DNA library

DNA library: a collection of different DNA

sequence from an organism, each of which has
been cloned into a vector for ease of purification,
storage and analysis.
Genomic libraries
(made from genomic DNA)
DNA library

cDNA libraries
(made from cDNA- copy of mRNA)
 Genomic DNA libraries
eukaryotes
Purify genomic DNA

prokaryotes
Fragment this DNA : (physical shearing and
restriction enzyme digestion)

Clone the fragments into vectors and transformation

DNA extraction
Step 1
 DNA extraction
Step 2

• Add 1 teaspoon of
detergent
• Add two pinches of
table salt.
 DNA extraction
Step 2 (cont.)

• Add 20 ml of distilled
water.
• Dissolve the salt and
detergent by stirring
slowly with the plastic
spoon to avoid foaming.
 DNA extraction
Step 3

• Add two heaping

teaspoons of the
banana mixture from
step 1.
• Mix the solution with
the spoon for 5-10
minutes.
 DNA extraction
Step 4

• Filter the mixture by

pouring it into the
filter and letting the
solution drain for
several minutes until
there is about 5-7 ml
 DNA extraction
Step 7

• Add ethanol to the

banana solution
(filtrate).
 DNA extraction
Results

• You can watch the

white DNA
precipitate out into
the alcohol layer.
DNA has the
appearance of
white, stringy
mucus.
Break DNA into fragments randomly:

Physical shearing :
pipeting, mixing or sonicaion

Restriction enzyme digestion:

Restriction digestion is
preferred becoz- ligatable lengths of
DNA fragments.
 Selection of restriction enzyme
The given plasmid consists of 8400 nucleotide base
pairs (bp).restriction endonuclease Pst I was used to
"digest" this plasmid. This enzyme has the following
recogniton sequence:
/GGATCC
CCTAGG/
What will be the expected no of cuts sides for the
enzyme Pst I within the plasmid sequence?
Selection of restriction enzyme

1. 6 cutter: 4016 bp and 4 cutter: 256 bp are

used based on the size requirement.
2. As restriction sites distributed randomly
and therefore, inserts may be too big or
small.
3. Ends produced (sticky or blunt) &
The cleaved ends of the vector to be cloned
Sau3A: 5’-GT/AC-3’, blunt less efficiency
BamH1: 5’-G/GATCC
 Vectors
Time of digestion and ratio of restriction enzyme to
DNA is dependent on the desired insert size range.
According to fragment size, we can select a proper
vector to construct a library .
Vectors Plasmid phageλ cosmid YAC
insert (kb) 5 23 45 1000

The most commonly chosen genomic cloning vectors

are λ replacement vectors.
 Size of library (ensure enough clones)
Must contain a certain number of recombinants for
there to be a high probability of it containing any
particular sequence

The formula to calculate the number of

recombinants:
ln (1-P)
N=
ln (1-f)

P: desired probability
f : the fraction of the genome in one insert
 Comparison of DNA carriers

Cosmid Phage Plasmid

Host Bacteria Bacteria Bacteria
Insert size Up to 45kb ~ 25 kb ~ 1-5 kb

Entry into Cells Infection Infection Transformation

Efficiency Very efficient Very efficient Less efficient

Outcome Multiply Multiply and kill Multiply

Appearance of Colonies Plaques Colonies

infected cells

Application Genomic library Genomic library GenomicLibrary

Summary
cDNA libraries ?
 cDNA libraries

RNA isolation, mRNA purification

Synthesis of cDNA

Treatment of cDNA ends

Ligation to vector followed by Transformation

 Detergent + salt-disrupt and breaks cells.

 Centrifugation

 Chloroform addition, separates the solution

to aqueous and organic phases.

 RNA remains in the aqueous phase.

 Addition of isopropyl alcohol precipitates

RNA.
 Centrifugation, pellet retained.
Ribonuclease (RNase)
is a type of nuclease
that catalyzes the
degradation of RNA into
smaller components.

Diethylpyrocarbonate
Inactivate RNase enzymes
Covalent binding of histidine
(most strongly), lysine, cysteine,
and tyrosine residues
 All reagents prepared with DEPC
 mRNA purification

5’ cap AAAAAAAAAAn

•Most eukaryotic mRNAs have 5’ CH3 Cap

and polya tail at 3’ ends
 Purification of mRNA from total RNA

Source: The molecular biology of the cell

 Three methods to isolate mRNA
1.Traditionally method was done by pass a
preparation of total RNA down a column of oligo
(dT)-cellulose
2.More rapid procedure is to add oligo(dT) linked
to magnetic beads directly to a cell lysate and
‘pulling out’ the mRNA using a strong magnet

3.Alternative route of isolating mRNA is lysing

cells and then preparing mRNA-ribosome
complexes on sucrose gradients
 Synthesis of cDNA :

First stand synthesis: materials reverse

transcriptase, primer(oligoT) and dNTPs.
Second strand synthesis: materials
reverse transcriptase/DNA polymerase,
dNTPs and S1 nuclease.
cDNA ‘tail’ at 3’-end of the first strand is
used as primer
 The synthesis of cDNA

Source: The molecular biology of the cell

A DNA copy (cDNA) of an mRNA molecule is produced by the
enzyme reverse transcriptase, thereby forming a DNA/RNA
hybrid helix. Treating the DNA/RNA hybrid with alkali
selectively degrades the RNA strand into nucleotides. The
remaining single-stranded cDNA is then copied into double-
stranded cDNA by the enzyme DNA polymerase or reverse
transcriptase. As indicated, both reverse transcriptase and
DNA polymerase require a primer to begin their synthesis.
For reverse transcriptase a small oligonucleotide is used; in
this example oligo(dT) has been annealed with the long poly-
A tract at the 3' end of most mRNAs. The double-stranded
cDNA molecule produced here lacks cohesive ends; such
blunt-ended DNA molecules can be cloned by one of several
procedures that are analogous.
 P
P

OH
OH
 Treatment of cDNA ends
Blunt and ligation of large fragment is not efficient, so
we have to use special process to create sticky ends.

The process :
Treatment with TdT / PNK

Use of linkers or adaptors

Ligate cohesive end cDNA with vectors

Transformation (Host) , library preserved/analyzed

 cDNA libraries

cDNA libraries are very useful for

eukaryotic gene analysis
• Condensed protein encoded gene libraries,
have no junk sequences.
• cDNAs have no introns  genes can be
expressed in E. coli directly
• Are very useful to identify new genes
• Tissue or cell type specific (differential
expression of genes)
 The differences between cDNA clones and
genomic DNA clones

Source: The molecular biology of the cell

 The differences between cDNA clones and
genomic DNA clones
In this example gene A is infrequently transcribed while
gene B is frequently transcribed, and both genes contain
introns (green). In the genomic DNA clones both the
introns and the nontranscribed DNA are included, and
most clones will contain only part of the coding
sequence of a gene. In the cDNA clones the intron
sequences have been removed by RNA splicing during
the formation of the mRNA, and a continuous coding
sequence is therefore present.
 DNA libraries
• DNA libraries are sets of DNA clones, each of which has been
derived from the insertion of a different fragment into a vector
followed by propagation in the host.
• Size of library A gene library must contain a certain number of
recombinant for there to be a high probability of it containing any
particular sequence. This value can be calculated if the genome
size and the average size of the insert in the vector are known.
• Genomic DNA For making libraries, genomic DNA, usually
prepared by protease digestion and phase extraction, is
fragmented randomly by physical shearing or restriction enzyme
digestion to give a size range appropriate for the chosen vector.
Often combination of restriction enzymes are used to partially
digest the DNA.
• Vectors Plasmids, λ pahge, cosmid, BAC or yeast artificial
chromosome vectors can be used to construct genomic libraries,
the choice depending on the genome size.
 Recall Restriction Enzymes
(from restriction enzyme)

• Restriction enzymes break DNA whenever

they encounter specific base sequences
• They occur reasonably frequently within
long sequences (a 6-base sequence target
appears, on average, 1:4096 bases)
• Can be used as molecular scissors
EcoRI EcoRI

cggtacgtggtggtgaattctgtaagccgattccgcttcggggagaattccatgccatcatgggcgttgc
gccatgcaccaccacttaagacattcggctaaggcgaagcccctcttaaggtacggtagtacccgcaacg
 EcoR I

8 kb
Pst I

Marker Pst I Eco RI

10 kb
8 kb
7 kb

5 kb
3 kb

1 kb
P EcoR I

8 kb

Marker EcoR I Eco RI

10 kb
8 kb
7 kb

5 kb
3 kb

1 kb
Restriction Mapping
 Restriction Mapping

• A restriction map is a description of

restriction endonuclease cleavage sites
within a piece of DNA.
• Generating such a map is usually the first
step in characterizing an unknown DNA,
and a prerequisite to manipulating it for
other purposes.
 Restriction Mapping
• There are three methods used to generate
a restriction map:
(i) mapping by single R.E. digestions
(ii) mapping by multiple R.E. digestions
(iii) using a computer
 EcoR I
8 kb
Hind I

SD SD DD
EcoR I EcoR I & Hind I
Plasmid 5kb Hind I

Insert DNA 3kb

6 kb
5 kb 5 kb

Eco RI 3 kb
Hind I 2 kb 2 kb

1 kb
 EcoR I

3 kb 5 kb
Hind I

2 kb 6 (5+1) kb
Hind I EcoR I

2 kb 1 kb 5 kb
• DNA to be mapped is contained within a
well-characterized plasmid vector for
which the R.E. map is known, mapping is
facilitated by using R.E. that cleave the
vector once
• Multiple restriction sites immediately
flanking the uncharacterized DNA, which
facilitates making the map.
• R.E. sites in the DNA are mapped with
respect to known sites in the vector
• It is assumed that the unknown DNA has
been inserted into a plasmid vector, but
the principles can readily be applied to
other situations.
 Mapping by Multiple R.E.
Digestions
• Mapping is to digest samples of the plasmid with:
(i) a set of individual enzymes,
(ii) and with pairs of those enzymes.
• The digestions are then "run out" on an agarose
gel to determine the sizes of the fragments
generated.
• The sizes of the fragments determined by
comparison with standard DNA molecular weight
markers.
• If you know the fragment sizes, it is usually a fairly
easy task to deduce where each enzyme cuts.
 Kpn I

1000 7000
Bam HI

2200 600 5200

Bam HI Bam HI

600 2200 5200

• Consider a plasmid that contains a 3000
base pair (bp) fragment of unknown DNA.
• Within the vector, immediately flanking the
unknown DNA are unique recognition sites
for the enzymes Kpn I and BamH I.
• First separate digestions with Kpn I and
BamH I
• Digestion with Kpn I yields two fragments:
1000 bp and 7000 bp.
• Since there is a single Kpn I site in the vector,
the presence of a 1000 bp fragment tells you
that there is also a single Kpn I site in the
unknown DNA
• And that it is 1000 bp from the Kpn I in the
vector.
• The 7000 kb fragment consist of the vector
plus the remaining 2000 bp of the unknown.
• Digestion with BamH I yields 3 fragments: 600, 2200
and 5200. The 5200 fragment is again the vector plus
a little bit (200 bp in this case) of unknown DNA.
• The presence of the 600 and 2200 bp fragments
indicate that there are two BamH I sites in the
unknown.
• You can deduce immediately that one BamH I site is
2800 bp (600 + 2200) from the BamH I in the vector.
• The second BamH I site can be in one of two
positions: 600 or 2200 bp from the BamH I site in the
vector.
• At this point, there is no way to know which of
these alternative positions is correct
• The trick to determining where the second BamH
I site is located is to digest the plasmid with Kpn I
and BamH I together
• This double digestion yields fragments of 600,
1000 and 1200 bp (plus the 5200 fragment).
• The 600 bp fragment is the same as that
obtained by digestion with BamH I alone.
• The 1000 and 1200 bp fragments tell you that
Kpn I cut within the 2200 bp BamH I fragment
observed when the plasmid was cut with BamH I
alone.
• We already know where Kpn I cuts in the
unknown DNA, and you therefore now know
the location of the second BamH I site!
 Problems of interpretation
• For a given enzyme, some recognition
sites can be cleaved much less efficiently
than others.
• Cost.
• Miss mapping of certain sites.
• It is difficult to map sites near the ends of
the fragment.
• Performed twice, with preparations of
fragment labelled at opposite ends.
 Using a Computer to Generate
Restriction Maps
• All of the techniques described above for
generating a restriction map assume that you
don't have the sequence of the DNA.
• If the sequence is known, it is a simple matter to
feed that sequence into any number of computer
programs.
• These programs will search the sequence for
dozens of restriction enzyme recognition sites
and build a map for you.
 Insilico analysis
• Open the given link http://www.restrictionmapper.org/
• Paste the below DNA sequence in the PASTE SEQUENCE HERE
in the tool
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGG
GCCACGGCCACCGCTGCCCTGCCCTGGAGGGTGGCCCCACCGGCCG
AGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCTC
CTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCC
GGGCCCCTCATAGGAGAGGAGCTCGGGAGGTGGCCAGGCGGCAGGA
AGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCTGCAG
GAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCAT
GAATGCTCACGCAAGTTTAATTACAGACCTGAA
• Set default parameters and click on MAP SITES
• Analyze the result page and give your inference
• Happy mapping!!!!!!
 LINKERS
&
ADAPTORS
Ligation

No ligation
 LINKER
• Synthetic oligonucleotides which contain
sites for one or more restriction
endonucleases.
• Usually, decameric.
• Helpful in ligating the vector with the gene
of interest (with blunt or non-cohesive
ends).
 The process…

1. Ligate the linker to both ends of foreign

DNA to be cloned, with high
concentration of DNA Ligase.
2. Treat the linker molecule with a REase
that produces sticky ends at both the
ends.
3. Subject the vector also to digestion with
the same REase as in last step.
4. Ligate the foreign DNA into the vector
• The advantage:
The insert DNA can be excised and
recovered at any point of time from the
vector.
Application of linker in cDNA ligation to Vector
Solution1: Simply choose another REase.
Solution2: Methylate internal sequence of the
foreign DNA with a suitable methylase.
Solution3: Adaptor
 Design an Adaptor molecule.
• Synthetic oligonucleotides which contain
preformed cohesive sites for a REase.
• One end would be blunt with a 5’
phosphate group and another end would
be cohesive, specific for a particular
REase without getting phosphorylated.

OH OH
Blunt end P OH Sticky end
 The process…
1. Ligate the adaptor to both ends of the
foreign DNA using T4 DNA Ligase i.p.o
ATP.
2. Phosphorylate the above at both the 5’
termini with Polynucleotide Kinase i.p.o
ATP.
3. Cut the vector with the suitable REase.
4. Ligate the foreign DNA into the vector.