical trace of your oligonucleotide using a gradient
of 0–100% buffer B over 25 min (see Note 20), using UV
detection at 260 nm.
3. Use your analytical trace to determine the elution time of your
oligonucleotide (see Notes 21 and 22).
4. Run several purification traces of your oligonucleotide using a
gradient of 0–100% buffer B over 25 min (see Notes 22 and
23), collecting the solution that is eluted at the elution time of
your oligonucleotide.
5. Combine the eluted solution you have collected into one sam-
ple and dry your oligonucleotide by gentle evaporation of the
buffer until approximately 50 μL remain.
6. Add approximately 1 mL of 20% acetic acid in water to your

purified oligonucleotide solution.
7. After 1 h gently evaporate the solution to dryness and resus-
pend in 1 mL of water.
3.3 Final Desalting of 1. Install the HPLC column, buffer C: 0.1 M aqueous triethyl
the Oligonucleotide ammonium bicarbonate, and buffer D: 0.1 M triethyl ammo-
Solution Using RP- nium bicarbonate 65:35 v/v acetonitrile/ water, using the
HPLC instructions supplied with your HPLC instrument (see
Note 19).
2. Run an analytical trace of your oligonucleotide using a gradient
of 0–100% buffer D over 30 min (see Note 25), using UV
detection at 260 nm.
3. Use your analytical trace to determine the elution time of your
oligonucleotide.
4. Run several purification traces of your oligonucleotide using a
gradient of 0–100% buffer D over 30 min (see Note 23),
collecting the solution that is eluted at the elution time of
your oligonucleotide.
5. Combine the eluted solution you have collected into one sam-
ple and dry your oligonucleotide by gentle evaporation of the
buffer.
6. Resuspend your dried oligonucleotide in 500 mL of water and
evaporate to dryness again. Repeat this process twice more.
7. Your dried oligonucleotide is now purified and ready for use in
any subsequent experiments.
4 Notes
1. Suppliers will often be able to provide reagents in bottles for

use with specific oligonucleotide synthesis instruments; make
sure you purchase the correct bottles for your instrument. If
the supplier does not offer regents in bottle compatible with
your instrument, ensure that you have a set of reagent bottles
that you can transfer the reagents into before use.
2. Historically 1H-tetrazole was used as the activator; however,
ETT is preferred for high-throughput oligonucleotide
synthesis.
3. Make sure that you prepare enough phosphoramidite solution
to synthesize the oligonucleotides you plan to make and to
prime the synthesizer instrument you are using.
4. Solid-phase synthesis column are available for specific auto-
mated synthesis instruments. They come in a variety of pore
sizes and nucleoside loading; which one you need will be
192 John Brazier
dependent on the sequence of your oligonucleotide (synthesis

progresses from the 3′ to 5′ direction), the length of the
oligonucleotide you are synthesizing, and the synthesis scale.
Please consult your supplier for the best option for your
planned synthesis.
5. Check the total volume of HPLC buffer you will require, and
adjust the volumes specified to match your needs.
6. Check the operating instruction of your oligonucleotide syn-
thesizer for details of the procedure for installing synthesis
reagents. If present on your instrument, set the reagent quan-
tity levels.
7. Check the operating instruction of your oligonucleotide syn-
thesizer for details of the procedure to prime the instrument.
8. As synthesis proceeds in the 3′–5′ direction, you will get a
better yield if any modifications (that have a lower coupling
efficiency than standard phosphoroamidites) are positioned at
the 5′ end of the sequence.
9. Whether you decide to retain the 5′-DMT group will depend
on your purification strategy. Purification by reverse-phase
HPLC will benefit from oligonucleotide synthesis with the
5′-DMT group intact.
10. Remember that synthesis proceeds from the 3′ to 5′ direction;
therefore, make sure that you use a synthesis column that
contains the base you require at the 3′ end of your final oligo-
nucleotide sequence.
11. The trityl monitor records the intensity of the DMT group
when it is removed in the deprotection step. This will show the
efficiency of the previous coupling step and provides an indica-
tion that the synthesis is proceeding correctly.
12. Make sure you use a fresh solution of concentrated ammonium
hydroxide to ensure complete cleavage and deprotection of the
oligonucleotide.
13. For a 1 μmol scale synthesis column, this will be approximately
1.5 mL.
14. It might help to push the bottom syringe plunger in while
pulling the top syringe plunger out. Just be careful not the
remove the syringes from the synthesis column.
15. After inverting the synthesis column, you can remove the top
syringe, draw in a little air, reattach the syringe to the synthesis
column, and use the air to push the remaining ammonium
hydroxide solution out of the column. Be careful to not use
too much pressure which might force the bottom syringe out
of the synthesis column.
16. Other protecting groups are available and require different

deprotection conditions; if you are using these, follow the
instructions provided by the supplier.
17. If the level has changed, this could indicate that the vial was not
fully sealed. In this case, you would need to transfer the ammo-
nium hydroxide solution to a new vial and completely dry the
sample. Once dried, resuspend in ammonium hydroxide and
follow from step 14 of the deprotection method again.
18. There are several methods of oligonucleotide purification,
including purification cartridges, and ion-exchange HPLC.
Purification cartridges use similar principles to RP-HPLC and
can be a good choice if available to you. Purification columns
come with detailed protocols for their use; therefore, this will
not be covered here.
19. For a 250 × 4.60 mm HPLC column, the flow rate of the
buffers should be set to 1 mL/ min.
20. It is good practice to allow the HPLC column to run with
100% buffer B for 5–10 min at the end of your gradient run to
clean any impurities from the column.
21. If you have retained the 5′-DMT protecting group, your oli-
gonucleotide should be the last peak to elute.
22. If this gradient does not give you clear separation of your target
sequence over failed oligonucleotide sequences, you will need
to adjust the gradient you use for purification. This could be by
modifying the length of the gradient or introducing plateaus
into your gradient.
23. If you inject your entire sample at once, you run the risk of
overloading the column’s ability to successfully separate your
target oligonucleotide and you will overload the UV detector.
Using several smaller injections will ensure that the separation
is optimal, and you reduce the risk of losing your entire sample
if anything goes wrong. You are still likely to overload the UV
detector, but not to the same extent as injecting your entire
sample.
24. All volumes described here are suitable for a 1 μmole scale
synthesis. If you have performed your synthesis at a larger
scale, you will need to adjust the volumes used accordingly.
25. It is good practice to allow the HPLC column to run with
100% buffer D for 5–10 min at the end of your gradient run to
clean any impurities from the column.
Chapter 15
Low Throughput Direct Cycle Sequencing of Polymerase

Chain Reaction (PCR) Products
George D. Zouganelis and Nikolaos Tairis
Abstract
Polymerase Chain Reaction (PCR) products have been traditionally characterized by cloning and cycle
sequencing. However, when quick sequencing data are required, the cloning step may be omitted and PCR
products can be sequenced directly. We describe here a sequencing protocol that involves the gold standard
Big Dye chemistry in a low throughput format using one of the latest sequencing platforms the ABI
Seqstudio. Our cycle sequencing protocol follows the following steps: (1) purification of the PCR product
with a spin column-based kit; (2) quality & quantity assessment of the PCR product with the use of
spectrophotometry & gel electrophoresis; (3) setup and amplification of the cycle sequencing reaction;
(4) Capillary Electrophoresis; (5) Sequence Data Analysis.
Key words PCR, Sanger sequencing
1 Introduction
The invention of polymerase chain reaction (PCR) in the early 80s

revolutionized our ability to characterize, analyze, and manipulate
nucleic acid sequences [1]. Although detection and characteriza-
tion were sufficiently done with the employment of restriction
enzymes and radioactive hybridization probes for some applications
of amplicon characterization, the employment of Sanger based
technologies for nucleotide sequencing has been essential for con-
firming the specificity and characteristics of the amplicons; the
identification of genetic variants and uncharacterized genes and
mapping those genes within organism genomes [2]. Traditionally
PCR products are cloned prior to sequencing, due to the fact that
recombinant molecules may be used for processes such as site
directed mutagenesis and protein expression. However, direct
sequencing techniques have been very useful in cases where a
nucleotide variant is to be identified or as screening before the
time-consuming process of recombinant cloning.
https://doi.org/10.1007/978-1-0716-3004-4_15,
195
196 George D. Zouganelis and Nikolaos Tairis
DNA Sequencing is based on the fact that a single strand of

DNA can be replicated by an enzyme known as DNA polymerase
using a specifically annealed oligonucleotide at an initial point and
nucleotides as building blocks for the complementary strand. The
building blocks are added based on complementarity and are joined
in a 5′—> 3′ fashion that forms phosphodiester bonds. These
principles were used by Sanger in a process known as a Sanger
Dideoxy-sequencing [3]. In this process nucleotide analogs are
added that obey the complementarity rules but have the deoxyri-
bose 3′ OH removed, thus not allowing the addition of another
nucleotide and serving as DNA polymerase terminators. The San-
ger sequencing process involves terminators that are labeled with
radioactivity. A set of four sequencing reactions are setup and the
products are separated via slab gel electrophoresis, resulting into
separated fragments at a resolution of one base, and the results are
detected on a radiographic plate. DNA sequencing has evolved by
replacing radioactivity with fluorescent terminators that are
incorporated in a single reaction that undergoes steps of denatur-
ation, annealing, and extension, creating products that are termi-
nated by one of the four nucleotides (Fig. 1) [4].
Every terminator is labeled with a particular fluorescent dye
with distinct excitation and emission properties. The characteriza-
tion of the resulting fragments is automated, and it involves separa-
tion of the extension reaction in an electrophoretic matrix, which is
housed within a special capillary. The capillary contains a tiny
window that allows the exposure of the fluorescent extension pro-
ducts to laser excitation while the emission signals are recorded by
an autodetector and are translated to peaks with the use of appro-
priate software (Figs. 2 and 3).
The cycle sequencing technology via capillary electrophoresis is
predominantly available from Applied Biosystems (Thermo Fisher
Scientific). There are five systems currently available by the com-
pany as summarized in Table 1. This protocol focuses on the use of
Fig. 1 Fluorescent cycle sequencing overview

Sanger Sequencing 197
Fig. 2 Sanger sequencing vs. cycle sequencing
Fig. 3 Capillary electrophoresis principle of operation
the latest instrument in capillary electrophoresis technology, the

Seqstudio™ by Thermo Scientific [6]. It is a low throughput
benchtop instrument featuring an all-in-one removable cartridge
that contains the capillary array, polymer reservoir, and the anode
buffer. This feature is very advantageous for a small to mid-size
University laboratory as it helps avoiding the situation of capillary
deterioration as a result of occasional usage. Finally, an important
feature of Seqstudio™ is the flexibility of operation as can be
operated though a PC and can be monitored remotely through
cloud-based applications. Here, we present a protocol the Seqstu-
dio™ is treated as a stand-alone instrument, and it is a part of a
multistep process such as the sequencing of PCR products.
Table 1
Capillary electrophoresis systems (Life Technologies) [5]
Seqstudio genetic 3500 series genetic analyzers 3730 genetic analyzer

analyser (3500, 3500 xL) (3730, 3730 xl)
Number of capillaries 4 8, 24 48,96
Maximum number of 6 6 5
dyes
Capillary cartridge Yes No No
Polymer type POP-1 POP-6, POP-7, POP-4* POP-6, POP-7
Minimum run time 30 min 30 min 20 min
Maximum sequencing 800b 850b 900b
read length
Sample capacity 12 × 8-strip 2 × sample plates 16 × sample plates 96 or
1 × 96-well plate 96 or 384 – well 384 well
2 Materials
Ensure that the work takes place in a dedicated laboratory and that
PPE is worn at all times in order to avoid contamination. Use
deionized water for buffer dilution and PCR grade molecular biol-
ogy water (12 Ω) for cycling reactions. When planning your work,
primers should be ordered first as they may take longer time to
arrive as they are customary synthesized.
2.1 Equipment 1. Microcentrifuge (see Note 1).

2. Horizontal Gel electrophoresis Tank and Powerpack (see
Note 2).
3. Gel Documentation (see Note 3).
4. Thermal Cycler (see Note 4).
5. Nanodrop™ 2000.
6. Seqstudio™ (Applied Biosystems).
7. Seqstudio™ Cartridge v2 (Applied Biosystems).
8. Seqstudio™ Cathode Buffer (Applied Biosystems).
9. Intergrated Capillary protector (Applied Biosystems).
10. Reservoir Septa (Applied Biosystems).
11. PC for data storage and analysis (see Note 5).
12. Vacuum Centrifuge.
13. PCR hood.
2.2 Kits, Reagents, 1. Qiaquick PCR Purification Kit (Qiagen).

and Consumables 2. Big Dye™ Terminator v3.1 Cycle Sequencing kit (Applied
Biosystems).
3. DyeEx 2.0 Spin kit (Qiagen).
4. Sequencing primers (as described in the methods section).
5. MicroAmp™ Reaction Tubes or MicroAmp™ 96-well plates.
6. Agarose Low EEO.
7. 10 X TBE Buffer.
8. DNA Ladder (see Note 6).
9. Gel Electrophoresis Loading Dye (see Note 7).
10. Gel Staining agent (see Note 8).
11. Hi-Fi™ Formamide (Applied Biosystems).
3 Methods
Order all materials in advance and store them according to manu-

facturer’s instructions. DNA Cycle Sequencing should take place in
a dedicated area to avoid carry over contamination, and procedures
should be conducted in room temperature. Wear PPE to avoid
contamination and to minimize degradation due to nuclease
exposure.
3.1 PCR Product Prior to cycle sequencing, PCR products are purified from the PCR
Purification and Master mix and primer dimers with the use of Qiaquick PCR
Clean up Purification Kit (Qiagen) [7]. In case that PCR results in nonspe-
cific products, a special protocol that involves gel excision is
required.
3.2 Specific PCR 1. To 1 volume of each PCR sample, add 5 volumes of PB buffer
Product and mix well.
2. Apply the mixture to each spin column which is placed in a
collection tube.
3. Spin the columns in a microcentrifuge at 13000 rpm at room
temperature for 30–60 s.
4. Discard the flow through. Place the spin column in the collec-
tion tube and add 750 μL of PE Buffer to the spin column (see
Note 9).
5. Spin at 13000 rpm for 30–60 s. Discard flowthrough, place
back to collection tube, and repeat spin to dry the spin column.
6. Remove spin column and add it to a 1.5 mL microcentrifuge
tube. Add 30–50 μL EB buffer or water.
7. Spin at 13000 rpm for 30–60 s to elute DNA.
3.3 Excision Gel 1. Excise the gel band with a new scalpel and place in a micro-
Protocol centrifuge tube. Minimize the amount gel at a maximum of
400 mg.
2. Add 300 μL of buffer QG per 100 mg of gel for 1% agarose.
For >2% agarose gels, add 600 μL QG per 100 mg of gel.
3. Incubate the microcentrifuge tube with the QC buffer and the
gel slice at 50 °C for 10 min with periodical vortexing until
melting.
4. Add 100 μL of isopropanol per 100 mg of gel slice if the
fragment in question is ≤500 bp and 4Kb > (see Note 10).
5. Mix the resulting liquid well and place it to the spin column,
centrifuge for 1 min at 13000 rpm and discard the flow-
through. If the liquid is more than 700 μL repeat step until
all liquid flows through.
6. Follow steps 4–7 as described in Subheading 2.1.
3.4 PCR Product Purified PCR products can be readily tested for concentration using
Quality and Quantity the Nanodrop™ 2000 instrument (Thermo Fisher) [8], which is an
Assessment accurate and versatile instrument that requires minimum amount of
sample (1–2 μL) and lower detection limit of 2 ng/μL. Template
3.4.1 Measurement of concentration is critical for the downstream sequencing reactions.
Concentration with
Nanodrop™ 2000 1. Double click on the desktop NanoDrop™ 2000 software icon
and select the “Nucleic Acids” icon.
2. Select “Add to report” so the measurements will be saved in
the report.
3. Use appropriate buffer to establish a blank. An appropriate
blank would be the solution that the PCR product is eluted
or dissolved in.
4. Pipette 1–2 μL of the blank solution onto the bottom pedestal,
lower the arm, and click the “Blank” button. Ensure that the
arm is always down for all measurements.
5. Clean the bottom pedestal with a Kimwipe, enter the sample
ID, and then click the “Measure” button.
3.4.2 Agarose Gel Prior to downstream sequencing applications, the PCR products
Electrophoresis should be checked with agarose gel electrophoresis to ensure:
(a) the integrity of the template and (b) the absence of primer
dimers that may interfere with downstream sequencing reactions.
For gel electrophoresis, the materials used are listed in Subheading
2.1, and an established methodology is followed [9].
3.5 Cycle In cases where the amplification product is less than 800 bp, one
Sequencing direction sequencing reaction may be sufficient to obtain the nec-
essary data. However, to obtain maximum data, two reactions in
3.5.1 Considerations for
forward and reverse fashions are advised. Forward and reverse
Sequencing Primer
sequencing is invaluable not only for improved coverage but also
Selection and Design
as a means of cross-referencing and validating sequencing results.
Very often the primers used in either direction could be the original
primers used for fragment amplification. Nevertheless, in cases
where resequencing is required or the fragments are too large (>
1500), nested primers must be employed in order to maximize
coverage. The criteria for primer selection and design are as follows
[10, 11]:
1. Primers should be 20–30 bp in length.
2. Close to 50% GC content.
3. The primers should include a C or G at the 3′ of their sequence.
4. Thymidine at 3′ and 5′ and four or more repeated bases should
be avoided.
5. Primers should not ideally form secondary structures or
hybridize with each other forming hairpins and loops. This
issue can be checked with the use of appropriate applications
available from primer synthesis vendors.
6. Melting temperature range is 55–65 °C.
7. Primers should be checked for specificity to the target with the
use of nBlast program and or annealing with the use of an
alignment program such as MEGA7.
8. As cycle sequencing reaction is often unreadable for the first
30–40 bp, the primer should be designed upstream of the area
of interest.
Finally, there is the option of including tag sequences to the
amplification primers. These tag sequences have to complements
corresponding to universal primer sequences listed in Table 2 that
are known to be reliable for DNA sequencing.
Table 2
Recommended universal primers for cycle sequencing [12]
Primer name Sequence (5′ to 3′)

M13–21 TGT AAA ACG ACG GCC AGT
M13–47 CGC CAG GGT TTT CCC AGT CAC GAC
M13-REV4 TCA CAC AGG AAA CAG CTA TGA C
T7 TAA TAC GAC TCA CTA TAG GG
3.5.2 Cycle Sequencing The cycle sequencing reaction is setup with the use of Big Dye™
Reaction Terminator v 3.1 Cycle Sequencing (Applied Biosystems) [13]. It is
recommended that the reaction is setup in a dedicated PCR cabinet
to avoid cross contamination. In addition, frequently calibrated
pipettes dedicated for sequencing should be used for the setup
cycle sequencing and other procedures.
1. Thaw the contents of the Big Dye™ Terminator v 3.1 kit and
keep in ice.
2. Prepare 3.2 μM solutions for sequencing primer(s) and keep
in ice.
3. Label 1.5 mL microcentrifuge tubes accordingly noting sample
and primer used, and add the following components as
described in Tables 3 and 4. The total volume of the reaction
is 20 μL. Mix well, centrifuge and keep on ice.
4. There is an option of diluting the sequencing reaction. For that
purpose, the Big Dye™ Terminator v 1.1 & v 3.1 5X Sequencing
Buffer should employed as shown in the example in Table 5.
Diluted reactions are not recommended to run without optimiza-
tion as the resulting sequence may be compromised. The volume
of Buffer is given by the formula: Buffer Volume = 0.5 * [(Total
Reaction Volume)/2.5 – Reaction Mix].
Table 3
Components required per cycle sequencing reaction
Component Quantity Example volume

Big dye terminator 3.1 ready reaction mix 8 μL 8 μL
Sequencing primer 3.2 pmoles 1 μL
Water (molecular biology grade) Variable 9 μL
Template Variable depending on concentration 11 μL
of template (see Table 6)
Total 20 μL
Table 4
Recommended DNA quantities per reaction
PCR product size Quantity

100–200 bp 2–6 ng/μL
200–500 bp 6–20 ng/μL
500–1000 bp 10–40 ng/μL
1000–2000 bp 20–80 ng/μL
>2000 bp 40–100 ng/μL
Table 5
Example of a diluted sequencing reaction
Example
Component Quantity volume
Big dye™ terminator 3.1 ready reaction 4 μL 4 μL
mix
Big dye™ terminator v 1.1 & v 3.1 5X 2 μL 2 μL
sequencing buffer
Sequencing primer 3.2 pmoles 1 μL
Water (molecular biology grade) Variable 11 μL
Template Variable depending on concentration of 2 μL
template (see Table 2)
Total 20 μL
Table 6
Cycle sequencing reaction parameters
Parameter Temperature Time (sec) Ramp rate

Incubation 96 °C 60 –
Denaturation 96 °C 10 25 cycles 1s
Annealing 50 °C 5
Extension 60 °C 240
Hold 4 °C Until purification
5. The reaction mixtures can be transferred now to PCR tubes or

appropriate 96 plates; gently mix and proceed to cycle
sequencing.
6. Place the tubes in a thermal cycler such as the Proflex PCR
system and perform the cycle sequencing reaction following
the conditions listed in Table 6.
7. The samples can now undergo purification or stored in con-
tainers that will minimize exposure to light at -20 oC.
3.6 Cycle After completion of the cycle sequencing, the excess dye termina-
Sequencing Product tors are required to be removed. For this purpose, we employ the
Purification DyeEx 2.0 Spin kit (Qiagen) [14], which uses gel filtration
technology.
1. The column is gently vortexed in order to resuspend the resin.
2. The cap on the column must be slightly loosened (about one
quarter turn) so vacuum within the tube is avoided.
3. The bottom closure of the should be broken and the spin

column should be placed in the provided 2 mL tube.
4. Centrifuge the spin column for 3 min at 750 × g.
5. The spin column is transferred now to a microcentrifuge tube
and apply with care 20 μL of the cycle sequencing reaction. The
application should be done in the middle of the spin column
and without disrupting the gel filtrate matrix.
6. Remove the spin column from the microcentrifuge tube. The
eluate contains the purified cycle sequencing product. The
sample is dried in a vacuum centrifuge.
3.7 Sample 1. Thaw a fresh aliquot of Hi-Fi™ Formamide. Make sure that it
Preparation has not been through more than two freeze-thaw cycles.
2. Resuspend the samples in 10–20 μL Hi-Fi™ Formamide. Do
not resuspend in water as the sample stability will be decreased.
3. Transfer the samples in MicroAmp™ Optical 96-Well Reaction
Plates or MicroAmp™ Reaction Tubes. The tubes are provided
in strips of 8 and should be kept in place by the MicroAmpTM
96-well tray and tray retainer.
3. Cover the plates or tubes with the appropriate septa by aligning
the holes of the septa with the wells or the tubes. Ensure that
the septa are in position by appropriate pressing.
4. Centrifuge briefly the plates or reaction tube assemblies to
ensure that the contents are at the bottoms of their tubes.
5. Run the samples as soon as possible after resuspension and
setup.
3.8 Running The instrument electrophoresis run can be setup from a connected
Sequencing on the PC through a mobile device or from the instrument touch screen
Capillary [15]. Here, we describe the setup from the touch screen. Prior to
Electrophoresis starting the run, it is important to check the storage history of the
System (Seqstudio™) cartridge (see Note 11).
1. From the start up menu, touch the Eject button and carefully
open the instrument door according to the screen prompt.
2. Open the lid by pressing the release button on the autosampler.
3. Ensure that the Cathode Buffer Container is full above the fill
line. Replace it accordingly (see Notes).
4. Place the plate or the tube assembly firmly in the autosampler
and close the lid until it clicks shut.
5. Select “Retract Plate” from the “Start Menu” and close the
instrument door.
6. To run the system go to the home screen and setup run and
follow the instructions in the previous section or select.
Table 7
Run modules, read lengths, and appropriate run times
Run module Continuous read Length (CLR) Approximate run time

ShortSeq ≥350 bp 30 min
MediumSeq >500 bp 45 min
LongSeq >800 bp 120 min
7. In the home screen touch “Setup run.”

8. Next, touch “Create New Setup.”
9. At the top right of the Plate Properties, select the tab Proper-
ties. In the Applications box, select Sequencing.
10. Save location by selecting Instrument. This will save your setup
in case you need to repeat the experiment.
11. At the “Plate Properties” menu select “Plate.” The wells are
organized in 4 well injection groups. The default loading is
A1-D1, E1-H1, A2-H2, etc.
12. From the “Plate Menu” Select “Edit.” Select the appropriate
Run module based on the information displayed in Table 7.
13. To name the samples in the wells, select “Sample name” from
the “Edit” menu.
14. Press “Done” and the “Plate properties” will appear. To run
the samples, choose “Run.” You may need to select “Save” if
you are planning to run the samples later.
15. During the run the status dials for every injection appear as
colored circles. If the color is green, all quality control checks
have passed. If the color is yellow, there is at least 1 warning
quality alert. If the color is red, there is at least 1 failing quality
alert.
16. You may need to stop the run if there are a failing quality alerts.
To do that choose “Actions”.and from that menu “Cancel
Remaining Injections.”
17. When a run is completed, a “Run Complete” message will
appear on the screen. To view the results, select the “Results”
box. To get a quality report, touch “List View.” The report is
colored coded as described previously.
18. At the end of the run, touch the eject button on the screen,
select “Eject” plate and after the instrument prompt opens.
19. To retrieve the results, attach an “instrument dedicated
USB.” From the Home screen, select Setttings > Run History.
Touch Export and select “Storage Location.” The files down
loaded should be in ab1. Format.
3.9 DNA Sequence Sequence can be viewed on the SeqStudio instrument. However,
Viewing and Analysis we find that the viewing and manipulation of sequences is more
convenient on a PC with the aid of freeware. For routine use, the
most cost efficient approach is to use the light version of Chro-
mas™ (Technelysium Pty LTd) that allows visualization of the
sequence and export to FASTA format which is useful when further
bioinformatics processing is necessary. Access to sequence traces
with Chromas™ is very simple as the user simply have to down load
and install the program in the PC. Simply clicking on AB1 files will
open the traces in Chromas. To analyze and process the sequence,
take the following steps:
1. Without scrolling inspect the first 50 bp. You should see peaks
of large intensity that are not distinctly separated. This is typical
as primer binding affects the reading. Click on the sequence
letters in the region of the first 50 bp. At the top right of your
screen a quality value will appear. An acceptable quality value
should be Q > 20. The majority of the first 40–50 bp usually
are below 20. Based on this the region should be excluded.
2. Scroll the sequence the to the left. In a good quality sequence
(Fig. 4b) the nucleotide peaks are very well separated from each
other and the Q > 20 for all the nucleotides. On the contrary, a
problematic sequence appears with very high noise or a large
number of nucleotides with Q < 20 (see Troubleshooting). In
that case, the sequence is rejected from further processing.
3. If you identify spurious nucleotides (i.e., 5 in a sequence of
500 bp) in the middle region with Q < 20, this may be due to
heterozygosity in particular loci (see Subheading 3.9
Troubleshooting).
4. While scrolling to still to the left there is a point where the
signal drops. This is the end of the sequence (see Fig. 4d).
5. When you are satisfied with the quality of sequence, select from
the “Edit” menu the “Trim Low-quality” function and then
“Export” the sequence as a “FASTA” file for further
processing.
3.10 Trouble- In this section we list some examples of problematic cycle sequenc-
shooting ing of PCR products with the Seqstudio system. Troubleshooting
advice is listed below every listed example.
3.10.1 Unincorporated A common artifact that appears as between 70 bp and 120 bp is a

Dye Blob large peak that obscures the real sequence (Fig. 5). This can be
attributed to unincorporated Dye Blob and usually does not inter-
fere with the reading of sequence that appears underneath. This can
be solved with the addition of more DNA template or less BigDye
in the reaction.
Fig. 4 Typical images of a sequence as shown in Chromas™ lite. (a) The beginning of the sequence is affected
by binding primer. (b) The middle part of a good quality sequence exhibits high Q values (Q > 20), and the
peaks are well separated from each other. (c) The middle part of a poor quality sequence where there are
stretches of multiple nucleotides (yellow boxes) with low Q values (Q < 20). (d) The end of the sequence
where there is no coherent laser signal
Fig. 5 Example of unincorporated dye blob
Fig. 6 Example of a poor start followed by a weak signal
3.10.2 Poor Start When there is a poor start followed by a weak signal, this may
Followed by a Weak Signal attributed either to primer binding to itself or there is other primer
present (Fig. 6). This can be addressed either by redesigning a new
sequencing primer or by checking the efficiency of PCR purification
via gel electrophoresis.
3.10.3 Overlapping In the case of overlapping peaks in sequencing data, the sequence
Peaks might exhibit multiple priming sites or the sequencing primer
might not be sufficiently purified by the manufacturers and the
impure mixture may be giving shadowing sequences (Fig. 7). In
both cases, the use of newly synthesized primers is advised. There is
a possibility that there is heterozygosity in the form of single
nucleotide polymorphisms (SNPs) in which case cross-referencing
with the sequence of the complementary strand is strongly advised
for confirmation.
3.10.4 Failed Sequence When the run fails to produce sequencing data, the probable causes
might be the suitability of the sequencing primer (Fig. 8), the
freshness of the primers stock, the quantity and quality of DNA,
and the presence inhibitors within template DNA. It is advisable to
repeat reaction first with a fresh aliquot of sequencing prime,
measure the concentration of template DNA, and ensure that a
Fig. 7 Example of overlapping peaks
Fig. 8 Example of a failed sequence
good quality PCR band is evident during electrophoresis. If the

problem persists, a second round of PCR purification maybe
required. Lastly, the synthesis of new sequencing primers may be
required.
3.10.5 Secondary In some cases, sequence may start well but the signal may weaken
Structure rapidly (Fig. 9). This is due to repeat regions such as GT or CT
repeats that may cause the sequencing signal to be depleted due to
formation of DNA loops or secondary structures. It is advisable to
add 1 μL of DMSO in the reaction or design nested sequencing
primers close to the secondary structure.
4 Notes
1. A compact microcentrifuge with maximum speed at

14,000 rpm is recommended.
2. Electrophoresis tanks from recognized manufacturers with
appropriate safety features are recommended. Powerpacks
from recognized manufacturers that are compact with capabil-
ities for 300 V, 400 Ma, and 60 W are sufficient.
Fig. 9 Example of secondary structure issues
3. Entry level gel documentation systems that allow for the use of
safe gel staining dyes are sufficient for this protocol.
4. It is recommended to use an Applied Biosystems™ thermal
cyclers as Big Dye™ chemistry kits are optimized with the use
of these instruments. Alternatively, cycle sequencing reaction
optimization might be necessary.
5. The PC used for data visualization and storage in this protocol
should be run on Windows™ 8 or 10 operation systems.
6. A wide range ladder should be used (100–10,000 bp) as the
PCR products may vary in size.
7. Premade loading dye (6X Loading Dye) in order to ensure
consistency during loading is recommended.
8. For staining of DNA in agarose we prefer to use dyes that are
safer than ethidium bromide such as SYBRSafe™ and
Noveljuice™.
9. Before the use of PE Buffer, add the appropriate
(as recommended on the bottle) amount of ethanol
(96–100%).
10. Fragments between 500b and 4 Kb are not affected by the
addition of isopropanol.
11. The cartridge can be stored up to 4 months on or off the
instrument. If the cartridge is stored off the instrument, it
should be kept at 2–8 °C and in an up-right position with an
integrated capillary protector and an optical cover installed.
References
1. Saiki RK, Scharf S, Faloona FA, Mullis KB, 2. Bevan SI, Rapley R, Walker MR (1992)
Horn CT, Erlich HA, Amheim N (1985) Enzy- Sequencing of PCR amplified DNA. PCR
matic amplification of β-globin genomic Methods Appl 1:222–228
sequences and restriction site analysis for diag-
nosis of sickle cell anemia. Science 230:1350–
1354
3. Sanger F, Nicklen S, Coulsen AR (1977) DNA 10. De Bellis G, Manoni M, Pergolizzi R,

sequencing with chain terminating inhibitors. Vezzoni P, Luzzana M (1990) Primer design
Proc Natl Acad Sci 74:5463–5467 in fluorescent DNA sequencing. Nucleic Acids
4. DNA Sequencing by Capillary Electrophoresis Res 18(16):4951–4952. https://doi.org/10.
2nd Edition (2009) Applied biosystems, 1093/nar/18.16.4951. PMID: 2395669;
Foster City PMCID: PMC332014
5. Instruments for Sanger Sequencing and Frag- 11. Rychlik W (1993) Selection of primers for
ment Analysis by Capillary Electrophoresis. polymerase chain reaction. Methods Mol Biol
Thermo Fisher Scientific. Available on: 15:31–40. https://doi.org/10.1385/0-
https://www.thermofisher.com/uk/en/ 89603-244-2:31
home/life-science/sequencing/sanger- 12. Standard Primers (2021) MRC PPU DNA
sequencing/sanger-sequencing-technology- sequencing services. Available on: https://
accessories.html www.dnaseq.co.uk/resources/primers/stan
6. Seqstudio Analyser Application Guide (2019). dard-primers
Applied biosystems 13. Big Dye Terminator v3.1 Cycle Sequencing kit.
7. Qiaquick PCR & Gel Cleanup Kit Handbook. Pub No. MAN0015666 (2016) Applied
Qiagen. Available on: https://www.qiagen. Biosystems
com/zh-us/products/discovery-and-transla 14. DyeEx 2.0 Spin Kit Handbook (2002) Qiagen.
tional-research/dna-rna-purification/dna-puri Available on: https://www.qiagen.com/cn/
fication/dna-clean-up/qiaquick-pcr-purifica resources/download.aspx?id=c1992325-e41
tion-kit?catno=28506 f-4a78-8b5a-248cc91d2c2e&lang=en
8. Nanodrop 2000/2000c Spectophotometer 15. Seqstudio™ Genetic Analyser Instrument and
User Manual (2009) Thermo scientific Software User Guide (2019) Applied
9. Serwer P (1983) Agarose gels: properties and Biosystems
use for electrophoresis. Electrophoresis 4:375–
382
Chapter 16
Nanopore Sequencing for Mixed Samples

Angela H. Beckett and Samuel C. Robson
Abstract
Long read Nanopore sequencing can be utilised to determine the quality and accuracy of genetically
engineered changes in animals, which often produce heterogenous samples. The protocol presented in
this chapter can be used for a range of both low and high throughput sequencing applications. DNA must
be repaired, barcoded and ligated to sequencing adapters prior to sequencing. Quality of sequencing data
produced is dependent on stringent adherence to the protocol. However, nanopore sequencing is a fast
moving field, therefore it is worth considering using the most up to date chemistry available.
Key words Next-generation sequencing, Third-generation nanopore sequencing, Library prepara-

tion, Oxford Nanopore Technologies
1 Introduction
Genetically engineered DNA modifications in microorganisms and

animals must be confirmed and validated using sequencing tech-
nologies [1]. After the modified region is amplified by PCR, the
amplicon is subcloned into a plasmid, transformed into bacteria and
resultant colonies are sequenced [2]. Sanger sequencing has typi-
cally been used for detecting and testing efficiency of sequencing
clones [3, 4]. This first-generation sequencing technique utilises a
chain termination method. The target sample is divided into 4 PCR
reaction pools; each pool contains deoxynucleoside triphosphates
(dNTPs: A, T, G and C), polymerase, fluorescently tagged primer
and one type of dideoxy-dNTP (ddNTP) per pool (A, T, G or C).
ddNTPs are lacking a 3′ hydroxyl group which halts the action of
polymerase during DNA extension, terminating the reaction. As
ddNTP concentration is so low, each time extension occurs, differ-
ing amounts of dNTPs are added before a ddNTP is incorporated;
thus, many-sized fragments are generated. After PCR, the product
DNA from each PCR pool is loaded into individual wells of a
denaturing urea PAGE gel. The size separation of the fragments is
used to determine the reverse complement of the sequence. For
https://doi.org/10.1007/978-1-0716-3004-4_16,
213
214 Angela H. Beckett and Samuel C. Robson
example, if the smallest fragment on the gel is from Pool 1(A), and
the second smallest fragment is from Pool 2 (C), the first nucleotide
in the reverse complement of the sequence is G, the second is T and
so on. In recent years, this process has been automated through the
use of capillary electrophoresis and base-specific fluorescent tags.
Second- and third-generation sequencing technologies have
since been developed, such as short- and long-read high-through-
put sequencing methods developed by Illumina and Oxford Nano-
pore Technologies (ONT), respectively [5]. The increased
throughput, speed and quality of these technologies have led
them to become widely adopted. Illumina utilises a bridge amplifi-
cation technique; a sequencing adapter is bound to the end of DNA
fragments, which are complementary to a lawn of oligos bound to
the glass surface of the Flow Cell. Polymerase creates a complement
of the hybridised strands, after which the double strand is dena-
tured and the original template is washed away. The remaining
strand folds over and binds to a second type of oligo bound to
the Flow Cell surface forming a bridge, where it is replicated by
polymerase and denatured into single strands (Bridge Amplifica-
tion). The replication is repeated through multiple cycles, creating
clusters of identical DNA oligos. Fluorescently tagged nucleotides
are added one by one, with the signal released after each addition
indicating which base has been incorporated. This occurs across all
fragments on the Flow Cell simultaneously. Emitted fluorescence is
detected, and the sequence for forward strands is calculated, after
which the reverse strands are transcribed and the process is
repeated. This massively parallel system greatly sped up sequencing
efforts. However, this method is limited as it only generates short
sequencing reads, thus resulting in potential gaps in the aligned
sequence or difficulty resolving highly repetitive regions. This limi-
tation has been addressed in third-generation long read sequenc-
ing, including nanopore-based sequencing from Oxford nanopore
Technology (ONT) and Single Molecule Real-Time (SMRT)
approaches from Pacific Biosciences (PacBio), capable of sequenc-
ing long fragments of DNA.
In this chapter, the methodology for library preparation
and sequencing using nanopore sequencing is described. ONT
have developed a small sequencing machine (MinION), roughly
the size of a standard stapler, which is portable and inexpensive
(<£1000). Researchers have taken the MinION to the Arctic to
perform field experiments [6] as well as using it on the international
space station [7, 8]. Despite the low initial cost of this instrument,
it is important to consider the cost of the sequencing consumables
and reagents. Each experiment is performed on a disposable Flow
Cell, depending on the number of samples sequenced and the
duration of sequencing these can be used for a maximum of 72 h.
The Flow Cell contains over 1000 nanopores, which are
1 nanometre-wide transmembrane proteins perforating an electro-
conductive membrane. DNA is bound to the pore by adapters and
NGS 215
dsDNA
Helicase
cis (-) enzyme
Protein pore
Lipid bilayer
trans (+)
ssDNA
Electrical current
Base-called data
T G A C
Fig. 1 A schematic diagram of the mechanism of Oxford Nanopore Technologies (ONT) sequencing. Double-
stranded DNA (dsDNA) is unwound by a helicase enzyme, and a single strand of DNA (ssDNA) is translocated
through the nanopore. Each nucleotide base causes a characteristic change in the ionic flow through the
nanopore, which can be computationally decoded to determine the underlying DNA sequence. (Figure created
using BioRender.com)
unwound by a helicase enzyme into single strands. As each nucleo-

tide on the single-stranded DNA crosses the membrane channel
within the pore, it interrupts the flow of electrical current across the
nanopore, with each of the four nucleotides causing a unique
characteristic change in the signal. The change in signal is recorded
and assessed by a machine learning classification algorithm as each
sequential nucleotide passes through the pore, thus revealing the
sequence of the fragment in a process called base-calling (Fig. 1).
This occurs simultaneously across multiple pores on the Flow Cell,
and the signal is detected by the computer. Samples can be multi-
plexed by up to 96 samples per Flow Cell by tagging the template
DNA with a unique, known barcode. Scaled-up versions of the
instrument are also available; the GridION has the capacity to run
five Flow Cell experiments simultaneously and has an inbuilt com-
puter for base calling, and the PromethION has a higher capacity
still for population-scale sequencing.
High-throughput, next-generation sequencing has undergone

a revolution during the SARS-CoV-2 pandemic. Throughout this
time, it has been critical to identify variants from positive patients so
that transmissibility and antigenicity can be monitored, informing
infection control measures in healthcare settings and vaccine design
as well as informing policy makers on transmission control decisions
[9, 10]. In the United Kingdom, scientists with sequencing cap-
abilities created a national network, the COVID-19 Genomics UK
(COG-UK) Consortium, which worked together with Public
Health Agencies and NHS Hospital Trusts to establish a consistent
approach to sequencing SARS-CoV-2. The large-scale sequencing
of positive patients across the United Kingdom allowed variants of
concern (VOC) and variants of interest (VOI) to be rapidly identi-
fied and transmission to be tracked through genomic epidemiology.
This approach has also been taken up globally, resulting in an
unprecedented amount of sequencing being performed, which is
likely to lead to sequencing being more frequently utilised in
healthcare settings in the future.
A mixture of the ARTIC SARS-CoV-2 V3 sequencing protocol
[11], the LSK-109 ligation-sequencing library preparation kit and
the NBD-196 Nanopore barcoding kit Protocol [12] (with addi-
tional adaptations) is the foundation of the method presented in
this chapter. These were selected as the basis for this chapter due to
their primary use at the time of writing and throughout the pan-
demic. However, it should be noted that ONT continue to update
their technology and chemistry for the nanopore-based systems
and at the time of publication have released their Version 14
chemistry ligation sequencing library preparation kit (LSK-114),
which offers significant improvements in base-calling data quality.
However, many of the recommendations suggested here will apply
equally to more recent updated protocols.
The first stage of the procedure is a DNA quality control
(QC) check to ensure there are no inhibitors in the eluate that
might interfere with sequencing, and also that there is a sufficient
quantity of DNA. After QC and quantification, end-repair and dA-
tailing are performed to repair nicks in the DNA, to produce blunt
ends and ligate A-tail overhangs onto the DNA template. The
A-tails allow unique barcode oligonucleotide sequences to be
ligated to each sample. Once barcodes have been ligated, a series
of washes are performed. DNA is bound to Solid Phase Reversible
Immobilization (SPRI) beads, which when placed on a magnetic
rack are held by the magnet as a pellet on the side of the tube. Any
remaining unbound barcodes and other impurities can be washed
away whilst the DNA remains bound. After washing, sequencing
adapters are ligated to the barcoded DNA fragments, allowing the
fragments to be translocated through the pores. Library and
sequencing preparation take approximately 5–7 h depending on
NGS 217
Fig. 2 Process Flow Chart and Timeline. Approximate timings of library preparation and sequencing. The
process can be expedited by increasing the number of lab workers during the End Repair and Barcoding steps.
(Figure created using BioRender.com)
operator experience and the number of samples. If it cannot be

completed within a day, the experiment can be paused at the first
and second DNA quantification steps, which are performed after
Barcode & Wash and Adapter & Wash steps, respectively (Fig. 2).
2 Materials
2.1 Consumables 1. 2.5 μL, 10 μL, 20 μL, 200 μL and 1000 μL Filter tips, Sterile.
2. 96-Well Reaction Plate, half-skirt and adhesive PCR plate seals.
3. Flat 8-cap strips.
4. 0.5 mL Screw Cap Tubes.
5. Invitrogen™ Qubit™ Assay Tubes.
6. 1.5 mL DNA Lo-Bind Tube.
2.2 Reagents 1. Invitrogen™ DNAZap™ PCR DNA Degradation Solutions.

2. Invitrogen™ Qubit™ dsDNA HS Assay Kit.
3. Nuclease free water.
4. Beckman Coulter™ Agencourt AMPure XP beads.
5. Absolute Ethanol >90%.
6. Tris-EDTA Buffer Solution pH 8.0.
7. NEBNext Ultra II End repair/dA-tailing Module (New Eng-
land Biolabs - NEB).
8. NEBNext Quick Ligation Module (NEB).
9. Blunt/TA Ligase Master Mix (NEB).
10. Native Barcode Expansion Kit (ONT) (see Note 1).
11. Ligation Sequencing Kit 109 (LSK-109) (ONT).
12. Flow Cell Priming Kit (included with LSK kit) (ONT).
13. Flow Cell Wash Kit (ONT).
2.3 Equipment 1. Qubit Fluorometer.

2. PCR Hood.
3. PCR Thermal Cycler.
4. Mini Plate Spinner Centrifuge.
5. MicroAmp™ Cap Installing Tool.
6. Microcentrifuge.
7. Vortexer.
8. Flow Cell MIN 109D (ONT).
9. 96-well cooling block.
10. Centrifuge tube Mini-cooler.
11. ONT Sequencer (see Note 2).
12. Magnetic Rack (see Note 3).
13. Timer.
14. P2, P10, P20/P100, P200, P1000 Single Channel Pipette.
15. 8x P10 Multichannel Pipette.
16. Repeat Pipettor (see Note 4).
3 Method
Here we assume the appropriate region of the genomic DNA from

the engineered animal has been PCR amplified, and the resulting
amplicons will act as the starting material. Where possible, all work
should be performed in a PCR hood, which limits contamination
occurrence. All thawed reagents should be stored on cool blocks or
ice unless otherwise stated.
3.1 Setting Up 1. Include a negative control, such as nuclease-free water (NFW),

and a known positive control per sequencing library (i.e., per
Flow Cell). If positive and negative controls have been added to
the plasmid PCR, carry them through to library preparation
along with the samples.
2. Create an experiment plan which includes sample ID and sam-
ple order. Up to 96 samples, including 2 controls, can be added
to a single Flow Cell, depending on coverage needed per
sample.
3. In a clean PCR hood/Laminar Flow, sub-aliquot NFW and
other NEB reagents into single use volumes (see Note 5).
4. Thoroughly clean a PCR hood and pipettes with DNAse ZAP
cleaning spray.
5. If possible, wear a different lab coat for library prep (post-PCR
amplification) than worn for the PCR preparation (pre-PCR
amplification) (see Note 6).
3.2 Post-PCR Quality 1. Quantify DNA from all samples, the positive control and the
Control NFW negative control using the Qubit Fluorometer (ng/μL).
2. Label the required number of Qubit, 0.5 mL tubes to test the
samples, including two additional tubes for the calibration
standards (see Note 7).
NGS 219
3. Prepare respective calibration standards by adding 190 μL of

Qubit working solution and 10 μL of the respective standard
(Standard 1 and Standard 2).
4. Add 199 μL of Qubit working solution and 1 μL of sample (see
Note 8).
5. Mix contents by inverting three times, and perform a swift
wrist flick to pool the contents at the bottom of the tube (see
Note 9).
6. Allow tubes to incubate at room temperature for 2 min.
7. On the Home screen of the Qubit Fluorometer, select
“1xdsDNA High Sensitivity,” followed by “Read Standards”
(see Note 10).
8. Insert the tube containing Standard 1 into the sample chamber,
close the lid and “Read Standard.” When the reading is com-
plete (~3 s), remove Standard 1 (see Note 11).
9. Repeat process with Standard 2 (see Note 12).
10. Select “Run Samples” to proceed to sample quantification.
11. On the assay screen, select the sample volume (1 μL) and units
required (ng/μL).
12. Insert a sample tube into the sample chamber, close the lid and
select “Read Sample.” When the reading is complete (~3 s),
remove the sample tube.
13. Repeat until all samples have been read. Record sample con-
centrations (see Note 13).
14. Check purity of DNA on a micro-spectrophotometer, and run
blank before testing samples. If 230/260 and 260/280 are
between 1.8 and 2.0, then continue with the experiment. If
samples are not within range, perform appropriate clean-up
before proceeding (see Note 14).
3.3 Sample Dilution, 1. Thaw Mastermix 1 (MM1) reagents (Table 1) on ice.

End Repair and dA- 2. For each sample, add 500 ng of DNA (≤24 samples) or 150 ng
Tailing of DNA (>24 samples) and make up to 15 μL using NFW. Put
each sample in an individual well on a 96-well plate. Keep
96-well plate on cool block throughout the process (see
Note 15).
3. Prepare MM1 (Table 1): In a 1.5 mL DNA Lo-bind tube,
combine Ultra II End Prep Reaction Buffer and Ultra II End
Prep Enzyme Mix (see Note 16).
4. In clean wells, on the same 96-well plate used for sample
dilution (if space, otherwise on a new 96-well plate), dispense
MM1 into 3 μL aliquots (see Note 17).
Table 1
Mastermix 1 reagent volume per sample
Component x1 sample volume (μL)

130–400 ng sample DNA 12
Ultra II End Prep Reaction Buffer 1.75
Ultra II End Prep Enzyme Mix 0.75
5. Using an 8x P10 Multichannel pipette (see Note 18), transfer

12 μL of diluted sample (containing either 400 ng or 130 ng of
sample DNA) from the previous step to the corresponding
well-containing MM1 (Fig. 3).
6. Centrifuge plate to collect contents at bottom of the well (see
Note 19).
7. Incubate the reaction in a thermal cycler at 22 °C for 15 min,
followed by 65 °C for 15 min (see Note 20).
8. When incubation is complete, cool on ice or on a cool block for
1 min.
3.4 Barcode Ligation 1. Meanwhile, prepare Mastermix 2 (MM2): In a 1.5 mL DNA

Lo-bind tube, mix Blunt TA/Ligase Master Mix and NFW
(Table 2) (see Note 16).
2. In clean wells on the same plate (if space, otherwise on a new
96-well plate), dispense MM2 into 8 μL aliquots (see Note 17).
3. Add 1.25 μL of barcode per sample, ensuring that each sample
has a unique barcode and sample/barcode order has been
recorded (see Note 21).
4. Add 0.75 μL of the previous reaction mixture (MM1 after
incubation on thermal cycler) to each corresponding well, seal
plate with Flat 8-cap strips using the capping tool and centri-
fuge plate (see Note 22).
5. Incubate the reaction in a thermal cycler as follows at 22 °C for
20 min, 65 °C for 10 min and 4 °C for 1 (see Note 23).
6. At the start of the incubation time, remove AMPure (SPRI)
beads from the fridge and leave at room temperature, remove
Short Fragment Buffer (SFB) from either the LSK kit or SFB
Expansion Pack and thaw on ice/in a cool block.
7. After incubation, cool the 96-well plate containing MM2 on
ice/in a cool block for 1 min.
3.5 Barcode Clean- 1. In a new 1.5 mL DNA Lo-bind Eppendorf tube, pool all 10 μL
Up barcoding reactions together (per library, e.g., 960 μL for
96-barcoded samples).
NGS 221
Diluted
sample MM1 MM2
01 09 01 09 01 09
02 0 02 10 02 10
03 11 03 11 03 11
04 12 04 12 04 12
05 13 05 13 05 13
06 14 06 14 06 14
07 15 07 15 07 15
08 16 08 16 08 16
12.0 µl 0.75 µl
Fig. 3 Example 96-well plate layout for 16 samples. As indicated by arrows, 12 μL of diluted sample DNA
(containing 400 ng or 130 ng) with a total volume of 15 μl from samples 01–08 can be transferred to
Mastermix 1 (diluted sample from Column 1: A1-H1 transported to Column 3: A3-H3) simultaneously using an
8x P10 Multichannel pipette. After Mastermix 1 has finished incubation and Mastermix 2 has been added to
the plate, 0.75 μl of Mastermix 1 can be transferred by multichannel to Mastermix 2 (Column 3: A3-H3
transported to Column 5: A5:H5). (Figure created using BioRender.com)
Table 2
Mastermix 2 reagent volumes. ×24-×96 sample volumes have overage included
×1 sample ×24 sample ×48 sample ×72 sample ×96 sample

Component volume (μL) volume (μL) volume (μL) volume (μL) volume (μL)
Previous Reaction Mixture 0.75
NBXX Barcode 1.25
Blunt/TA Ligase Mastermix 5 135 265 395 525
Nuclease Free Water 3 81 159 237 315
Fig. 4 Demonstration of pipetting technique whilst using magnetic rack.

Magnetic rack is held at an angle whilst pipetting to better visualise the beads
and improve pipetting accuracy
2. Mix beads thoroughly by vortex and mix-pipetting, until

homogenous. Add 4 μL of AMPure beads per sample, i.e.,
96 μL AMPure beads for an × 24 pooled sample reaction or
384 μL for 960 μL sample reaction (see Note 24).
3. Pulse centrifuge to collect tube contents at the bottom of the
tube (see Note 25).
5. Whilst the library is incubating, prepare ethanol ahead of time.
Dilute absolute ethanol to 70% by adding 700 μL ethanol to
300 μL of NFW (see Note 26).
6. Place library tube(s) onto a magnetic rack and incubate for
2 min (see Note 27).
7. Holding the magnetic rack at an angle, carefully remove and
discard the supernatant, being careful not to touch the bead
pellet (Fig. 4) (see Note 28).
8. Add 250 μL short fragment buffer (for x24-plex pool), 500 μL
SFB (x48-plex pool), 1000 μL SFB (x96-plex pool) and
re-suspend beads completely by pipette mixing.
9. Pulse centrifuge to collect tube contents at the bottom of the
tube (see Note 29).
10. Place sample tube(s) onto magnetic rack and incubate for a
minimum of 2 min.
NGS 223
11. Carefully remove supernatant and discard (see Note 30).

12. Repeat SFB wash, pellet and discard.
13. Pulse centrifuge and remove any residual SFB using a P10
pipette (see Note 29).
14. Leave the tube in the magnetic rack, and add 200 μL of room-
temperature 70% ethanol to bathe the pellet. Do not resuspend
or disturb the pellet.
15. Carefully remove and discard ethanol, being careful not to
touch the bead pellet.
16. Pulse centrifuge to collect all liquid at the bottom of the tube,
and carefully remove as much residual ethanol as possible using
a P10 pipette.
17. With the tube lid open, incubate for 1 min or until the pellet
loses its shine (see Note 29).
18. Resuspend the pellet in 30 μL NFW/Tris-EDTA buffer
pH 8.0/Elution Buffer, mix gently by flicking/pipetting and
incubate for 2 min (see Note 30).
19. Place on a magnetic rack and incubate for 2 min.
20. Transfer the library to a clean 1.5 mL Eppendorf tube ensuring
no beads are transferred into this tube (see Note 31).
3.6 Sequencing 1. Quantify 1 μL of barcoded amplicon pool using the Qubit

Adapter Ligation and Fluorometer, as described in Subheading 3.2, step 2 (see
Clean-Up Note 32).
2. Set up the AMII adapter ligation reaction (Table 3).
3. Incubate at room temperature for 20 min.
4. Meanwhile, remove the required number of Flow Cells from
fridge and allow to come to room temperature.
5. Mix AMPure beads thoroughly by vortex and mix-pipetting,
until homogenous.
6. After the 20 min adapter incubation, add 50 μL (1:1) of
AMPure beads to the library tube(s) and mix gently by invert-
ing/pipetting.
Table 3
Adapter ligation mix
Component Volume (μL)

Library (pooled & barcoded samples) 29
NEBNex 5X Quick Ligation Reaction Buffer 10
AMII Adapter Mix (LSK109 kit) 5
NEB Quick T4 DNA Ligase 5

8. Place library tube(s) onto magnetic rack and incubate for
2 min.
9. Carefully remove and discard the supernatant, being careful
not to touch the bead pellet.
10. Add 250 μL SFB and re-suspend beads completely by
pipetting.
11. Pulse centrifuge and place library tube(s) onto magnetic rack
and incubate for 2 min.
12. Discard supernatant.
13. Repeat SFB wash steps.
14. Pulse centrifuge and remove any residual SFB.
15. Add 15 μL Elution buffer (LSK) and re-suspend beads by
pipette mixing.
16. Incubate at room temperature for 2 min.
17. Place on magnetic rack and incubate for 2 min.
18. Transfer final library to a new 1.5 mL DNA Lo-bind Eppen-
dorf tube (see Note 33).
3.7 Sequencing 1. Quantify 1 μL of barcoded amplicon pool using the Qubit

Preparation Fluorometer as described in Subheading 3.2, step 2 (see
Note 34).
2. Thaw sequencing reagents at room temperature (Table 4)
before placing on ice; a fresh tube of Flush Buffer is required
per Flow Cell.
3. Open the ONT MinKnow Software.
4. Insert configuration cell into the instrument by sliding the cell
under the clip and pushing down gently. Run the hardware
check from the “Start” menu. Check system messages to see if
hardware check was successful (see Note 35). Remove
configuration cell.
Table 4
Sequencing reagents required to prepare library for loading onto flow cell
Kit Reagent
Ligation Sequencing Kit Sequencing Buffer
Ligation Sequencing Kit Loading Beads
Flow Cell Priming Kit Flush Buffer (FB)
Flow Cell Priming Kit Flush Tether (FLT)
NGS 225
5. Load Flow Cell into the instrument by sliding it under the clip
and pushing down gently.
6. If using Flow Cell containing storage buffer (first use Flow
Cells and Flow Cells which have been stored after the second
use), go to the “Start” menu and run a “Flow Cell Check.” A
Flow Cell check takes ~20 min, so continue with the next step
while waiting for it to complete. The number of pores available
will display on the “sequencing overview” screen. Any value
over 800 pores passes the ONT warranty threshold. If the
number of available pores is below 800 on a new Flow Cell,
and it is less than 3 months old; set it aside, inform ONT and
request a replacement (see Note 36).
7. Meanwhile, add 30 μL FLT to the FB tube and mix well by
vortex to create Flush buffer-mix.
8. Once the Flow Cell check is complete, open the priming port
and take a P1000 pipette with the volume to 800 μL. Holding
the pipette completely upright, place the empty pipette tip into
the priming port and remove any air from the inlet port by
turning the volume dial anti-clockwise (Fig. 5). Remove
~30 μL of the buffer from the Flow Cell (see note 37).
9. Load 800 μL of Flush buffer-mix into the Flow Cell via the
priming port (Fig. 5), dispense slowly and smoothly to mini-
mise shear forces on the library and avoid the introduction of
any air bubbles (Fig. 5) (see note 38).
10. Wait for 5 min, in the meantime move to the next step.
1. Slide open the priming port cover by 2. Place tip vertically into priming port and 3. Load 800µl of Flush Buffer-mix slowly
90˚ to reveal the priming port dial anticlockwise to remove air bubble through the priming port
4. After 5 minutes, open the SpotON 5. Load 200µl of Flush Buffer-mix slowly 6. Load the library dropwise into the
port through the priming port SpotON port
Fig. 5 Priming and loading a Flow Cell. Flow Cell is primed with flush buffer-mix prior to the library being
loaded via the SpotON port. (Image adapted from © 2022 Oxford Nanopore Technologies plc)
Table 5
Sequencing reagent quantities required to prepare library for loading onto
flow cell
Component Volume (μL)

Sequencing Buffer 37.5
Loading Beads 25.5
Library 12
3.7.1 Library Preparation 1. Dilute library in NFW so that 12 μL contains 40 ng of DNA

and Loading (3.3 ng/μL) for x24–47 sample pools or 50 ng of DNA for
≥48 sample pools (4.2 ng/μL). If concentration of DNA is less
than 3.3 ng/μL, do not dilute. If concentration of DNA is
>15 ng/μL, perform a 1:1 dilution (see Note 39).
2. In a new tube prepare the library for sequencing (Table 5),
ensuring that loading beads are mixed thoroughly by vortex
and mix pipetting until homogeneous (see Note 40).
3. After the 5-min incubation of Flush buffer-mix on the Flowcell
has elapsed, gently lift the SpotON cover to reveal the
SpotON port (Fig. 5).
4. With the SpotON port open, load another 200 μL of Flush
buffer-mix into the Flow Cell via the priming port. Dispense
slowly and smoothly, leaving a small amount of liquid remain-
ing in the pipette tip to avoid the introduction of any air
bubbles (Fig. 5) (see Note 41).
5. Load 75 μL of the library onto the Flow Cell via the SpotON
sample port, using a P200 pipette suspended above the port,
dispensing in a dropwise fashion. Ensure each drop siphons
into the port before adding the next (Fig. 5) (see Note 42).
6. Gently replace the SpotON sample port cover, making sure the
bung enters the SpotON port. Close the priming port and
close the instrument lid.
7. On the ONT MinKnow software go to the “Start” menu and
“Start Sequencing.”
8. Enter experiment name and sample name (see Note 43).
9. Select kits used (i.e., LSK109), and relevant barcoding kit (i.e.,
NBD104, 114 or 196).
10. Set run options: either set time to 72 h and stop when there is a
sufficient amount of data or set for a shorter amount of time
depending on coverage required (e.g., 24 h for <15 samples,
32 h for 15–48 samples and 48 h for 96 samples are often
sufficient for SARS-CoV-2 sequencing).
NGS 227
Fig. 6 Flow Cell health and duty time plot. X2 shows a low number of sequencing pores despite there being a
high number of available pores, likely caused by insufficient adapter ligation. X1 shows a healthy Flow Cell
run, with a high proportion of available pores being utilised for sequencing. (Figure created using BioRender.
com)
11. If performing multiple runs, make a record of which library is

on which Flow Cell (see Note 43).
12. Double-check all the settings and then start the run. Monitor
the run on the “Sequencing Overview” (see Note 44).
13. Check the health of the run (Fig. 6) (see Note 45).
14. Wait for run time to elapse or manually “Stop Sequencing”
when a sufficient amount of data has been generated. It is also
possible to pause the run, wash the Flow Cell, re-load with
fresh library and continue sequencing to obtain more data (see
Note 46).
4 Notes
1. 1–12 and 13–24 or 1–96 depending on sample quantity. If

performing many experiments, it is better to buy the 1–96
kit. The 96-barcode kit comes in a 96-well plate format, instead
of screw top lids which makes it easier to barcode multiple
samples at once using a multichannel. If not using all 96 bar-
codes in one go, make a note of which barcodes are used and
use sequential barcodes for the next experiment so that they are
used evenly and do not result in cross-contamination
between runs.
2. MinION, GridION or PromethION. GridION and Pro-
methION have an inbuilt computer, whilst the MinION
requires a computer.
3. It is recommended to use the Invitrogen™ DynaMag™-2
Magnet. This magnet makes it easier to perform high-quality
washes of DNA.
4. These pipettes are optional and are worth purchasing if high-
throughput testing is to be performed.
5. ONT reagents are packaged as 6 libraries per tube, do not
sub-aliquot these. NEB reagents come packaged in larger
volumes, sub-aliquot into smaller volumes. If possible, aliquot
into single-use volumes. This prevents cross-contamination
events. NFW should be dispensed into a single-use aliquot,
and not reused. Whenever an aliquot has been used and put
back for future use, mark the lid with a pen so that if a contam-
ination event occurs, pre-used tubes can be destroyed. Give
each set of reagent aliquots a unique ID so that if a contamina-
tion event occurs, the causative reagent can be identified and
destroyed. Use seperate PCR hoods for aliquoting reagents and
performing library preparation.
6. Wearing a separate lab coat for library prep will reduce the
likelihood of contamination when the PCR for sequential
experiments is performed.
7. Only use the specific Qubit tubes which are of desired thick-
ness. Do not label the side of the tube as this could interfere
with the sample read.
8. The final volume in each tube should be 200 μL. Use a P2
pipette for adding 1 μL for high accuracy, when pipetting such
small volumes, it is best practice to break the surface tension in
the tip before use. Pipette the volume of liquid required and
expel to the second stop to break the surface tension, prior to
pipetting the desired volume for use in the process. Holding
the pipette upright at a 90° angle, whilst drawing up liquid into
the pipette tip, will produce more accurate results than holding
at a 45° angle.
9. Do not centrifuge the tubes, they are thin-walled and will break
under centrifugal force.
10. Calibrate the instrument with the standards at the start of the
week or if it has been used for another type of assay (such as
RNA). It does not need to be calibrated before each use.
11. Value is usually ~30–50.
12. Value is usually ~1600–1900.
NGS 229
13. If the PCR positive control value contains >20 ng/μl and
NFW is <20 ng/μl proceed with experiment, otherwise halt
experiment. If the sample contains <20 ng/μl but the PCR
positive control is >20 ng/μl, test another sample. It may be
that one sample had a low starting concentration. If many of
the samples contain <20 ng/μl and the positive control con-
tains >20 ng/μl, this suggests samples prior to PCR were low
quality and may require clean-up. If the positive control is also
low, this suggests an issue with the PCR itself. When a PCR has
been performed, the negative control often looks higher than it
would without PCR, as primer-dimers can cause a signal. This
can be checked by performing gel electrophoresis or TapeSta-
tion analysis on the negative control. Primer-dimers appear as
smears on the gel but contamination will show as a band the
size of the PCR amplicon. In some instances, low levels of
contamination are masked and cannot be detected until
sequenced. However, if there has been a catastrophic failure,
such as a sample mix-up in which DNA was added to the NFW,
this will be detectable. For a 25 μL PCR reaction pool, the
Qubit quantification should be <20 ng/μL.
14. When 230/260 and 260/280 values are outside of the pre-
scribed range this indicates that there are inhibiting substances
carried over from the PCR protocol. Clean-up DNA by: bind-
ing to AMPure beads at a 2× vol ratio, washing with 80%
ethanol and resuspending in TE buffer/NFW using the same
methodology as the bead washing steps throughout the proto-
col. Retest concentration and purity after clean-up. It is also
possible to use spin-column kits such as Qiagen QIAquick PCR
Purification Kit.
15. A 130 ng input is based on 200 fmol of 1 Kb fragment length.
This quantity can be adjusted based on the fragment length of
the amplicon. If 130 ng of DNA contains larger 5Kb frag-
ments, there will be less fragments which need end-repair
than if 130 ng contains many smaller 1Kb fragments. Thus,
to ensure that there is sufficient enzyme to perform end-repair
on all DNA fragments, the fmol concentration must be taken
into account. The fmol input can be calculated as such:
First: moles dsDNA (mol) = mass of dsDNA (g)/((length
of dsDNA (bp) × 617.96 g/mol/bp) + 36.04 g/mol).
Second: moles of dsDNA ends = moles dsDNA (mol) × 2.
Third: DNA copy number = moles of dsDNA × 6.022e23
molecules/mol.
This can be more easily calculated using online biocalcula-
tors. The amplicon length can be confirmed using gel electro-
phoresis, or for a more sensitive result a Tapestation or
Bioanalyser. Furthermore, 150 ng of DNA is diluted to a
total volume of 15 μl, so that in the next step, when 12 μl is
transferred into Mastermix 1, that there is sufficient overage in

the wells to ensure no air bubbles in the tip which may cause
inaccuracy in the results.
16. In the table, the ×1 volume column indicates the exact volumes
needed for one sample. When making a custom size Master-
mix, it is advisable to increase reagent volume by at least 10%
overage. The higher the number of samples, the greater the
overage required as volume is lost on the outside of the pipette
tip. Thus, every time the pipette tip enters and leaves the tube,
reagent is lost.
17. For dispensing large quantities of repeating volumes (i.e.,
96 × 3 μL), use an automatic repeat pipettor or a reverse
pipetting technique with a single channel pipette.
18. Using a multichannel pipette at this step reduces pipetting
errors and expedites the process.
19. If possible, use a small benchtop plate spinner instead of a large
centrifuge to save time.
20. This first incubation step can either be used as an opportunity
to take a break or to prepare for the next step. A 4 °C for 1
step can be added at the end of the incubation, if an extended
break is to be taken during this step.
21. Use NBD104 and NBD114 for up to 24 samples, otherwise
use NBD196 barcode kit. Cover all unused wells with PCR
plate seals or Flat 8-cap strips, so that they remain free of
contaminants for the proceeding steps. Use 0.5–20 μl tips
with a P10 pipette as the wells of the barcode plate are very
deep, a longer tip reduces opportunities for contamination.
22. Use Flat 8-cap strips instead of adhesive PCR tape, as they
prevent evaporation during incubation.
23. This is an ideal stage to stop for a break; the 4 °C step is
optional and allows the samples to be left in the thermocycler
after the heated incubation steps. After incubation and when
the samples have been pooled, keep the plate with the remain-
ing MM1 and MM2 stored in the fridge until sequencing has
been successfully completed. If there is a sequencing error,
library preparation can be repeated from MM1 stage onwards.
24. The bead concentration used at this step is 0.4X bead volume
to sample volume, thus for 24 pooled samples
(24 × 10 μL = 240 μL. 240 μL × 0.4 = 96 μL). Therefore,
for a 240 μl pooled library volume, add 96 μl of beads.
25. Do not centrifuge at a high speed/force or for an extended
duration of time. Whilst the contents need collecting at the
bottom of the tube, it is important that the beads don’t come
out of solution. The mixture should remain homogenous.
Always centrifuge with the hinge of the Eppendorf tube facing
outwards.
NGS 231
26. Once opened ethanol will absorb water and evaporate, reduc-
ing the ethanol content over time. When the ethanol concen-
tration reduces, the water concentration increases and removes
DNA from the beads during the wash step. Therefore, it is
essential that Ethanol dilutions are prepared fresh daily.
27. Smaller experiments (<15 samples per tube) often need longer
than 2 min to form the bead pellet. Wait until the liquid in tube
is completely clear before proceeding to the next step. This can
take up to 5 min.
28. A lot of care must be taken at this step. If the supernatant is
removed too quickly, it can pull DNA off the beads. Use a
P200 to remove the supernatant, set the volume to half the
total volume in the tube. That is, if there is 300 μL in the tube,
set the pipette to 150 μL so that supernatant can be removed in
a slow and controlled fashion. Keep the pipette tip angled away
from the beads and just below the meniscus of the supernatant;
pipette as slowly as possible; move pipette tip down the tube as
more volume is removed. Before discarding the supernatant,
check the liquid in the pipette tip for beads. If there is any
discoloration indicating the presence of beads, return the
supernatant back to the tube, wait for beads to pellet onto
magnet, and repeat. If it is not possible to remove the last
50 μL without accidentally removing beads, use a P20 or P10
pipette. Holding the magnetic rack at an angle can make it
easier to visualise the beads and the pipetting (Fig. 4).
29. Use 0.5–20 μL pipette tips with a P10 pipette. The longer tip
length allows for greater dexterity within the tube, making it
easier to avoid the bead pellet. For larger experiments with
higher sample numbers and thus more beads, the incubation
time will need to be extended up to 3 min. Do not allow the
pellet to dry completely; it will crack and become difficult to
re-suspend.
30. Use NFW if immediately continuing protocol. If leaving over-
night before proceeding, use Elution Buffer or Tris-EDTA
Buffer pH 8.0. Tris-EDTA and Elution buffer stabilise the
DNA for storage. This is not required if immediately using
the eluate for the next steps of the protocol. This step is a
good place to stop if there is not enough time to continue
the rest of the library preparation. Throw away the tube con-
taining 70% ethanol so that it is not accidentally used in later
steps.
31. For greater precision, when transferring eluate, transfer
3 × 10 μL with a P10 pipette to avoid accidental transfer of
beads.
32. Value is dependent on the number of samples; typically 10 sam-

ples produce 0.5–1 ng/ul, 24 samples 2–8 ng/μL, 48 samples
10–15 ng/ul and 96 samples 20–30 ng/μL.
33. For greater precision, when transferring eluate, transfer
2 × 7.5 μL with a P10 pipette to avoid accidental transfer of
beads.
34. If not immediately using library, it can be stored at 4 °C for up
to 3 months. Storage periods >3 months store at -80 °C. This
is a good place to stop if there is not enough time to load
samples for sequencing (which can take 30–60 min).
35. If hardware check is unsuccessful, restart the instrument/com-
puter. If error message still occurs, contact ONT technical
support.
36. Whenever a Flow Cell Check is performed, it is logged and
recorded by ONT. If there is an issue with the Flow Cell
quality, the Flow Cell ID can be given to ONT tech support
and they can access the Flow Cell check data. A replacement
will be sent out for new Flow Cells if; the fault lies with the
Flow Cell itself, the Flow Cell check has been performed is
within 3 months of delivery, and if it shows fewer than
800 pores. If using a GridION and the Flow Cell check
shows <800 pores for more than one Flow Cell in the same
port (i.e., in X1 port), test the Flow Cell in a different port. If
the port is faulty, turn the GridION off and unplug for 10 sec.
If the problem persists, MinKnow software should be
re-installed. Similarly, if Flow Cells are within date and the
MinION is consistently showing <800 pore values for multiple
Flow Cells, restart or re-install software.
37. Volume should be removed slowly, and carefully. If too much
liquid volume is removed, buffer will be drawn off the sensor
array and will permanently damage the pores. Sometimes the
priming port is blocked, and liquid is not drawn up as the
volume dial is turned. If this happens, try closing and opening
the priming port a few times.
38. Keep pipette upright when transferring Flush-buffer mix from
the tube to the Flow Cell. Holding the pipette at an angle may
cause liquid to move up the tip and create an air bubble at the
bottom. If air is introduced, it will cause irreparable damage to
pores on the sensor array.
39. When the concentration is high enough such that only 1–2 μL
of DNA is used in the dilution step, it can lead to poor
sequencing results. It may be the Qubit slightly overestimates
the concentration; so when adding 1 μL of DNA, there is an
insufficient amount for good-quality sequencing. Thus, in this
instance, a 1:1 dilution is performed to ensure a sufficient
quantity of DNA is added.
NGS 233
40. Once mixed with loading beads and sequencing buffer, the
library must be used immediately and cannot be stored for
use at another time. Always ensure the Flow Cell check has
been successfully completed before performing this step.
41. Steady pipette by resting the shaft of the pipette against the
back of hand. When dispensing, the buffer may bubble out of
the Spot-on port. If this occurs, pause or slow down dispensing
to prevent buffer overflow. Do not raise thumb on the pipette,
thus drawing liquid back up into the pipette. If the buffer is
removed from the sensor array and air is introduced, damage to
Flow Cell pores will be irreparable. Pores in contact with air
bubbles will perish and become inactive; this will be indicated
in the low number of available pores reported in the sequenc-
ing overview.
42. Do not pipette directly into the SpotON port as this will
introduce air and damage the sensor array. Sometimes when
the Flow Cell has been used before, the SpotON port can
become blocked with dried precipitate from the last library.
Try carefully re-opening and closing the port, or if this fails
carefully chip away the precipate from around the port using a
small sterile pipette tip, being careful not to touch the sensor
array. If this does not resolve the issue then a new Flow Cell will
need to be used.
43. Label experiment as desired with an easily identifiable naming
scheme to track sequencing runs. We recommend prepending
IDs with the run date for simple chronological ordering (e.g.,
20201120_Experiment001_Run001).
44. Ensure there is enough disk space on the computer for the run
to complete. Delete previous runs as required. If there is not
enough disk space, sequencing will automatically stop. If this
occurs, delete previous files and then restart sequencing with a
new experiment ID. Data from both runs can be combined
during analysis by the bioinformatician. If the Flow Cell has
been sat inactive for a long time, restarting the run on the same
Flow Cell may not produce any data. If there is any library
remaining, prepare a new library for sequencing and run on a
fresh Flow Cell.
45. Wait 5 min before checking the run (at the start of the run the
Flow Cell health is loading and is not accurate). A common
issue seen at this stage is that there is a low number of pores
being utilised for sequencing despite there being a large num-
ber available (Fig. 6). This is usually caused by an error during
the adapter ligation steps. If the adapter has been insufficiently
ligated or missed in error, despite there being a high concen-
tration of DNA in the second quantification, the DNA will not
be transported through the pores. If the DNA is not being
transported through the pores, a low quantity of data will be
produced and the Flow Cell Health will rapidly decline as pores
perish when they are not being utilised. Library preparation
will have to be repeated and loaded onto a new Flow Cell. If the
Flow Cell Health rapidly drops to show mostly recovering and
inactive pores (indicated in blue – Fig. 6), this suggests insuffi-
cient quantity of DNA being added.
46. After the run has finished, it is normal to see small condensa-
tion bubbles above the sensor array.
Acknowledgments
The authors would like to thank Dr Sharon Glaysher, Jo Herbert

and Alex Gould for their expertise and guidance during the creation
of this book chapter.
References
1. Piccinni M, Sharpe C, Guille M (2019) Using 7. Castro-Wallace SL, Chiu CY, John KK et al
HDR and a template to introduce an in-frame (2017) Nanopore DNA sequencing and
HA tag on the 3′ end of the Xenopus laevis genome assembly on the international Space
gata2.L open reading frame. microPubl Biol Station. Sci Rep 7. https://doi.org/10.1038/
2019. https://doi.org/10.17912/MICRO S41598-017-18364-0
PUB.BIOLOGY.000170 8. Stahl-Rommel S, Jain M, Nguyen HN et al
2. Ran F, Hsu P, Wright J et al (2013) Genome (2021) Real-time culture-independent micro-
engineering using the CRISPR-Cas9 system. bial profiling onboard the international Space
Nat Protoc 8:2281–2308. https://doi.org/ Station using Nanopore sequencing. Genes 12:
10.1038/NPROT.2013.143 1 – 1 8 . h t t p s : // d o i . o r g / 1 0 . 3 3 9 0 /
3. Koch B, Nijmeijer B, Kueblbeck M et al (2018) GENES12010106
Generation and validation of homozygous 9. Korber B, Fischer WM, Gnanakaran S et al
fluorescent knock-in cells using CRISPR/ (2020) Tracking changes in SARS-CoV-
Cas9 genome editing. Nat Protoc 13:1465. 2 spike: evidence that D614G increases infec-
https://doi.org/10.1038/NPROT.2018.042 tivity of the COVID-19 virus. Cell 182:812.
4. Furtmann N, Schneider M, Spindler N et al https://doi.org/10.1016/J.CELL.2020.
(2021) An end-to-end automated platform 06.043
process for high-throughput engineering of 10. du Plessis L, McCrone JT, Zarebski AE et al
next-generation multi-specific antibody thera- (2021) Establishment and lineage dynamics of
peutics. MAbs 13:1955433. https://doi.org/ the SARS-CoV-2 epidemic in the UK. Science
10.1080/19420862.2021.1955433 (New York, NY) 371:708–712. https://doi.
5. Goodwin S, McPherson JD, McCombie WR org/10.1126/SCIENCE.ABF2946
(2016) Coming of age: ten years of next- 11. nCoV-2019 sequencing protocol v3 (LoCost).
generation sequencing technologies. Nat Rev https://www.protocols.io/view/ncov-2019-
Genet 17(6):333–351. https://doi.org/10. sequencing-protocol-v3-locost-bh42j8ye.
1038/nrg.2016.49 Accessed 15 Aug 2021
6. Goordial J, Altshuler I, Hindson K et al (2017) 12. Community – Protocol – Native barcoding
In situ field sequencing and life detection in genomic DNA (with EXP-NBD196 and
remote (79°26′N) Canadian high Arctic per- S Q K - L S K 1 0 9 ) . h t t p s : // c o m m u n i t y.
mafrost ice wedge microbial communities. nanoporetech.com/protocols/native-
Front Microbiol 8. https://doi.org/10. barcoding-96-gdna/v/nbe_9121_v109_
3389/FMICB.2017.02594 revb_19jan2021. Accessed 15 Aug 2021
Chapter 17
Ethics, Legality, and Safety for Geneticists

Simon E. Kolstoe
Abstract
Never before have we had the methods to edit or manipulate genes and genomes in the way we can today.
This volume has described technologies that, a generation ago, were unthinkable. But such power raises
broader issues on how we wield it. These concerns are relevant at a number of levels, from basic safety,
through the importance of scientific reproducibility and transparency, to Ethical, Philosophical, or even
Political considerations. But why should this matter to a laboratory scientist – surely results are the main aim
of experiments? However, such a view misses the important point that alongside our research generating
new information, experience gained conducting research can also be used for influence far beyond the lab
bench. Indeed, how research is conducted can be as important as the results themselves because our actions
also reflect and inform the values that society and us as individuals view as important. Rather than focusing
on the details of policy or legislation, this chapter therefore seeks to reflect on how Ethics, Legality, and
Safety impact the molecular biologist, and why researchers need to view these not as bureaucracy, but rather
as a critical part of their wider scientific identity and task.
Key words Scientific ethics, Regulations, Safety
1 Introduction
The words “Health & Safety” and “Ethics” often raise feelings of
frustration and consternation among laboratory scientists. Science
is hard enough without having to contend with bureaucracy,
administration, and often the perception that while having roles
that supposedly support research, others actively seem not to want
experiments to be conducted. This razor sharp focus on getting the
experiment done is entirely necessary for researchers to remain
motivated through frustrations and set-backs, but can obscure the
broader picture of why experiments are conducted in the first place.
The intricacies and complexity of biochemical systems mean that
although the relevance of a specific result is often limited, the
experience gained by the researcher, and the attitude and behavior
they demonstrate while conducting the work, can sometimes be as
important as the result itself. Society needs people who are able to
https://doi.org/10.1007/978-1-0716-3004-4_17,
235
236 Simon E. Kolstoe
think carefully and deeply about problems so as to find creative

solutions. The attitudes and insights learned at the lab bench are
widely applicable, so must also be considered as an important
result—or perhaps impact—of conducting experiments. It is there-
fore unfortunate when laboratory scientists only see the bureau-
cracy and miss the fact that ethical, legal, and safety processes are an
engagement with the wider societal context of research. Within the
area of genetic engineering the issues raised can be as interesting,
and certainly as complex, as some of the biochemical experiments
themselves.
In 1975 leading international molecular biologists met in the
Asilomar Conference Centre in California to discuss the risks of
recombinant DNA technology [1]. Two years earlier, concerns for
the emerging capabilities of this technology were raised at Gordon
Research Conference on Nucleic Acids, leading to a letter pub-
lished by the US Academy of Sciences calling for a moratorium
on experiments using recombinant DNA until the hazards had
been discussed. The Asilomar conference and its subsequent guide-
lines are widely viewed as a pivotal moment in the development of
scientific responsibility, especially from the perspective of the life
sciences community [2]. However, one critique of the Asilomar
conference was that the recommendations were very practical in
nature, not really focusing on some of the wider Philosophical
implications of the technology. Today, such a conference would
no doubt have included a significant number of Bioethicists, many
with practical laboratory experience in cloning and other related
techniques, but at the time, the science was still too new for many
beyond those immediately involved in the lab to really understand
the significance of what was being developed. Thus it was no
surprise that the subsequent recommendations took a mostly
health and safety, risk minimization, approach to the issue.
Now, almost 50 years later, technologies such as CRISPR/
Cas9 provide the capability to make almost any modification to
the genome. Although clearly valuable scientific tools, what are the
boundaries for using such technology, and can the public trust
scientists to use them responsibly? Already, just considering
CRISPR related technologies, a scientist is behind bars in China
for creating gene edited babies [3], and there are frequent calls for
moratoriums on the use of this technology for certain applications
[4]. There are also large and complex legal battles over who can use
and profit from the technology and in what ways [5]. While most
scientists are not directly in the position to abuse genetic technol-
ogy, how should geneticists and molecular biologists approach their
work on a daily basis, and what boundaries should be in place?
This volume provides a manual for applying a wide range of
sophisticated genetic technologies. But alongside these methods, it
is important to at least be aware of the inherent ethical, legal, and
safety issues. How should the community of laboratory scientists
Ethics and Legality 237
engage with others outside the community to ensure that legisla-

tion, guidance, and frameworks are updated alongside scientific and
methodological developments? How should scientists engage with
the philosophical, ethical, and sometimes political ramifications of
their work?
This short chapter will not be able to address or note all issues
discussed by Bioethicists in an increasingly large and complex land-
scape. However, over the following pages, I will attempt to lay out a
framework that can be used by scientists and researchers as they
plan, conduct, and then reflect on their work. By examining and
distinguishing between the concepts of Research Integrity,
Research Governance, and the role of Independent Review, I will
highlight the different considerations that a practical researcher
needs to address as they seek to make reliable, responsible, and
hopefully ground breaking discoveries. I also seek to encourage
active researchers to engage in the wider social and philosophical
discussion that their work stimulates.
2 Research Integrity
To many scientists research integrity is interpreted as being

concerned with research results: how robust, reliable, and critically
reproducible are the experiments being reported? Much has been
made about a so-called “reproducibility crisis” affecting life science,
wherein many published experiments turn out to be near impossi-
ble to reproduce or replicate [6]. This is concerning as it suggests
much of the literature (some estimates are as high as 40% in certain
subject areas) could be wrong. However, while clearly concerning,
it is important to consider the reasons why science can often not be
reproduced. While misconduct will occur among any group of
humans, especially when there is competition for resources, it is
unlikely that this reproducibility problem is caused solely, or even
mainly, by dishonest behavior. Instead, as anyone who has con-
ducted research in life sciences will know, the systems being studied
are immensely complex. Indeed the main challenge for researchers
is to work out how to articulate a research question in such a way
that the methods available to the research team can be used
to address it in a meaningful way. Likewise methodologies are so
complex that laboratories often only have a limited number of
techniques available to them, and thus even working with colla-
borators, it can be hard to design an experiment that always gives a
meaningful answer to a research question. The matter is signifi-
cantly complicated when many of the tools used for the research
have to be created in a bespoke manner, perhaps special cell lines,
antibodies, or other reagents that are often themselves the focus of
years of development. As a consequence, while a criterion of publi-
cation is a clear research question and result, often the tools used to
get to this are simply not available to anyone outside the specific
research groups with many years of prior experience or preparatory
work. Add to this the complexities caused by variations in the purity
and availability of even simple consumables, and the pressures
created by limited funding and the constant push for novel results,
and it is really no surprise that many experiments or results cannot
legitimately be reproduced.
This situation is clearly regrettable, but there are only really
three courses of action that concerned scientists (and others within
the research system) can take. The first is to devote considerable
(and potentially up to 50% of available science funding) to repeat-
ing experiments. While such a course of action will definitely
improve the quality of the literature and thus the reliability of
existing knowledge, it is unlikely to produce the rapid results
needed (and expected) by the wider community that commissions
and funds research. The second response might be to acknowledge
the problem, but then just accept that this is a hazard of the
profession, and thus something any good researcher needs to take
into account when they rely on previous work to plan their new
experiments. Indeed many, perhaps more experienced, researchers
might be heard to comment anecdotally that they have always
known that there is a lot of “nonsense” in the literature. The
problem with this approach is that it is extremely wasteful, with
one famous study, commenting on medical research in particular,
reporting that “85% of research is wasted, usually because it asks the
wrong questions, is badly designed, not published or poorly reported”
[7]—such a figure is not helpful when trying to argue for increased
funding! As a consequence, the third, and only really practical
response to the reproducibility problem, is to pursue a middle
path of acknowledging the problem, acknowledging the reason
for the problem, and then seeking to conduct research in such a
way that minimizes waste wherever possible. Scientists should also
engage more broadly within both their research areas and also
wider academic communities supporting efforts to improve
research culture through education, and initiatives aimed at helping
improve the research process as a whole. Far from being a distrac-
tion, these activities are fundamental to the process of doing good
science and thus being a researcher.
Based on this argument it should be clear that the attitude of
researchers is vitally important for the production of good science.
A 2014 survey by the UK’s Nuffield Council on Bioethics (among
mostly life scientists) highlighted specific virtues (or character
traits) viewed as essential for the production of high-quality
research. These were being rigorous, accurate, original, honest,
and transparent, followed by supporting collaboration, multidisci-
plinarity, openness, and creativity [8]. Such traits can only really be
learned “on the job” so to speak, emphasizing the importance of
strong mentoring and good academic role models. Often only lip
service is paid to such “staff development” activities; however, to

not take this seriously misses the opportunity to minimize future
research waste. If we are to take our science seriously, we must focus
on ensuring both our own behavior, and the behavior of those we
work with, demonstrates the virtues of a good researcher wherever
possible. To do so is to act with integrity, and thus ensure the
overall integrity of our contribution to scientific knowledge.
While this issue of research integrity impacts every area of
research, those working in the field of genetic engineering must
also appreciate the social and philosophical discomfort caused by
aspects of their work. Although such discomfort often comes from
a relatively poor understanding of what genetics is and how genes
work, researchers must nevertheless appreciate that work in this
area attracts more ethical comment than almost any other type of
research. The rapid expansion on CRISPR technologies (and con-
troversies) over the last ten years or so is a case in point. As a
consequence, maintaining high levels of rigor, accuracy, honesty,
and transparency in particular are needed so as to maintain public
trust and thus support for this type of research. Returning to the
issue of reproducibility, genetic researchers in particular cannot
afford to make high profile mistakes or, even more importantly,
be found to engage in dishonest or ethically questionable behavior.
In a field that stimulates heated moral and ethical debate even prior
to a pipettor being raised, a failure of integrity in the conduct of
researchers can have wide ranging and potentially research stopping
consequences. The next section addresses the topic of legal control
and, in some cases, prohibition of certain research activities. Often
there are good reasons for legal constraints, but it is important that
such constraints are formulated based on careful and rational con-
sideration of the issues at stake, not as a knee jerk public reaction to
dishonest and ethically dubious behavior by the research commu-
nity itself.
3 Research Governance
Whereas research integrity refers to the behavior and attitude of

scientists, research governance refers to the laws and policies that
govern research. Laws are generally implemented at a national level,
whereas policies are implemented at more local levels by funders,
research sponsors, companies, and institutions. Where research
breaks the law both researchers and their hosting institutions can
be prosecuted in court, while research that contravenes policy often
leads to the withdrawal of research funds and researchers losing
their jobs. An additional penalty that particularly affects academic
researchers is the retraction of research papers and subsequent
consequences to professional reputation.
While law and policy are implemented on a national and local

level, they are often based upon international agreements, treaties,
declarations and conventions. Given the high profile of genetic
engineering and related technologies, a large number of these
international guidance documents have been produced. Attempts
to systematically map these documents is complicated by overlap,
and often explicit mention of genetic manipulation activities, within
other international agreements covering issues like importation/
exportation, data protection, health and safety, environment pro-
tection, etc. Similarly, regional, legal, binding agreements such as
the European “General Data Protection Regulations” (GDPR)
cover genetic data (in the case of GDPR in relation to special
category personal data). How these international agreements are
turned into, and then enforced, varies on a country by country
basis. This clearly makes it very difficult to provide a complete
overview of the legislation and policy that apply to each laboratory
conducting work in this area. However, what follows is a brief
summary of the basic governance areas that apply to researchers
seeking to carry out genetic experiments. As a matter of researcher
integrity, readers are encouraged to explore the exact details that
apply to them through their own local and national governance
structures.
3.1 Health and Safety Health and Safety procedures should be familiar to anyone working
(Physical, Chemical, within a laboratory. Biosafety levels dictating containment arrange-
Biological) ments and are broadly consistent internationally. Biosafety Level
1 (BSL1) covers the handling of well-characterized agents that do
not cause disease in humans; Biosafety Level 2 (BSL2) covers the
handling of mildly infectious agents (to both humans or the envi-
ronment); Biosafety Level 3 (BSL3) covers the handling of highly
infectious and lethal agents, and Biosafety Level 4 (BSL4) is the
highest level for handling aerosol transmitted lethal agents. The
majority of genetic modification experiments can be routinely han-
dled at BSL1; however, if organisms are being created that can
potentially infect humans (most commonly using viral vectors),
BSL2 or above may be needed.
Every laboratory with a BSL categorization will confirm to
certain standards but should also have in place specific local risk
assessments that researchers need to be made aware of prior to
working in the laboratory. Local risk assessments will often also
cover other physical, chemical, and radiological risks that, while not
directly part of Biosafety, are often dictated by parallel standards. As
a consequence, local risk assessments and arrangements will often
refer to Biosafety Standards but then extend to also include the
various other (commonly nationally defined) standards that are
being addressed. Importantly, in order to meet such standards,
laboratories also often have to register with a regulator and allow
themselves to be open to both internal and external inspection so as
to reassure regulators, and perhaps the public in general, that

they are complying to the required standards. Outcomes from
external inspections may then help shape the local policies and
arrangements within the respective labs, for instance, requirements
for frequent local inspections, maintenance schedules on specialist
equipment, etc.
3.2 Genetically Closely linked to the more general health and safety arrangements
Modified Organism described above, countries may also have specific legislation or
Legislation/Policy policies governing the laboratory handling of genetically modified
organisms in particular. Often containment arrangements for such
organisms closely parallel Biosafety Level arrangements wherein the
level of BSL is dictated by the type of genetic modification. Such an
alignment makes pragmatic sense as it allows for multiple proce-
dures, both genetic and biochemical, to be carried out within the
same laboratories and under safety arrangements that are suitable
for all such work. However, such legislation also often includes the
requirement for registration of experiments as countries or regions
seek to keep a record of the types and details of genetic modification
work that is being carried out. Such reporting requirements do vary
considerably between settings, but whereas general chemical/
biological/physical standards are ensured through regular inspec-
tions, genetic modification work may trigger additional reporting
or registration requirements. Here, it should be noted that experi-
ment using human tissue, especially human embryos, is often
highly regulated and subject to numerous laws and standards that
are legally enforced by various national regulators. Indeed the
majority of court cases and criminal convictions handed out to
scientists due to their research activities are within this area. As a
consequence all researchers wishing to work in this area should be
encouraged and ideally funded to attend specific courses relevant to
their regulatory context.
3.3 Ethics Policies The above two sections focus mainly on the practical elements of
laboratory work with the aim being to protect researchers and the
environment. Coupled to this there may be broader limitations on
the type of genetic work that can be carried out. Such limitations
are often defined nationally by statute and reflect each nation’s
political and social acceptance of genetic modification. Here inter-
national statements (such as UNESCO’s Universal Declaration on
Bioethics and Human Rights) are clearly influential, but how the
principles are translated into national law is mostly based on local
dialogue. Regulators may well be established to oversee legislation,
authorize experiments or laboratories, and conduct inspections
alongside (or as part of) Health and Safety regulation. This formal
process is often coupled with less formal arrangements dictated by
funders who may, for instance, prohibit certain types of working
being conducted using money from their funding schemes.
Similarly there are some funders who will not release funds to
institutions or organizations that conduct any work—even if
funded by others—that go against their principles. Such arrange-
ments are generally outlined clearly in guidance from regulators or
funders and then transferred into local policy in Universities or
other organizations seeking to conduct relevant work.
The above three legal and governance areas reflect processes
that can broadly be handled using administrative processes, be it
through inspection, standard operating procedures, or the audit of
policy requirements. Compliance with such processes is often not
negotiable from the individual scientist perspective. However, sci-
ence moves quickly and such processes may not always be sufficient,
or relevant, to newer discoveries or methodologies. In such cases
mechanisms need to be in place to discuss new situations and
arrange suitable oversite. This may be through updating regula-
tions or engaging with the wider research community to decide
what work is acceptable or not. Here independent review can
be key.
4 Independent Review
All scientists understand the value, but perhaps also weakness and
frustrations, of peer review. This is traditionally encountered at the
beginning and end of research through the review of grants sub-
mitted to funders, and then of manuscripts submitted to journals.
Independent review is also used during promotion and recruitment
processes. But such peer reviews can be frustrating as they are open
to abuse. However, if reviewers take seriously the virtues described
above in the researcher integrity section, they can add significant
value to the research process. This is because it is not easy to design
research, choose methodologies, analyze data, and then interpret-
ing results (let alone communicate them clearly). While increasingly
sophisticated guidance and even computational methods are avail-
able, sometimes there is no substitute for another scientist, with
sufficient experience and ideally a level of neutrality, reviewing
the work.
But within fields that conduct research with human participants
independent review also serves a second function beyond reviewing
scientific validity. Following the Second World War, the develop-
ment of the Nuremberg code and the subsequent 1964 Declaration
of Helsinki by the World Medical Association research ethics com-
mittees were established as central to any research involving human
participants:
The research protocol must be submitted for consideration, comment,
guidance and approval to the concerned research ethics committee before
the study begins. [9]
The establishment of such committees is now routine within

human participant research communities from medicine, through
Psychology and increasingly even in the Social Sciences. While the
value of such reviews in protecting the rights, dignity, autonomy,
and safety of human participants is perhaps obvious, the contribu-
tion of an ethics review to non-human participant research can be
less obvious. However, increasingly the role of ethics committees is
not just about protecting participants but also includes promoting
and supporting researchers in conducting high quality research. As
a consequence, their remit is being extended far wider than human
participant research with institutions and other research sponsors
increasingly using them as part of their governance processes to
check that researchers are understanding and following responsible
research practice. For instance, the European Union requires that
the majority of projects funded through their various grant schemes
are reviewed by independent “ethics experts” (who may or may not
be working in a committee context depending on the complexity of
the research) in parallel with the scientific review of studies and
prior to any funding being awarded. Likewise, many institutions
insist that all their staff and students submit their research plans to
an often proportionate process of review depending on the risks
associated with their research. In the United States, such commit-
tees are often called “Institutional Review Boards” (IRBs) to
emphasize this role encompasses both ethics review and institu-
tional governance processes.
While in many cases the existence of independent review com-
mittees are based on local policy, many countries also require such
reviews by law for certain types of research. Medical Research, and
in particular, research leading to the development and licensing of
new drug products, is often heavily regulated with the legal require-
ment for both ethics, and also safety and efficacy reviews, through
organizations such as the UK’s Medicines and Healthcare products
Regulatory Agency (MHRA) and Health Research Authority
(HRA), the US’s Food and Drug Administration (FDA), and the
European Medicines Agency (EMA). Likewise research involving
animals, and especially vertebrates and non-human primates, is
heavily legislated and controlled through national networks of
legally constituted review committees. Research access to large
health systems (such as the UK’s National Health Service (NHS))
is also controlled through processes of independent review and
oversight. Finally, even when humans or animals are not partici-
pants in research, some countries also require the review of certain
types of research—such as that using genetic modification—by
independent committees prior to any research getting underway.
Again, the national structures vary considerably and researchers are
encouraged to seek training and also engagement within their own
national context.
However, there is no escaping that such reviews can often be

viewed as burdensome and disruptive by researchers who are often
keen to get on with their experiments [10]. But, as mentioned in
the discussion on both research integrity and governance, research-
ers do not conduct their work in a vacuum. In many ways research-
ers are both protected and given considerable freedoms to conduct
science by the law, their institutions, and their professions. In
return, it is not unreasonable to allow a level of scrutiny so as to
ensure accountability, but also as a means of gaining support and
reassurance that plans are reasonable and will, hopefully, lead to
meaningful results. While such systems are indeed better estab-
lished within direct human participant research, increasingly, they
are becoming expected—and needed—in all areas of research.
5 Conclusion
It is an exciting time to be a geneticist. CRISPR technologies in

particular are opening new experiment, therapeutic and engineer-
ing possibilities that hitherto have only been discussed in science
fiction. Indeed the Science Fiction writer Arthur C. Clarke (writing
in the Journal Science) perceptively observed that “any sufficiently
advanced technology is indistinguishable from magic” [11]. This
quote is an important one for highly trained scientists to remember
because we live in communities where the majority do not under-
stand, and never will have the opportunity to be taught about, the
activities that are conducted in our laboratories. As a consequence
alongside conducting our experiments, we must make considerable
efforts to ensure transparency and openness. This comes from
behaving well (integrity), following the rules (governance), but
also self-policing and engaging in policy development/discussion
(Independent Review). The possibilities of genetic engineering are
powerful and exciting, but to many people remain a type of
“magic.” Alongside the power of using our technology, we must
ensure we are responsible in how we wield this power.
References
1. Berg P (2008) Asilomar 1975: DNA modifica- 3. Cyranoski D (2020) What CRISPR-baby
tion secured. Nature 455:290–291. https:// prison sentences mean for research. Nature
www.nature.com/articles/455290a 577:154–155. https://www.nature.com/arti
2. Institute of Medicine (US) Committee to cles/d41586-020-00001-y
Study Decision Making (1991) Biomedical 4. Lander, E. S., Baylis F (2019) Feng Zhang et al
politics. In: Hanna KE (ed) Asilomar and Adopt a moratorium on heritable genome edit-
recombinant DNA: The end of the beginning. ing. Nature 567:165–168. Available from:
National Academies Press (US), Washington, https://doi.org/10.1038/d41586-019-
DC. Available from: https://www.ncbi.nlm. 00726-5. https://www.nature.com/articles/
nih.gov/books/NBK234217/ d41586-019-00726-5
5. Cohen J (2020) The latest round in the 8 . h t t p s : // w w w. n u f fi e l d b i o e t h i c s . o r g /

CRISPR patent battle has an apparent victor, publications/the-culture-of-scientific-
but the fight continues. Science. https://www. research
science.org/news/2020/09/latest-round- 9. https://www.wma.net/policies-post/wma-
crispr-patent-battle-has-apparent-victor-fight- declaration-of-helsinki-ethical-principles-for-
continues medical-research-involving-human-subjects/
6. Baker M (2016) 1,500 scientists lift the lid on 10. Petrova M, Barclay S (2019) Research
reproducibility. Nature 533:452–454. https:// approvals iceberg: how a ‘low-key’ study in
doi.org/10.1038/533452a England needed 89 professionals to approve it
7. Glasziou P, Chalmers I (2016) Is 85% of health and how we can do better. BMC Med Ethics
research really “wasted”? January 14, 2016. 20:7. https://doi.org/10.1186/s12910-018-
https://blogs.bmj.com/bmj/2016/01/14/ 0 3 3 9 - 5 . h t t p s : // b m c m e d e t h i c s .
paul-glasziou-and-iain-chalmers-is-85-of- biomedcentral.com/articles/10.1186/s12
health-research-really-wasted/ 910-018-0339-5
1 1 . h t t p s : // w w w. s c i e n c e . o r g / l o o k u p /
doi/10.1126/science.159.3812.255-b
INDEX
A DpnI .............................................. 27, 28, 31, 34, 35, 39,

40, 42, 43, 47, 49, 88, 90–93
Agarose gel dsDNA...................................................... 17, 51, 89, 118,
DNA gel loading dye ................................... 12, 35, 39 119, 147, 151, 155, 159, 215, 217, 229
DNA size ladder ..................................................12, 16
ethidium bromide (EtBr) ..........................12, 84, 118 E
TBE............................................................................ 12
transilluminator ...................................................27, 28 Epitope tag ........................................................... 135, 136
Allotetraploidy............................................................... 112 Escherichia coli (E. coli)
Ancient DNA .................................................................. 58 dam+ ............................................................. 88, 90, 93
Aptamers.................... 145–160, 166–169, 172, 177–179 DH5α.................................................... 27, 29, 30, 47,
57, 59, 62, 63, 103, 106, 160
B HB101 ................................................... 147, 153, 157
JM109........................................................................ 57
Barcode ......................215–217, 220–223, 227, 228, 230 One Shot ........................................................ 102, 104
Beta-lactamase .................................................... 1, 20, 157 recA ............................................................................ 33
Bioethics ............................................................... 238, 241 Top10 ..............................................57, 102, 104, 106
European Xenopus Resource Center (EXRC) ............. 98,
C
99, 106, 107, 135
ccdb gene................................................................ 98, 106 Exonuclease activity ..................................................30, 92
cDNA............................................................................. 128
Cloning F
classical.................................................................45, 55
FLAG tag ......................................................................... 40
directional ....................................................... 6, 19, 20 Fosmid .................................................................. 103, 107
gateway ...................................................................... 12 Frameshift ............................................................. 117, 126
Gibson ........................................ 12, 34, 45, 133, 137
modular cloning (MoClo) ..................................12, 45 G
sequence and ligation independent cloning
(SLIC)..................................................... 11, 25–31 γ-crystalline............................................99, 101, 104, 106
TA .................................................... 11, 55–57, 64, 86 Gene synthesis ..................... 35, 41, 43, 65–78, 178, 180
TOPO ........................................................................ 11 Genotyping................................................. 112, 115, 116,
Clustal ................................................................... 117, 157 118, 121, 122, 125, 139
Codon.................................... 4, 11, 37, 38, 42, 125, 135 Green fluorescent protein (GFP) ..................98–101, 104
CRISPR/Cas9........................ v, 111–129, 131, 138, 236
H
CRISPRscan ................................................ 117, 118, 135
Hexachlorofluorescein (HEX)............................. 147, 158
D Histag .............................................................................. 40
Damaged ends................................................................. 57 Homologous .................34, 36–39, 41, 42, 46, 132, 135
Defolliculation............................................................... 137 Homology directed repair (HDR)............................... 132
Deoxynucleotide triphosphates (dNTPs) .............. 12, 15,
I
25, 27–29, 34, 46, 47, 49, 68, 72, 81, 82, 88, 89,
92, 93, 113, 115, 133, 134, 149, 213 inDelphi ....................................................... 117, 126, 128
DNA assembly..............................................33–36, 39–43 Intracytoplasmic sperm injection (ICSI) ............ 131–142
DNA synthesis................................................................. 76
https://doi.org/10.1007/978-1-0716-3004-4,
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer
Nature 2023
247
DNA MANIPULATION AND ANALYSIS
248 Index
In vitro ........................................................ 34, 68, 87–94, Plasmid
114, 132, 164–172, 174–178, 180–182 CloneJET................................................................. 160
In vivo .......................... 33–37, 39–43, 99, 111, 117, 128 pBlueScript ................................................................ 22
I-SceI .............................98, 99, 101, 102, 105, 107, 108 pBR322...................................................................... 22
pET-28b(+) .........................................................19, 21
K pGEM®-T Easy ..................................................56, 64
Katushka ................................................ 99–101, 104–106 pJET1.2 ................................................................... 160
pUC19.......................................................... 5, 22, 160
L Polyacrylamide gel electrophoresis (PAGE) ...............148,
152, 156, 213
Lambda-exonuclease............................................ 145–160 Polymerase chain reaction (PCR) ........................... v, 4, 6,
Legality ................................................................. 235–244 7, 9, 11–13, 15–19, 21–23, 25–30, 34–36, 38–43,
Ligase .......................................2, 6–9, 11, 13, 16, 19, 22, 46–53, 55–57, 60–65, 68, 71–73, 77, 81–94, 99,
45–47, 51, 56, 61, 98, 158, 217, 220, 221, 223 103, 107, 108, 113, 115, 118, 122, 128, 136,
Long single stranded DNA (lssDNA) ................ 135–137 137, 147–151, 154, 155, 158–160, 180,
195–210, 213, 217, 218, 228–230
M
PPE ............................................12, 15, 57, 99, 113, 116,
Melting temperature (Tm) ...............................19, 29, 42, 133, 148, 153, 198, 199
66, 67, 89, 93, 134, 137, 158, 201 Primer
Microarray ........................................... 164–177, 180–183 design.............................................. 20, 29, 34, 36–38,
Micro computed tomography (MicroCT) .................112, 42, 46, 48–50, 68–70, 75, 85, 90, 93, 178, 201
122, 124, 125 overlapping ............................. 48, 49, 66, 75, 76, 208
Microinjection .............................. 97, 114, 116, 119, 138 Promoter ........................................... 4, 5, 20, 31, 43, 75,
Multiple cloning site (MCS) ........................................ 1, 5 88, 98–101, 103, 104, 107, 118, 125, 167, 168,
Mutagenesis 177, 178
deletions...............................................................52, 87 Protein expression .........5–7, 14, 25, 125, 131, 164, 195
insertions .............................................................52, 87 pTransgenesis ..........................................................97–108
random ...................................................................... 81
site-directed (SDM) ......................34, 52, 78, 87, 195 R
substitutions ................................................. 52, 82, 87 Recombinant ........................................ v, vi, 1–23, 25, 98,
101, 104, 155, 158, 160, 195, 236
N Red fluorescent protein (RFP) ....................................... 40
Nonsense mutations ................................... 111, 125, 238 Restriction enzyme
blunt ends ..............................................................6, 20
O sticky ends...................................................4, 6, 20, 25
Reverse-phase HPLC (RP-HPLC) ....187, 188, 190–193
Oligonucleotide ....................................... v, vi, 49, 50, 52,
Ribosomal binding site (RBS)....................................4, 20
65, 66, 76, 78, 112, 113, 118, 126, 146–150,
Riboswitches................................................ 145, 146, 163
153, 155, 157, 158, 164, 166, 172, 176–178,
Ribozymes ................................................... 145, 146, 163
180, 185–193, 196
RNA ................................................. 5, 31, 113, 114, 116,
Oocytes ................................................................ 118, 119,
118, 120, 121, 128, 145–147, 163–183, 185, 228
132–134, 137–139, 141
RNAfold ...................................................... 157, 169, 174
Origin of replication (ori)...................................... 1, 5, 19
S
P
Safety.............................................................209, 235–244
PCR SAR-CH4 insulator................................................ 99, 101
colony ................................................. 4, 9, 18, 19, 23, SARS-CoV-2 ........................................................ 216, 226
34, 51, 64, 88, 91–93, 158, 160, 213 Secondary structure .......................... 20, 50, 89, 93, 120,
error-prone .......................................................... 81–86 147, 153, 155, 157, 166–169, 178, 201, 209, 210
Peer review .................................................................... 242 Selectable marker
Phenotyping ........................................112, 116, 122, 125 ampicillin ..........................5, 27, 48, 59, 64, 104, 107
Phosphoramidite chemistry...................................... v, 185 chloramphenicol..................................................27, 48
Phosphotungstic acid (PTA) ...................... 112, 116, 122 kanamycin .......................................13, 14, 21, 27, 30,
Phusion DNA polymerase ........................................47, 51 48, 59, 64, 103, 107
DNA MANIPULATION AND ANALYSIS
Index 249
Sequencing T
long read.................................................................. 214
low throughput ....................................................... 197 Taq DNA Polymerase .......................................12, 15, 51,
nanopores ....................................................... 214, 216 55, 56, 81, 82, 84, 85, 113, 115, 150
next generation .............................................. 160, 216 T4 DNA polymerase .................................................25–27
Sanger ............................................... 9, 11, 23, 31, 99, Thermodynamically balanced inside-out
121, 123, 127, 128, 158, 195–197, 213 (TBIO)...........................................................65–78
Single guide RNA (sgRNA) ............. 112, 113, 117, 118, Transformation..............................................2–4, 7, 9, 14,
120–122, 125–129, 135, 138 16, 18, 20–22, 29, 31, 34–36, 39–43, 47, 59,
Site-specific recombination........................................... 100 61–64, 88, 91, 93, 94, 98, 148, 155, 158–160
Snapgene Viewer .......................................................36, 48 Transgenesis ............................................................97–108
SOC broth ....................................................................... 14
U
Software
ABI Seqstudio ...............................197, 198, 204, 206 Untranslated region (UTR) ......................................... 117
ApE editor ................................................................. 50
OligoCalc...................................................... 20, 36, 42 V
SnapGene....................................................36, 48, 113
Vectors .................................................. 1, 4–9, 11, 13, 16,
Spectrophotometer ...........................................13, 17, 22,
19–23, 25–31, 34, 36–38, 41–43, 46, 48–50, 52,
27–29, 99, 102, 113, 120, 149, 150, 153, 155
55–59, 61, 62, 64, 68, 78, 87, 98–101, 103, 104,
Sperm nuclei ................................................ 132, 139, 141
106, 133, 136, 150, 158, 160, 240
ssDNA................................................ 116, 118, 119, 134,
137, 138, 146, 147, 149, 151–157, 159, 160, 215 X
Sticky ends .......................................................... 25, 43, 46
Streptavidin.................................................. 174, 175, 178 Xenopus
Synthetic biology ...................................... 45, 46, 66, 164 laevis.................................................... 57, 97, 99, 112,
Systematic evolution of ligands by exponential 115, 125, 127, 131–142
enrichment (SELEX)................................ 145–160 tropicalis................................................. 112, 115, 125
X-gal................................................................................... 9

Dna Manip

Uploaded by

Copyright:

Available Formats

Dna Manip

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Dna Manip

Uploaded by

Copyright:

Available Formats

Methods in

Molecular Biology 2633

Garry Scarlett Editor

For further volumes:

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Portsmouth, UK Garry Scarlett

1 Classical Recombinant DNA Cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1

14 Chemical Synthesis of Oligonucelotide Sequences: Phosphoramidite

ANITA ABU-DAYA • European Xenopus Resource Centre, University of Portsmouth,

SAMUEL C. ROBSON • Centre for Enzyme Innovation, University of Portsmouth, Portsmouth,

Classical Recombinant DNA Cloning

1.2 Traditional Traditional molecular cloning consists of a set of linked experimen-

Some vectors contain additional features that allow for specific

wide range of experimental purposes, careful consideration is

1.4 Restriction Deciding on a restriction endonuclease for your cloning experi-

restriction endonucleases available that can broadly be divided into

competent bacteria can be bought pre-treated and ready for trans-

cloning (SLIC), Gateway cloning, Gibson assembly, type IIS clon-

Ensure your laboratory is suitably registered and set up for molec-

2.3 Ligation 1. T4 DNA Ligase enzyme: 5 U/μL from a commercial supplier.

3.1 Polymerase 1. Prepare a single 25 μL PCR reaction by adding the following

PCR step Temperature (°C) Time (s)

30 s. Take care to wear a padded glove—molten agarose can

14. Use the commercial microspin column purification kit to purify

3.3 Ligation 1. Take a clean microcentrifuge tube and label it “Ligation” or

9. To visualize the PCR samples on an agarose gel, refer to

Recommended (Do) Not recommended (Do not)

sequence insertion. Most cloning or expression vectors

6. If you wish to use a different buffer for the restriction digestion

14. The recommended molar ratio of vector:insert DNA is 3:1

The recommended amount of DNA is 100–200 ng per ligation

22. Performing this step creates a stock of bacterial cells contain-

A Sequence- and Ligation-Independent Cloning (SLIC)

The generation of recombinant DNA by molecular cloning is

A progression of LIC procedure is sequence- and ligation-

2.1 Molecular 1. Thermocyler.

2.3 Plasmid 1. Water bath.

H2O. Incubate for 10 min at 25 °C then place on ice. Use

3.2 Transformation 1. In separate 15 mL polypropylene tubes, mix 2.5 μL of each

1. Primers should be approximately 40 bp, including a minimum

3. Vector propagated in a laboratory E. coli cloning strain such as

Extension times increase with length of template to be ampli-

Molecular Cloning Using In Vivo DNA Assembly

Molecular cloning is a cornerstone of biomedical research and has

2.1 Polymerase 1. Premixed PCR master solution, prepared as 23 μL premixed

Fig. 1 General in vivo DNA assembly scheme. A DNA fragment of interest

2.2 DNA Gel 1. Agarose powder (see Note 3).

2.3 Transformation 1. Chemically competent bacteria: XL-10 Gold® Ultracompetent

3.1.1 Insertion We define an insertion as the introduction of a new segment of

3.1.3 Mutagenesis Mutagenesis involves the replacement of short DNA sequences,

3.1.4 Sub-cloning Sub-cloning involves the incorporation of a larger DNA sequence

assembly of two separate linear fragments, through recombination

3. Prepare a solution containing 5 μM (in deionized water) of

3.3 Transformation 1. Transform 3–4 μL of the reaction mix to 100 μL of competent

that multiple modifications can be made to a plasmid template in a

1. Although higher volume PCR reactions will also work success-

3. Use low melting point agarose to make a 1% agarose gel. We

12. For multiple modifications performed in a single-tube PCR,

Assembling Multiple Fragments: The Gibson Assembly