IDENTIFICATION OF GENERAL TRANSCRIPTION

FACTOR-TWO-E AND MEDIATOR COMPLEX

INTERACTIONS IN THE CONTEXT OF PRE-INITIATION
COMPLEX FORMATION

A THESIS SUBMITTED TO

THE GRADUATE SCHOOL OF ENGINEERING AND SCIENCE

OF BILKENT UNIVERSITY

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR

THE DEGREE OF

MASTER OF SCIENCE

IN

MOLECULAR BIOLOGY AND GENETICS

By

Onur Rojhat Karasu

June 2018
IDENTIFICATION OF GENERAL TRANSCRIPTION FACTOR-TWO-E AND
MEDIATOR COMPLEX INTERACTIONS IN THE CONTEXT OF PRE-INITIATION
COMPLEX FORMATION

By Onur Rojhat Karasu

June 2018

We certify that we have read this thesis and in our opinion it is fully adequate, in scope
and in quality, as a thesis for the degree of Master of Science.

_______________________________________
Murat Alper Cevher (Advisor)

_______________________________________
Onur Çizmecioğlu

_______________________________________
Ayşe Elif Erson-Bensan

Approved for Graduate School of Engineering and Science:

_________________________________
Ezhan Karaşan
Director of Graduate School of Engineering and Science

i
 ABSTRACT

IDENTIFICATION OF GENERAL TRANSCRIPTION FACTOR-TWO-E AND

MEDIATOR COMPLEX INTERACTIONS IN THE CONTEXT OF PRE-INITIATION
COMPLEX FORMATION

Onur Rojhat Karasu

M.Sc. in Molecular Biology and Genetics

Advisor: Murat Alper Cevher

June 2018

Transcription is a multistep process which requires the presence of many different

proteins and protein complexes. The minimal protein components enabling transcription
to happen are identified to execute the event in vitro. However, formation of the
transcriptional machinery and the interactions of the proteins while forming the machinery
are still not fully understood. General Transcription Factors (GTFs) are identified as the
essential elements required for the transcription yet, it is still not clearly known how they
are being recruited to the promoter site. Mediator Complex is known to relay the signal
received from enhancer sequences to the transcription machinery which is called the Pre-
Initiation Complex (PIC) right before the transcription. Here, we are aimed to characterize
how Transcription Factor-Two-E is being recruited to TATA promoter by showing this
recruitment is strongly corelated with Mediator complex. Besides, this recruitment of
Transcription Factor-Two-E to TATA promoter may require more than one subunit of
Mediator complex in addition to functional core. Also, here we confirm that Transcription
Factor-Two-E co-precipitates with RNA Polymerase II (RNAP II) and TFIIH which are
consistent with the existing data in literature. However, the details and the nature of these
interactions are yet to be clarified. Identification of these interaction will hopefully result
in insights about the sequential formation of PIC or pre-formed holoenzyme multi
proteins.

Key Words: Mediator Complex, Pre-initiation Complex, General Transcription Factor-

Two-E, transcription,

ii
 ÖZET

GENEL TRANSKRİPSİYON FAKTÖRÜ II-E VE MEDİATOR KOMPLEKSİNİN

ETKİLEŞİMİNİN BAŞLAMA ÖNCESİ KOMPLEKSİ OLUŞUMU BAĞLAMINDA
TANIMLANMASI

Onur Rojhat Karasu

Moleküler Biyoloji ve Genetik Yüksek Lisans

Tez Danışmanı: Murat Alper Cevher

Haziran 2018

Transkripsiyon birçok proteinin ve protein kompleksinin gerekli olduğu çok

basamaklı bir olaydır. Transkripsiyonu sağlayan proteinler, olayın yapay ortamda
yapılmasına olanak sağlayabilecek kadar saptandı. Ancak, transkripsiyon sisteminin
oluşumu ve bu oluşumu sırasında proteinlerin etkileşimlerinin neler olduğu hala tam
olarak anlaşılmış değil. Genel Transkripsiyon Faktörleri (GTFler) transkripsiyon olması
için temel elementler olarak tanımlandı ancak bu elementlerin de promoter bölgesine nasıl
getirildiği tam olarak bilinmemekte. Mediator kompleksinin ise arttırıcı sekanslardan
aldığı sinyali Başlama Öncesi Kompleksi denen transkripsiyon sistemine ilettiği biliniyor.
Bu çalışmada, Transcription Factor-iki-E’nin TATA promoter bölgesine nasıl
getirildiğini, bu olayın Mediator kompleksiyle güçlü bir ilgisi olduğunu göstererek
karakterize etmeyi amaçladık. Ayrıca Transcription Factor-iki-E’nin Mediator TATA
promoter bölgesine getirilmesi için fonksiyonel çekirdek alt birimlerine ek olarak birden
fazla Mediator Kompleksi alt birimine ihtiyaç duyulabileceğini belirttik. Ayrıca,
literatürdeki var olan bilgilere uygun olarak, Transcription Factor-iki-E’nin RNA
Polimeraz II (RNAP II) ve TFIIH ile de birlikte çöktüğünü doğruladık. Her ne kadar bu
etkileşimlerin detayı ve doğası henüz tam olarak aydınlatılamamış olsa da bu
etkileşimlerin tanımlanmasının Başlama Öncesi Kompleksinin oluşumuna veya daha
önceden oluşmuş holoenzim multi proteinlerine dair fikir vereceği ümit edilmektedir.

Anahtar Kelimeler: Mediator Kompleksi, Başlama Öncesi Kompleksi, Genel Transkripsiyon

Faktörü-iki-E, transkripsiyon

iii
 To my dear family and my beloved sister;
I dedicate this study, for which I had to
stay away from them a long time.

iv
TABLE OF CONTENTS

ABSTRACT ........................................................................................................ii

ÖZET ..................................................................................................................iii

TABLE OF CONTENTS .................................................................................... v

Acknowledgements ..........................................................................................viii

List of Figures .................................................................................................... ix

List of Tables ...................................................................................................... xi

Abbreviations ....................................................................................................xii

CHAPTER 1……….INTRODUCTION ............................................................ 1

1.1. Eukaryotic Transcription System and Machinery ............................................... 1

1.1.1. RNA Pol II Mediated Transcription and Transcriptional Steps .................... 1

1.1.2. Difference of Basal and Activator Driven Transcription .............................. 2

1.1.3. Recruitment of RNAP II and GTFs to the Promoter Site ............................. 2

1.1.4. TAFs, PCs and NCs ...................................................................................... 5

1.2. Human Mediator Complex .................................................................................. 6

1.2.1. Presence of Different Forms of Mediator Complex in Cell and The

Assembly Question ................................................................................................. 7

1.2.2. Function, Structure and Architecture of Human Mediator Complex ............ 7

1.2.3. Effects of Mediator’s Architecture and Modular Structure on Its Function

and Regulations of Mediator Complex in Transcription and Pre-initiation
Complex Formation and Function .......................................................................... 9

1.3. General Transcription Factor IIE (GTF-TWO-E\TF-TWO-E) ......................... 12

1.3.1. Structure of GTF-TWO-E ........................................................................... 12

1.3.2. Functions of GTF-TWO-E .......................................................................... 14

v
1.4. Baculovirus Expression System ........................................................................ 16

CHAPTER 2………MATERIALS AND METHODS ..................................... 18

2.1. MATERIALS .................................................................................................... 18

2.1.1. Tables for Required Materials, Buffers and Solutions ................................ 18

2.2. METHODS ........................................................................................................ 23

2.2.1. Production and Purification of Mediator Complex Modules ...................... 23

2.2.1. Depletion of Mediator Complex from HeLa Nuclear Extracts ................... 24

2.2.2. Immobilized Template Recruitment Assay Using Streptavidin Dynabeads 24

2.2.2.1. Production of Template....................................................................... 24

2.2.2.2. Fixing the Template to the Streptavidin Dynabeads ........................... 24

2.2.2.3. Immobilized Template Recruitment Assay ........................................ 25

2.2.3. Protein Extractions from SF9 Insect Cells .................................................. 26

2.2.4. Production of GTF IIB, IIE and IIF in BL21 Bacteria Cells....................... 27

2.2.5. Immunoprecipitation Using M2 Agarose and Sepharose Beads ................. 28

2.2.6. Cloning of His-tagged RNA Polymerase II Subunits ................................. 29

CHAPTER 3…………RESULTS .................................................................... 31

3.1. Purification of Functional Human Core Mediator Complex with Baculovirus

Expression System ...................................................................................... 31

1.2. Dependency of PIC Elements to Mediator Complex to be Recruited to the

Promoter Site ............................................................................................... 32

1.3. Immuno-precipitation Result of Kinase Module- TF-Two-E Association ........ 34

1.4. Immunoprecipitation Result of Tail Module- TF-Two-E Association with

Additional Check of Med19 ........................................................................ 38

vi
1.5. Comparison of Mediator Depleted Nuclear Extract and Full Nuclear Extracts in
the Manner of TF-Two-E -Mediator Complex Association........................ 40

1.6. Association of TF-Two-E with PIC Elements ................................................... 41

1.7. Association of RNAP II and TFIIH with Separate TF-Two-E Subunits........... 43

CHAPTER 4………DISCUSSION .................................................................. 45

CHAPTER 5……….FUTURE PERSPECTIVES ............................................ 49

BIBLIOGRAPHY ............................................................................................. 52

APPENDIX ....................................................................................................... 62

vii
Acknowledgements

I would like to thank to our mentor and advisor Assist. Prof. Murat Alper Cevher
for all his advices and efforts. As a young scientist, his approach has taught me much more
than I could imagine I can learn. His positive behavior against all of us and vision that he
gave us were unique and in his own way. His acceptance of me to his lab totally changed
my life and my way of understanding life in all manners. So, I deeply want to thank him
for creating a step for me to go higher.

I want to thank to my dear parents Leyla Karasu and M. Arif Karasu for their
endless support. It did not matter how hard it was for them to keep convincing me go on.
They were patient, wise and strong so that I have never felt doing wrong while listening
to them. Also, my beloved sister, Malivan Karasu, is a source of energy to me just by
herself. Sometimes I got confused which one of us is the older one. She never let me feel
alone and stood always beside me. I could not do this without her.

Then, I must thank to my lab mates Tuğçe Canavar and Merve Erden. They were
my first mentors and without their friendship I do not think I could finish this thesis. Days
and nights and on and on we stood together and I always felt their support. I want them to
know that they will never be forgotten. Then to my friends in the whole department, Said
Tiryaki, Havva Kilgöz, Özlem Bulut and Gizem Kılıç for sharing many laughs and
memories with me. Sometimes those laughs were the only thing that kept me going. I
specifically want to thank Bilgenaz Özkan and Elif Özçelik. Whenever I felt down, I found
them beside me physically or by heart and they will always have a special place in my
heart.

And lastly, I want to thank to my senior students Mine Tanrıöver and Selin Yağlı
for their helps. We worked together and most importantly, I feel very lucky to encounter
such good companions and friends during my work. I am sure to see them in higher places
in the future which is also my biggest wish for them in their forthcoming life.

This Project was financially supported by European Molecular Biology

Organization (EMBO) Grant.

viii
List of Figures

Figure 1.1: The panel A show the sequential assembly of PIC in the described order and
panel B shows the Holoenzyme model in two different subpopulations….……………...5

Figure 1.2: Representation of modular structure of Mediator Complex and some distinct
subunits identified for regulatory pathways……………………………………………...8

Figure 1.3: Representation of Mediator-dependent Transcription in PIC formation,

initiation and elongation………………………………………………………………...11

Figure 1.4: Represented amino acid sequences of both subunits of Transcription Factor-
Two-E and their predicted interaction sites in corresponding
domains………………………………………………………………..………………...12

Figure 1.5: The cartoon representation of human Transcription Factor-Two-E α, human

TFIIS, archaeal TFIIB and yeast
RPB9…………………………………………………………………………………….13

Figure 1.6: The representation of indicated functions of Transcription Factor-Two-E

subdomains according to the computer based studies and
predictions……………………………………………………………………..………..14

Figure 1.7: Summary of Baculovirus expression system for virus production and protein
expression……………………………………………………………………………….16

Figure-3.1: Coomassie staining result of recombinantly purified Head (H), Middle (M),
H+M and H+M+14+26 core Mediator complex produced by Multi-Bac expression
system…………………………………………………………………………………...31

Figure-3.2: Immobilized template recruitment assay executed with and without mediator
presence. The H, H+M, H+M+26 and H+M+14+26 subcomplexes were added
separately to see the difference in the recruitment……………………………………...33

Figure-3.3 Western blot result that shows the Kinase module subunits which are pulled
down by flag-tagged Transcription Factor-Two-E bound M2 agarose
beads…………………………………………………………………………………….35

ix
Figure-3.4: Western blot result showing the pulled down Med12 subunit on
Transcription Factor-Two-E -α and Transcription Factor-Two-E -β bound
beads……………………….……………………………………………………………36

Figure-3.5: Western blot results of Med12 pull down with empty beads and reverse IP
with Med12 bound Sepharose beads……………………………………………………37

Figure-3.6: Western blot result that shows the Tail module subunits which are pulled
down by flag-tagged Transcription Factor-Two-E bound M2 agarose
beads…………………………………………………………………………………….39

Figure-3.7: Western blot check of nuclear extracts with (full NE) and without (Med
Depleted NE) Mediator Complex………………………………………………………40

Figure-3.8: Checked proteins on the Flag-tagged Transcription Factor-Two-E bound M2

agarose beads after the incubation with 10ng/ul concentrated HeLa nuclear
extracts…………………………………………………………………….……………42

Figure-3.9: Western blot analysis to check which subunit of Transcription Factor-Two-E

binds to RNAP II and
TFIIH…………………………………………………………………………………....43

Figure 4.1: Visual representation of designed ITRA experiment which shows two
different systems with and without the Mediator complex……………………………..45

Figure 5.1: The agarose gel electrophoresis images of cloned RPB subunits into pFBDM
vector……………………………………………………………………………………50

Figure-5.2: Western blot check of purified TFIIB and produced TFIIF subunits………51

x
List of Tables

Table 1.1: The elements of human transcription machinery and their functions in general
transcription………………………………………………………………………………3

Table 2.1: Immobilized template recruitment assay using streptavidin Dynabeads

buffers…………………………………………………………………………………...18

Table 2.2: Buffers for protein extractions from SF9 insect cells……………………….18

Table 2.3: Solutions for nuclear extract from HeLa cells………………………………19

Table 2.4: Materials for preparation of SDS-PAGE resolution gels…………………....19

Table 2.5: Materials for preparation of SDS-PAGE stacking gel………………………19

Table 2.6: Buffers required for western blotting…………………………………….….20

Table 2.7: Other materials and solutions for western blotting……………………….…20

Table 2.8: Used Antibodies in Western Blots……………………………………….….21

Table 2.9: Mediums required for GTF IIB, IIE and IIF production in BL21 Bacteria
Cells……………………………………………………………………………………..22

Table 2.10: Other used materials and Kits……………………………………………..22

Table 2.11: PCR program for TATA template multiplication……………………...….24

Table 2.12: Immobilized template recruitment assay plan with added NE and protein
amounts……………………………………………………..…………………………..25

Table 2.13: Produced subunits, their modules and usage amount of viruses………….26

Table 2.14: Contents of bacterial cell lysis buffer for protein extraction………….......27

Table 2.15: Primers used for clonings of RNAP II subunits with 6xHis tags………....29

Table 2.16: Program for Template Production with His Tagged Primers……………..30

xi
Abbreviations

GTF General Transcription Factor

Pol II RNA Polymerase II

RNAP II RNA Polymerase II

PIC Pre-initiation complex

TFIIA Transcription Factor IIA

TFIIB Transcription Factor IIB

TFIID Transcription Factor IID

TF-Two-E Transcription Factor IIE

TFIIF Transcription Factor IIF

TFIIH Transcription Factor IIH

TAF TBP Associated Factors

TBP TATA Binding Proteins

Med Mediator complex

CDK8 Cyclin Dependent Kinase 8

CCNC Cyclin C

SEC Super Elongation Complex

kDa Kilo Dalton

RXN Reaction

IPTG Isopropyl β-D-1-thiogalactopyranoside

PC Positive Factors

NC Negative Factors

xii
NAT Negative regulator of Activated Transcription

SRB Suppressor of RNA Polymerase B

TRAP Thyroid Hormone Associated Protein

CRSP Cofactor Required for Sp1 Activation

SMCC SRB/MED Cofactor Complex

BSA Bovine serum albumin

xiii
CHAPTER 1
INTRODUCTION
1.1. Eukaryotic Transcription System and Machinery

1.1.1. RNA Pol II Mediated Transcription and Transcriptional Steps

The central dogma is the process which converts the genetic code from DNA to
RNA and then to the proteins [1]. Transcription is the process in which DNA is used as a
template to make RNA in a very ordered and conserved way by the function of RNA
Polymerase [2]. The RNA Polymerase was first encountered by Gladstone and Weiss in
nuclei of rat liver cells in 1959 and Hurwitz and Stevens have seen the same activity in
Escherichia coli in 1960 [3-4]. With those discoveries, the role of RNA Polymerase on
transcription of DNA has been settled as a universal function. Until now, four different
RNA polymerases have been discovered and named as RNA Polymerase I, II. III and IV.
The RNA Polymerases I, II and III were named according to their fraction numbers while
purification and they are involved in 18S and 28S rRNAs (I), mRNAs (II) and tRNAs (III)
transcription processes respectively [5]. RNA Polymerase IV was discovered in last
decade in plants functioning by facilitating the production of small interfering RNAs
(siRNAs) [6]. Due to the distinct functions of these RNA polymerases, they require
different sets of additional proteins and here we will be focusing on the transcription event
mediated by RNA Polymerase II (RNAP II).

For RNAP II to start the transcription of a gene, three major steps are executed: (I)
Chromosome opening and the formation of euchromatin, (II) modification of histones on
the related gene for the access of activators and silencers and (III) assembly of the
transcription machinery at the promoter site of the gene [7].

1
 1.1.2. Difference of Basal and Activator Driven Transcription

Activators and repressors are the proteins required for the regulation of
transcription of a specific gene or a set of genes in cells. For the activator dependent
transcription to happen, it is crucial that related activator or activators sits on the
corresponding Enhancer sequence sites [8]. For instance, Estrogen Receptor- α is an
activator and needs to sit on to Estrogen Enhancer Sequence (EES) site to start activator
dependent transcription. The specificity of an activator to its related set of genes comes
from its special DNA binding domain which prevents it to bind any other enhancer
sequences than its own [9]. The basal level transcription is the observed level of expression
of a gene even under the suppression and executed by the general transcription machinery.
The difference between activator dependent transcription and basal transcription starts
from the distinct core promoter sites of these two events. Upon the binding of activator,
the signal of enhancer is relayed to the transcription machinery and boost the transcription
by both increasing the transcribed mRNA levels and speculatively by helping to bring the
transcription machinery to the core promoter sites [10].

1.1.3. Recruitment of RNAP II and GTFs to the Promoter Site

Apart from the gene specific activators, there are some set of proteins required for
the transcription to happen. Upon binding of activator, the transcription machinery is
recruited to the promoter site. This transcription machinery is composed of RNAP II and
some other accessory proteins which are required in the site-specific transcription
initiation. The necessity of these accessory proteins was first shown by Weil in 1979. He
achieved in vitro transcription by additionally putting crude subcellular extraction
fractions onto the RNAP II with the native adenovirus DNA template [11]. Further
examinations for identification of these accessory proteins in the extract fractions revealed
different proteins eluted in increasing salt concentrations in ion exchange chromatography
[11]. At the end these proteins were identified as transcription factors, named as TFIIA,
TFIIB, TFIID, TF-Two-E, TFIIF and TFIIH and characterized as general transcription
factors (GTFs). In the nomenclature the TFs stand for transcription factor, the roman
2
number represents the RNAP II dependent transcription and the letters correspond to the
chromatographic fractions at which each protein was eluted [12].

Table 1.1: The elements of human transcription machinery and their functions in general
transcription [13]

Factor Protein Composition Function

Antirepressor; stabilizes TBP-TATA complex;
TFIIA p35 (α), p19 (β), and p12 (γ)
coactivator
Start site selection; stabilize TBP-TATA complex; pol
TFIIB p33
II/TFIIF recruitment
Core promoter-binding factor, Coactivator, Protein
TFIID TBP + TAFs (TAF1-TAF14) kinase, Ubiquitin-activating/conjugating activity, Histone
acetyltransferase
Recruits TFIIH, Facilitates formation of an initiation-
TFIIE p56 (α) and p34 (β)
compentent pol II, Involved in promoter clearance
Binds pol II and facilitates pol II recruitment to the
promoter, Recruits TFIIE and TFIIH, Functions with
TFIIF RAP30 and RAP74 TFIIB and pol II in start site selection, Facilitates pol II
promoter escape, Enhances the efficiency of pol II
elongation
ATPase activity for transcription initiation and promoter
P89/XPB, p80/XPD, p62, p52, clearance, Helicase activity for promoter opening,
TFIIH p44, p40/CDK7, p38/Cyclin H, Transcription-coupled nucleotide excision repair,
p34, p32/MAT1, and p8/TFB5 Kinase activity for phosphorylating pol II CTD, E3
ubiquitin ligase activity
Transcription initiation, elongation, termination,
Recruitment of mRNA capping enzymes, Transcription-
RNAP II RPB1-RPB12 coupled recruitment of splicing and 3 end processing
factors, CTD phosphorylation, glycosylation, and
ubiquitination

Even though the components of the human general transcription machinery are
known, there are two different hypotheses about how the formation of this machinery
occurs. The first hypothesis suggests a sequential assembly before the initiation of
transcription based on the in vitro transcription assays conducted with different
chromatographic fractions of crude HeLa cell extracts [14]. According to it, after the DNA
is opened for transcription, the TFIID is recruited to the TATA box and binds to the DNA

3
via one of its components, Tata Binding Protein (TBP) [15]. This prokaryotic σ-factor-
analogous function of TBP was first discovered in Drosophila [16], then in mammals [17]
and lastly in S. cerevisiae (yeast) [18]. After that, the TFIIA comes as a facilitator for
TFIIA-TBP-DNA complex formation by inhibition of inhibitory elements in the
environment and raises the possibility of TBP or TFIID to bind to the DNA [19]. Also, it
helps the stabilization of the TBP-DNA complex by binding the complex from an opposite
direction of the TFIIB binding site [20]. The other stabilizer of the TBP-TATA box
complex is the TFIIB. As mentioned before, the TFIIB and TFIIA bind to the opposite
sites of the TBP-DNA complex to increase the stability of the complex [20-21]. Also, the
TFIIB acts as a recruiter for the RNAP II-TFIIF complex so that it marks the transcription
start site [22] and helps the RNAP II-TFIIF complex to dock on the DNA [23]. The TFIIF
is closely interacting with RNAP II [24] and its entry to the promoter site happens together
with RNAP II. It has some distinct functions like helping RNAP II to enter to the
transcription machinery by docking onto readily formed TFIIA-TBP-TFIIB-DNA
complex [25], stabilizing the RNAP II on the complex by bending the DNA towards
RNAP II and creating new DNA and protein interaction sites [26], enabling the
Transcription Factor-Two-E -TFIIH entry to the complex [21] determining the start site
of transcription along with RNAP II and TFIIB and lastly helping the RNAP II to leave
the promoter site upon the transcription initiation 28]. The Transcription Factor-Two-E on
the other hand interacts with several members of Pre-Initiation Complex (PIC) but it
mainly recruits TFIIH to the PIC and regulates its ATPase 29], kinase [30], and helicase
[31] activities. The general functions and detailed structures of Transcription Factor-Two-
E will be explained in “General Transcription Factor IIE” section. The last member of PIC
is the TFIIH and it is necessary for a couple of reasons. Its ATPase activity is required for
promoter clearance, helicase activity is required for unrolling the DNA and kinase activity
is required for CTD phosphorylation of RNAP II to stimulate transition from initiation
stage [13].

The second theory is based on the existence of different subpopulations of

transcription machinery containing RNAP II. According to that, the RNAP II holoenzyme
is found in nucleus with different combinations of GTFs or even without the GTFs [32].
The different versions of the holoenzyme complex were eluted by using different

4
chromatographic conditions for purifications and separate laboratories obtained varying
subsets of the holoenzyme. The representation of both pathway can be seen in the Figure
1.1 below. There are enough evidence supporting both pathways so it is important to
speculate that the variations in the environment and physiological conditions determine
pathway choice and formation of PIC.

Figure 1.1: The panel A show the sequential assembly of PIC in the described order and
panel B shows the Holoenzyme model in two different subpopulations [13].

1.1.4. TAFs, PCs and NCs

Further in vitro transcription assays for revealing the core elements of transcription
machinery for activator dependent transcription showed some controversial results about
the requirements of some GTFs. Separate laboratories identified different elements so it
can be speculated that the variations in purification steps can result in the elution of some
distinct factors enabling the transcription. However, it was shown that TBP, which is a

5
subunit of TFIID, is not sufficient on its own for the transcription [33]. This finding then
followed by the finding of TBP Associated Factors (TAFs) which are also identified as
the subunits of TFIID and characterized as activator dependent transcription regulators
that are transmitting the signal from activator to the machinery [33]. Thus, the usage of
TAFs with TBP which is the TFIID itself or presence of only TBP determines activated
or basal level transcription respectively. Later, the biochemical studies identified driver
regulators other than TAFs from the cell extracts which are called as Upstream
Stimulatory Activity (USA) [34] and these activities involved both activation and
repression so they were divided into one Negative Cofactor (NCs) and four Positive
Cofactors (PC1-4) which are working as a coactivator in the presence of the activators and
working as a repressor to stop basal transcription in the absence [35], so their function
depends on the presence and absence of activators. Although there were some matching
elements in these PC fractions, the PC2 is important especially since it is composed of
many subunits which are later identified as belonging to Mediator Complex [36] that is
also a general cofactor relaying the gene specific signals from activators or repressors to
the transcription complex [37].

1.2. Human Mediator Complex

At the beginning, Mediator Complex was found in S. cerevisiae composing of 11

essential and 9 accessory subunits which makes a 20-subunit protein complex [38]. The
human mediator complex was first purified as human Thyroid Hormone-α Receptor
Associated Protein (TRAP) Complex. This complex was eluted together with human
Thyroid Hormone Receptor-α (hTR-α) and enables in vitro transcription when a DNA
template that includes T3 Response elements or TREs is used [39]. Later, many subunits
of the Mediator complex were also found in independently purified protein complexes like
SRB/MED-containing cofactor complex (SMCC) which contains TRAP220 TRAP170
and TRAP 100 in common with TRAP complex [40], activator-recruited complex (ARC)
[41], vitamin D receptor interacting protein complex (DRIP) [42], cofactor required for
Sp1 activation (CRSP) which also shares some subunits with TRAP complex [43],
Positive Cofactor 2 (PC2) [35] and negative regulator of activated transcription (NAT)

6
which has indeed a repressive role in transcription due to the repressor function of CDK8
[44].

1.2.1. Presence of Different Forms of Mediator Complex in Cell and

The Assembly Question

As mentioned before, there are many Mediator-like subpopulations in the cell.

Those subpopulations contain some subunits which are identified as Mediator complex
subunits. Other subunits of those subpopulations represent a very high homology with
Mediator complex elements. These findings show us that Mediator Complex can be found
in cells in different versions which are composed of varying subunits and that creates a
high heterogeneity for the Mediator Complex. Mediator complex is present in a very low
amount in cell and has that high heterogeneity. The complex is also very dynamic and
flexible which makes the complex very hard to study [45]. Some defined subpopulations
of Mediator Complex were MED13(TRAP240), MED12(TRAP230), Cyclin C, and
CDK8 subcomplex [46] and MED23(hSUR2), MED24(TRAP100) and
MED16(TRAP95) subcomplex [47]. Many other studies based on a subunit of Mediator
Complex also describes that heterogeneity. For example, the Zhang, X. et. al., (2005) [45]
mentions the versions of Mediator complex with and without MED1/TRAP220 by
pointing out the presence of MED1/TRAP220 subunit only in some subpopulations [45].
Due to this dynamic structure and high heterogeneity, the human Mediator Complex is
defined into modules which are the Head, Middle Tail and CDK8 containing Kinase
module [48]. The first question here to be asked is that how such a complex is being
formed in a cell. It requires further examinations and analysis to determine if those
subpopulations act as pre-formed structures to be assembled after being induced by a
regulator or a sequential de novo assembly happens for the whole Mediator formation.

1.2.2. Function, Structure and Architecture of Human Mediator

Complex

The multi-subunit human Mediator Complex is a 30-subunit complex in humans.

As mentioned before, it has the Head, Middle, Tail and Kinase modules even though the

7
composition of these modules differ in separate papers from independent laboratories. The
first functional identification of human Mediator Core Complex was done in 2015 which
shows that the Head, Middle, Med14 and Med26 forms the transcriptionally active core
of the complex [49]. It is the function of Mediator to receive signals from regulatory
pathways in a cell and to turn it into a transcriptional response [50]. Mediator Complex is
the hub for many distinct pathways where the signal is converted and transmitted to
transcriptional machinery. Since the Head and Middle modules along with Med14 gives
the functionality to the complex, it is important to speculate that these distinctive subunits
of each pathway, that are resulted from physiological conditions of a cell, rest in the Tail
and Kinase subunits. The representation of some identified subunits for separate pathways
can be seen in Figure1.2 below.

Figure 1.2: Representation of modular structure of Mediator Complex and some distinct
subunits identified for regulatory pathways [50].

8
 1.2.3. Effects of Mediator’s Architecture and Modular Structure on
Its Function and Regulations of Mediator Complex in Transcription
and Pre-initiation Complex Formation and Function

As it was mentioned before, the mammalian Mediator Complex has 30 subunits

and 4 of these subunits are of Kinase module [48]. Due to the distinct functions and
dynamic interactions with Mediator Complex, CDK8 containing Kinase module
sometimes counts as separate and Mediator Complex is told to have 26 subunits [46].
Since the Transcription Factors (TFs) have separate and different binding domains from
each other, Mediator Complex can also bind multiple TFs instead of interacting them
individually. Also, due to its interactions with the PIC, it can be said that the Mediator
Complex also has a high number of interactions with RNAP II even though the exact
mechanism of Mediator Complex - RNAP II interaction is not known yet.

Since the composition of Mediator also changes much even within the same cell,
this ability of Mediator to detach from its subunits according to the executed function
makes it mechanistically important for the transcription. Some studies also found and
purified Mediator complexes that are lacking different numbers of Mediator subunits apart
from the Kinase Module (e.g. PC2) [51-52]. Since these Mediator Complexes cannot
transmit the signal coming from the TFs that bind to the lost subunits, this creates a
direction in the selection of the transcribed gene. In such cases, it is shown that the Med1
binds to the thyroid hormone receptor(TR) and its knock out stopped the TR induced
transcription [39] and Med23 is shown to bind ELK1 [53]. Again, the knockout of Med23
causes an inhibition on the ELK1 activated gene expression [53]. It is important to add
that these knockouts do not stop the transcription regulated by other gene specific TFs.
[39-53] Thus it can be concluded that the Mediator Complexes having fewer subunits than
whole Mediator Complex should have a more specified function.

Another structural tool of Mediator, the Kinase module, gives very distinct
properties to the complex. It is known that the Kinase module has a reversible interaction
9
with the complex which is also very dynamic and this interaction creates a different sub-
population of complex often called as CDK8-Mediator Complex [54-55]. When this
subpopulation is further examined, it is seen that the Med26 subunit is not notably present
in that subcomplex resulting in a 29 subunit Mediator. [56] Even though the exact
mechanism underlying the association and dissociation of Kinase module is not fully
figured, some studies suggest the ubiquitination and phosphorylation of Med13 may have
link to that event [57]. In that aspect, it is hypothesized that the PARP1 protein which
normally ribosylates proteins [58] and FBW7, which is a ubiquitin ligase, stimulates the
dissociation of Kinase module from the Mediator Complex [57-58]. Also, it is being
thought that the structural changes upon the binding of Kinase module to the Mediator
complex prevents the RNAP II-Mediator interaction [59]. The RNAP II Carboxyl
Terminal Domain (CTD) associated Mediator complex has failed to show a presence of
kinase module subunits [59] and consistently the Kinase module bound Mediator did not
pull down any RNAP II subunits in purifications [60]. Yet, when the initiation is
completed, the re-association of Kinase module to the Mediator somehow starts the
elongation step. [61] Besides, Kinase module incorporated Mediator Complex fails to bind
to TFIIH which results in the inhibition of RNAP II - TFIIH interaction and prevents
promoter escape. By this way, re-binding of new RNAP II to the same promoter is also
prevented since RNAP II cannot leave the PIC [62].

The Mediator is thought to form many interactions with RNAP II [63-64] and this
interaction may create a scaffold for the PIC formation since the Mediator Complex
transmits the signals from TFs to RNAP II and PIC which is called as the bridge model
[65-66]. Some studies suggest that the recruitment of RNAP II via Mediator Complex
happens due to its association with RPB1 subunit [61]. Also, it is thought that the Mediator
Complex regulates the RNAP II entry to the PIC with the involvement of GDOWN1 which
is a factor that binds to RNAP II when it is not Mediator bound and thus inhibits
transcription by disrupting the TFIIF-RNAP II interaction [67-68].

10
 Studies about the transcriptional elongation showed that the Med26 may interact
with the Super Elongation Complex (SEC) and may help the initiation of elongation [69].
Interestingly, the same studies show Med26 to bind TFIID as well and suggest that the
facilitative role for Med26 in PIC formation and then a regulatory function in elongation
upon a regulatory signal due to its interaction with SEC [69]. These data also bring a
proposition for that integrated roles of Mediator, GDOWN1 and SEC by stating a
configurational remodeling or switching system. Additionally, Med26 has been shown to
colocalize with the heterochromatin in contrast with other Mediator Complex subunits
which can bring an explanation to the antagonistic function of Mediator and
heterochromatin regions in humans [70].

Figure 1.3: Representation of Mediator-dependent Transcription in PIC formation,

initiation and elongation [71].

As it can be seen from Figure-3 above, in Panel A, Mediator Complex first helps
the formation of the PIC by bringing RNAP II and other TFs to the promoter site [72] At
the beginning, The CTD of RNAP II is not phosphorylated much but with the actions of
TFIIH, it gets phosphorylated and initiate the transcription which is called the promoter
escape (at serine 2 and serine 5 residues of the heptad repeats) [73]. After nearly
transcribing 50 to 60 nucleotides, RNAP II stalls at some genes [74]. Although it is not
known whether Mediator complex stays interacting with stalled RNAP II, Panel B
represents the situation after the Mediator Complex and RNAP II bonds are seized and
Kinase module entry to Mediator Complex happens since they have an exclusive behavior
when binding to Mediator Complex. At this stage, it is shown that the CDK8 associates
with SEC to stimulate the stalled RNAP II to go on with elongation [61-75]. It is also

11
predicted that the Med26 can have a role at this stage by dissociating from complex upon
binding of Kinase module. The Panel C shows the recruitment of a new RNAP II by the
remaining PIC which is called as re-initiation [76].

1.3. General Transcription Factor IIE (GTF-TWO-E\TF-TWO-E)

1.3.1. Structure of GTF-TWO-E

As it was explained in Figure-1, in the sequential assembly of PIC, Transcription

Factor-Two-E enters the complex after the RNAP II-TFIIF recruitment. The Transcription
Factor-Two-E consists of two subunits which are named as Transcription Factor-Two-E -
α and Transcription Factor-Two-E -β [77]. (Although at first it was thought that this
protein works in a heterodimer structure with two α and two β subunits [77], later studies
showed that the protein works as a α+β heterodimer form [78].) The α subunit is a 439-
amino acid long polypeptide with a molecular mass of 56 kDa and the β subunit is a 291-
amino acid long and 34 kDa polypeptide [77]. The predicted interaction sites and of
Transcription Factor-Two-E subunits on the represented aminoacids sequences are shown
in the Figure-4 below.

Figure 1.4: Represented amino acid sequences of both subunits of Transcription Factor-
Two-E and their predicted interaction sites in corresponding domains [13].

12
 The N-terminal domain of α subunit which is between 12th and 118th amino acids
appears to interact with the Transcription Factor-Two-E -β by the region between 197th-
238th amino acids. The C-terminal domain on the other hand appears to be the interaction
site of α subunit and TFIIH [13]. Since it is known that the Transcription Factor-Two-E
helps the recruitment of TFIIH to the PIC [79], it is quite logical to see a direct interaction
between Transcription Factor-Two-E and TFIIH. Upon looking the Figure 1.4, there are
some distinct regions in the subunits. For example, the α subunit has a homology with the
bacterial σ factor at the residues between 13th and 49th amino acids, there is a leucine
repeated part from 38th to 66th residues, the zinc finger domain is between 121st and 151st
one Helix-Turn-Helix (HTH) motif domain between 159th and 182nd aminoacids. There
are two different alanine rich domains following the HTH domain and close to the C-
terminus, there is an acidic domain formed mainly with aspartic and glutamic acids
between 378th and 398th aminoacids [13]. Due to the nature of zinc finger motifs, their
function is mainly to bind the DNA. Generally, a zinc finger domain is composed of 3 or
4 beta strands as it is seen in TFIIB, TFIIS and RPB9 orthologs but the zinc finger domain
of Transcription Factor-Two-E differs from others by having one alpha helix and two beta
sheets in an ββαβββ order. The Zn+2 ion is binding to Cysteine amino acids at 129, 132,
154 and 157 locations [80]. The HTH domain of α subunit has a homology between
archaeal TFE which also has a HTH motif and helps the transcription initiation by
facilitating the TATA box recognition [81] This is the only predicted function for the HTH
domain of human Transcription Factor-Two-E -α subunit.

Figure 1.5: The cartoon representation of human Transcription Factor-Two-E α, human

TFIIS, archaeal TFIIB and yeast RPB9 [80].

13
 On the other hand, the β subunit also has some structurally distinct sites. There is
a serine rich site between 26th and 71st amino acids and a winged HTH site in 75th and
139th residues. Then comes a leucine rich site between 145th and 163th residues and a
bacterial σ factor subdomain 3 homology site between 163rd and 193rd amino acids [13].
The C-terminus contains two basic Loop-Helix-Loop and Helix-Loop domains. The
homology predictions state a resemblance with the Krüppel TF of Drosophila which has
a DNA binding function. Also, the Winged HTH region has a homology with the RAP30
from its RNAP II binding domain. Even though these interactions are predicted, more
experiments are required to define the certain interaction sites [13-79].

1.3.2. Functions of GTF-TWO-E

In the literature, there are three different functions that are assigned to GTF-TWO-
E. As it can be seen from the Table-1.1, these functions are to recruit the TFIIH to the PIC,
to help the assembly of PIC and to help the promoter clearance. The indicated functions
of Transcription Factor-Two-E domains and their sites can be seen in the Figure-6 below
[78].

Figure 1.6: The representation of indicated functions of Transcription Factor-Two-E

subdomains according to the computer based studies and predictions [78].

14
 Even though it is not clear yet how the Transcription Factor-Two-E is being
recruited to the promoter site at the beginning, there are some suggested candidates like
Krüppel protein [82], Antennapedia Abd-B homeodomain proteins which are shown to
bind Transcription Factor-Two-E in vivo [83] however, it is not clear if they also involve
in the recruitment of Transcription Factor-Two-E to the promoter region and to the PIC.
Due to its location in PIC, the Transcription Factor-Two-E is thought to be interacting
with TFIIF, TFIIB, RNAP II and TFIIH [13].

The interaction of Transcription Factor-Two-E and TFIIH have been shown in

many different studies. This interaction enables TFIIH to be recruited to the PIC at the
promoter site. The absence of TFIIF prevented the TFIIH entry to the PIC [84]. The
defined interaction of Transcription Factor-Two-E and TFIIH is on the C-terminus domain
of Transcription Factor-Two-E -α subunit. This interaction enables Transcription Factor-
Two-E to regulate the kinase and ATPase activities of TFIIH so that it phosphorylates the
CTD domain of RNAP II and starts the elongation [79]. Also, the promoter region where
Transcription Factor-Two-E sits is found as -10 where the Transcription Factor-Two-E
also helps TFIIH helicase activity for promoter clearance at +1 and DNA melting [85]. It
is also shown that the Transcription Factor-Two-E and TFIIH are not required for in vitro
transcription from a pre-melted template using adenovirus promoter (AdE4) [85]. Thus, it
has been concluded that the Transcription Factor-Two-E does not only recruit TFIIH but
also act as a mechanistical check point from initiation to elongation stages [84] The co-
occupancy between Transcription Factor-Two-E and TFIIB was also reported by glycerol
sedimentation analysis [86]. The same method was also used to show the co-occupancy
of RNAP II and Transcription Factor-Two-E without defining any specific subunits. This
method only gives the conclusion that these two proteins (Transcription Factor-Two-E -
TFIIB and Transcription Factor-Two-E -RNAP II) co-exist together and elute together
[86]. It is also shown that Transcription Factor-Two-E co-purifies the non-phosphorylated
RNAP II specifically [84] which is also logical since the aim of recruitment of TFIIH via
Transcription Factor-Two-E is to phosphorylate the CTD and to start elongation.

15
 1.4. Baculovirus Expression System

Baculovirus expression system has been designed to overcome some important

obstacles emerged due to the nature of bacterial expression system. More important of
these obstacles can be said as lacking eukaryotic post translational modifications and
inability of producing large proteins. Also, the stability of the vector produced mRNAs in
bacterial system is quite low and thus the assembly of the protein complexes produced
under the same promoter, does not fully happen in the system [87].

The Baculovirus expression system for multi-protein complexes has two different
expression cassettes with T7 and Cre/Lox translocation sites. These vectors, which are
pFBDM and pUCDM respectively, contain polyhedron (polh) and p10 viral promoters
with two different multiple cloning sites (MCSs) to allow cloning of genes of interest via
digestion with a bunch of restriction enzymes. For the first selection, to distinguish the
gene inserted vectors, pUCDM and pFBDM contain chloramphenicol and ampicillin
resistance markers. To sub clone multiple genes, both vectors have a multiplication
module which contain BstZ17I and SpeI restriction sites at the beginning and PmeI and
AvrII restriction sites at the end of the cloning region [88]. After the genes are cloned to
the vectors the procedure follows as described below in Figure-7

16
Figure 1.7: Summary of Baculovirus expression system for virus production and protein
expression [89].

After the genes are cloned into vectors, the plasmids are transformed into the
bacteria that has the Bacmid. Through Cre-Lox recombination and Tn7transposition, the
plasmids are added to the Bacmids. The Bacmid DNA carries the LacZ gene for blue/white
selection in DH10Bac cells. When the gene cloned plasmid is translocated into the Bacmid
successfully, the Bacmid DNA is isolated and used for transfections with SF9 cells to
generate the first generation of viruses called the P0 viruses. Then the amplification of the
viruses can be made to create P1 and P2 and P3 generations and to increase the virus titers.
Then the created viruses can be used for the expression of multi-subunit proteins in high
quantities [88].

17
CHAPTER 2
MATERIALS and METHODS
2.1. MATERIALS

2.1.1. Tables for Required Materials, Buffers and Solutions

Table 2.1: Immobilized template recruitment assay using streptavidin Dynabeads

buffers

2X B&W Buffer 10X Assay Mix

10mM Tris-HCl (pH:7.5) 0.2M HEPES-KOH (pH: 8.2)

1mM EDTA (pH: 0.5) 50mM MgCl2

2M NaCl
Blocking Buffer Washing Buffer
10X Assay Mıx 40mM HEPES

5mg/ml BSA 4mM MgCl2

5mg/ml PVP 4mM DTT

12.5mM DTT 100mM KCl
3% NP-40 0.1% NP-40

Table 2.2: Buffers for protein extractions from SF9 insect cells

BC1000 BC0
20mM Tris-HCl (pH: 7.9 at 4 oC) 20mM Tris-HCl (pH: 7.9 at 4 oC)
20% Glycerol 20% Glycerol
0.1 mM EDTA 0.1 mM EDTA
0.5 mM PMSF 0.5 mM PMSF
0.5 mM DTT 0.5 mM DTT
1M KCL

18
Table 2.3: Solutions for nuclear extract from HeLa cells

Solution I Solution II
40 mM HEPES 40 mM HEPES
1.5 mM MgCl2 1.5 mM MgCl2
10 mM KCl 0.2 mM EDTA
0.5 mM DTT 0.5 mM DTT
0.5 mM PMSF 0.5 mM PMSF
0.3 M NaCl
25% sterile Glycerol

Table 2.4: Materials for preparation of SDS-PAGE resolution gels

Resolution Gel
7% 10% 12% 15%
Percentage
ddH2O 7.4ml 6.25 ml 5.20 ml 3.65 ml
Tris (1M pH:8.8) 3.45 ml 3.45 ml 3.45 ml 3.45 ml
5% SDS 300 ul 300 ul 300 ul 300 ul
30% Acylamide 3.75 ml 5 ml 6 ml 7.5 ml
10% APS 100 ul 100 ul 100 ul 100 ul
TEMED 10 ul 10 ul 10 ul 10 ul

Table 2.5: Materials for preparation of SDS-PAGE stacking gel

ddH2O 3 ml
Tris (0.5 M pH:6.8) 1.25 ml
5% SDS 100 ul
30% Acylamide 670 ul
10% APS 50 ul
TEMED 5 ul

19
Table 2.6: Buffers required for western blotting

1 X SDS-PAGE Running Buffer 1 X SDS-PAGE Transfer Buffer

25 mM Tris 25 mM Tris

192 mM Glycine 192 mM Glycine

0.1 % SDS 10% Methanol

Coomassie Brilliant Blue

Membrane Stripping Buffer
Staining
0.1% Coomassie Brilliant Blue
62.5 mM Tris-HCl (pH: 6.7)
R20 (w/v)

2% SDS 50% Methanol (v/v)

100 mM Betamercaptoethanol 10% Acetic Acid (v/v)

40% ddH2O

Table 2.7: Other materials and solutions for western blotting

8 mM Na2HPO4, 150 mM NaCl, 2

1X PBS-Tween mM KH2PO4, 3 mM KCl, 0.1%
Tween20
50% H2O, 40% Methanol, 10%
Destaining Solution
Acetic Acid
292,2 gr/L Acrylamide, 7.8 gr/L
30% Acrylamide (v/v)
Bisacrylamide
10% Ammonium Persuşphate 10 ml ddH2O, 1 gr Ammonium
(APS) Persulphate
240 mM Tris-HCl (pH:6.8), 8%
SDS (w/v), 40% Glycerol (v/v),
4X SDS Loading Buffer
0.04% Bromophenolblue, 5%
Betamercaptoethanol

20
Table 2.8: Used Antibodies in Western Blots

Santa Cruz Cat. No:

Med 12 Home made * Med27
Sc-390296
Santa Cruz Cat. No:
Med13 Home made * Med29
SC 393800
Abcam Cat No:
Med14 Med30 Home made *
ab170605

Proteintech Cat. No:

Med15 RPB1 Home made *
115661AP

Med16 Santa Cruz RPP62 Home made *

Med17 Home made * CDK7 Cell Signaling

Med19 Home made * CDK8 Home made *

Med23 Home made * CCNC Home made *

Med24 Home made * XPB Cell Signaling

Santa Cruz Cat. No: Anti-

Med25 Cell Signaling
SC393759 Histidine
Sigma Cat. No:
Med26 Home made * Anti-Flag
F7425

GDOWN1 Home made * TF-Two-E-α Home made *

*Home made antibodies are produced at Rockefeller University, USA.

21
Table 2.9: Mediums required for GTF IIB, IIE and IIF production in BL21 Bacteria
Cells

LB-Agar Plates LB Medium SOC Medium

10 gr Tryptone 10 gr Tryptone 2% Tryptone

5 gr Yeast Extract 5 gr Yeast Extract 0.5% Yeast Extract

10 gr NaCl 10 gr NaCl 0.4% Glucose

15 gr Agar 950 ml ddH2O 10 mM NaCl

951 ml ddH2O 2.5 mM KCl

5mM MgSO4

5mM MgCl2

Table 2.10: Other used materials and Kits

Anti-flag M2 Agarose Affinity

Sigma Cat. No: A4596
Agarose Beads
Flag Peptide Sigma Cat. No: F3290

Streptavidin Dynebeads M-280 Invitrogen Thermo Fisher Cat.

No: 11205D
BCA Protein Kit Assay Kit Thermo Fisher Pierce BCA Kit
Cat. No: 23227
Restriction Value Pack Thermo Fisher Fastdigest
Restriction Set Cat. No. SM1553
Gel Extraction Kit Thermo Fisher Gel Extraction Kit
Cat. No: K0691
Plasmid Isolation Kit Thermo Fisher Gel Extraction Kit
Cat. No: K0502
Lyophilized Lysozyme enzyme Sigma Aldrich Cat. No:
cDNA Synthesis RevertAid RT
Thermo Scientific Cat. No:
Reverse Transcription Kit K1691

22
 2.2. METHODS

2.2.1. Production and Purification of Mediator Complex

Modules

The Head (H), Middle (M), Head+Middle (H+M), Head+Middle+14 (H+M+14)

and Head+Middle+14+26 (H+M+14+26) complexes were readily purified as it is stated
in Cevher et al. 2014 [49]. The Mediator complex subunits were cloned to the pFBDM
and pUCDM Baculovirus expression system vectors with different tags like Flag, 6xHis
and HA. Mediator Head module (Med6-8-11-18-19-20-22-30), Middle module (Med4-7-
9-10-21-26-31) Med 17 and Med 14 were inserted into the vectors with tags of HA:Med7,
His:Med10 and Flag:Med14. Then the Plasmids were integrated into the Bacmid DNA
and amplified. After the purification of Bacmid DNA and transfection of Bacmid into the
SF9 cells, first generation P0 viruses were created. Then the amplification of the P0 viruses
were also made to the second and third generations P1 and P2 with a higher titer of viruses.
So as to obtain the proteins, the infections of Head module virus and Middle module virus
and co-infections of H+M, H+M+14, H+M+14+26 were done by infecting nearly 100ml
100 million Hi5 cells for 5 to 6 days. The titrations were determined according to the
stoichiometric production of the complexes. To collect the cells, the suspension grown
Hi5 cells were centrifuged at 1500 rpm for 10 minutes and supernatant was discarded. The
pellet was re-suspended in 4 ml BC500 (5 ml BC1000 + 5ml BC0, 5mmDTT, 5mmPMSF)
and cells were homogenized by douncing 3times. After centrifugation of the lysate at
14000 rpm for 15 minutes, pellet was discarded and supernatant was diluted to 300mM
salt concentration by addition of BC0 in a drop by drop manner. The extract then incubated
with the M2 and followed by HA agarose beads at 4oC overnight to pull down the modules
from the tagged subunits. After washing the beads with BC300+0.1%NP-40 five times,
complexes were eluted with of 0.5mg/ml Flag or HA peptides to the corresponding beads.
Elution step was repeated 3 times at 4oC for 45 minutes in rotation and checked with
Coomassie brilliant blue staining and Western blots.

23
 2.2.1. Depletion of Mediator Complex from HeLa Nuclear
Extracts
Depletion of Mediator complex from HeLa cell nuclear extract was done according
to the procedure stated in Cevher et al., 2014 [49]. The depletion was checked again with
Western blot.

2.2.2. Immobilized Template Recruitment Assay Using Streptavidin

Dynabeads
2.2.2.1. Production of Template
In order to produce the TATA containing template DNA fragments, conventional
PCR was used. Biotinylated primers were used to allow the binding of templates to the
streptavidin beads. The PCR was conducted with the program shown below and the
products were extracted from agarose gel with Gel Extraction Kit (Table 2.10).

Table 2.11: PCR program for TATA template multiplication

10x TATA
Forward Reverse
Taq dNTP Template MgCl2
Reagents Primer Primer ddH2O
Buffer (10mM) (10 (25mM)
(10mM) (10mM)
(5U/ul) ng/ul)
Added Volume
5 1 1,5 1,5 1 4 36
(ul)

PCR cycle
95 95 68 72 72 4
temperatures (oC)
Time (minutes) 4 0,5 1 1 7 Till taken
34 cycles

2.2.2.2. Fixing the Template to the Streptavidin Dynabeads

Dynabeads (10 ul/rxn) were shaken to homogenize the slurry and 10 ul for each
reaction was taken into eppendorf tubes. Beads were washed with 1XB&W buffer (Table
2.1) for 5 times by putting the tubes on the magnetic rack each time for 90 seconds. Then
beads were resuspended in 150 ul 2XB&W buffer. Nearly 8 ug template was added on to
the beads to immobilize and volume was completed to 300 ul with H2O addition. The
beads were incubated at room temperature for 15 minutes by inverting the eppendorf tubes

24
in every 5 minutes to prevent aggregation and heterogenous distribution of the template.
Then the tubes were put onto the magnetic rack again and the liquid buffer was taken out
but not discarded since the amount of bound template can be checked by finding out the
final concentration of the DNA in the buffer. The Dynebeads were then washed with 300ul
of 1XB&W buffer with 0.5mg/ml BSA and 0.003% NP-40 for two times. After that the
beads were blocked by addition of 100 ul of Blocking buffer and incubation at room
temperature for 15 minutes. Finally, the beads were washed with 500 ul washing buffer
two times and stored at +4 oC in 150 ul Wash buffer.

2.2.2.3. Immobilized Template Recruitment Assay

6 reactions were planned with HeLa nuclear extract (NE) and Mediator depleted
nuclear extract (∆Mediator NE) by the addition Head (H), Head+Middle (H+M),
Head+Middle+14 (H+M+14), Head+Middle+14+26 (H+M+14+26) recombinantly and
one negative group with no recombinant Mediator modules added. Then the prepared
beads were washed 4 times with 1X assay mix including 0.025% NP-40 and 0.25 mg/ml
BSA. Then 300 ul 2X assay mix including 60 ug/ml E. coli genomic DNA was put onto
the beads and beads were divided into 6 tubes since 6 reactions were planned. After that,
stated amount of recombinant proteins were added onto the beads as it is shown in Table
13 below. The reaction was incubated at 30 oC for 50 minutes by mixing in every 10
minutes. Following the incubation, beads were washed with 50mM NaCl and 16 ul 1X
SDS loading buffer was added into each reaction tube to further check by western blot.

Table 2.12: Immobilized template recruitment assay plan with added NE and protein
amounts

∆Mediator NE
HeLa NE ∆Mediator NE +
Recombinantly added
(Full NE) recombinant proteins
Mediator Modules
H M 14 26 N. Cont. (∆Mediator NE only)
+ + + + H+M+14+26
+ + + + H+M+14
+ + H+M
+ H

25
For the Full NE, 180ug is added while for the H, H+M, H+M+14 and H+M+14+26
4500ug, 5940ug, 5400ug and 6300ug were used respectively

2.2.3. Protein Extractions from SF9 Insect Cells

Table 2.13: Produced subunits, their modules and usage amount of viruses

Amount
Produced Mediator Amount of infected
Modules of used
Subunits Sf9 cells
virus
Med12 25ml (106 cells/ml) 1ml
Kinase Med13 25ml (106 cells/ml) 1ml
Module CDK8 25ml (106 cells/ml) 1ml
6
CCNC 25ml (10 cells/ml) 1ml
Med15 25ml (106 cells/ml) 1ml
MEd16 25ml (106 cells/ml) 1ml
Med23 25ml (106 cells/ml) 1ml
Tail 6
Med24 25ml (10 cells/ml) 1ml
Module
6
Med25 25ml (10 cells/ml) 1ml
Med27 25ml (106 cells/ml) 1ml
Med29 25ml (106 cells/ml) 1ml
Head
Med19 50ml (106 cells/ml) 1.5ml
Module

The readily prepared P1 and P2 generation viruses were produced for the Tail and
Kinase subunits as it is described in the production of Mediator modules section. After the
infections, the cells were centrifuged at 1500 rpm for 10 minutes and supernatant was
discarded. The pellet was re-suspended in 4 ml BC500 (5 ml BC1000 + 5ml BC0,
5mmDTT, 5mmPMSF) and cells were lysed by douncing 3times with glass douncers.
After centrifugation of the lysate at 14000 rpm for 15 minutes, pellet was discarded and
supernatant was diluted to 300mM salt concentration by addition of BC0 in a drop by drop
manner. The extract then incubated with the M2 and HA agarose beads at 4oC overnight
to pull down the modules from the tagged subunits. After washing the beads with

26
BC300+0.1%NP-40 five times, complexes were eluted by addition of 0.5mg/ml Flag of
HA peptides to the corresponding beads. Elution step was repeated 3 times at 4oC for 45
minutes in rotation and checked with Coomassie brilliant blue staining and Western blots.

2.2.4. Production of GTF IIB, IIE and IIF in BL21 Bacteria Cells

TFIIB, TF-Two-E (IIE-αand IIE-β) and TFIIF (Rap30 and Rap74) were readily
cloned into Flag and His tagged pET11d and pET15b bacterial expression vectors,
respectively. The cloned expression vectors then transformed into the BL21 bacterial cells
for protein production. Firstly, a 4ml starter culture was made for each TF with 100ug/ml
ampicillin addition. Overnight incubation of the cells allows the production of a very
concentrated bacterial culture. Then this starter culture is used before any precipitation
happened and 300ml of SOC media was inoculated with that starter culture for each TFs
again with the addition of 100ug/ml ampicillin addition. When the OD600 reaches to 0.4,
IPTG was added to induce the production of the proteins with a final concentration of 0.8
mM. In order to allow the protein expression, the culture was incubated at 36 oC for 3
hours and then cells were collected by centrifugation at 4500 rpm for 10 minutes. After
this point, pellet can be frozen with liquid nitrogen for further use or the lysis procedure
can be followed to extract the produced proteins.

The lysis step was conducted with Lysozyme enzyme. A lysozyme stock was
prepared with 100 mg/ml concentration. Then the pellet was resuspended in Lysis buffer
which is described below. 100 ul of lysozyme stock was added into 10 ml resuspended
cells (final concentration of Lysozyme: 1mg/ml). After adding 5 mM of PMSF to the
resuspended cells, the cells were rocked for 1 hour at +4 oC.

Table 2.14: Contents of bacterial cell lysis buffer for protein extraction

Lysis buffer (500mM salt) Lysis buffer (0mM salt)

Final Final
Material Material
Concentration Concentration

HEPES (pH:7.9) 40 mM HEPES (pH:7.9) 40 mM

KCl 0.5 M KCl -
NP-40 0.10% NP-40 0.10%

27
 Glycerol 10% Glycerol 10%
DTT 2 mM DTT 2 mM

After 1hour rotation, the mixture was centrifuged at 1800 rpm at +4 oC and the salt
concentration was diluted into 300mM salt concentration by addition of lysis buffer
prepared without KCl (ddH2O was added instead). Finally, the extracted TF proteins were
stored at -80 oC by freezing the diluted, 300 mM salt containing supernatant with liquid
nitrogen.

2.2.5. Immunoprecipitation Using M2 Agarose and Sepharose Beads

For each reaction 10 ul of M2 agarose beads were used. The extracts of TF-Two-
E -α and –β subunits were mixed to allow dimerization of the protein in vitro. Firstly, the
beads were washed with BC300 containing 5mM PMSF, 5mM DTT and 0.1%NP-40 5
times (with 1 ml each time). Then, the flag tagged TF-Two-E α and β extract mixture was
put onto the beads and incubated on rotator for 3 hours at +4 oC. Secondly, the TF-Two-E
extract was taken out and the beads were washed 2 times with BC150 containing same
amount of PMSF, DTT and NP-40. Then 500 ul of Mediator Complex subunit extracts
were put onto the beads and incubated again on rotator for 3 hours at +4 oC. After the
incubation, the extract was taken out and the beads were washed 4 times with BC150
containing 5mM PMSF, 5mM DTT and 0.05% NP-40 (with 200 ul of BC150 and by
inverting the tube 4 times in each wash) Lastly, 16 ul of 2X SDS loading buffer was added
onto the beads and protein content was further analyzed by Western blot.

The sepharose beads were used to conduct a reverse IP since the mediator subunits
do not contain a Flag or His tag. The procedure has only one additional step of attaching
the relevant antibody to the sepharose beads. For that the beads again washed 5 times with
the BC300 containing 5mM PMSF, 5mM DTT and 0.1%NP-40. Then 2 ul of antibody
was added onto 100 ul of BC300 and the beads. The mixture was incubated on rotator for

28
3 hours at 4+ oC. Then the procedure follows as in M2 beads for attachment of first protein
and second protein’s addition.

2.2.6. Cloning of His-tagged RNA Polymerase II Subunits

Table 2.15: Primers used for clonings of RNAP II subunits with 6xHis tags
GCGAATTCATGCATCATCATCATCATCATGC
His-RPB8 EcoRI Forward
GGGCATCCTGTTTGAG

RPB8 Hind3 Reverse GCAAGCTTTCAGGCGAGGTTCAGAAGGCT

GCGAATTCATGCATCATCATCATCATCATGA
His-RPB9 EcoRI Forward
GCCCGACGGGACTTAC

RPB9 Hind3 Reverse GCAAGCTTTCACTCGGTCCAGCGGTGGCC

GCGAATTCATGCATCATCATCATCATCATAT
His-RPB10 EcoRI Forward
CATCCCTGTACGCTGC

RPB10 Hind3 Reverse GCAAGCTTTCACTTCTCCAGGGGTGCATA

GCGAATTCATGCATCATCATCATCATCATAA
His-RPB11 EcoRI Forward
CGCCCCTCCAGCCTTC

RPB11 Hind3 Reverse GCAAGCTTCTACTCAATTCCTTCCTGCTT

GCGAATTCATGCATCATCATCATCATCATGA
His-RPB12 EcoRI Forward
CACCCAGAAGGACGTT

RPB12 Hind3 Reverse GCAAGCTTTCATCGAGCATCAAAAACGAC

In order to attach the required His tag to the subunits of RNAP II, readily extracted
whole mRNAs were used to produce the cDNAs of the related RNAP II subunit. By using
the oligodT primes, the cDNAs and following that the dsDNAs of each subunit were
produced. The dsDNAs were then digested with the restriction enzymes which are EcoRI
and Hind3 for each subunit. by following the instructions of the manufacturer, dsDNAs
29
and pFBDM baculovirus expression vector was digested and ligated. After the ligations,
the constructs were transformed to E. coli DH5α cells. Formed colonies were checked
again with PCR and positive colonies were grown for miniprep to obtain the insert having
plasmids. The PCR programs for each subunit can be found below.

Table 2.16: Program for Template Production with His Tagged Primers

10x
Forward Reverse
Taq dNTP Template MgCl2
Reagents Primer Primer ddH2O
Buffer (10mM) (10 ng/ul) (25mM)
(10mM) (10mM)
(5U/ul)
Added Volume
5 1 1,5 1,5 1 4 36
(ul)

Initial Final
Denaturation Annealing Elongation Storage
Denaturation Extension
PCR cycle
temperature 95 95 * 72 72 4
(oC)
Time
4 0,5 1 1 7
(minutes)
34 cycles

*Annealing temperature for the RPB8-9-10-11 and 12 were set as 68, 66, 65, 63 and
58oC respectively.

30
CHAPTER 3
RESULTS
3.1. Purification of Functional Human Core Mediator Complex with
Baculovirus Expression System

As mentioned before, Mediator complex has a high heterogeneity and a very

dynamic structure which is in a reciprocal relation with the presence of the subcomplexes.
Since the presence of endogenous Mediator complex is very low, the studies on these
subcomplexes require the recombinant productions of the subcomplexes [48] the
Baculovirus expression system provides the needs of a recombinant multisubunit protein
production procedure [87]. As explained in Figure-1.7, the Multi-Bac system was used to
produce the human Mediator functional core complex with Head, Middle, and
Head+Middle combination by Cevher et al. (2014). The Med14 and Med26 were also
added to the core due to their roles in the complex to give functionality [49].

(This figure is taken from Cevher et al., 2014 [49].)

Figure-3.1: Coomassie staining result of recombinantly purified Head (H), Middle
(M), H+M, H+M+14 and H+M+14+26 core Mediator complex produced by Multi-

31
Bac expression system. H, M, H+M and H+M+14+26 viruses were used to infect Hi5
insect cells and cells were harvested 72 hours after the infection. Then the extracts were
incubated with M2 agarose beads and subcomplexes were eluted with 0.5 mg/ml Flag
peptide. The Coomassie stain also shows that the subcomplex subunits have an
approximate stoichiometry. The corresponding subunits were shown with lines and stars
indicate the impurities.

Figure 3.1 shows the produced H, M, H+M, H+M+14 and H+M+14+26 subcomplexes
stained with Coomassie brilliant blue. Each protein is shown with the corresponding
subunit names and impurities are stated with stars (*). Impurities does not correspond any
subunits of those subcomplexes.

1.2. Dependency of PIC Elements to Mediator Complex to be Recruited

to the Promoter Site

Since the Mediator complex has the function of helping the formation of PIC at
the promoter site [66], immobilized template recruitment assay was performed to see
which elements depend on Mediator Complex to be brought to the PIC. Immobilized
template recruitment assay is a method in which promoter containing DNA fragments
were attached to Dynabeads which are magnetic. Addition of nuclear extracts onto those
DNA fragments allows us to detect proteins that are located to promoter region of DNA
fragment. Here, TATA promoter was used downstream of p53 enhancer sequence. Two
different systems were designed with Mediator containing HeLa nuclear extract (NE) and
Mediator depleted HeLa nuclear extract (denoted as ∆Mediator NE) to see the changes in
the protein composition in promoter region upon Mediator depletion. The H, H+M,
H+M+26 and H+M+14+26 subcomplexes were additionally used to recover the
recruitments.

32
Figure-3.2: Immobilized template recruitment assay executed with and without
mediator presence. The H, H+M, H+M+26 and H+M+14+26 (functional core)
subcomplexes were added separately to see the difference in the recruitment. NE
represents the full HeLa nuclear extract and the ∆Mediator NE is the Mediator depleted
HeLa nuclear extract. The system was designed to show the difference in recruitment with
one positive control (lane1), one negative control (lane 2) and four different subcomplexes
which are H, H+M, H+M+26 and H+M+14+26 in lanes 3, 4, 5 and 6 respectively. RPB1
is a subunit of RNAP II, TAF100 is a subunit of TFIID, CDK7 and p62 are subunits of
TFIIH and TF-Two-E -α is a subunit of TF-Two-E. (This figure was done by Ms.
Yasemin Barış)

In Figure 3.2, lane 1 shows the detected proteins which were recruited to the TATA
promoter site. The negative control (which contains no additional Mediator
subcomplexes), lane 2, showed no presence of RPB1 and TF-Two-E -α when Mediator is
fully depleted. Additions of H, H+M, H+M+26 did not recover the recruitment of RPB1

33
and TF-Two-E -α (lanes-3, 4, 5). When functional core (H+M+26+14) was added (lane 6)
RPB1 recruitment was again recovered as in lane 1. However, TF-Two-E -α was still
absent when whole Mediator is not present. This result showed that the RNAP II and TF-
Two-E require the assistance of Mediator complex to be recruited to the PIC on promoter
site. Addition of functional Mediator core recovered the RNAP II recruitment yet it was
not sufficient to recover TF-Two-E recruitment (lane 6). The TAF100, CDK7 and p62
can be used as the loading control.

1.3. Immuno-precipitation Result of Kinase Module- TF-Two-E

Association

As it is said, Mediator complex has four modules which are Head, Middle, Kinase
and Tail [51]. The Head Middle modules form the functional core and it is not sufficient
to rescue the recruitment of TF-Two-E to the promoter site. So, it can be speculated that
the association of Mediator complex- TF-Two-E is via the subunits apart from the
functional core subunits which are Tail and Kinase module subunits.

After the determination that TF-Two-E may possibly associate to the Mediator
Kinase and tail subunits, the recombinant production of each subunit was done by using
the Baculovirus expression system as it is explained in Methods chapter. Med12, 13,
CCNC and CDK8 are the subunits that form the Kinase module. They were cloned to the
Baculovirus expression plasmid separately instead of a multi-subunit clone in one plasmid.
Then, produced viruses were used to infect SF9 cells and the cells were collected nearly 5
days subsequently to the infection. Since they do not contain any tags, the proteins were
used as cell lysates instead of purified proteins. For each subunit 3.33 ml of extract
obtained in 300mM salt solution. Since the aim is to check a sign of interaction or
association, inputs of each proteins show difference due to the fact that there was no strict
necessity for protein amount equilibration for the first screening by immunoprecipitation
(IP) experiments.

34
Figure-3.3 Western blot result that shows the Kinase module subunits which are
pulled down by flag-tagged TF-Two-E bound M2 agarose beads. A) The inputs of two
flag tagged TF-Two-E subunits and bead bound TF-Two-E subunits are shown. M2
agarose beads without TF-Two-E subunit attachment were also loaded to eliminate the
possible bands of impurities that may result from the beads. B) The expressed Kinase
module subunits were checked on the flag-tagged TF-Two-E α&β bound M2 agarose
beads which contains cross-linked flag antibodies on it. Cross-linked anti-Flag antibodies
do not dissociate from beads so flag input is not necessary. Med13 extract was also
prepared but the input showed no presence of Med13 so it is excluded from the result.

In figure 3.3, first the Flag tagged TF-Two-E subunits were attached to M2 agarose
beads (3.3- panel A). M2 agarose beads has cross-linked anti-Flag antibodies on itself and
can bind to Flag tagged proteins so when flag tagged TF-Two-E extracts added onto M2
beads, they are TF-Two-E subunits bind to M2 beads. Panel B shows IP of kinase module
subunits with TF-Two-E bound M2 agarose beads. Here, the band of Med12 on IP lane in
panel B shows that Med 12 has a potential to have an association with TF-Two-E since
CCNC and CDK8 subunits showed no presence on the TF-Two-E bound beads after the
beads were washed with 150mM salt solution. The smear like band that occurred in Med12
input may be a result of proteolytic degradation happened during extraction procedure or
after the extract was stored. Also, the pulled down Med12 showed the same pattern with
the Med12 input. Upon these patterns, it can be concluded that the TF-Two-E association

35
site of Med12, if it ever exits, could be step wise lost due to the degradation which in
return first decreases and then completely seizes the interaction.

After seeing the possible interaction with Med12 and TF-Two-E, the TF-Two-E
subunits were this time separately bound to the M2 agarose beads to figure out which
subunit has the major, if not complete, role in this association. Figure-3.4 shows the IP of
Med12 with separate TF-Two-E subunits.

Figure-3.4: Western blot result showing the pulled down Med12 subunit on TF-Two-
E -α and TF-Two-E -β bound M2 beads. A) The immunoblots of TF-Two-E subunits
shown as separate inputs. Empty beads were also loaded to eliminate the possible bands
of impurities that may result from the beads. B) Med12 and Med26 immunoblots on input
lane and IP lanes with TF-Two-E -α and TF-Two-E -β bound beads are seen. Med26 was
used as a negative control and shoed no specific bands with two subunits.

Figure 3.4 shows two panels A and B. Panel A shows the immunoblots of both
subunits of TF-Two-E with empty bead negative control. When Med12 is pulled down
with TF-Two-E -α and TF-Two-E -β bound M2 agarose beads (lanes of IP with IIEα and
IIEβ in figure 3.4 panel B), both lanes showed some quantities of Med12 present on both
the flag-tagged TF-Two-E -α and TF-Two-E -β bound M2 agarose beads The well after
the input was left empty to avoid any leak from the input loaded well into the other wells
which may create a deceiving false positive result. The negative control was Med26 which

36
was a member of core Mediator so it was known that they do not interact at the TF-Two-
E recruitment to promoter event. The smear on TF-Two-E -β bound beads lane may be
due to the proteomic degradation happened during the procedure even TF-Two-E α and β
bound beads were treated in the same way and experiment was conducted at the same time
for both subunit.

In order to have a conclusive inference about TF-Two-E -Med12 association, it

was necessary primarily to check the ability of Med12 to bind the TF-Two-E absent M2
agarose beads and secondarily to carry out a reverse IP experiment at which the Med12
was bound onto the beads and presence of TF-Two-E was checked by western blot. Thus,
the reverse IP was done as it can be seen in Figure-3.5 below.

Figure-3.5: Western blot results of Med12 pull down with empty beads and reverse
IP with Med12 bound Sepharose beads. A) The presence of Med12 is shown both in the
extract and on the empty beads. B) Western blot result showing the pulled down TF-Two-
E -α and TF-Two-E -β subunits on Med12 bound Sepharose beads. The presence of Flag-
tagged TF-Two-E -α & β subunits on Med12 bound Sepharose beads were checked by
Anti-flag antibody. TF-Two-E -α showed no bands even though TF-Two-E -β showed a
band.

37
 In figure 3.5 panel A, the IP of Med12 with empty M2 agarose beads was done to
eliminate the probability of Med12 to bind the beads nonspecifically and since beads
without TF-Two-E showed no Med12 binding, reverse IP was conducted. Panel B shows
input of Med12, inputs of TF-Two-E subunits and IP of TF-Two-E with Med12 bound
sepharose beads. In the IP lane, it was checked if Flag tagged TF-Two-E subunits were
pulled down with Med12 bound sepharose beads. there is only a band of TF-Two-E -β.
The reverse IP which shows that the TF-Two-E -α has no ability to pull down Med12 even
though TF-Two-E -β may have a possibility for the interaction. However, TF-Two-E alpha
and beta inputs are not same and TF-Two-E beta input is more than TF-Two-E alpha. It is
highly likely that the excess amount of TF-Two-E beta present in the extract is the reason
of the band in spite of the washing step that was done with 150 mM salt solution.
According to that result, it can be speculated that the TF-Two-E band may be a result of
excess presence in the extract compared to TF-Two-E -α but the possibility of an
interaction still remains to be cleared out in further.

1.4. Immunoprecipitation Result of Tail Module- TF-Two-E Association

with Additional Check of Med19

After the Kinase module results, the screening was continued with Tail module
subunits. Previously prepared viruses for each single subunit of Tail module were used to
infect Sf9 cells and the cells were collected after nearly 5 days after the infection. The cell
lysates were prepared as it is explained in Methods chapter. Again, they did not have any
tags so the lysates were used directly for the immune-precipitation experiment. Just to
screen the associations, the TF-Two-E subunits were bound to beads again as a
heterodimer so each bead has both subunits attached to itself. Figure-3.6 shows the
western blot result of pulled down Tail subunits with flag-tagged TF-Two-E bound M2
agarose beads.

38
Figure-3.6: Western blot result that shows the Tail module subunits which are pulled
down by flag-tagged TF-Two-E bound M2 agarose beads A) The inputs of TF-Two-E
subunits and bead bound TF-Two-E subunits are shown. Empty beads were also loaded
to eliminate the possible bands of impurities that may result from the beads. B) The
expressed Tail module subunits were checked on the flag-tagged TF-Two-E bound M2
agarose beads. Med15 extract was also prepared but the input showed no presence of
Med15 so it is excluded from the result.

In Figure 3.6, first the TF-two-E subunits were bound to the M2 agarose beads and
their presence on beads were checked with immunoblotting as in panel A. When the beads
were attached to TF-two-E subunits, Tail module subunit extracts were put on those beads
separately and Panel B shows the pulled down Tail subunits with TF-two-E bound M2
agarose beads. Even though some subunits showed a very weak band on the input lane as
in panel B, Med23 input, all the expressed Tail subunits has failed to be pulled down by
TF-Two-E bound beads. Also, Med19, which is a head module subunit, was checked
because of the fact that it acts separately when forming the functional core and is not pulled
down together with the core after it is assembled. However, it also has failed to show an
interaction or association with TF-Two-E subunits.

39
 1.5. Comparison of Mediator Depleted Nuclear Extract and Full Nuclear
Extracts in the Manner of TF-Two-E -Mediator Complex Association

After the immunoprecipitation experiments conducted with one by one Kinase and
Tail module subunits showed no certain interaction with TF-Two-E, the possibility of
requirement of more than one subunit for the TF-Two-E association has risen. To check
such kind of an association, it seemed a nice method to check the Mediator depleted and
full HeLa nuclear extracts in the context of TF-Two-E interaction.

It is known that the RNAP II interacts with Mediator Complex directly and thus,
depletion of Mediator Complex causes a relative decrease in the amount of RNAP II so,
in order to check the nature of TF-Two-E -Mediator complex interaction, comparing
nuclear extracts with and without Mediator Complex, was planned as the next step. If the
interaction between TF-Two-E -Mediator Complex is as direct as RNAP II-Mediator
Complex, it is logically expected to see a decrease in the TF-Two-E amount when
Mediator complex is pulled out of the nuclear extract like the case of RNAP II. In order
to do that, Mediator depleted Hela nuclear extract and normal HeLa nuclear extract were
checked by Western blot as it can be seen in Figure-3.7 below.

40
Figure-3.7: Western blot check of nuclear extracts with (full NE) and without (Med
Depleted NE) Mediator Complex. Shown bands of TF-Two-E are the TF-Two-E -α
subunit bands. RPB1, which is the biggest subunit of RNAP II, was checked as a positive
control because of its direct interaction with Mediator Complex. Med30, Med13 and
CCNC were checked as the controls for Mediator Complex depletion and CDK7, which is
a subunit of TFIIH, was used as the equal loading control.

The Figure-3.7 showed that the depletion was done successfully since the levels of
Med30, Med13 and CCNC was nearly diminished. Also, the positive control worked well
too as it can be seen from the decreasing RPB1 levels upon Mediator Complex depletion.
However, there was no change in the levels of TF-Two-E -α subunit representing the TF-
Two-E amount in the extracts like the case of TFIIH subunit CDK7. Upon this result, it
can be speculated that the Mediator Complex and TF-Two-E association is not likewise
the RNAP II and Mediator complex interaction.

1.6. Association of TF-Two-E with PIC Elements

In order to check which elements of PIC interact with the TF-Two-E, the proteins
pulled down by the Flag-tagged TF-Two-E bound M2 agarose beads were incubated with
HeLa nuclear extract. After the washing step which was done with 150 mM salt solution,
beads were separated from all attached and pulled down proteins by addition of 2XSDS
loading buffer and heating at 95 oC for 4 minutes.

41
Figure-3.8: Checked proteins on the Flag-tagged TF-Two-E bound M2 agarose beads
after the incubation with 10 ug/ul concentrated HeLa nuclear extracts. Mediator
Complex (Med 13, 14, 16, 17, 25, 26 and CDK8), RNAP II (RPB1) and TFIIH (CDK7)
were checked. Panel A and Panel B shows different gel percentages of the same IP
experiment (A: 10%, B:7%)

According to Figure 3.8, TF-Two-E bound M2 agarose beads could pull down CDK7
which is a subunit of TFIIH and RPB1 which is a subunit of RNAP II. However, no
Mediator subunits were pulled down with TF-Two-E bound M2 beads. In order to figure
out which TF-Two-E subunit is responsible for the pull downs, separate TF-Two-E
subunits were bound to M2 beads and IP experiment was repeated.

42
 1.7. Association of RNAP II and TFIIH with Separate TF-Two-E
Subunits

According to the Figure-3.8, it can be said that RNAP II and TFIIH have clear
interactions with TF-Two-E unlike Mediator Complex. The bands appeared on the Med17
membranes are not matching with the input and also present on the empty lane as well.
Thus, it can be said that these bands are either a result of nonspecific binding of proteins
in the nuclear extracts or they are impurities resulted from the beads themselves. After
these data, another IP was designed to see which TF-Two-E subunits bind to RNAP II and
TFIIH. As in the case of Med12, again, TF-Two-E subunits were attached to the beads
separately and TF-Two-E -α and TF-Two-E -β bound M2 agarose beads were again put
into the HeLa nuclear extract.

Figure-3.9: Western blot analysis to check which subunit of TF-Two-E binds to

RNAP II and TFIIH. A) IP of XPB and p62 which are subunits of TFIIH. B) IP of RNAP
II subunit RPB1 and Med14. Two HeLa inputs with different concentrations (HeLa input
1:10ug/ul and 10ul loaded to SDS-PAGE gel. HeLa input 2: 9.5ug/ul and 4ul loaded to
SDS-PAGE gel since we run out of HeLa nuclear extract 2) were loaded as the inputs and
Med14 was checked as the negative control since TF-Two-E does not directly bind or
interact with it.

The result in Figure 3.9 shows a thicker band in RPB1 in the empty bead lanes
indicating that the visible interactions are not specific even though the conditions of IP

43
experiment were not on purposely changed (again washed with 150 mM salt solution).
Also, the XPB membrane shows bands in all lanes with a relatively decrease in TF-Two-
E -β and empty bead lanes. However, the Med14, which was the negative control, has no
bands in TF-Two-E bound and empty bead lanes. Besides, p62 and CDK7 showed clear
interactions with only TF-Two-E -α subunits. Thus, there is the possibility that a harsher
washing condition can eliminate the nonspecific bands in RPB1 and XPB membranes if
they are really not specific. For the inputs, in panel B an additional HeLa input was used.
After the IPs of TFIIH, RPB1 and Med14 subunits were done with HeLa nuclear extract
2, there remained a very little amount (4 ul) of HeLa nuclear extract 2 to be used as input
and we used HeLa nuclear extract 1 not to miss inputs in that experiment. It is important
to say that all IPs were done with HeLa nuclear extract 2 and HeLa nuclear extract 1 was
only used as an input.

44
CHAPTER 4
DISCUSSION

The aim of this study started as to characterize the Pre-initiation complex elements
which depended on Mediator to be recruited to the promoter sites and to understand the
corresponding Mediator subunits that played roles in those recruitments. With that aim,
we identified a high correlation between Mediator complex presence at the promoter and
the recruitment of TF-Two-E. Due to the very large size, dynamic structure and
heterogeneity of the Mediator complex, it was hard to understand the recruitment
mechanism of GTFs (focused on TF-Two-E) to promoters. Therefore, we decided to
divide Mediator into its modules as well as its subunits to dissect the interactions or
associations formed with TF-Two-E.

As its function, Mediator Complex is a multi-subunit transcriptional regulator that

has a role in different stages of transcription such as chromatin remodeling, Pre-initiation
complex formation, promoter opening and elongation [13-71]. Therefore, Mediator
Complex is also an essential element for the transcription. As we are focusing on the PIC,
we skipped characterization of other earlier stages. Thus, here we are underscoring the
characterization of Mediator-dependent PIC elements for transcription on naked DNA
template. To do that, immobilized template recruitment assay (ITRA) was performed with
one varying condition: presence and absence of Mediator complex as it can be seen in
Figure-4.1 below.

45
Figure 4.1: Visual representation of designed ITRA experiment which shows two

different systems without Mediator and with functional Mediator core complex. The
left side represents the Mediator depleted system in which the DNA is bound to
Streptavidin Dynabeads where recruitment of RNAP II and TF-Two-E is prevented. The
right side shows the system which contains the functional Mediator core complex and the
successful recruitment of RNAPII to the TATA promoter site. Interestingly, TF-Two-E is
still not brought to the promoter due to the lack of full Mediator complex.

Comparison of the elements recruited to the used TATA promoter site in the
presence and absence of Mediator Complex enabled us to see that RNAP II and TF-Two-
E requires Mediator to enter the PIC on promoter region. In order to identify the major
subunits having a role in these recruitments, a strategy of addition of recombinantly
produced Mediator complex modules was followed to catch a rescue function with the
additions. As it can be seen in Figure-3.2, addition of H+M+14+26, which is called as the
functional Mediator core, to the Mediator lacking ITRA system rescued the RNAP II
recruitment however, the same Mediator core that is also transcriptionally active (data not
shown) failed to recover the recruitment of TF-Two-E. Since the presence of the full
Mediator complex successfully enabled TF-Two-E entry to the PIC, we speculated that
the responsible subunit of Mediator enabling this recruitment should reside in Kinase or
Tail modules which have the subunits other than the functional Mediator core. Here, we
specifically tried to characterize the Mediator Complex- TF-Two-E interaction by
expressing the subunits of the Mediator one by one with Baculovirus expression system
using insect cells and performed immunoprecipitation experiments.

According to the results of Kinase module immunoprecipitation experiments,

Med12 showed a potential to be the main subunit for TF-Two-E recruitment. However,
due to the negative result of reverse immunoprecipitation experiment in Figure-3.5 we
decided to move on with the Tail module subunits for further analysis. The Tail subunits
were also expressed in Baculovirus expression system one by one. Even though protein
levels in the inputs are not the same for all subunits, protein equilibration was not
necessary to have an idea about which subunits of Mediator interacts with TF-Two-E. As

46
Figure-3.6 shows the Tail subunits were also failed to present an interaction with TF-Two-
E.

Although the immunoprecipitation experiments did not show any possible direct
interactions between Mediator Complex subunits and TF-Two-E, it is also known that
Mediator complex was a crucial necessity for TF-Two-E recruitment, yet the functional
core is not sufficient to rescue this interaction. There may be two possible reasons for this
result. One reason may be that the TF-Two-E recruitment rely on more than one Mediator
subunits at the same time (e.g. a module). Thus, one to one immunoprecipitation may have
fail due to the lack of other subunits. The other reason may be that the TF-Two-E and
Mediator complex may not directly interact with each other. Another protein, proteins or
cascades may enable Mediator to mediate the TF-Two-E entry to the PIC. Apart from the
Mediator complex link, in gene specific transcription, Krüppel, Antenna and Abd-
homeodomain proteins have been shown to associate with TF-Two-E for its recruitment
to promoter site in Drosophila [13]. However, these proteins work as a TF for the gene
specific and activator dependent transcription and for the basal transcription, TF-Two-E
is also shown to be required when promoter is not melted yet. Thus, it can be speculated
that possibility of having other proteins between Mediator and TF-Two-E is relatively
higher for now.

Also, it is known that Mediator complex interacts with RNAP II [13]. By starting
from this data, it was speculated that depletion of Mediator complex should also decrease
the amount of RNAP II in extracts. By taking this assumption as a control, it was
speculated that depletion of Mediator complex should also decrease the amount of TF-
Two-E in the extract if the nature of the interaction between TF-Two-E and Mediator
complex is similar with RNAP II-Mediator interaction. According to the result in Figure
3.7, the RNAP II (RPB1) amount did indeed decrease with depletion of Mediator complex.
However, amount of TF-Two-E did not change. This shows that the nature of TF-Two-E
-Mediator complex interaction is different from RNAP II-Mediator interaction. The reason
behind this can be the presence of other proteins or cascades between Mediator complex
and TF-Two-E. Somehow, interaction or association of TF-Two-E -Mediator complex
may not be as direct as in RNAP II interaction yet Mediator complex still manages the

47
TF-Two-E entry to the PIC as found from Figure 3.2. From this aspect, the way of
Mediator complex to mediate the TF-Two-E recruitment must be further investigated.

Also, to identify the interactions of TF-Two-E with PIC elements, analysis of

proteins pulled down with TF-Two-E beads from HeLa nuclear extracts confirmed that
TF-Two-E interacts with RNAP II and TFIIH. According to Figure3.8 and 3.9, TF-Two-
E interacts with RNAP II when there is both subunits of TF-Two-E and TFIIH (apart from
XPB) binds majorly to the TF-Two-E -α subunit. Even though the interaction between TF-
Two-E and RNAP II was found before [13], the corresponding subunits of TF-Two-E and
RNAP II were not clearly shown by biochemical assays especially from the aspect of
RNAP II. Also, TFIIH interaction site of TF-Two-E was figured out by truncation of TF-
Two-E [79] but the corresponding TFIIH subunit and the subpopulation of TFIIH to which
TF-Two-E binds among all TFIIH subpopulations, remains to be clarified.

48
CHAPTER 5
FUTURE PERSPECTIVES

What it is known now about the Mediator Complex and TF-Two-E relation is that
Mediator complex is involved in the recruitment of TF-Two-E to promoter regions and
facilitate TF-Two-E entry to the PIC. However, it is also known that although the Mediator
Complex is essential for this recruitment, functional core Mediator is not sufficient to
rescue this recruitment. So, we predicted that the TF-Two-E and Mediator interaction or
association may be via the remaining Mediator subunits which make the Tail and Kinase
modules of the complex. However, the immunoprecipitation experiments conducted with
Tail and Kinase subunits one by one ended up with no interaction. Thus, we speculated
that TF-Two-E requires a combination of subunits instead of a one by one interaction, to
form a sustainable link which will carry it to the promoter. To test that, Mediator Tail and
Mediator Kinase modules must be reconstituted with the same baculovirus system used to
produce the functional Mediator core. After the reconstitution, these modules should be
integrated to the functional core since their simple addition onto the extract will not form
a working subcomplex [49]. Then, it can be checked if multiple subunits are required for
the TF-Two-E interaction.

In order to specifically clarify the interaction sites of TF-Two-E with the RNAP II
and TFIIH, primarily, it is important to express each subunits of these multi-proteins and
then try to pull them down with TF-Two-E bound beads. In order to do that, we first started
cloning of RNAP II subunits as can be seen in the Figure-5.1 below. Since produced TF-
Two-E contains Flag-tag in each subunit, here the subunits of the RNAP II were cloned
with a 6xHis tag attached to the N-terminal regions to ease the procedure of further IP
experiments.

49
Figure 5.1: The agarose gel electrophoresis images of cloned RPB subunits into
pFBDM vector. The RPB subunits were cloned into pFBDM vector and then the plasmids
of positive colonies were isolated. This figure contains the results of PCR reactions in
which the isolated plasmids were used as a template to verify the clonings.

After all the 12 subunits are cloned, they can be used in baculovirus expression
system to stably express and extract the proteins separately as it has been done for
Mediator complex subunits [89]. RNAP II subunit or subunits responsible for TF-Two-E
interaction can be found this way. Revealing such an interaction will also help to clarify
the assembly of RNAP II and PIC on the promoter site.

To further dissect the sequential assembly and holoenzyme pathways, procedure

that has been applied to TF-Two-E can also be applied to other GTFs. For that purpose,
TFIIB and TFIIF which are also expressed in the bacterial expression system due to their
small size, can be used as the next step. Figure-5.2 shows the purified TFIIB and produced
TFIIF subunits (Rap30 and Rap74).

50
Figure-5.2: Western blot check of purified TFIIB and produced TFIIF subunits. A)
Flag-tagged TFIIB (35kDa) present in pET11D bacterial expression plasmid produced by
IPTG induction. Then it was purified by incubation with M2 agarose beads. B) 6xHis
tagged Rap30 and Rap74 present in pET15b bacterial expression vector produced by
IPTG induction. Smear bans in Panel B are due to the whole bacterial extracts.

When the TF-Two-E -Mediator, TF-Two-E -RNAP II and TF-Two-E -TFIIH

interactions are fully identified, then the same procedure may be followed for TFIIB and
TFIIF to clarify the PIC formation and role of Mediator complex in that pathway.

51
BIBLIOGRAPHY

1. Franklin, S., Vondriska, T. M. 2011. “Genomes, proteomes, and the central dogma.”
Circ Cardiovasc Genet. 4(5):576. doi: 10.1161/CIRCGENETICS.110.957795
2. Engel, C., Neyer, S., Cramer, P. 2018. “Distinct Mechanisms of Transcription
Initiation by RNA Polymerases I and II.” Annu Rev Biophys. 47:425-446. doi:
10.1146/annurev-biophys-070317-033058.
3. Weiss, S. B. and Gladstone, L. 1959. “A mammalian system for the incorporation of
cytidine triphosphate into ribonucleic acid.” J. Am. Chem. Soc. 81 (15), pp 4118–4119
DOI: 10.1021/ja01524a087
4. Hurwitz, Jerard. 2005. “The Discovery of RNA Polymerase.” The Journal of
Biological Chemistry vol. 280, no. 52, pp. 42477–42485 doi:
10.1074/jbc.X500006200
5. Roeder, R. G., Rutter, W. J. 1970. “Specific nucleolar and nucleoplasmic RNA
polymerases.” Proc Natl Acad Sci U S A. 1970 Mar;65(3):675-82.
6. Herr, A. J., M. B. Jensen, T. Dalmay, and D. C. Baulcombe. 2005. “RNA polymerase
IV directs silencing of endogenous DNA.” Science 308(5718):118-20. DOI:
10.1126/science.1106910 Epub 2005 Feb 3.
7. Butler, Jennifer E.F., and James T. Kadonaga. 2002. “The RNA polymerase II core
promoter: a key component in the regulation of gene expression.” Genes Dev
16(20):2583-92. DOI: 10.1101/gad.1026202
8. Engel, C., Neyer, S., Cramer, P. 2018. “Distinct Mechanisms of Transcription
Initiation by RNA Polymerases I and II.” Annual Review of Biophysics Vol. 47:425-
446 (Volume publication date May 2018) https://doi.org/10.1146/annurev-biophys-
070317-033058
9. Martin, K. J. 1991. “The interactions of transcription factors and their adaptors,
coactivators and accessory proteins.” Bioessays 13(10):499-503. DOI:
10.1002/bies.950131003

52
10. Howcroft, T. K., Raval, A., Weissman, J. D., Gegonne, A., Singer, D. S. 2003.
“Distinct transcriptional pathways regulate basal and activated major
histocompatibility complex class I expression.” Mol Cell Biol. 23(10):3377-91.
11. Weil, P. A., Luse, D. S., Segall, J., Roeder, R. G. 1979. “Selective and accurate
initiation of transcription at the Ad2 major late promotor in a soluble system dependent
on purified RNA polymerase II and DNA.” Cell 18:469–484
12. Sawadogo, M. and Roeder, R.G. 1985a. “Factors involved in specific transcription by
human RNA polymerase II: analysis by a rapid and quantitative in vitro assay.” Proc
Natl Acad Sci USA 82:4394–4398.
13. Mary C. Thomas & Cheng-Ming Chiang (2006) The General Transcription Machinery
and General Cofactors, Critical Reviews in Biochemistry and Molecular Biology, 41:3,
105-178, DOI: 10.1080/10409230600648736
14. Fire, A., Samuels, M., and Sharp, P.A. 1984. Interactions between RNA polymerase
II, factors, and template leading to accurate transcription. J Biol Chem 259:2509–2516.
15. Carole A. Bewley, Angela M. Gronenborn, G. Marius Clore. 1998. “Minor groove-
binding architectural proteins: structure, function, and dna recognition.” Annu. Rev.
Biophys. Biomol. Struct. 1998. 27:105–31
16. Parker, C.S. and Topol, J. 1984. “A Drosophila RNA polymerase II transcription
factor contains a promoter-region-specific DNA-binding activity.” Cell 36:357–369.
17. Sawadogo, M. and Roeder, R.G. 1985b. “Interaction of a gene-specific transcription
factor with the adenovirus major late promoter upstream of the TATA box region.”
Cell 43:165–175.
18. Buratowski, S., Hahn, S., Sharp, P.A., and Guarente, L. 1988. “Function of a yeast
TATA element-binding protein in a mammalian transcription system.” Nature
334:37–42
19. Imbalzano, A.N., Kwon, H., Green, M.R., and Kingston, R.E. 1994a. “Facilitated
binding of TATA-binding protein to nucleosomal DNA.” Nature 370:481–485.
20. Geiger, J.H., Hahn, S., Lee, S., and Sigler, P.B. 1996. “Crystal structure of the yeast
TFIIA/TBP/DNA complex.” Science 272:830–836.
21. Orphanides, G., Lagrange, T., and Reinberg, D. 1996. “The general transcription
factors of RNA polymerase II.” Genes Dev 10:2657–2683.

53
22. Hahn, S. 2004. “Structure and mechanism of the RNA polymerase II transcription
machinery.” Nat Struct Mol Biol 11:394–403.
23. Hampsey, M. 1998. “Molecular genetics of the RNA polymerase II general
transcriptional machinery.” Microbiol Mol Biol Rev 62:465–503.
24. Price, D.H., Sluder, A.E., and Greenleaf, A.L. 1989. “Dynamic interaction between a
Drosophila transcription factor and RNA polymerase II.” Mol Cell Biol 9:1465–1475.
25. Flores, O., Lu, H., Killeen, M., Greenblatt, J., Burton, Z.F., and Reinberg, D. 1991.
“The small subunit of transcription factor IIF recruits RNA polymerase II into the
preinitiation complex.” Proc Natl Acad Sci USA 88:9999–10003.
26. Robert, F., Douziech, M., Forget, D., Egly, J.-M., Greenblatt, J., Burton, Z.F., and
Coulombe, B. 1998. “Wrapping of promoter DNA around the RNA polymerase II
initiation complex induced by TFIIF.” Mol Cell 2:341–351.
27. 27. Ghazy, M.A., Brodie, S.A., Ammerman, M.L., Ziegler, L.M., and Ponticelli, A.S.
2004. “Amino acid substitutions in yeast TFIIF confer upstream shifts in transcription
initiation and altered interaction with RNA polymerase II.” Mol Cell Biol 24:10975–
10985.
28. Yan, Q., Moreland, R.J., Conaway, J.W., and Conaway, R.C. 1999. “Dual roles for
transcription factor IIF in promoter escape by RNA polymerase II.” J Biol Chem
274:35668–35675.
29. Ohkuma, Y. and Roeder, R.G. 1994. “Regulation of TFIIH ATPase and kinase
activities by TFIIE during active initiation complex formation.” Nature 368:160–163.
30. Serizawa, H., Conaway, J.W., and Conaway, R.C. 1994. “An oligomeric form of the
large subunit of transcription factor (TF) IIE activates phosphorylation of the RNA
polymerase II carboxyl-terminal domain by TFIIH.” J Biol Chem 269:20750-20756.
31. Ohkuma, Y., Hashimoto, S., Wang, C.K., Horikoshi, M., and Roeder, R.G. 1995.
Analysis of the role of TFIIE in basal transcription and TFIIH-mediated carboxy-
terminal domain phosphorylation through structure-function studies of TFIIE-α. Mol
Cell Biol 15:4856–4866.
32. Ossipow, V., Tassan, J.-P., Nigg, E.A., and Schibler, U. 1995. “A mammalian RNA
polymerase II holoenzyme containing all components required for promoter-specific
transcription initiation.” Cell 83:137–146.

54
33. Buratowski S, Hahn S, Guarente L, Sharp PA. 1998. “Five intermediate complexes in
transcription initiation by RNA polymerase II.” Cell. 1989 Feb 24;56(4):549-61.
34. Meisterernst M, Roy AL, Lieu HM, Roeder RG. 1991.” Activation of class II gene
transcription by regulatory factors is potentiated by a novel activity.” Cell. 1991 Sep
6;66(5):981-93.
35. Kaiser, K. and Meisterernst, M. 1996. “The human general co-factors.” Trends
Biochem Sci 21:342–345.
36. Malik, S., Gu, W.,Wu, W., Qin, J., and Roeder, R.G. 2000. “The USA-derived
transcriptional coactivator PC2 is a submodule of TRAP/SMCC and acts
synergistically with other PCs.” Mol Cell 5:753–760.
37. Kornberg, R.D. 2005. “Mediator and the mechanism of transcriptional activation.”
Trends Biochem Sci 30:235–239.
38. Kim, Y.-J., Björklund, S., Li, Y., Sayre, M.H., and Kornberg, R.D. 1994. “A
multiprotein mediator of transcriptional activation and its interaction with the C-
terminal repeat domain of RNA polymerase II.” Cell 77:599–608.
39. Fondell, J.D., Ge, H., and Roeder, R.G. 1996. “Ligand induction of a transcriptionally
active thyroid hormone receptor coactivator complex.” Proc Natl Acad Sci USA
93:8329–8333.
40. Ito, M., Yuan, C.-X., Malik, S., Gu,W., Fondell, J.D., Yamamura, S., Fu, Z.- Y.,
Zhang, X., Qin, J., and Roeder, R.G. 1999. Identity between TRAP and SMCC
complexes indicates novel pathways for the function of nuclear receptors and diverse
mammalian activators. Mol Cell 3:361–370.
41. Näär, A.M., Beaurang, P.A., Zhou, S., Abraham, S., Solomon,W., and Tjian, R. 1999.
“Composite co-activator ARC mediates chromatin-directed transcriptional
activation.” Nature 398:828–832.
42. Rachez, C., Suldan, Z., Ward, J., Chang, C.P., Burakov, D., Erdjument- Bromage, H.,
Tempst, P., and Freedman, L.P. 1998. “A novel protein complex that interacts with the
vitamin D3 receptor in a ligand dependent manner and enhances VDR transactivation
in a cell-free system.” Genes Dev 12:1787–1800.

55
43. Ryu, S., Zhou, S., Ladurner, A.G., and Tjian, R. 1999. “The transcriptional cofactor
complex CRSP is required for activity of the enhancer binding protein Sp1.” Nature
397:446–450.
44. Sun, X., Zhang, Y., Cho, H., Rickert, P., Lees, E., Lane, W., and Reinberg, D. 1998.
“NAT, a human complex containing Srb polypeptides that functions as a negative
regulator of activated transcription.” Mol Cell 2:213–222.
45. Zhang, X., Krutchinsky, A., Fukuda A., Chen, W., Yamamura, S., Chait, B. T.,
Roeder, R. G. 2005. “MED1/TRAP220 exists predominantly in a TRAP/ Mediator
subpopulation enriched in RNA polymerase II and is required for ER-mediated
transcription.” Molecular Cell, Vol. 19, 89–100 DOI 10.1016/j.molcel.2005.05.015
46. Malik, S., Roeder, R. G. 2005. “Dynamic regulation of pol II transcription by the
mammalian Mediator complex.” Trends Biochem Sci 30(5):256-63. DOI:
10.1016/j.tibs.2005.03.009
47. Ito, M., Okano, H.J., Darnell, R.B., and Roeder, R.G. 2002. “The TRAP100
component of the TRAP/Mediator complex is essential in broad transcriptional events
and development.” EMBO J 21:3464–3475.
48. Tsai, K.L., Tomomori-Sato, C., Sato, S., Conaway, R. C., Conaway, J. W., Asturias,
F. J. 2014. “Subunit Architecture and Functional Modular Rearrangements of the
Transcriptional Mediator Complex.” Cell. 158(2):463. doi:
10.1016/j.cell.2014.06.036. Epub 2014 Jul 17.
49. Cevher, M. A., Shi, Y., Li, D., Chait, B. T., Malik, S., Roeder, R. G. 2014.
“Reconstitution of active human core Mediator complex reveals a critical role of the
MED14 subunit.” Nat Struct Mol Biol. 21(12):1028-34. doi: 10.1038/nsmb.2914.
Epub 2014 Nov 10.
50. Malik, S., Roeder, R. G. 2010. “The metazoan Mediator co-activator complex as an
integrative hub for transcriptional regulation.” Nat Rev Genet 11(11):761-72.
doi:10.1038/nrg2901. Epub 2010 Oct 13.
51. Malik, S., Guermah, M., Yuan, C., X., Wu, W., Yamamura, S., Roeder, R. G. 2004.
“Structural and functional organization of TRAP220, the TRAP/mediator subunit that
is targeted by nuclear receptors.” Mol. Cell. Biol. 24, 8244–8254. doi:
10.1128/MCB.24.18.8244-8254.2004

56
52. Taatjes, D. J. & Tjian, R. (2004). “Structure and function of CRSP/Med2: a promoter-
selective transcriptional co‑activator complex.” Mol. Cell 14, 675–683. doi:
10.1016/j.molcel.2004.05.014
53. Stevens, J. L., Cantin, G. T., Wang, G., Shevchenko, A., Shevchenko, A., Berk, A. J.
l. (2002). “Transcription control by E1A and MAP kinase pathway via Sur2 mediator
subunit.” Science 296(5568):755-8. DOI: 10.1126/science.1068943. Epub 2002 Apr
4.
54. Liu, Y., Ranish, J. A., Aebersold, R. & Hahn, S. (2001). “Yeast nuclear extract
contains two major forms of RNA polymerase II mediator complexes.” J. Biol. Chem.
276, 7169–7175
55. Taatjes, D. J., Naar, A. M., Andel, F., Nogales, E., Tjian, R. (2002). “Structure,
function, and activator-induced conformations of the CRSP coactivator.” Science 295,
1058–1062
56. Knuesel, M. T., Meyer, K. D., Bernecky, C., Taatjes, D. J. (2009). “The human CDK8
subcomplex is a molecular switch that controls Mediator co‑activator function.” Genes
Dev. 23, 439–451
57. Davis, M. A., Larimore, E. A., Fissel, B. M., Swanger, J., Taatjes, D. J., Clurman, B.
E. (2013). “The SCF‑Fbw7 ubiquitin ligase degrades MED13 and MED13L and
regulates CDK8 module association with Mediator.” Genes Dev. 27, 151–156
58. Pavri, R., Lewis, B., Kim, T. K., Dilworth, F. J., Erdjument-Bromage, H., Tempst, P.,
de Murcia, G., Evans, R., Chambon, P., Reinberg, D. (2005). “PARP‑1 determines
specificity in a retinoid signaling pathway via direct modulation of mediator.” Mol.
Cell 18, 83–96 doi: 10.1016/j.molcel.2005.02.034
59. Naar, A. M., Taatjes, D. J., Zhai, W., Nogales, E., Tjian, R. (2002). “Human CRSP
interacts with RNA polymerase II CTD and adopts a specific CTD-bound
conformation.” Genes Dev. 16, 1339–1344
60. Ebmeier, C. C., Taatjes, D. J. (2010). “Activator-Mediator binding regulates
Mediator–cofactor interactions.” Proc. Natl Acad. Sci. USA 107, 11283–11288 doi:
10.1073/pnas.0914215107. Epub 2010 Jun 4.

57
61. Donner, A. J., Ebmeier, C. C., Taatjes, D. J., Espinosa, J. M. (2010). “CDK8 is a
positive regulator of transcriptional elongation within the serum response network.”
Nature Struct. Mol. Biol 17, 194–201 doi: 10.1038/nsmb.1752. Epub 2010 Jan 24
62. Kim, Y. K., Bourgeois, C. F., Pearson. R., Tyagi, M., West, M. J., Wong, J., Wu, S.
Y., Chiang, C. M., Karn, J. (2006). “Recruitment of TFIIH to the HIV LTR is a rate-
limiting step in the emergence of HIV from latency.” EMBO J. 25, 3596–3604 DOI:
10.1038/sj.emboj.7601248
63. Bernecky, C., Grob, P., Ebmeier, C. C., Nogales, E., Taatjes, D. J. (2011). “Molecular
architecture of the human Mediator–RNA polymerase II–TFIIF assembly.” PLoS Biol.
9, e1000603
64. 64. Davis, J. A., Takagi, Y., Kornberg, R. D., Asturias, F. A. (2002). “Structure of the
yeast RNA polymerase II holoenzyme: Mediator conformation and polymerase
interaction.” Mol. Cell 10, 409–415
65. Holstege, F. C., Jennings, E. G., Wyrick, J. J., Lee, T. I., Hengartner, C. J., Green, M.
R., Golub, T. R., Lander, E. S., Young, R. A. (1998). “Dissecting the regulatory
circuitry of a eukaryotic genome.” Cell 95, 717–728
66. Myers, L. C., Gustafsson, C. M., Hayashibara, K. C., Brown, P. O., Kornberg, R. D.
(1999).
“Mediator protein mutations that selectively abolish activated transcription.” Proc.
Natl Acad. Sci. USA 96, 67–72
67. Hu, X., Malik, S., Negroiu, C. C., Hubbard, K., Velalar, C. N., Hampton, B., Grosu,
D., Catalano, J., Roeder, R. G., Gnatt, A. (2006). “A Mediator-responsive form of
metazoan RNA polymerase II.” Proc. Natl Acad. Sci. USA 103, 9506–9511
68. Cheng, B., Li, T., Rahl, P. B., Adamson, T. E., Loudas, N. B., Guo, J., Varzavand, K.,
Cooper, J. J., Hu, X., Gnatt, A., Young, R. A., Price, D. H. (2012). “Functional
association of Gdown1 with RNA polymerase II poised on human genes.” Mol. Cell
45, 38–50 doi: 10.1016/j.molcel.2011.10.022.
69. Takahashi, H., Parmely, T. J., Sato, S., Tomomori-Sato, C., Banks, C. A., Kong, S. E.,
Szutorisz, H., Swanson, S. K., Martin-Brown, S., Washburn, M. P., Florens, L., Seidel,
C. W., Lin, C., Smith, E. R., Shilatifard, A., Conaway, R. C., Conaway, J. W. (2011).

58
 “Human Mediator subunit MED26 functions as a docking site for transcription
elongation factors.” Cell 146, 92–104
70. Smallwood, A., Black, J. C., Tanese, N., Pradhan, S., Carey, M. (2008).
“HP1‑mediated silencing targets Pol II coactivator complexes.” Nature Struct. Mol.
Biol. 15, 318–320. DOI: 10.1038/nsmb.1385
71. Allen, B. L., Taatjes, D. J. (2015). “The Mediator complex: a central integrator of
transcription.” Nat Rev Mol Cell Biol. 16(3):155-66. doi: 10.1038/nrm3951. Epub
2015 Feb 18.
72. Grunberg, S. & Hahn, S. (2013). “Structural insights into transcription initiation by
RNA polymerase II.” Trends Biochem. Sci. 38, 603–611 doi:
10.1016/j.tibs.2013.09.002. Epub 2013 Oct 11.
73. Eick, D. & Geyer, M. (2013). “The RNA polymerase II carboxy-terminal domain
(CTD) code.” Chem. Rev. 113, 8456–8490 doi: 10.1021/cr400071f. Epub 2013 Aug
16.
74. Adelman, K., Lis, J. T. (2012). “Promoter-proximal pausing of RNA polymerase II:
emerging roles in metazoans.” Nature Rev. Genet. 13, 720–731 doi: 10.1038/nrg3293.
75. Galbraith, M. D., Allen, M. A., Bensard, C. L., Wang, X., Schwinn, M. K., Qin, B.,
Long, H. W., Daniels, D. L., Hahn, W. C., Dowell, R. D., Espinosa, J. M. (2013).
“HIF1A employs CDK8– Mediator to stimulate RNAPII elongation in response to
hypoxia.” Cell 153, 1327–1339
76. Park, J. M., Werner, J., Kim, J. M., Lis, J. T., Kim, Y. J. (2001). “Mediator, not
holoenzyme, is directly recruited to the heat shock promoter by HSF upon heat shock.”
Mol. Cell 8, 9–19
77. Peterson, M. G., Inostroza, J., Maxon, M. E., Flores, O., Admon, A., Reinberg, D.,
Tjian, R. (1991). “Structure and functional properties of human general transcription
factor IIE.” Nature 354(6352):369-73. DOI: 10.1038/354369a0.
78. Jawhari, A., Uhring, M., De Carlo, S., Crucifix, C., Tocchini-Valentini, G., Moras, D.,
Schultz, P., Poterszman, A. (2006). “Structure and oligomeric state of human
transcription factor TFIIE.” EMBO Rep. 7(5):500-5. DOI: 10.1038/sj.embor.7400663.
Epub 2006 Mar 17.

59
79. Ohkuma, Y., Hashimoto, S., Wang, C. K., Horikoshi, M., Roeder, R. G. (1995).
“Analysis of the role of TFIIE in basal transcription and TFIIH-mediated carboxy-
terminal domain phosphorylation through structure-function studies of TFIIE-alpha.”
Mol Cell Biol. 1995 Sep;15(9):4856-66.
80. Okuda, M., Tanaka, A., Arai, Y., Satoh, M., Okamura, H., Nagadoi, A., Hanaoka, F.,
Ohkuma, Y., and Nishimura, Y. (2004). “A novel zinc finger structure in the large
subunit of human general transcription factor TFIIE.” J Biol Chem 279:51395–51403.
81. Bell, S.D., Brinkman, A.B., van der Oost, J., and Jackson, S.P. (2001). “The archaeal
TFIIEα homologue facilitates transcription initiation by enhancing TATA-box
recognition.” EMBO Rep 2:133–138.
82. Sauer, F., Fondell, J.D., Ohkuma, Y., Roeder, R.G., and Jackle, H. (1995). “Control
of transcription by Krüppel through interactions with TFIIB and TFIIEβ.” Nature
375:162–164.
83. Zhu, A. and Kuziora, M. A. (1996). “Homeodomain interaction with the β subunit of
the general transcription factor TFIIE.” J Biol Chem 271:20993–20996.
84. Maxon, M. E., Goodrich, J. A., Tjian, R. (1994). “Transcription factor IIE binds
preferentially to RNA polymerase IIa and recruits TFIIH: a model for promoter
clearance.” Genes Dev 8:515–524.
85. Holstege, F. C. P., van der Vliet, P. C., and Timmers H. T. M. (1996). “Opening of an
RNA polymerase II promoter occurs in two distinct steps and requires the basal
transcription factors IIE and IIH.” EMBO J 15:1666–1677.
86. Reinberg, D. and Roeder, R. G. (1987). “Factors Involved in Specific Transcription
by Mammalian RNA Polymerase II. Purification and functional analysis of initiation
factors IIB and IIE.” The Journal of Biological Chemistry 262(7):3310-21
87. Romier, C., Ben Jelloul, M., Albeck, S., Buchwald, G., Busso, D., Celie, P. H.,
Christodoulou, E., De Marco, V., van Gerwen, S., Knipscheer, P., Lebbink, J. H.,
Notenboom, V., Poterszman, A., Rochel, N., Cohen, S. X., Unger, T., Sussman, J. L.,
Moras, D., Sixma, T. K., Perrakis, A. (2006). “Co-expression of protein complexes in
prokaryotic and eukaryotic hosts: experimental procedures, database tracking and case
studies.” Acta Crystallogr D Biol Crystallogr. 62(Pt 10):1232-42. Epub 2006 Sep 19.

60
88. Berger, I., Fitzgerald, D. J., Richmond, T. J. (2004). “Baculovirus expression system
for heterologous multiprotein complexes.” Nat Biotechnol. 22(12):1583-7. Epub 2004
Nov 28.
89. Ogiue-Ikeda, M., Machida, K. 2017. “Expression and Purification of SH2 Domains
Using Baculovirus Expression System.” Methods Mol. Biol. 1555:183-198. doi:
10.1007/978-1-4939-6762-9_11.

61
APPENDIX
Copyright Permissions

62
Copyright permission for Figure 1.1, Figure 1.4 and Table 1.1

https://s100.copyright.com/AppDispatchServlet#formTop

63
Copyright permission for Figure 1.2

64
Copyright for Figure 1.3

65
66
Copyright for figure 1.5
11200
Rockville Pike
Suite 302
Rockville, Maryland 20852

August 19, 2011

American Society for Biochemistry and Molecular Biology

To whom it may concern,

It is the policy of the American Society for Biochemistry and Molecular Biology
to allow reuse of any material published in its journals (the Journal of Biological
Chemistry, Molecular & Cellular Proteomics and the Journal of Lipid Research)
in a thesis or dissertation at no cost and with no explicit permission needed.
Please see our copyright permissions page on the journal site for more
information.

Best wishes,

Sarah Crespi

American Society for Biochemistry and Molecular Biology

11200 Rockville Pike, Rockville, MD
Suite 302
240-283-6616
JBC | MCP | JLR

Tel: 240-283-6600 • Fax: 240-881-2080 • E-mail: asbmb@asbmb.org

67
Copyright for Figure 1.6

68
Copyright for Figure 1.7

69