diagnostics

Review
Detection of Biomarker Using Aptasensors to Determine the
Type of Diabetes
Dinda Exelsa Mulyani and Iman Permana Maksum *

Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Padjadjaran,

Sumedang 45363, Indonesia; dinda19003@mail.unpad.ac.id
* Correspondence: iman.permana@unpad.ac.id

Abstract: Diabetes mellitus (DM) is a metabolic disorder characterized by elevated blood glucose
levels. This disease is so serious that many experts refer to it as the “silent killer”. The early detection
of diabetes mellitus, whether type 1, type 2 or mitochondrial, is crucial because it can improve
the success of treatment and the quality of life for patients. Aptamer-based biosensor diagnosis
methods have been widely developed because they have high sensitivity and selectivity in detecting
biomarkers of various diseases. Aptamers are short sequences of oligonucleotides or proteins that
recognize specific ligands and bind to various target molecules, ranging from small ions to large
proteins. They are promising diagnostic molecules due to their high sensitivity and selectivity, ease of
modification, low toxicity, and high stability. This article aims to summarize the progress of detection
methods, including detection principles, sensitivity, selectivity, and the performance of detection
devices, to distinguish between types of diabetes mellitus using electrochemical aptasensors with
biomarkers such as glucose, insulin, HbA1c, GHSA, and ATP.

Keywords: aptasensor; aptamer; diabetes mellitus; biosensor

1. Introduction
Diabetes mellitus (DM) is a metabolic disorder characterized by increased blood glu-
cose levels (hyperglycemia) resulting from defects in insulin secretion and insulin action [1].
Citation: Mulyani, D.E.; Maksum, I.P. According to the International Diabetes Federation (IDF), in 2021, there were 537 million
Detection of Biomarker Using
adults aged 20–79 years with diabetes worldwide, which means that 1 in 10 people suffer
Aptasensors to Determine the Type of
from this disease. Moreover, diabetes kills around 6.7 million people every year, which
Diabetes. Diagnostics 2023, 13, 2035.
is equivalent to one person dying every 5 s [2]. Several biomarkers are used as tests for
https://doi.org/10.3390/
DM patients, such as oral glucose tolerance tests (OTGG), fasting glucose level, insulin
diagnostics13122035
levels, glycated hemoglobin (HbA1c), and glycated albumin (GHSA) levels [3,4]. Various
Academic Editor: Marijn Speeckaert techniques have been developed to detect diabetes, including the HPLC-UV technique [5],
fluorescence [6–9], chemiluminescence [10], ion exchange chromatography [11], immunoas-
Received: 8 May 2023
Revised: 4 June 2023
say [12], and capillary electrophoresis [13]. However, measuring these biomarkers with
Accepted: 8 June 2023
instruments is not suitable for on-site monitoring [13,14].
Published: 12 June 2023 This article will discuss the detection of biomarkers using aptamer bioreceptors,
commonly called aptasensors, to determine the type of diabetes in patients. Aptamers are
short, single-stranded DNA/RNA molecules that can recognize specific target molecules.
The characteristics of aptamers make them very suitable for use as bioreceptors; they have
Copyright: © 2023 by the authors. good affinity for biosensors and offer an alternative approach that involves the use of small
Licensee MDPI, Basel, Switzerland. DNA molecules that can bind to specific targets with a very high affinity and specificity,
This article is an open access article replacing antibodies [15].
distributed under the terms and
conditions of the Creative Commons 2. Methods
Attribution (CC BY) license (https://
The method used to obtain systematic reviews is by searching for keywords such as
creativecommons.org/licenses/by/
pathophysiology of diabetes, diabetes mellitus detection, diabetes mellitus biomarkers,
4.0/).

Diagnostics 2023, 13, 2035. https://doi.org/10.3390/diagnostics13122035 https://www.mdpi.com/journal/diagnostics

Diagnostics 2023, 13, 2035 2 of 19

aptasensors and biosensors. Furthermore, journal literature or previous research from

Sciene Direct, PubMed and Google Scholar were searched. Articles that are relevant to the
discussion of the review were selected.

3. Result
3.1. Diabetes Mellitus (DM)
Diabetes mellitus, commonly referred to as DM, is a metabolic disorder characterized
by prolonged high blood sugar levels or hyperglycemia. This disease is very serious, which
is why many experts call it the silent killer [16]. The main complications of diabetes are
micro-vascular complications (retinopathy, nephropathy, neuropathy) and macro-vascular
complications (ischemic heart disease, stroke, peripheral vascular disease) [3,17,18]. Dia-
betes can also occur during pregnancy and alongside a number of conditions, including
genetic disorders, drug or chemical toxicity, endocrinopathies, insulin receptor disorders,
and diseases of the exocrine pancreas [18–20]. There are two types of diabetes that are
commonly known that can be seen in Figure 1.

Figure 1. The types of diabetes: type 1 diabetes due to insulin secretion and type 2 diabetes due to
insulin resistance.

Type 1 diabetes occurs due to an autoimmune process that causes damage to the
pancreatic beta cells. This leads to a decrease in insulin production [21]. This disease is
closely related to premature morbidity and mortality, and can lead to complications such
as neuropathy, nephropathy, and retinopathy. Patients with this condition require lifelong
insulin administration to prevent hyperglycemia and ketoacidosis [22]. The pathology of
type 1 DM involves the process of damage to insulin-producing cells by the immune system,
caused by internal (genetic) and external (environmental) factors. This damage means that
the hormone insulin used to regulate the movement of glucose from the bloodstream into
cells for use by the metabolism is not produced. In type 1 DM disease, an autoimmune
process occurs in pancreatic beta cells, where inflammation occurs involving the proin-
flammatory cytokines IL-1, TNF-alpha and INF-gamma induced by T lymphocytes. These
cytokines can activate apoptosis [23] so that the pancreas stops producing insulin and blood
glucose levels increase [24,25]. Increased glucose levels can lead to the transportation of
glucose into the urine (glucosuria), resulting in osmotic diusesis because of excessive urine
output (polyurea). Increased glucose levels in DM sufferers can be used as a biomarker for
the early detection of diabetes to prevent the occurrence of diabetes complications. Diabetes
can also be caused by the glycation of several proteins, namely HbA1c and GHSA. Blood
glucose criteria for the diagnosis of DM are as follows [26] (Table 1):
 Current Glucose
Fasting Blood
Plasma Tolerance
Glucose Hb
Glucose Impaired
Diagnostics 2023, 13, 2035 (mg/dL)
3 of 19
(mg/dL) (mg/dL)
Diabetes ≥200 ≥200 ≥126
Prediabetes
Table 1. Criteria Not applicable
for diagnosis of diabetes mellitus. 140–199 100–125
Diabetes during
Glucose Tolerance ≥200 ≥200 HbA1c≥126
Current Plasma Fasting Blood
(%)
Glucose (mg/dL)pragnency Impaired (mg/dL) Glucose (mg/dL)
Diabetes ≥200 Normal ≥200Not applicable ≥126<140 <100
≥6.5
Prediabetes Not applicable 140–199 100–125 5.7–6.4
Diabetes during
≥200 Type 2 diabetes is ≥200
caused by permanent ≥126
hyperinsulinemia ≥6.5
due to decreas
pragnency
Normal Not applicable <140 <100
secretion, insulin resistance, or both [27]. This disease is usually caused by facto <5.7

age, obesity, and lifestyle [28]. The pathophysiology of type 2 diabetes i

Type 2 diabetes
disturbance is caused by
of glucose permanent hyperinsulinemia
homeostasis. Under normal dueconditions,
to decreased insulin
insulin is se
secretion, insulin resistance, or both [27]. This disease is usually caused by factors such
pancreatic beta cells when glucose levels increase, leading to glycolysis and inh
as age, obesity, and lifestyle [28]. The pathophysiology of type 2 diabetes involves a
hormone ofglucagon
disturbance as a directive
glucose homeostasis. Under for gluconeogenesis,
normal conditions, insulinthereby
is secretedsuppressin
by
production in the liver and muscles [29–31]. In patients with type 2 DM, insu
pancreatic beta cells when glucose levels increase, leading to glycolysis and inhibiting
the hormone
direct the glucagon
openingasofa directive for gluconeogenesis,
the “gates”, thereby suppressing
so glucose cannot glucose becau
enter the tissues
production in the liver and muscles [29–31]. In patients with type 2 DM, insulin cannot
resistance occurs, meaning that the insulin hormone is rejected by target cell
direct the opening of the “gates”, so glucose cannot enter the tissues because insulin
glucose occurs,
resistance metabolism
meaning does
that not function
the insulin in cells
hormone [27]. Inbyaddition
is rejected to and
target cells, insulin
the levels
type ofmetabolism
glucose diabetes does
related to the respiratory
not function in cells [27]. chain, called
In addition mitochondrial
to insulin levels, therediabetes,
is
athe
typedysfunction
of diabetes related to the respiratory chain, called mitochondrial diabetes,
of insulin secretion due to an inhibition of the production of caused
by the dysfunction of insulin secretion due to an inhibition of the production of adenosine
triphosphate (ATP), which is needed for insulin secretion. This dysfunction is
triphosphate (ATP), which is needed for insulin secretion. This dysfunction is related to
mutations
mutations in DNA
in the the DNAtRNA tRNA
genes ofgenes of mitochondria
mitochondria (mtDNA) [32](mtDNA)
(Figure 2). [32] (Figure 2).

Figure
Figure 2. Pathology
2. Pathology of2 type
of type 2 diabetes
diabetes caused bycaused by insulin
insulin resistance [33].resistance [33].
When blood glucose levels are high, the glucose metabolism is activated, producing
ATP and When blooditsglucose
increasing levelsinare
concentration high, the
pancreatic glucose
β cells. This,metabolism is activated,
in turn, induces the p
ATP and
closure of K increasing
+ channels in its
theconcentration
plasma membrane, in pancreatic β cells. This,
leading to membrane in turn, induces
depolarization. In t
response to the membrane depolarization, Ca 2+ channels open, allowing for Ca2+ to flow
of K channels in the plasma membrane, leading to membrane depolarization. In
+
into the cell. When the concentration of Ca2+2+in the cytosol is high enough, it can trigger
to the membrane depolarization, Ca channels open, allowing for Ca2+ to flow in
the release of the insulin hormone through exocytosis. In mitochondrial diabetes, ATP
When the
deficiency concentration
occurs, which inhibitsof
insulin in the cytosol
Ca2+secretion is high
and results enough, itAs
in hyperglycemia. can trigger the
a result,
the insulin
glucose hormone
in the blood cannot bethrough
taken up exocytosis. In mitochondrial
by gluscose transporter diabetes,
(GLUT) and remains in ATP
the blood [34]
occurs, (Figure
which 3).
inhibits insulin secretion and results in hyperglycemia. As a resu
3, x FOR PEER REVIEW 4 of 21

in the blood cannot be taken up by gluscose transporter (GLUT) and remains in the blood
Diagnostics 2023, 13, 2035 4 of 19
[34] (Figure 3).

Figure 3. Effect of the regulation of ATP concentration levels on the insulin secretion and pathology
Figure 3. Effect of the regulation of ATP concentration levels on the insulin secretion and pathology
of mitochondrial diabetes [35].
of mitochondrial diabetes [35].
3.2. Aptasensor
3.2. Aptasensor In 1962, Calrk and Lysons first used the term biosensor [36]. A biosensor is a de-
vice capable of providing quantitative or semi-quantitative analytical information that
In 1962, Calrk and Lysons
combines first used
the specificity the term
of biological biosensor
recognition [36]. Awith
mechanisms biosensor
physical is a device
transduction
capable of providing
techniquesquantitative or on
that can be based semi-quantitative analytical
electrochemical, mechanical, information
thermal, that
or optical sensing
combines the specificity of biological recognition mechanisms with physical transduction
principles [36,37]. Biosensors have many operational advantages, namely fast detection,
ease be
techniques that can of use,
basedhighon
sensitivity, cost effectiveness,
electrochemical, and ease of
mechanical, mass production
thermal, [38]. sensing
or optical One type
of biosensor is an aptasensor. This aptasensor uses the aptamer as its bioreceptor.
principles [36,37]. Biosensors
The aptasensorhave many
must operational
have four advantages,
main component namely
parts [39], fast detection,
namely sensitive elements
ease of use, high (bioreceptors),
sensitivity, cost effectiveness, and ease of mass production
transducers, detection systems, and transporters. Bioreceptors [38]. One are type
bind-
of biosensor is aning/interaction
aptasensor. mediaThis aptasensor
between a target usesandthe aptamerdevice.
a biosensor as itsThe
bioreceptor.
transducer functions
to change
The aptasensor must the interactions
have fourthat mainoccurcomponent
in the bioreceptor so that
parts theynamely
[39], can be read, such as
sensitive
nanoparticles, nanoporous, nanowires, and fluorophores, which are directly proportional
elements (bioreceptors), transducers,
to the number of molecules detection systems,
that are bound and to
or reacting transporters.
the surface of Bioreceptors
the sensor that
are binding/interaction media between a target and a biosensor device.
can be connected to the reader [40]. The detection system measures the signal The transducer
from the
functions to change the interactions
interaction that occur
that occurs. Lastly, in transporters
there are the bioreceptor so that
that function to they canthe
integrate besteps
read,of
a process.
such as nanoparticles, nanoporous, nanowires, and fluorophores, which are directly
proportional to the number of molecules that are bound or reacting to the surface of the
3.3. Aptamer
sensor that can be connected to the
Aptamers are reader
short [40].ranging
sequences The detection
from 40 to system measures
180 nucleotides the signal
or peptides with
from the interaction that occurs. Lastly, there are transporters that function to integrate
10–30 amino acid residues that recognize specific ligands and bind to a wide range of target
molecules ranging from small ions to large proteins with high affinity and specificity [41].
the steps of a process.
The term aptamer comes from the word ‘aptus’, which means ‘fit’ [42]. Aptamers can be
either single-strandded DNA (ssDNA) or RNA, with the only difference being the nitroge-
3.3. Aptamer nous bases, namely thymine and uracil. DNA and RNA aptamers have the same specificity
Aptamers andshort
are affinitysequences
for targets; the difference
ranging fromis that DNA
40 to 180aptamers are more
nucleotides orstable, whilewith
peptides RNA
aptamers are more flexible and able to adopt more 3D conformations [43] (Figure 4).
10–30 amino acid residues that recognize specific ligands and bind to a wide range of
target molecules ranging from small ions to large proteins with high affinity and
specificity [41]. The term aptamer comes from the word ‘aptus’, which means ‘fit’ [42].
Aptamers can be either single-strandded DNA (ssDNA) or RNA, with the only difference
being the nitrogenous bases, namely thymine and uracil. DNA and RNA aptamers have
the same specificity and affinity for targets; the difference is that DNA aptamers are more
stable, while RNA aptamers are more flexible and able to adopt more 3D conformations
[43] (Figure 4).
Diagnostics 13, 13,
2023,2023,
Diagnostics 2035x FOR PEER REVIEW 5 of 21 5 of 19

Figure
Figure 4. SELEX
4. SELEX scheme.
scheme. Thebegins
The process processwithbegins with
incubation incubation
of the target withof the target
a random with a random nucleic
nucleic
acid library, followed by selection and elution to obtain a specific aptamer against the target, and
acid library, followed by selection and elution to obtain a specific aptamer against the target, and
then amplificatin by PCR to obtain the aptamer library [44].
then amplificatin by PCR to obtain the aptamer library [44].
The systematic evolution of ligands by exponential enrichment (SELEX) is used to
isolate The systematic
aptamers evolution
with a high affinity forof ligands target
a molecular by exponential enrichment
from approximately 1012–1015(SELEX) is used to
oligonucleotide
isolate aptamers with a high affinity for a molecular target fromofapproximately
combinations [45–47]. In general, the SELEX process consists three 1012 –1015
steps: creating a “library”, binding and separation, and amplification. This process is
oligonucleotide combinations [45–47]. In general, the SELEX process consists of three steps:
repeated to find the nucleotide with the best specificity and affinity.
creating a “library”, binding and separation, and amplification. This process is repeated to
find
3.4. the nucleotide
Comparison of Aptamerwith the best
specificity and affinity.
with Antibodies
Aptamers are often called synthetic antibodies and can mimic antibodies in a number
of3.4. Comparison
applications. of Aptamer
The selected with
aptamer Antibodies
binds to a specific target with a comparable affinity
and specificity
Aptamers to that of an
are antibody
often [47].
called Aptamers antibodies
synthetic present several advantages
and compared
can mimic antibodies in a number
to antibodies as bioreceptors, namely the production of aptamer that is relatively easy and
of applications. The selected aptamer binds to a specific target with a comparable affinity
economical with conventional chemical methods compared to antibodies, which are more
and specificity
expensive to that
because they of an
usually antibody
require the use [47]. Aptamers
of animals as hostspresent several
during the advantages compared
production
to antibodies
process as bioreceptors,
[48]. Aptamers can interactnamely the production
very strongly of aptamer
with the desired target that is relatively easy and
because
conformational
economical with changes can occur during
conventional the binding
chemical process compared
methods when using various bonds
to antibodies, which are more
[49]. Aptamers can bind to target compounds via noncovalent multipoint interactions
expensive because they usually require the use of animals as hosts during the production
based on the combined contribution of several attractive forces, including hydrogen
processelectrostatic
bonding, [48]. Aptamers can interact
and hydrophobic very π–π
interactions, strongly with the
arrangement, desired
and Van target because confor-
der Waals
forces. This multi-point interaction is favored by a conformational change in thevarious bonds [49].
mational changes can occur during the binding process when using
secondary
Aptamersstructure
can bind of tothetarget
aptamer, which folds
compounds back around the
via noncovalent target with
multipoint interactions based on
complementary molecular shapes and chemical structures.
the combined contribution of several attractive forces, including This binding mechanism
hydrogen bonding, elec-
allows for the formation of highly stable affinity–target aptamer complexes, with
trostatic and
dissociation hydrophobic
constants ranging from interactions,
the nanomolarπ–π level arrangement, and [50]
to the picomolar level Van(Table
der Waals forces. This
multi-point interaction is favored by a conformational change in the secondary structure of
2).
the aptamer, which folds back around the target with complementary molecular shapes
and chemical structures. This binding mechanism allows for the formation of highly stable
affinity–target aptamer complexes, with dissociation constants ranging from the nanomolar
level to the picomolar level [50] (Table 2).

Table 2. Comparison of aptamers with antibodies [51].

Characteristics Aptamer Antibody

Toxic or poorly immunogenic
No Yes
immunogenogenic target
Limited to psychological conditions with animal
Isolation process In vitro selection under various conditions
immunization
Immunogenicity Little to none Significant
Batch activity Uniform Varies
Insensitive to redox reactions. Difficult to aggregate due
Sensitive to redox reactions. Easy to form aggregates.
Stability to lack of hydrophobicity. Resistant to changes in pH and
Sensitive to changes in pH and temperature.
temperature.
Screening time snd cost Limited screening processes Time-comsuming and expensive
Shelf life Long Limited
Controllable binding and release condition Can be changed on demand Difficult to modify
Chemical modifications Easy to modify with low cost Difficult and expensive to modify
Diagnostics 2023, 13, 2035 6 of 19

An important step in the development of the electrochemical aptasensor is the mo-

bilization of the aptamer to the electrode surface and the development of a strategy for
reliable aptamer mobilization so as to maintain its biophysical characteristics and binding
ability, as well as to minimize nonspecific binding/adsorption events [52]. As the sensor re-
quires the aptamer to be mobilized to a solid surface, many modifications have been made;
for example, the addition of a linker in the form of a thiol group. The role of the linker is to
spatially extend the receptor from the surface to increase its accessibility by ligand solutions
and eliminate non-specific adsorption. The type of coadsorbent affects the reduction in
non-specific binding and maintains the integrity of the being mobilized biomolecules [53].

4. Aptasensor for Diagnosis of Diabetes Mellitus and Mitochondrial Diabetes

4.1. Aptasensor for Glucose Detection
Blood glucose is a carbohydrate monomer that is absorbed by the body and typically
stored as glycogen in the liver and skeletal muscles. In the body, glucose serves as a source
of energy and is metabolized, with one example being glycolysis. In patients with DM,
hyperglycemia occurs due to insulin dysfunction or insulin resistance, preventing glucose
from entering the cells [54].
Liu et al. (2022) developed a portable chip aptasensor with smartphone measurement
for the precise diagnosis of prediabetes/diabetes by monitoring glucose and insulin. In
their study, thiol group-bound aptamers were immobilized through Au–S bonds to gold
nanoparticles on screen-printed carbon electrodes (SPCEs), which then bound to the methy-
lene blue redox probe. The detection was carried out using saliva samples, and 7the
Diagnostics 2023, 13, x FOR PEER REVIEW of biochip
21
was able to detect glucose concentrations as low as 0.08 mM. The results indicate that the
detection biochip performs well when detecting the desired glucose levels [55].
4.2. Aptasensor for HbA1c Detection
4.2. Aptasensor for HbA1c Detection
HbA1c is hemoglobin that binds glucose at the N-terminus of the amino valine of the
HbA1c is hemoglobin that binds glucose at the N-terminus of the amino valine of the
hemoglobin β chain. This structural change results in a change in the secondary structure
hemoglobin
of Hb so that β chain.
it has This structural
a different polarity change
from Hbresults in a change
[56] (Figure 5). in the secondary structure
of Hb so that it has a different polarity from Hb [56] (Figure 5).

Figure 5. Left, 3D structure of hemoglobin β-chain, the prosthetic group of hemoglobin is marked in
Figure 5. Left, 3D structure of hemoglobin β-chain, the prosthetic group of hemoglobin is marked
orange. Right, magnification of the structure of the amino acid glucose-binding site at the N-terminal
in orange. Right, magnification of the structure of the amino acid glucose-binding site at the N-
of the Valine
terminal of theβ-chain (in red).(in
Valine β-chain The orange
red). pentagon
The orange at the at
pentagon N-terminal valinevaline
the N-terminal amino group
amino indicates a
group
fructosylagroup
indicates [57].group [57].
fructosyl

Glycatedhemoglobin
Glycated hemoglobin is is formed
formed through
through a non-enzymatic
a non-enzymatic reaction.
reaction. The stage
The first first stage
of of
the formation
the formation of HbA1c is the interaction of hemoglobin with the aldehyde
HbA1c is the interaction of hemoglobin with the aldehyde group of group of glucose
to form to
glucose anform
aldimine covalentcovalent
an aldimine bond called
bondthe Schiff
called thebase
Schiff and theand
base second stage isstage
the second irreversible
is
where the Schiff
irreversible wherebasethe rearrangement occurs to become
Schiff base rearrangement occurs atomore stablea ketoamine
become more stableand is
called the amadori
ketoamine product
and is called [58]. HbA1c
the amadori productwas[58].
recommended
HbA1c was by the American
recommended by Diabetes
the
American
Association Diabetes
(ADA)Association
in 2010 as a(ADA) in 2010for
biomarker asdiabetes
a biomarker for diabetes
diagnosis diagnosis
and blood sugar and
control
blood sugar
because it iscontrol because
considered it is considered
capable capable
of identifying of identifying
average plasma average
glucose plasma glucose over
concentrations
concentrations
the past 60–90 over daysthe
to past
reduce 60–90 days to reduce
complications complications
[59]. HbA1c is also [59]. HbA1c
a very is also abiomarker
potential very
potential
because its biomarker because
blood level is notitsaffected
blood level is time
by the not affected
of day, by the time
recently of day,
eaten food,recently
fasting, and
eaten
rapidfood, fasting,
lifestyle and rapid
changes [60]. lifestyle
The level changes [60]. Theoflevel
of formation thisof formation
glycated of thiscan
protein glycated
be used to
protein can be used to assess glycemic control and diagnose type 2 diabetes [61]. The
higher the HbA1c level, the more glucose binds to hemoglobin [62].
The detection technique that is currently being developed uses an electrochemical
aptasensor for HbA1c detection because of its advantages, such as having a high affinity,
low cost, easy modification and specific response [63,64]. Eissa et al. (2017) developed a
Diagnostics 2023, 13, 2035 7 of 19

assess glycemic control and diagnose type 2 diabetes [61]. The higher the HbA1c level, the
more glucose binds to hemoglobin [62].
The detection technique that is currently being developed uses an electrochemical
aptasensor for HbA1c detection because of its advantages, such as having a high affinity,
low cost, easy modification and specific response [63,64]. Eissa et al. (2017) developed
a label-free aptamer array to detect HbA1c and tHb in human blood. This aptamer is
specifically designed to interact with HbA1c; the aptamer is modified by adding a thiol
group at the end and will be immobilized on the surface of the AuNP electrode, which can
then be used as a method of detecting HbA1c and tHb by voltammetry. This aptasensor
showed high sensitivity, with detection limits of 0.28 and 0.33 mg/mL, respectively [65].
Eissa et al., in 2019, showed high selectivity and sensitivity results for HbA1c. The
existence of a specific binding between the target protein (HbA1c) to the aptamer can
increase the transfer of electrons on the surface of the electrode and produce a certain
signal. This is the basis for measurement. The resulting signal is directly proportional to
the concentration of HbA1c in the sample [66].
Research was carried out by Anand et al. (2021) regarding docking and molecular
dynamics’ simulations to understand the high-affinity interaction between the aptamer
and the target. In his research, the 3D structure of the SELEX aptamer results was modeled,
Diagnostics 2023, 13, x FOR PEER REVIEW
which was then docked to determine the binding site to the peptides aglycated 8 of 21 the
with
four fructose D tautomers as ligands (indicated by G1, G2, G3, and G4). The results of the
docking showed three interaction sites on the aptamer, namely hairpin 1, hairpin 2, and
hairpin
loop. 2, and loop.
Compared Compared
to the to the three
three binding sites,binding
hairpinsites,
1 hashairpin 1 has
a higher a higher
docking docking
score than the
score binding
other than the sites,
other of −9.2 kcal/mol
binding sites, of −9.2
[9]kcal/mol
(Figure [9]
6). (Figure 6).

Figure 6.
Figure 6. The
Thesecondary
secondarystructure of the
structure aptamer
of the selected
aptamer by the
selected bySELEX method
the SELEX shows the
method hairpin
shows the hair-
1 (blue colored) and hairpin 2 (bright red colored) regions with the highest binding affinity to the
pin 1 (blue colored) and hairpin 2 (bright red colored) regions with the highest binding affinity to
target. [9].
the target [9].
To further understand the binding interactions, molecular dynamics simulations
To further understand the binding interactions, molecular dynamics simulations were
were conducted for 70 ns between the aptamer and GP1, GP2, GP3, and GP4. The resulting
conducted for 70 ns between the aptamer and GP1, GP2, GP3, and GP4. The resulting com-
complex showed a structural stability with an RMSD value of approximately 1.0 A.
plex showed a structural stability with an RMSD value of approximately 1.0 A. Hydrogen
Hydrogen bonds were observed at GP1 between the hydroxyl groups of fructose and
bonds were observed at GP1 between the hydroxyl groups of fructose and peptides, such
peptides, such as histidine2, thirosin4, and glutamine6, with the aptamer nucleotides,
as histidine2, thirosin4, and glutamine6, with the aptamer nucleotides, namely G2, G4, A5,
namely G2, G4, A5, A17, G18, and C33. These interactions are illustrated in Figure 3. The
A17,
free G18,
energyand C33. These
calculated interactions
from are illustrated
the simulation in Figurethat
results indicated 3. The
GP1free
hadenergy calculated
the highest
from the simulation results indicated that GP1 had the highest energy value
energy value of −12.50, while GP2 had the lowest free energy value of −10.79. The MD of −12.50,
while GP2 had
simulation freethe lowest
energy free
was energy
then value of
compared −10.79.
with The MD simulation
the experimental free energy
results obtained by was
then compared
SiNW-FET, with
which the experimental
showed results
a free energy valueobtained
of 12.30 by SiNW-FET,
± 0.05 kcal/molwhich
for theshowed
aptamera free
energy
complex value of 12.30 ± 0.05 kcal/mol for the aptamer complex and GP.
and GP.

4.3.
4.3. Aptasensor forGHSA
Aptasensor for GHSADetection
Detection
GHSA
GHSA is is an
analbumin
albuminthatthat
is is covalently
covalently bonded
bonded to a to a glucose
glucose group.group. The formation
The formation of
of this glycate is non-enzymatic, where the amino acids lysine, arginine,
this glycate is non-enzymatic, where the amino acids lysine, arginine, and cysteine and cysteine
in in
albumin
albumin covalently bindtotothe
covalently bind thealdehyde
aldehyde group
group of of sugar
sugar to form
to form an irreversible
an irreversible Schiff
Schiff base base
so
so that
that it
it undergoes Amadorirearrangement
undergoes Amadori rearrangement to to form
form a more
a more stable
stable aminomethyl
aminomethyl ketone
ketone
(ketoamine). Under normal circumstances, glycated albumin levels range from 6 to 15%,
but in DM patients it increases by about 2–3 times [67].
GHSA can be used as medium-term glycemic control by reflecting glycemic status in
the previous 2–3 weeks and is not affected by hemoglobin metabolism and erythrocyte
Diagnostics 2023, 13, 2035 8 of 19

(ketoamine). Under normal circumstances, glycated albumin levels range from 6 to 15%,
but in DM patients it increases by about 2–3 times [67].
GHSA can be used as medium-term glycemic control by reflecting glycemic status
in the previous 2–3 weeks and is not affected by hemoglobin metabolism and erythrocyte
age. GHSA was chosen as a faster control of glycemic status than HbA1c, especially for
patients suffering from anemia, patients receiving iron preparations and pregnant women
(associated with iron-deficiency anemia) [68].
Increased glycated albumin levels are associated with the development of vascular
complications in diabetic patients, particularly those with chronic kidney failure who un-
dergo hemodialysis. Glycated albumin can form advanced glycation end-products (AGEs),
which can produce reactive oxygen species (ROS). These ROS can bind to cell surface recep-
tors and form cross-links, leading to micro- and macro-vascular complications in diabetes.
AGEs can also alter the function of intracellular proteins, change the extracellular matrix,
and affect hormone action, cytokines, and free radicals through cell-surface receptors [69].
In a study conducted by Pu et al. in China with 320 subjects, elevated GHSA levels were
associated with the presence and severity of coronary artery disease [70].
Albumin examination can be used to assess short-term glycemic control in certain
conditions where HbA1c measurement cannot be applied, such as in patients with type 1
diabetes, type 2 diabetes receiving insulin therapy, hemolytic anemia, bleeding, blood
transfusion, chronic kidney failure undergoing hemodialysis, pregnant women, liver cir-
rhosis, variant hemoglobin, and patients with postprandial hyperglycemia [68]. However,
this examination cannot be used for patients affected by albumin metabolism disorders
such as those with nephrotic syndrome, hyperthyroidism, and those receiving glucocorti-
coid treatment [68].
Research has been conducted to measure GHSA levels using interdigitation electrode-
based disposable enzyme sensor strips that show excellent sensitivity with high repro-
ducibility [71]. In addition to the use of enzymes as bioreceptors, many biosensors have
been developed for GHSA detection using aptamers because of their advantages. Gosh et al.
(2017) described the diagnosis of diabetes mellitus using aptasensor-based optical detection.
This aptasensor uses ssDNA aptamers, quantum dot semiconductors and gold nanoparti-
cles. The detection principle will result in an increase in photoluminescense in line with the
increase in GHSA concentration. This diagnosis is effective if made in conjunction with
traditional methods of glucose monitoring [72]. In addition to using gold nanoparticles,
it is also possible to use phosphorescent quenching graphene oxide (GO) for the GHSA
detection aptasensor. The ability of graphene oxide to interact with single-stranded DNA
(ssDNA) molecules was proven through the increase in π–π and the ability to quench
the fluorescence intensity of ssDNA-labeled fluorescence. Go and fluorescently labeled
aptamers are incubated to form a GO–aptamer complex (showing off signal). When GHSA
is added to the reaction, the fluorescent label of the aptamer is released from the GO surface
and binds to GHSA, producing a fluorescence signal [73,74].
The detection method developed by Bunyarataphan in 2019 uses an aptamer-based
electrochemical biosensor, which interacts specifically with GHSA and HSA and measures
protein-binding to the aptamer using square wave voltammetry (SWV). The aptamer
is modified by adding biotin and immobilized with SPCE, which is then added with
streptavidin. During the measurement process, it is expected that the aptamer will bind
to GHSA or HSA, forming a complex that inhibits the electron transfer rate, which is then
measured as an electrochemical signal. The aptamer specificity test was conducted by
reacting the aptamer with other interfering substances in the blood, namely GHSA, HSA,
glucose, glycine, folic acid, and ampicillin [75].
In another study by Aye et al. (2021), the electrochemical aptasensor was studied,
focusing on the sensitive and selective detection of albumin glycation in DM patients
with thalassemia. The specificity tests that were conducted were carried out with other
biomolecules that cause reduced biosensor performance, such as glucose, HAS, and biliru-
bin. There are also drugs that are used as comparators, such as ampicillin and folic acid.
Diagnostics 2023, 13, 2035 9 of 19

Experimental results show a high specificity in the detection of GHSA [76]. Zhou et al.
(2023) conducted research on a flexible multielectrode array-based electrochemical aptasen-
sor for the simultaneous detection of HSA and GHSA. This aptasensor, with HSA and
GHSA targets, has the lowest detection limit of 13 nm for HSA and 25 nm for GHSA. This
target shows good selectivity in diluted whole blood samples. This aptasensor utilizes
a polymer substrate for the sensor chip that can reduce material costs, thus providing a
reliable and affordable long-term glycemic control tool at the point of care [77].

4.4. Aptasensor for Insulin Detection

A hormone that plays an important role in glucose metabolism is insulin. Insulin has
Diagnostics 2023, 13, xtwo
FORchains,
PEER REVIEW
namely the A chain with 21 amino acids and the B chain with 30 amino acids 10 of 21
with a molecular weight of 5802 and an isoelectric point of pH5.5. Both are connected by
two disulfide bonds from the N-helix in the A chain to the center of β and the C-terminal
from the A chainInsulin
to the center of the
synthesis B chain
occurs [78].
in the beta cells of the pancreas. Initially, insulin is in the
Insulin form of a occurs
synthesis signal in peptide,
the betawhich is the
cells of synthesized
pancreas.into pre-proinsulin
Initially, and
insulin is in thethen
formbecomes
proinsulin
of a signal peptide, in the
which endoplasmic into
is synthesized reticulum. Secretory and
pre-proinsulin vesicles
thenwill send proinsulin
becomes proinsulin from the
endoplasmic
in the endoplasmic reticulum
reticulum. to the
Secretory golgi apparatus,
vesicles and zinc and
will send proinsulin fromcalcine are added so that
the endoplasmic
reticulum to proinsulin forms a hexamer
the golgi apparatus, and zincthat
andiscalcine
not soluble in water.
are added so thatThis proinsulin
proinsulin formshexamer
a is
hexamer thatconverted into in
is not soluble insulin
water.and
ThisC-peptide
proinsulinwith the help
hexamer of enzymes
is converted outsideand
into insulin the golgi
C-peptide withapparatus
the help [78].
of enzymes outside the golgi apparatus [78].
Yoshida et al. (2009)etconducted
Yoshida al. (2009) conducted
a selectiona ofselection
aptamer of arrays
aptamer arrays
that can that caninsulin
detect detect insulin
using the SELEX method, resulting in aptamers with higher
using the SELEX method, resulting in aptamers with higher affinity compared to insulin- affinity compared to insulin-
link polymorphic repeat region (ILPR) [79]. The arrangement of aptamers chosen by
link polymorphic repeat region (ILPR) [79]. The arrangement of aptamers chosen by
Yoshida was used by research by Kubo in 2015 to describe the electrochemical aptasensor
Yoshida was used by research by Kubo in 2015 to describe the electrochemical aptasensor
immobilized on a gold electrode to determine its electrochemical activity. The results
immobilized on a gold electrode to determine its electrochemical activity. The results
showed that the peak current depends on insulin concentration [80].
showed that the peak current depends on insulin concentration [80].
A detection method was developed using the aptasensor by Zhao et al. (2019)
A detection method was developed using the aptasensor by Zhao et al. (2019) regard-
regarding the dual-signaling aptasensor for the ultra-sensitive detection of insulin in order
ing the dual-signaling aptasensor for the ultra-sensitive detection of insulin in order to
to obtain a sensor with a high level of sensitivity and specificity. In the biosensor device,
obtain a sensor with a high
an insulin binding level of sensitivity
aptamer modified and
withspecificity.
methylene Inblue
the biosensor
is used as device, an probe
a signal-off
insulin binding aptamer modified with methylene blue is used as a signal-off
and AuNP modified with DNA (Ferrocene) as a signal-on probe, both of which are probe and
AuNP modified with DNA
integrated (Ferrocene)
with the mDNA linkeras a signal-on
to make theprobe, both of which
AU electrode are integrated
a sensing interface. The MB
with the mDNA and Fc responses are used as signal indicators. This sensor scheme isMB
linker to make the AU electrode a sensing interface. The and Fc
expected to have a
responses aredetection
used as limit
signal indicators. This sensor scheme is expected to have a detection
for insulin with a low concentration and high specificity [81] (Figure 7).
limit for insulin with a low concentration and high specificity [81] (Figure 7).

Figure 7.representation
Figure 7. Schematic Schematic representation of insulin using
of insulin detection detection using an electrochemical
an electrochemical dual-signaling
dual-signaling
aptasensor
aptasensor [81]. [81].

A specificity test was carried out with thrombin, HSA, and HigG because it was
considered a substance that interfered with the target during the detection process; the
results showed that the proposed aptasensor specificity was very good at detecting
targets. This aptasensor has an acceptable detection stability and exhibits comparable
aptasensor reproducibility with a single signaling.
In 2021, Asadpour et al. (2021) conducted research monitoring the aptasensor to
Diagnostics 2023, 13, 2035 10 of 19

A specificity test was carried out with thrombin, HSA, and HigG because it was
considered a substance that interfered with the target during the detection process; the
results showed that the proposed aptasensor specificity was very good at detecting targets.
This aptasensor has an acceptable detection stability and exhibits comparable aptasensor
reproducibility with a single signaling.
In 2021, Asadpour et al. (2021) conducted research monitoring the aptasensor to detect
insulin using thin films of mesoporous silica nanoparticles using the EASA method. This
aptasensor has a detection limit of 10–350 nM and shows good selectivity for glucose, urea,
glutathione, and dopamine [82].

4.5. Aptasensor for ATP Detection

ATP, which is called the energy currency in bioenergetics, can be used to evaluate or
detect cell viability and proliferation [83], cell death [84,85], and energy transmission [86].
Manson et al. (2012) and Ellsworth et al. (2009) explained that ATP is used as a compound
that indicates a breakdown in metabolism [87,88]. The three main pathways that produce
ATP in eukaryotic organisms are glycolysis, the citric acid cycle/oxidative phosphorylation,
and the beta-oxidation of fatty acids. When the production of the process of ATP synthesis
in mitochondria is disrupted, it causes disease, one of which is mitochondrial diabetes [89].
ATP is a biomarker for mitochondrial diabetes. Naing et al., in 2014, suggested that
mitochondrial diabetes could be caused by a mutation in the mitochondrial organelle DNA
component at position 3243 [90]. Maksum et al. (2013) described the pathology of the
A3243G mutation, which causes the inhibition of Leusil-tRNA synthetase activity, which
can form early respiration proteins that can inhibit ATP production [91]. When this process
is inhibited, mitochondria’s important role in the production of energy in the form of ATP
will be disrupted, resulting in cellular abnormalities and cell death [92]. Additionally, the
A3243G mutation can affect the methylation process at the G10 nucleotide position, where
the A nucleotide at position 3243 is responsible for introducing methyltransferases. Failure
of this process can lead to a lack of methylation, which is critical because a single missing
methyl group can affect the binding of tRNA to other components that play a crucial role
in the machinery of mitochondrial protein synthesis.
A molecular dynamics simulation study was conducted on the secondary structure
prediction approach of the tRNA-leucine dimer of the A3243G mutation. The results
predicted stability in terms of binding energy and root mean square deviation (RMSD).
The results show that the RMSD value of the dimer structure of the mutant leucine tRNA
is lower because there are more hydrogen bonds than there are on a normal dimer [93].
Recent research has proved in silico the effect of the mitochondrial DNA tRNA leucine
A3243G mutation in patients with type 2 DM. The study showed that the stability of the
dimer structure of the mutant is due to the presence of nucleotide bonds 14 and 48. The
stable dimer structure resulted in a decrease in the process of aminosylation [94].
Furthermore, the T10609C and C10676G mutations in the ND4L gene are associated
with proton translocation in patients with type 2 diabetes and cataracts. Molecular dynam-
ics simulations were performed on the native and mutant subunits, and the simulation
results showed that the mutations resulted in the disruption of the translocation pathway
by the formation of hydrogen bonds between Glu34 and Try157 [95]. Several mutation
detection tests have been developed, including a study that designs and optimizes PCR-
RFLP tests for the detection of G9053A and T15663C mutations, as well as other studies
on the confirmation of point mutations using site-directed mutagenesis for mutations
in mitochondria [96,97]
In addition to the mutations in A3243G, Maksum et al. (2017) also explained the
mutations in G9053A that are found in diabetes and cataract patients. The result of these
mutations can interfere with the ATPase6 proton translocation channel. The mutation
changes electrostatic potential from serine to asparagine, causing the inhibition of insulin
secretion. This results in hyperglycemia as the glucose in blood cannot be taken up by
Diagnostics 2023, 13, 2035 11 of 19

GLUT and remains in the blood [34,98]. ATP can be considered as a suitable biomarker for
mitochondrial diabetes.
The ATP molecule is composed of three subunits: adenine base, ribose sugar, and
triphosphate. The triphosphate is the reactive site due to the low activation energy required
to break the phosphodiester bond, which is relatively weak. This allows for the final phos-
phate group to be easily transferred from one molecule to another while simultaneously
releasing energy [99]. However, the selectivity of aptamers for ATP is not very good for
other adenosine phosphates, such as ADP and AMP. Nutiu and Li (2003) found that the
ABA aptamer shows a relatively high affinity for adenine, but not the triphosphate group,
meaning that adenosine, AMP, and ADP provide the same fluorescence yield response
as ATP.
Efforts have been made to optimize the design of aptamer structures so that they
can interact specifically with nucleobases and triphosphates. However, some unfavorable
results have been reported. Sazani et al. (2014) found that, although the aptamer has a
good level of interaction with triphosphate, its affinity for nucleobases is reduced [100].
Another attempt to increase selectivity takes advantage of the difference in density between
ATP, ADP, AMP, and adenosine by introducing a secondary recognition mechanism that
can strongly interact with the triphosphate moiety of ATP, such as the uranyl salofen
complex [101–103]. To prevent the repulsive interaction of the triphosphate group with the
anionic back of the aptamer, the use of neutral nucleic acids such as peptide nucleic acids
or morpholinos can be modified.
One of the efforts made by Kheyrabadi and Mehrgardi (2013) in the application of
aptamer for electrochemical biosensors is to fragment ABA into two aptamer fragments
with a termination point between T14 and T15 [104]. The aptamer that can interact with
ATP is the ATP-binding aptamer (ABA) with PDB ID: 1AW4. The structure of the aptamer
shows that there are two recognition pockets, one consisting of G6, G22, and A23, and the
other containing G9, A10, and G19. Each pocket can hold one ATP molecule [105].
The aptamer was fragmented into two parts: F1 with a 50 end plus an alkyl and a thiol
conjugated with AuNP, which was used to increase the sensitivity and conductivity of the
analyte signal due to its large surface area and excellent electrocatalytic ability [106]. The
covalent interaction strength of the thiol–gold coordination provides the basis for fabricat-
ing strong, self-assembled monolayers, which can be used for a wide range of applications
and thus have enabled many important achievements in nanobiotechnology [107]. This
research also measures the sensor signal with other ATP analogues, resulting in a specific
response to ATP, and has acceptable stability.
From the results of the selectivity test, compared to UTP, GTP, and CTP with the same
concentration, F1 and F2 aptamers showed good selectivity, with an ATP 10 signal that was
times higher than the other analogues. Recent research from Mulyani in 2022 also supports
the research of Kashefi-Khernyabadi (2013); Mulyani conducted electrochemical sensor
research using the ATP-binding aptamer with the differential pulse voltammogram (DPV)
method. The voltammogram characterization results show that the peak current in ATP is
lower than in UTP, CTP, and GTP [108].
Rustaman et al. (2023) conducted research on the specificity of aptasensors for diabetes
mellitus detection using in silico methods. This in silico research refers to the research of
Kashefi (2013) to determine the interaction of aptasensor candidates with ATP through the
interaction site and interaction stability, and also determine the specificity of the aptamer
by comparing its interactions with ADP and AMP.
This study analyzed the interaction based on a molecular dynamics simulation for
100 ns. The significant interactions that occurred were three hydrogen bonds between ATP
and G7, G8, and A24. In particular, the ATP aptamer complex has a quite good interaction
and better specificity potential than ADP and AMP. Therefore, this study shows that the
aptamer for ATP detection is very promising for further tests, such as tests on direct samples
and clinical trials of the aptasensor as a diagnostic tool [109].
Diagnostics 2023, 13, 2035 12 of 19

Research was carried out by Xie et al. (2020) regarding in silico ATP-binding aptamer
(ABA) studies. Simulations revealed that the aptamer displays a high degree of rigidity and
is structurally very little affected by ATP binding. The decomposition of interaction ener-
gies suggests that the dispersion forces from deposition between ATP and nucleobases G6
and A23 at the aptamer binding sites play an important role in stabilizing the supramolec-
ular complex, as do the hydrogen bond interactions between ATP and G22. In addition,
metadynamic simulations show that, during the association process, water molecules act
as an important bridge connecting ATP with G22, which supports the dynamic stability of
the complex [105].
An explanation of the various apatamers used for diabetes mellitus biomarker detec-
tion is summarized in the following Table 3.

Table 3. Summary of aptasensors used to detect diabetes mellitus biomarkers.

Detection Principle Biomarker Aptamer Sequence Result Ref

Surface modification of SPCE with
gold nanoparticles using methylene Glucose: 50 –HS–HS-C6 -
blue as a redox probe. The prepared CTCTCGGGACGACCGTGTGTGTTGCT
Glucose and Good stability and
SPCE is integrated with a CTGTAACAGTGTCCATTGTCGTCCC-MB-30 [55]
Insulin high sensitivity.
micro-device containing a bluetooth Insulin: 50 –HS–HS-C6 -AAAAGGTGGTGGGG
transmission system for smartphone GGGGTTGGTAGGGTGTCTTCT-MB30
signal reading.
High sensitivity and
Apatamers modified with thiol
50 -GGGGACACAGCAACACACCCACCCAC selectivity, with an LoD of
groups were immobilized on AuNP
HbA1c CAGCCCCAGCATCATGCCCA 0.2 mL−1 and a linear [65]
electrodes and measured using
TCCGTCGTGTGTG-30 range of
square wave voltammetry (SWV).
100 pg mL−1 –10µg mL−1 .
The aptamer was non-covalently
immobilized on six electrodes of The SWCNT aptasensor
nanomaterials via π–π stacking 50 -ACACACCCACCCA showed the highest
interactions between DNA HbA1c CAGCCCCAGCATCATGCCC selectivity and sensitivity, [66]
nucleobase and carbon material ATCCGTCGTGTGT-30 with a limit of detection
surface. Measurements were (LoD) of 0.03 pg mL−1 .
performed using SWV.
Aptamer immobilization on silicon
Aptamer has a binding
nanowire field effect transistors.
energy of
Aptamer was also modified with 50 -HS-GGT
GAG TTA AGG AAT CAG CGG
HbA1c 12.30 ± 0.05 kcal/mol, [9]
polyethylene glycol. Docking and CTC AGA CGA CCC GAC GCA C-30
which is consistent with
molecular dynamics simulations
theoretical calculations.
were performed.
Immobilization of thiolated aptamer
High selectivity to GHSA.
on gold electrode surface and
50 -Thiol C6/TGCGGTTGTAGT Concentration range of
quantum dot. Measurement GHSA [72]
ACTCGTGCCCG/Thiol C6 SS 3’ 1008 nM–4500 nM and
conducted using Ocean Optics
limit of detection of 1 nM.
USB4000 spectrophotometer.
Immobilization of fluorescently
High sensitivity when
labeled aptamer on graphene oxide 50 -GGTGCGGTTCGTGC
detecting human serum
surface. When GHSA is present, the GHSA GGTTGTAGTACTCGTGGCC [73]
with an LoD of
fluorescence-labeled aptamer will GATAGAGGTAGTTTCG-30
50 µg mL−1
bind to GHSA and produce a signal.
Immobilization of biotinylated High selectivity for GHSA
aptamer on screen-printed carbon 5’ TGCGGTTGTAGTAC compared to glucose,
GHSA [75]
electrode modified with streptavidin TCGTGCCCG-3 glycine, folic acid
and measurement using SWV. and ampicillin.
Immobilization of thiol aptamer on
50 -NH2 -TGC GGT TGT AGT ACT CGT GGC High selectivity, with an
the surface with graphene oxide was GHSA [76]
CG–3 LoD of 0.031 µg mL−1.
measured using SWV.
GHSA: 50 -ferrosen-(CH2 )6-GTC TCA GCT
Immobilization of aptamer on the ACC TTA CCG TAT GTG GCC CAA AGC GTC
Selective to the target in
surface of the pollimer chip modified TGG ATG GCT ATG
diluted blood samples
with gold electrode. Measurement GHSA and HSA AA-(CH2 )6-SS-(CH2 )6-OH-30 [77]
with an LoD for HSA of 13
conducted by differential pulse HSA: 50 -ferrosen-(CH2)6-TGC GGT TCG TGC
nM and 25 nM for GHSA.
voltammetry (DPV). GGT TGT AGT ACT CGT GGC CGA
T-(CH2 )6-SS-(CH2 )6-OH-30 .
Diagnostics 2023, 13, 2035 13 of 19

Table 3. Cont.

Detection Principle Biomarker Aptamer Sequence Result Ref

Selection of aptamers by SELEX
process; the process of measuring 50 -GGTGGTGGGGGGGG The aptamer folded well
Insulin [79]
circular dichroism (CD) is used to TTGGTAGGGTGTCTTC-30 into a quartet structure.
select specific aptamers.
The aptamer was immobilized on a
The cathodic peak in
gold electrode. Measurements were
50 -GGTGGTGGGGGGGGTTG IGA3–hemin complex
made using cyclic voltammetry and Insulin [80]
GTAGGGTGTCTTC-30 decreased with insulin
activity was confirmed using
concentration.
spectrophotometry.
Good linear relationship,
with an insulin
Immobilization of insulin aptamer
50 -GGTGGTGGGGGGG concentration ranging
on graphene oxide with quaternary Insulin [110]
GTTGGTAGGGTGTCTTC-30 from 1.0 pM to 1.0 µM
tetraphenylethine salt probe.
with a low LOD of
0.42 pM.
Immobilized insulin binding
aptamer (IBA) modified with High sensitivity and
methylene blue (MB) as “signal off” selectivity; good
Aptamer IBA: 50 -SH-TTTTTTCAC CCT ACC
probe and aptamer/ferrocene Insulin reproducibility with an [81]
ACC CCCTATGTAATA AGA GCT AAA-30
modified with gold nanoparticles as LoD of 0.1 pM and linear
“signal on” probe. Measurements range of 10 pM–10 nM.
were made using SWV.
The aptamer hybridizes with cDNA
on the mesoporous silica surface as a
molecule that limits the diffusion of
the probe towards the electrode by High selectivity and
closing the mesochannels. When 50 -GGT GGT GGG GGG GGT TGG TAG GGT sensitivity, with an LoD of
Insulin [82]
binding to insulin, the hybridization GTC TTC-30 3 nM and linear range of
of cDNA with the aptamer will be 10.0–350.0 nM.
destroyed and open the
nano-channels, resulting in an
increase in DPV signal.
Immobilization of aptamer-labeled
High sensitivity and
red emission carbon dots (R-CDs) on
anti-interference, with an
graphene oxidase. Effectively 50 -(CH2 )6-NH2GGT GGT GGG GGG GGT
Insulin LOD of 1.1 nM and a [111]
detected insulin (INS) generates TGG TAG GGT GTC TTC-30
linear range of
fluorescence resonance energy
1.3–150 nM.
transfer (FRET).
Immobilization of aptamer on glass
carbon electrode (GCE); when
High selectivity and
insulin binds to aptamer, it will
sensitivity for the
undergo hydrolysis with the help of
50 -SH-(CH2 )6-GGT GGT GGG GGG GGT TGG detection of insulin, with
Exo 1 to cut the aptame that does not Insulin [112]
TAG GGT GTC TTC 30 an LoD of 9.8 fM and
bind. Gold nanoparticle-probe
linear range from 0.1 pM
aptamer is added so that a complex
to 1.0 µM.
is formed to form a sandwich assay.
Measurement with DPV.
High sensitivity and
Immobilization of aptamer on
NH2 -5’-GGT GGT GGG GGG GGT TGG TAG selectivity, with a linear
quantum dot surface. Fluorescence Insulin [113]
GGT GTC TTC-3’ range of 0.001–5000 nM
signal measurement.
and LoD of 0.5 pM.
The stability of the sensor
Methylene blue (MB)-modifed
was good for 10 days,
insulin-specifc aptamer immobilized SH-(CH2)6–GGT GGT GGG GGG GGT TGG
Insulin remaining at 92% with [114]
on gold-deposited TAG GGT GTC TTC—AttoMB2
high sensitivity
screen-printed electrodes.
and selectivity.
Aptamer with MB probe
High-sensitivity dan
immobilized on Au@Fe-MIL-88. 50 -NH2 GGTGGTGGGG
Insulin reproducibility, with an [115]
Measurements by cyclic voltametry GGGGTTGGTAGGGTGTTTTC-30
LoD 1.3 × 10−16 mol L−1 .
and DPV.
High selectivity for ATP
Immobilization of aptamer on
compared to UTP, CTP,
modified SPCE on gold F1: 50 -HS-(CH2 )6-ACCTGGGGGAGTAT-30
ATP and GTP. Good [104]
nanoparticles. Measurement F2: 50 -TGCGGAGGAAGGT-CH2 )2-NH2 -30
reproducibility
with DPV.
and stability.
Diagnostics 2023, 13, 2035 14 of 19

Table 3. Cont.

Detection Principle Biomarker Aptamer Sequence Result Ref

High selectivity for ATP
Immobilization of aptamer on
compared to UTP, CTP,
modified SPCE on gold F1: 50 -HS-(CH2 )6-ACCTGGGGGAGTAT-30
ATP and GTP, with LOD and [108]
nanoparticles. Measurement F2: 50 -TGCGGAGGAAGGT-CH2 )2-NH2 -30
LOQ values of 7.43 and
with DPV.
24.78 µM, respectively.
Molecular dynamics simulation
High specificity to ATP
between aptamer and ATP, forming a F1: 50 -HS-(CH2)6-ACCTGGGGGAGTAT-30
ATP compared to ADP [109]
sandwich conformation assay to F2: 50 -TGCGGAGGAAGGT-CH2 )2-NH2 -30
and AMP.
determine the interaction.
Aptamer has a high
degree of rigidity due to
Molecular dynamics simulation
the influence of ATP.
between aptamer and ATP to 50 -ACCTGGGGGAGTAT
ATP Interacts on nucleobases at [105]
determine the interaction and TGCGGAGGAAGGT-30
G6, A23, and forms
binding energy.
hydrographic bonds
at G22.
High selectivity, stability
The aptamer was immobilized on a and reproducibility with
50 -NH2 -ACC TGG GGG AGT ATT GCG
modified glassy carbon electrode. ATP an LoD of 0.01 pM and [116]
GAG GAA GGT-30
Measurement conducted by DPV. linear range of
0.01 pM–1 µM.
High sensitivity and
Immobilization of aptamer on excellent specificity, with
50 -NH2 -TGGAAGGAGGCGTTATGAGGGG
modified GCE with Fe3HAI4@ ATP an LoD of 0.17 nmol/L [117]
GTCCA-30
Cu@Cu2O nanocomposite. and a linear range of
0.5–2500 nmol/L.
High sensitivity and
Immobilization of aptamer labeled
50 -CACTGACCTGGGGGAGTAT selectivity with LoD
with FAM aptamer on ATP [118]
TGCGGAGGAAGGT-30 0.29 ng mL−1 and a linear
origami-based duplex.
range of 0.1 ng mL−1 .

5. Conclusions and Future Direction

This review summarizes the recent development of aptasensors for the diagnosis
of biomarkers of diabetes mellitus, namely glucose, insulin, HbA1c, GHSA, and ATP.
These aptasensors can be specifically designed to bind to specific biomarkers to distinguish
between types of diabetes mellitus (type 1, type 2, and mitochondrial diabetes). An research
objective in the field of biosensors is to produce an aptasensor for biomarker detection for
use by the community as an early diagnostic tool for diabetes mellitus that can distinguish
between types of diabetes mellitus so that there are no treatment errors that result in death.
The future direction of the aptasensor faces some challenges related to the reliability
and validity values of the diagnostic tool, such as sensitivity, stability, and specificity. In
addition, aptamer interaction studies should be conducted with the target and pharmacoki-
netics before clinical trials and commercialization.

Author Contributions: Gathering the required information and drafting manuscript: D.E.M. and
I.P.M. Revising and editing the manuscript: D.E.M. and I.P.M. All authors have read and agreed to
the published version of the manuscript.
Funding: This research was funded by Padjadjaran University in the form of Academic Leadership
Grant (ALG) 2023, Number: 1549/UN6.3.1/PT.00/2023 and Penelitian Dasar Kompetitif Nasional
(PDKN), Number: 044/E5/PG.02.00.PL/2023 and Number: 1834/UN.6.3.1/PT.00/2023.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.
Diagnostics 2023, 13, 2035 15 of 19

References
1. Smeltzer, S.C.; Bare, B.G. Buku Ajar Keperawatan Medikal Bedah Brunner & Suddarth, 8th ed.; Penerbit Buku Kedokteran: Jakarta,
Indonesia, 2013; Volume 2.
2. International Diabetes Federation. IDF Diabetes Atlas; International Diabetes Federation: Brussels, Belgium, 2021; Volume 102,
ISBN 9782930229980.
3. Powers, A.C.; Niswender, K.D.; Evans-Molina, C. Diabetes Mellitus: Diagnosis, Classification, and Pathophysiology. In Harrison’s
Principles of Internal Medicine, 20th ed.; Jameson, J.L., Fauci, A.S., Kasper, D.L., Hauser, S.L., Longo, D.L., Loscalzo, J., Eds.;
McGraw-Hill Education: New York, NY, USA, 2018.
4. Persatuan Endokrinologi Indonesia. Konsensus Pengelolaan Dan Pencegahan Diabetes Melitus Tipe 2 Di Indonesia 2006; Persatuan
Endokrinologi Indonesia: Jakarta, Indonesia, 2006.
5. Juarez-Facio, A.T.; de Lagarde, V.M.; Monteil, C.; Vaugeois, J.-M.; Corbiere, C.; Rogez-Florent, T. Validation of a Fast and Simple
HPLC-UV Method for the Quantification of Adenosine Phosphates in Human Bronchial Epithelial Cells. Molecules 2021, 26, 6324.
[CrossRef] [PubMed]
6. Vancraenenbroeck, R.; Webb, M.R. A Fluorescent, Reagentless Biosensor for ATP, Based on Malonyl-Coenzyme A Synthetase.
ACS Chem. Biol. 2015, 10, 2650–2657. [CrossRef] [PubMed]
7. Ning, Y.; Wei, K.; Cheng, L.; Hu, J.; Xiang, Q. Fluorometric aptamer based determination of adenosine triphosphate based on
deoxyribonuclease I-aided target recycling and signal amplification using graphene oxide as a quencher. Microchim. Acta 2017,
184, 1847–1854. [CrossRef]
8. Qu, F.; Sun, C.; Lv, X.; You, J. A terbium-based metal-organic framework@gold nanoparticle system as a fluorometric probe for
aptamer based determination of adenosine triphosphate. Microchim. Acta 2018, 185, 359. [CrossRef]
9. Anand, A.; Chen, C.-Y.; Chen, T.-H.; Liu, Y.-C.; Sheu, S.-Y.; Chen, Y.-T. Detecting glycated hemoglobin in human blood samples
using a transistor-based nanoelectronic aptasensor. Nano Today 2021, 41, 101294. [CrossRef]
10. Srivastava, P.; Razi, S.S.; Ali, R.; Srivastav, S.; Patnaik, S.; Srikrishna, S.; Misra, A. Highly sensitive cell imaging “Off–On”
fluorescent probe for mitochondria and ATP. Biosens. Bioelectron. 2015, 69, 179–185. [CrossRef]
11. Rukmini, M.S.; Ashritha; Nishmitha, P.; Yalla, D.; Christy, A.; Manjrekar, P. Analytical Calibre of High Performance Liquid
Chromatography and Ion Exchange Chromatography Resin Methods in Estimation of Glycated Hemoglobin: A Comparitive
Study. Biomed. Res. 2017, 28, 1765–1769.
12. Lakshmy, R.; Gupta, R. Measurement of Glycated Hemoglobin A1c from Dried Blood by Turbidimetric Immunoassay. J. Diabetes
Sci. Technol. 2009, 3, 1203–1206. [CrossRef]
13. Gilani, M.; Aamir, M.; Akram, A.; Haroon, Z.H.; Ijaz, A.; Khadim, M.T. Comparison of Turbidimetric Inhibition Immunoassay,
High-Performance Liquid Chromatography, and Capillary Electrophoresis Methods for Glycated Hemoglobin Determination.
Lab. Med. 2020, 51, 579–584. [CrossRef]
14. Zhou, G.; Wang, Y.; Cui, L. Biomedical Sensor, Device and Measurement Systems; Serra, P.A., Ed.; IntechOpen: Rijeka, Croatia,
2015; p. 7.
15. Velasco-Garcia, M.N.; Missailidis, S. New Trends in Aptamer-Based Electrochemical Biosensors. Gene Ther. Mol. Biol. 2009,
13, 1–10.
16. Tandra, H. Strategi Mengalahkan Komplikasi Diabetes; Gramedia Pustaka Utama: Jakarta, Indonesia, 2014.
17. American Diabetes Association. Diagnosis and Classification of Diabetes Mellitus. Diabetes Care 2014, 37 (Suppl. S1), S81–S90.
[CrossRef]
18. Forouhi, N.G.; Wareham, N.J. Epidemiology of diabetes. Medicine 2014, 42, 698–702. [CrossRef]
19. Bhatt, H.; Saklani, S.; Upadhayay, K. Anti-Oxidant and Anti-Diabetic Activities of Ethanolic Extract of Primula Denticulata
Flowers. Indones. J. Pharm. 2016, 27, 74. [CrossRef]
20. Forbes, J.M.; Cooper, M.E. Mechanisms of Diabetic Complications. Physiol. Rev. 2013, 93, 137–188. [CrossRef]
21. Akil, A.A.-S.; Yassin, E.; Al-Maraghi, A.; Aliyev, E.; Al-Malki, K.; Fakhro, K.A. Diagnosis and treatment of type 1 diabetes at the
dawn of the personalized medicine era. J. Transl. Med. 2021, 19, 137. [CrossRef]
22. Kahanovitz, L.M.; Sluss, P.M.; Russell, S.J. Type 1 Diabetes—A Clinical Perspective. Point Care J. Near-Patient Test. Technol. 2017,
16, 37–40. [CrossRef]
23. Paschou, S.A.; Papadopoulou-Marketou, N.; Chrousos, G.P.; Kanaka-Gantenbein, C. On type 1 diabetes mellitus pathogenesis.
Endocr. Connect. 2018, 7, R38–R46. [CrossRef]
24. Yahaya, T.; Salisu, T. Genes predisposing to type 1 diabetes mellitus and pathophysiology: A narrative review. Med. J. Indones.
2020, 29, 100–109. [CrossRef]
25. Giwa, A.M.; Ahmed, R.; Omidian, Z.; Majety, N.; Karakus, K.E.; Omer, S.M.; Donner, T.; Hamad, A.R.A. Current understandings
of the pathogenesis of type 1 diabetes: Genetics to environment. World J. Diabetes 2020, 11, 13–25. [CrossRef]
26. Soelistijo, S.A.; Lindarto, D.; Decroli, E.; Permana, H.; Sucipto, K.W.; Kusnadi, Y. Pengelolaan Dan Pencegahan Diabetes Melitus Tipe
2 Dewasa Di Indonesia; Perkeni: Jakarta, Indonesia, 2019; p. 133.
27. Ndisang, J.F.; Rastogi, S.; Vannacci, A. Insulin Resistance, Type 1 and Type 2 Diabetes, and Related Complications 2015. J. Diabetes
Res. 2015, 2015, 234135. [CrossRef]
28. Maxine, A.; Papadakis, M.D.; Stephen, J.; McPhee, M.D.; Michael, W.; Rabow, M. Current Medical Diagnosis & Treatment. In
LANGE Medical Book; McGrow Hill: New York, NY, USA, 2022.
Diagnostics 2023, 13, 2035 16 of 19

29. Galicia-Garcia, U.; Benito-Vicente, A.; Jebari, S.; Larrea-Sebal, A.; Siddiqi, H.; Uribe, K.B.; Ostolaza, H.; Martín, C. Pathophysiology
of Type 2 Diabetes Mellitus. Int. J. Mol. Sci. 2020, 21, 6275. [CrossRef] [PubMed]
30. Goyal, R.; Jialal, I. Diabetes Mellitus Type 2; StatPearls Publishing: Treasure Island, FL, USA, 2022.
31. Hatting, M.; Tavares, C.D.; Sharabi, K.; Rines, A.K.; Puigserver, P. Insulin regulation of gluconeogenesis. Ann. N. Y. Acad. Sci.
2017, 1411, 21–35. [CrossRef] [PubMed]
32. Maassen, J.A.; Hart, L.M.; van Essen, E.; Heine, R.J.; Nijpels, G.; Tafrechi, R.S.J.; Raap, A.K.; Janssen, G.M.; Lemkes, H.H.
Mitochondrial Diabetes. Diabetes 2004, 53, S103–S109. [CrossRef] [PubMed]
33. Kindred Healthcare Pathophysiology of Diabetes Mellitus. Available online: https://www.kindredhospitals.com/resources/
blog-kindred-continuum/2013/11/07/pathophysiology-of-diabetes-mellitus (accessed on 7 May 2023).
34. Chae, J.H.; Hwang, H.; Lim, B.C.; Cheong, H.I.; Hwang, Y.S.; Kim, K.J. Clinical features of A3243G mitochondrial tRNA mutation.
Brain Dev. 2004, 26, 459–462. [CrossRef] [PubMed]
35. Nelson, D.L.; Cox, M. Lehninger Principles of Biochemistry; Freeman and Company: New York, NY, USA, 2013.
36. Martinkova, P.; Pohanka, M. Biosensors for Blood Glucose and Diabetes Diagnosis: Evolution, Construction, and Current Status.
Anal. Lett. 2015, 48, 2509–2532. [CrossRef]
37. Iswantini, D.; Tri, W.; Purwaningsih, H.; Nurhidayat, N. Biosensor: Prinsip Dan Aplikasinya; IPB Press: Bogor, Indonesia, 2020.
38. Ferentinos, K.; Yialouris, C.; Blouchos, P.; Moschopoulou, G.; Tsourou, V.; Kintzios, S. The Use of Artificial Neural Networks as a
Component of a Cell-based Biosensor Device for the Detection of Pesticides. Proc. Eng. 2012, 47, 989–992. [CrossRef]
39. Migliozzi, D.; Guibentif, T. Assessing the Potential Deployment of Biosensors for Point-of-Care Diagnostics in Developing
Countries: Technological, Economic and Regulatory Aspects. Biosensors 2018, 8, 119. [CrossRef]
40. Drummond, T.G.; Hill, M.G.; Barton, J.K. Electrochemical DNA sensors. Nat. Biotechnol. 2003, 21, 1192–1199. [CrossRef]
41. Santosh, B.; Yadava, P.K. Nucleic Acid Aptamers: Research Tools in Disease Diagnostics and Therapeutics. BioMed Res. Int. 2014,
2014, 540451. [CrossRef]
42. Oleszek, M.; Kowalska, I.; Oleszek, W. Phytochemicals in Bioenergy Crops; Springer: Berlin/Heidelberg, Germany, 2019; Volume 18,
ISBN 0123456789.
43. Toh, S.Y.; Citartan, M.; Gopinath, S.C.; Tang, T.-H. Aptamers as a replacement for antibodies in enzyme-linked immunosorbent
assay. Biosens. Bioelectron. 2015, 64, 392–403. [CrossRef]
44. Witt, M.; Walter, J.-G.; Stahl, F. Aptamer Microarrays—Current Status and Future Prospects. Biotech 2015, 4, 115–132. [CrossRef]
45. Huang, R.; Xi, Z.; He, N. Applications of aptamers for chemistry analysis, medicine and food security. Sci. China Chem. 2015,
58, 1122–1130. [CrossRef]
46. Suaebah, E.; Naramura, T.; Myodo, M.; Hasegawa, M.; Shoji, S.; Buendia, J.J.; Kawarada, H. Aptamer-Based Carboxyl-Terminated
Nanocrystalline Diamond Sensing Arrays for Adenosine Triphosphate Detection. Sensors 2017, 17, 1686. [CrossRef]
47. Radi, A.-E. Electrochemical Aptamer-Based Biosensors: Recent Advances and Perspectives. Int. J. Electrochem. 2011, 2011, 863196.
[CrossRef]
48. Dunn, M.R.; Jimenez, R.M.; Chaput, J.C. Analysis of aptamer discovery and technology. Nat. Rev. Chem. 2017, 1, 76. [CrossRef]
49. Cai, S.; Yan, J.; Xiong, H.; Liu, Y.; Peng, D.; Liu, Z. Investigations on the interface of nucleic acid aptamers and binding targets.
Analyst 2018, 143, 5317–5338. [CrossRef]
50. Villalonga, A.; Pérez-Calabuig, A.M.; Villalonga, R. Electrochemical biosensors based on nucleic acid aptamers. Anal. Bioanal.
Chem. 2020, 412, 55–72. [CrossRef]
51. Byun, J. Recent Progress and Opportunities for Nucleic Acid Aptamers. Life 2021, 11, 193. [CrossRef]
52. Pividori, M. Electrochemical genosensor design: Immobilisation of oligonucleotides onto transducer surfaces and detection
methods. Biosens. Bioelectron. 2000, 15, 291–303. [CrossRef]
53. Nogues, C.; Leh, H.; Lautru, J.; Delelis, O.; Buckle, M. Efficient Antifouling Surface for Quantitative Surface Plasmon Resonance
Based Biosensor Analysis. PLoS ONE 2012, 7, e44287. [CrossRef]
54. Milne, N.; Di Rosa, F. The Diabetes Review: A Guide to the Basics. J. Diabetes Nurs. 2020, 24, JDN161.
55. Liu, S.; Shen, Z.; Deng, L.; Liu, G. Smartphone assisted portable biochip for non-invasive simultaneous monitoring of glucose and
insulin towards precise diagnosis of prediabetes/diabetes. Biosens. Bioelectron. 2022, 209, 114251. [CrossRef] [PubMed]
56. Park, J.-Y.; Chang, B.-Y.; Nam, H.; Park, S.-M. Selective Electrochemical Sensing of Glycated Hemoglobin (HbA1c ) on Thiophene-
3-Boronic Acid Self-Assembled Monolayer Covered Gold Electrodes. Anal. Chem. 2008, 80, 8035–8044. [CrossRef] [PubMed]
57. Ogawa, N.; Kimura, T.; Umehara, F.; Katayama, Y.; Nagai, G.; Suzuki, K.; Aisaka, K.; Maruyama, Y.; Itoh, T.; Hashimoto, W.; et al.
Creation of haemoglobin A1c direct oxidase from fructosyl peptide oxidase by combined structure-based site specific mutagenesis
and random mutagenesis. Sci. Rep. 2019, 9, 942. [CrossRef]
58. Sherwani, S.I.; Khan, H.A.; Ekhzaimy, A.; Masood, A.; Sakharkar, M.K. Significance of HbA1c Test in Diagnosis and Prognosis of
Diabetic Patients. Biomark. Insights 2016, 11, BMI-S38440. [CrossRef]
59. Hörber, S.; Achenbach, P.; Schleicher, E.; Peter, A. Harmonization of immunoassays for biomarkers in diabetes mellitus. Biotechnol.
Adv. 2019, 39, 107359. [CrossRef]
60. Pohanka, M. Glycated Hemoglobin and Methods for Its Point of Care Testing. Biosensors 2021, 11, 70. [CrossRef]
61. Duanghathaipornsuk, S.; Reaver, N.G.F.; Cameron, B.D.; Kim, D.-S. Adsorption Kinetics of Glycated Hemoglobin on Aptamer
Microarrays with Antifouling Surface Modification. Langmuir 2021, 37, 4647–4657. [CrossRef]
Diagnostics 2023, 13, 2035 17 of 19

62. Suryathi, N.M.A. Hemoglobin Glikosilat Yang Tinggi Meningkatkan Prevalensi Retinopati Diabetik Proliferatif ; Universitas Udayana:
Denpasar, Indonesia, 2015; pp. 1–92.
63. Thiruppathi, M.; Lin, P.-Y.; Chou, Y.-T.; Ho, H.-Y.; Wu, L.-C.; Ho, J.-A.A. Simple aminophenol-based electrochemical probes for
non-enzymatic, dual amperometric detection of NADH and hydrogen peroxide. Talanta 2019, 200, 450–457. [CrossRef]
64. Destiani, S.; Maksum, I.P.; Hartati, Y.W. Biosensor Elektrokimia untuk Memonitor Level Hemoglobin Terglikasi (HbA1c) pada
Penyakit Diabetes Melitus. Alchemy J. Penelit. Kim. 2023, 19, 94–107. [CrossRef]
65. Eissa, S.; Zourob, M. Aptamer- Based Label-Free Electrochemical Biosensor Array for the Detection of Total and Glycated
Hemoglobin in Human Whole Blood. Sci. Rep. 2017, 7, 1016. [CrossRef]
66. Eissa, S.; Almusharraf, A.Y.; Zourob, M. A comparison of the performance of voltammetric aptasensors for glycated haemoglobin
on different carbon nanomaterials-modified screen printed electrodes. Mater. Sci. Eng. C 2019, 101, 423–430. [CrossRef]
67. Bai, X.; Wang, Z.; Huang, C.; Wang, Z.; Chi, L. Investigation of Non-Enzymatic Glycosylation of Human Serum Albumin Using
Ion Trap-Time of Flight Mass Spectrometry. Molecules 2012, 17, 8782–8794. [CrossRef]
68. Koga, M.; Kasayama, S. Clinical impact of glycated albumin as another glycemic control marker. Endocr. J. 2010, 57, 751–762.
[CrossRef]
69. Goldin, A.; Beckman, J.A.; Schmidt, A.M.; Creager, M.A. Advanced Glycation End Products: Sparking the Development of
Diabetic Vascular Injury. Circulation 2006, 114, 597–605. [CrossRef]
70. Pu, L.J.; Lu, L.; Shen, W.F.; Zhang, Q.; Zhang, R.Y.; Zhang, J.S.; Hu, J.; Yang, Z.K.; Ding, F.H.; Chen, Q.J.; et al. Increased Serum
Glycated Albumin Level is Associated with the Presence and Severity of Coronary Artery Disease in Type 2 Diabetic Patients.
Circ. J. 2007, 71, 1067–1073. [CrossRef]
71. Hatada, M.; Loew, N.; Okuda-Shimazaki, J.; Khanwalker, M.; Tsugawa, W.; Mulchandani, A.; Sode, K. Development of an
Interdigitated Electrode-Based Disposable Enzyme Sensor Strip for Glycated Albumin Measurement. Molecules 2021, 26, 734.
[CrossRef]
72. Ghosh, S.; Datta, D.; Cheema, M.; Dutta, M.; Stroscio, M.A. Aptasensor based optical detection of glycated albumin for diabetes
mellitus diagnosis. Nanotechnology 2017, 28, 435505. [CrossRef]
73. Japrung, D.; Apiwat, C.; Treerattrakoon, K.; Dharakul, T.; Luksirikul, P. Aptasensor for diabetes mellitus detection and monitoring.
In Proceedings of the 2015 IEEE 15th International Conference on Nanotechnology (IEEE-NANO), Rome, Italy, 27–30 July 2015;
pp. 1521–1524. [CrossRef]
74. Apiwat, C.; Luksirikul, P.; Kankla, P.; Pongprayoon, P.; Treerattrakoon, K.; Paiboonsukwong, K.; Fucharoen, S.; Dharakul, T.;
Japrung, D. Graphene based aptasensor for glycated albumin in diabetes mellitus diagnosis and monitoring. Biosens. Bioelectron.
2016, 82, 140–145. [CrossRef]
75. Bunyarataphan, S.; Dharakul, T.; Fucharoen, S.; Paiboonsukwong, K.; Japrung, D. Glycated Albumin Measurement Using an
Electrochemical Aptasensor for Screening and Monitoring of Diabetes Mellitus. Electroanalysis 2019, 31, 2254–2261. [CrossRef]
76. Aye, N.N.; Maraming, P.; Tavichakorntrakool, R.; Chaibunruang, A.; Boonsiri, P.; Daduang, S.; Teawtrakul, N.; Prasongdee, P.;
Amornkitbamrung, V.; Daduang, J. A Simple Graphene Functionalized Electrochemical Aptasensor for the Sensitive and Se-lective
Detection of Glycated Albumin. Appl. Sci. 2021, 11, 10315. [CrossRef]
77. Zhou, L.; Figueroa-Miranda, G.; Chen, S.; Neis, M.; Hu, Z.; Zhu, R.; Li, Y.; Prömpers, M.; Offenhäusser, A.; Mayer, D. Flexible
multielectrode arrays based electrochemical aptasensor for glycated human serum albumin detection. Sens. Actuators B Chem.
2023, 386, 133730. [CrossRef]
78. Fargion, S.; Dongiovanni, P.; Guzzo, A.; Colombo, S.; Valenti, L.; Fracanzani, A.L. Iron and insulin resistance. Aliment. Pharmacol.
Ther. 2005, 22, 61–63. [CrossRef] [PubMed]
79. Yoshida, W.; Mochizuki, E.; Takase, M.; Hasegawa, H.; Morita, Y.; Yamazaki, H.; Sode, K.; Ikebukuro, K. Selection of DNA
aptamers against insulin and construction of an aptameric enzyme subunit for insulin sensing. Biosens. Bioelectron. 2009,
24, 1116–1120. [CrossRef]
80. Kubo, I.; Eguchi, T. Study on Electrochemical Insulin Sensing Utilizing a DNA Aptamer-Immobilized Gold Electrode. Materials
2015, 8, 4710–4719. [CrossRef]
81. Zhao, Y.; Xu, Y.; Zhang, M.; Xiang, J.; Deng, C.; Wu, H. An electrochemical dual-signaling aptasensor for the ultrasensitive
detection of insulin. Anal. Biochem. 2019, 573, 30–36. [CrossRef]
82. Asadpour, F.; Mazloum-Ardakani, M.; Hoseynidokht, F.; Moshtaghioun, S.M. In situ monitoring of gating approach on meso-
porous silica nanoparticles thin-film generated by the EASA method for electrochemical detection of insulin. Biosens. Bioelectron.
2021, 180, 113124. [CrossRef]
83. Ishizaka, A.; Tono-Oka, T.; Matsumoto, S. Evaluation of the proliferative response of lymphocytes by measurement of intracellular
ATP. J. Immunol. Methods 1984, 72, 127–132. [CrossRef]
84. Nakamura, N.; Wada, Y. Properties of DNA fragmentation activity generated by ATP depletion. Cell Death Differ. 2000, 7, 477–484.
[CrossRef]
85. Garland, J.M.; Halestrap, A. Energy Metabolism during Apoptosis. J. Biol. Chem. 1997, 272, 4680–4688. [CrossRef]
86. Crouch, S.P.M.; Kozlowski, R.; Slater, K.J.; Fletcher, J. The use of ATP bioluminescence as a measure of cell proliferation and
cytotoxicity. J. Immunol. Methods 1993, 160, 81–88. [CrossRef]
87. Manson, J.; Thiemermann, C.; Brohi, K. Trauma alarmins as activators of damage-induced inflammation. Br. J. Surg. 2011,
99, 12–20. [CrossRef]
Diagnostics 2023, 13, 2035 18 of 19

88. Ellsworth, M.L.; Ellis, C.G.; Goldman, D.; Stephenson, A.H.; Dietrich, H.H.; Sprague, R.S. Erythrocytes: Oxygen Sensors and
Modulators of Vascular Tone. Physiology 2009, 24, 107–116. [CrossRef]
89. Chida, J.; Ono, R.; Yamane, K.; Hiyoshi, M.; Nishimura, M.; Onodera, M.; Nakataki, E.; Shichijo, K.; Matushita, M.; Kido, H. Blood
Lactate/ATP Ratio, as an Alarm Index and Real-Time Biomarker in Critical Illness. PLoS ONE 2013, 8, e60561. [CrossRef]
90. Naing, A.; Kenchaiah, M.; Krishnan, B.; Mir, F.; Charnley, A.; Egan, C.; Bano, G. Maternally inherited diabetes and deafness
(MIDD): Diagnosis and management. J. Diabetes Its Complicat. 2014, 28, 542–546. [CrossRef]
91. Maksum, I.P.; Natradisastra, S.G.; Nuswantara, Y.N. The Effect of A3243G Mutation of Mitochondrial DNA to the Clinical
Features of Type-2 Diabetes Mellitus and Cataract. Pap. Knowl. Towar. Media Hist. Doc. 2013, 96, 591–599.
92. Frazier, A.E.; Thorburn, D.R.; Compton, A.G. Mitochondrial energy generation disorders: Genes, mechanisms, and clues to
pathology. J. Biol. Chem. 2019, 294, 5386–5395. [CrossRef]
93. Maksum, I.P.; Maulana, A.F.; Yusuf, M.; Mulyani, R.; Destiarani, W.; Rustaman, R. Molecular Dynamics Simulation of a tRNA-
Leucine Dimer with an A3243G Heteroplasmy Mutation in Human Mitochondria Using a Secondary Structure Prediction
Approach. Indones. J. Chem. 2021, 22, 1043–1051. [CrossRef]
94. Sari, R.P.; Maulana, A.F.; Yusuf, M.; Maksum, I.P. Simulation Modeling of A3243g Mutations on tRNALeu (UUR) against Type 2
Diabetes Mellitus using In Silico Method. Res. J. Chem. Environ. 2023, 27, 65–71. [CrossRef]
95. Destiarani, W.; Mulyani, R.; Yusuf, M.; Maksum, I.P. Molecular Dynamics Simulation of T10609C and C10676G Mutations of
Mitochondrial ND4L Gene Associated with Proton Translocation in Type 2 Diabetes Mellitus and Cataract Patients. Bioinform.
Biol. Insights 2020, 14, 1–8. [CrossRef]
96. Azizah, M.I.; Mulyani, R.; Maksum, I.P. Design and Optimization of PCR-RFLP Assay for Detection of G9053A and T15663C
Mutation in Mitochondrial DNA. Res. J. Chem. Environ. 2023, 27, 1–5. [CrossRef]
97. Maksum, I.P.; Farhani, A.; Rachman, S.D.; Ngili, Y. Making of the A3243g Mutant Template through Site Directed Mutagenesis as
Positive Control in PASA-Mismatch Three Bases. Int. J. PharmTech Res. 2013, 5, 441–450.
98. Maksum, I.P.; Saputra, S.R.; Indrayati, N.; Yusuf, M.; Subroto, T. Bioinformatics Study of m.9053G>A Mutation at the ATP6 Gene
in Relation to Type 2 Diabetes Mellitus and Cataract Diseases. Bioinform. Biol. Insights 2017, 11, 1–5. [CrossRef]
99. Ng, S.; Lim, H.S.; Ma, Q.; Gao, Z. Optical Aptasensors for Adenosine Triphosphate. Theranostics 2016, 6, 1683–1702. [CrossRef]
100. Sazani, P.L.; Larralde, R.; Szostak, J.W. A Small Aptamer with Strong and Specific Recognition of the Triphosphate of ATP. J. Am.
Chem. Soc. 2004, 126, 8370–8371. [CrossRef]
101. Zhao, M.; Liao, L.; Wu, M.; Lin, Y.; Xiao, X.; Nie, C. Double-receptor sandwich supramolecule sensing method for the determina-
tion of ATP based on uranyl–salophen complex and aptamer. Biosens. Bioelectron. 2012, 34, 106–111. [CrossRef]
102. Sessler, J.L.; Melfi, P.J.; Pantos, G.D. Uranium complexes of multidentate N-donor ligands. Co-Ord. Chem. Rev. 2006, 250, 816–843.
[CrossRef]
103. Rudkevich, D.M.; Verboom, W.; Brzozka, Z.; Palys, M.J.; Stauthamer, W.P.R.V.; van Hummel, G.J.; Franken, S.M.; Harkema, S.;
Engbersen, J.F.J.; Reinhoudt, D.N. Functionalized UO2 Salenes: Neutral Receptors for Anions. J. Am. Chem. Soc. 1994, 116, 4341–4351.
[CrossRef]
104. Kashefi-Kheyrabadi, L.; Mehrgardi, M.A. Aptamer-based electrochemical biosensor for detection of adenosine triphosphate using
a nanoporous gold platform. Bioelectrochemistry 2013, 94, 47–52. [CrossRef]
105. Xie, Y.-C.; Eriksson, L.A.; Zhang, R.-B. Molecular dynamics study of the recognition of ATP by nucleic acid aptamers. Nucleic
Acids Res. 2020, 48, 6471–6480. [CrossRef]
106. Kanyong, P.; Rawlinson, S.; Davis, J. Gold nanoparticle modified screen-printed carbon arrays for the simultaneous electrochemical
analysis of lead and copper in tap water. Microchim. Acta 2016, 183, 2361–2368. [CrossRef]
107. Odeh, F.; Nsairat, H.; Alshaer, W.; Ismail, M.A.; Esawi, E.; Qaqish, B.; Al Bawab, A.; Ismail, S.I. Aptamers Chemistry: Chemical
Modifications and Conjugation Strategies. Molecules 2019, 25, 3. [CrossRef]
108. Mulyani, R.; Yumna, N.; Maksum, I.P.; Subroto, T.; Hartati, Y.W. Optimization of Aptamer-Based Electrochemical Biosensor for
ATP Detection Using Screen-Printed Carbon Electrode/Gold Nanoparticles (SPCE/AuNP). Indones. J. Chem. 2022, 22, 1256–1268.
[CrossRef]
109. Rustaman, R.; Rahmawan, R.R.; Maksum, I.P. In Silico Study of Aptamer Specificity for De-Tection of Adenosine Triphosphate
(Atp) As Biosensor Development for Mitochondria. Turk. Comput. Theor. Chem. 2023, 7, 58–69.
110. Zeng, X.; Wang, H.; Zeng, Y.; Yang, Y.; Zhang, Z.; Li, L. Label-free Aptasensor for the Ultrasensitive Detection of Insulin Via a
Synergistic Fluorescent Turn-on Strategy Based on G-quadruplex and AIEgens. J. Fluoresc. 2022, 33, 955–963. [CrossRef]
111. He, Y.; Cheng, Y.; Wen, X. A design of red emission CDs-based aptasensor for sensitive detection of insulin via fluorescence
resonance energy transfer. Spectrochim. Acta Part A: Mol. Biomol. Spectrosc. 2022, 280, 121497. [CrossRef]
112. Liu, J.; Zhu, B.; Dong, H.; Zhang, Y.; Xu, M.; Travas-Sejdic, J.; Chang, Z. A novel electrochemical insulin aptasensor: From glassy
carbon electrodes to disposable, single-use laser-scribed graphene electrodes. Bioelectrochemistry 2021, 143, 107995. [CrossRef]
113. Mandani, S.; Rezaei, B.; Ensafi, A.A. Developing a highly-sensitive aptasensor based on surface energy transfer between InP/ZnS
quantum dots and Ag-nanoplates for the determination of insulin. J. Photochem. Photobiol. A Chem. 2021, 423, 113601. [CrossRef]
114. Şahin, S.; Kaya, Ş.; Üstündağ, Z.; Caglayan, M.O. An electrochemical signal switch–based (on–off) aptasensor for sensitive
detection of insulin on gold-deposited screen-printed electrodes. J. Solid State Electrochem. 2022, 26, 907–915. [CrossRef]
Diagnostics 2023, 13, 2035 19 of 19

115. Salandari-Jolge, N.; Ensafi, A.A.; Rezaei, B. An ultrasensitive electrochemical aptasensor based on a single-stranded aptamer-
Au@Fe-MIL-88 complex using methylene blue as an electrochemical probe for insulin detection. Anal. Bioanal. Chem. 2021,
413, 7451–7462. [CrossRef]
116. Meng, A.; Hong, X.; Zhang, Y.; Yin, J.; Sheng, L.; Li, Z. An antifouling electrochemical aptasensor based on poly (glutamic acid)
and peptide for the sensitive detection of adenosine triphosphate. Microchem. J. 2021, 168, 106365. [CrossRef]
117. Li, J.; Wang, X.; Liu, W.; Li, X.; Yang, L.; Ma, H.; Wu, R.; Wei, Q. Highly selective electrochemiluminescence aptasensor coupled
with mesoporous Fe3 O4 @Cu@Cu2 O as co-reaction accelerator for ATP assay based on target-triggered emitter release. Sens.
Actuators B Chem. 2021, 346, 130581. [CrossRef]
118. Wang, X.; Mao, Z.; Chen, R.; Li, S.; Ren, S.; Liang, J.; Gao, Z. Self-assembled DNA origami-based duplexed aptasensors combined
with centrifugal filters for efficient and rechargeable ATP detection. Biosens. Bioelectron. 2022, 211, 114336. [CrossRef] [PubMed]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.