PIIS0092867424006317

Article
Preclinical proof of principle for orally delivered

Th17 antagonist miniproteins
Graphical abstract Authors
Stephanie Berger, Franziska Seeger,
Ta-Yi Yu, ..., Matthias Siebeck,
Roswitha Gropp, David Baker
Correspondence
berger389@gmail.com (S.B.),
dabaker@uw.edu (D.B.)
In brief
De novo proteins can be computationally
designed with sub-picomolar affinity and
extreme stability to enable oral
administration and were effective in a
model of colitis.
Highlights
d Computational design yielded low- and sub-pM minibinders
of IL-17A and IL-23R
d IL-23R minibinders are extremely resistant to heat, acid, and

proteolysis
d Oral IL-23R minibinder is as effective as a clinical mAb in

mouse colitis
Berger et al., 2024, Cell 187, 1–13

August 8, 2024 ª 2024 The Author(s). Published by Elsevier Inc.
https://doi.org/10.1016/j.cell.2024.05.052 ll
Please cite this article in press as: Berger et al., Preclinical proof of principle for orally delivered Th17 antagonist miniproteins, Cell (2024),
https://doi.org/10.1016/j.cell.2024.05.052
ll
OPEN ACCESS
Article
Preclinical proof of principle for orally
delivered Th17 antagonist miniproteins
Stephanie Berger,1,2,16,* Franziska Seeger,1,2 Ta-Yi Yu,1,2,3 Merve Aydin,4 Huilin Yang,5,6 Daniel Rosenblum,7
Laure Guenin-Macé,7,8 Caleb Glassman,9 Lauren Arguinchona,1,2 Catherine Sniezek,2 Alyssa Blackstone,2
Lauren Carter,2 Rashmi Ravichandran,2 Maggie Ahlrichs,2 Michael Murphy,2 Ingrid Swanson Pultz,2 Alex Kang,1,2
Asim K. Bera,1,2 Lance Stewart,2 K. Christopher Garcia,9,10,11 Shruti Naik,7,12 Jamie B. Spangler,5,6,13 Florian Beigel,14
Matthias Siebeck,4 Roswitha Gropp,4 and David Baker1,2,15,*
1Department of Biochemistry, University of Washington, Seattle, WA 98195, USA
2Institutefor Protein Design, University of Washington, Seattle, WA 98195, USA
3Department of Bioengineering, University of Washington, Seattle, WA 98195, USA
4Department of General, Visceral and Transplantation Surgery, LMU University Hospital, LMU Munich, 81377 Munich, Germany
5Department of Chemical and Biomolecular Engineering, Johns Hopkins University, Baltimore, MD 21218, USA
6Translational Tissue Engineering Center, Johns Hopkins University, Baltimore, MD 21231, USA
7Department of Pathology, NYU Langone Health, New York, NY 10016, USA
8Immunobiology and Therapy Unit, INSERM U1224, Institut Pasteur, Paris 75015, France
9Department of Molecular and Cellular Physiology, Stanford University School of Medicine, Stanford, CA 94304, USA
10Department of Structural Biology, Stanford University School of Medicine, Stanford, CA 94304, USA
11Howard Hughes Medical Institute, Stanford School of Medicine, Stanford, CA 94305, USA
12Department of Medicine, Ronald O. Perelman Department of Dermatology, Perlmutter Cancer Center, NYU Langone Health, New York, NY
10016, USA
13Department of Biomedical Engineering, Johns Hopkins University, Baltimore, MD 21218, USA
14Department of Medicine II, LMU University Hospital, LMU Munich, 80336 Munich, Germany
15Howard Hughes Medical Institute, University of Washington, Seattle, WA 98195, USA
16Lead contact
*Correspondence: berger389@gmail.com (S.B.), dabaker@uw.edu (D.B.)

SUMMARY
Interleukin (IL)-23 and IL-17 are well-validated therapeutic targets in autoinflammatory diseases. Antibodies
targeting IL-23 and IL-17 have shown clinical efficacy but are limited by high costs, safety risks, lack of sus-
tained efficacy, and poor patient convenience as they require parenteral administration. Here, we present de-
signed miniproteins inhibiting IL-23R and IL-17 with antibody-like, low picomolar affinities at a fraction of the
molecular size. The minibinders potently block cell signaling in vitro and are extremely stable, enabling oral
administration and low-cost manufacturing. The orally administered IL-23R minibinder shows efficacy better
than a clinical anti-IL-23 antibody in mouse colitis and has a favorable pharmacokinetics (PK) and bio-
distribution profile in rats. This work demonstrates that orally administered de novo-designed minibinders
can reach a therapeutic target past the gut epithelial barrier. With high potency, gut stability, and straightfor-
ward manufacturability, de novo-designed minibinders are a promising modality for oral biologics.
INTRODUCTION 30% of IBD patients receiving the anti-IL-23 monoclonal anti-

body (mAb) Stelara achieve remission, and approximately 20%
Interleukin (IL)-23 cytokine is produced by antigen presenting of initial responders lose response over time due to generation
cells and promotes differentiation and phenotype maintenance of anti-drug antibodies.1–4 Systemic immune suppression puts
of T-helper type 17 (TH17) cells. IL-23 stimulates production of patients at increased risk for malignancies and serious infec-
the pro-inflammatory cytokine IL-17 in circulating TH17 as well tions.5 Due to their large molecular size and poor permeability,
as tissue-resident innate lymphoid cells (ILCs) and ɣdT-cells. antibodies are not administered orally but by intravenous infu-
IL-23 and IL-17 are genetically and clinically validated therapeu- sion or subcutaneous injection, which can be inconvenient and
tic targets for the treatment of several TH17-mediated autoin- stressful for patients. Systemically administered antibodies
flammatory diseases, including inflammatory bowel disease generally show poor tissue penetrance, only reaching 5%–
(IBD; IL-23 only) and psoriasis (both IL-23 and IL-17). However, 10% of serum concentration in target tissues after systemic
existing antibody therapies have several limitations. Only about administration.6 Manufacturing and distribution of antibodies is
Cell 187, 1–13, August 8, 2024 ª 2024 The Author(s). Published by Elsevier Inc. 1
This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
ll
OPEN ACCESS Article
expensive as they are typically produced in mammalian expres- We aimed to design proteins that bind IL-17A at the surface
sion systems, need complex purification processes to achieve mediating its interaction with IL-17RA or IL-17RC.
purity suitable for parenteral administration, and require refriger- Computational design of binding proteins generally starts from
ation for storage and transport. a crystal or cryogenic electron microscopy (cryo-EM) structure
A number of oral and topical proteins, peptides, and small mol- of the target. If a ligand-bound structure is available, critical bind-
ecules are in development as convenient, less immunogenic, ing residues (or hotspots) of the ligand may be incorporated into
inexpensive alternatives to systemically administered anti- design.21,22 If only the apo structure of the target is available, hot-
bodies. Oral versions of approved anti-tumor necrosis factor spots may be computationally generated.23 We took a combined
alpha (TNF-a) antibodies (adalimumab, Biora Therapeutics; in- approach, using one native hotspot from IL-23p19 cytokine
fliximab, Celltrion and Intract Pharma) promise greater conve- (W156) and additional computationally determined de novo hot-
nience with the same cellular potency but require proprietary spots generated at the p19 interface to seed design. For IL-17A,
formulation to reach the site of action intact, adding to the we exclusively used de novo hotspots generated at the receptor
already high cost of the antibody alone. Oral Janus kinase surface. Thousands of computationally designed miniproteins
(JAK) inhibitors are approved for a number of chronic inflamma- with diverse topologies and experimentally validated stability
tory conditions, including IBD, but severe side effects have (scaffolds)11,24,25 were docked at the IL-23R or IL-17A surface
limited their use.7 Oral peptides are in development for psoriasis such that hotspots were incorporated into the scaffold back-
and IBD, targeting IL-23R (PN-235/JNJ-77242113, Protagonist bone. Then, with each docked configuration as input, we used
Therapeutics and Janssen) and a4b7 integrin (PN-943, Protago- the Rosetta molecular modeling suite to optimize scaffold resi-
nist Therapeutics). However, the peptides require noncanonical due identities and conformations at the IL-23R or IL-17A inter-
amino acids and crosslinks to confer resistance to gastrointes- face for high-affinity binding. Native and de novo hotspots, res-
tinal (GI) proteases, necessitating expensive manufacturing via idues in the scaffold hydrophobic core, and scaffold residues
chemical synthesis. Orally delivered small molecules targeting not at the target interface were kept fixed. The resulting designed
IL-17A are in development for psoriasis (DC-806 and DC-853, inhibitor candidates were filtered on computational metrics
Dice Therapeutics and Eli Lilly); while the affinity of next-genera- correlating with binding affinity and monomer stability, and
tion variant DC-853 is unknown, DC-806 binds IL-17A with only genes encoding the best 15,000 per target were obtained and
low nanomolar affinity and requires two relatively high daily transformed into yeast for surface display. Yeast were selected
doses to achieve modest clinical effect.8,9 Although the above for binding to labeled recombinant human IL-23R or IL-17A by
therapies are more convenient than parenterally administered multiple successive rounds of fluorescence-activated cell sort-
mAbs, their safety risks, high cost of goods, and limited efficacy ing (FACS). Naive and sorted pools were analyzed by next-
are significant downsides. generation sequencing (NGS) and designs were ranked by their
Computational design methods now enable the design of relative enrichment or depletion.
small (60 residue) binding proteins with low picomolar affinity, Two IL-23R designs, 23R-1 and 23R-2, and three IL-17A de-
extreme thermostability, resistance to proteolysis, and low signs, 17-1, 17-2, and 17-3, were highly enriched in the final sorts
immunogenicity.10–16 We reasoned that designed miniprotein in- and were selected for further biochemical characterization and
hibitors of IL-23R and IL-17 could address the unmet need for sequence optimization. The IL-23R binding designs are 55-
effective, convenient, safe, and low-cost therapies for autoin- (23R-1) and 54-residue (23R-2) 3-helix bundles comprising a cen-
flammatory diseases, and set out to develop such compounds. tral binding helix that incorporates the native Trp hotspot, and two
additional helices that stabilize the central binding helix and make
RESULTS AND DISCUSSION additional contacts with IL-23R (Figure 1A). IL-17A binding de-
signs, 43-residue 3-helix bundle 17-2 and 61-residue ferredoxins
Computational design yields proteins with low 17-1 and 17-3, incorporate de novo-generated hotspots at the IL-
nanomolar affinity for IL-23R and IL-17 17A surface that mimic IL-17RA (Figure 1B).
IL-23 consists of the p19 subunit unique to IL-23 and the p40 The binding affinity and potency of the minibinders was deter-
subunit shared with IL-12. The IL-23 receptor is also heterodi- mined with biolayer interferometry (BLI) and cell-based signaling
meric, with a unique subunit, IL-23R, which binds p19, and assays. Designs were expressed in E. coli and purified. Binding
a shared subunit, IL-12Rb1, which binds p40.17,18 Anti-p40 affinities were quantitatively determined with BLI; all designs
antibody Stelara, which blocks both IL-23 and IL-12, has seen bound their target with low nanomolar affinity (Figure S1). The
enormous clinical success. However, preclinical studies minibinders were very stable to heat and chemical denaturant
demonstrated that IL-23 and not IL-12 drives pathogenic autoin- (guanidinium hydrochloride [Gdn]) in circular dichroism (CD) ex-
flammation and, therefore, subsequent drug discovery efforts periments. IL-23R minibinders 23R-1 and 23R-2 had denatur-
have largely focused on targeting the IL-23-specific subunit, ation transition temperatures (Tm) >95 C and very high chemical
p19.19,20 Thus, we aimed to design proteins that disrupt the IL- denaturation midpoint concentrations (5 M Gdn for 23R-1, >6 M
23R:p19 interaction to selectively inhibit IL-23 and not IL-12. for 23R-2; Figures 2C and 2D). IL-17A minibinder 17-1 had a Tm
IL-17A and IL-17F monomers pair to form homodimeric (A/A, of approximately 90 C and Gdn denaturation midpoint of 4 M
F/F) and heterodimeric (A/F) cytokines that signal via a ternary (Figure S2C). IL-17A minbinder 17-2 had the weakest stability,
complex with receptors IL-17RA and IL-17RC. We selected IL- with a Tm of approximately 70 C and Gdn denaturation midpoint
17A as our initial design target as it is best established among of 2 M (Figure 3C). The minibinders blocked IL-23- or IL-
the IL-17 homologs as a mediator of autoinflammatory disease. 17A-mediated cell signaling in a dose-dependent manner
2 Cell 187, 1–13, August 8, 2024

ll
Article OPEN ACCESS
Figure 1. Computational design of IL-23R and IL-17A minibinders

(A) Minibinder 23R-1 was designed to bind IL-23R domain D1 at the IL-23p19 interaction surface, and all designs incorporate native hotspot W156.
(B) Minibinder 17-1 was designed to bind IL-17A at site 1 of the IL-17RA interaction surface and incorporates de novo hotspots (purple) that mimic native hotspots
from IL-17RA (dark gray).
(C) The relative affinity of each mutation was determined using deep mutational scanning. The enrichment (blue) or depletion (red) of each mutation, depicted in
2D heatmaps, represents its impact on affinity relative to the original minibinder sequence (set to 0, white). Positional conservation scores are depicted in a 1D
heatmap from minimum (light gray) to maximum (dark gray) per design. Asterisks indicate native and de novo hotspots. See Figure S1 for binding data and
Figures S3 and S6 for deep mutational scanning heatmaps of additional IL-23R and IL-17A computationally designed minibinders and peptides.
(Figures 2A, 3A, and S2A). Figures 2E and 3D provide an over- in the sorted pools was calculated as an estimate for binding
view of the design and optimization strategy for IL-23R and IL- fitness. Enrichment per position per amino acid was visualized
17A minibinders, respectively, described in detail below. in a two-dimensional (2D) heatmap (Figures 1C and S3A), with
blue boxes indicating highly enriched and red boxes highly
Saturation mutagenesis data corroborate predicted depleted mutations. An overall sequence conservation score
monomer structure and binding mode was calculated per amino acid position of each minibinder,
Probing the sequence fitness landscape of the designed pro- visualized in a one-dimensional (1D) heatmap located above
teins provides insight into their three-dimensional (3D) structure the enrichment heatmap, colors ranging from light gray (low
and binding mode. Site-directed saturation mutagenesis (SSM) conservation) to dark gray (high conservation). Positions
libraries were synthesized comprising all possible single-posi- contributing to the hydrophobic core or binding interface in
tion mutants of 23R-1, 23R-2, 17-1, 17-2, and 17-3, trans- the design model were conserved (dark gray), while surface po-
formed into yeast, and screened for binding to labeled target sitions distal to the interface, which can more readily be
protein using FACS. Naive and sorted pools were deep mutated without disrupting the minibinder’s 3D structure or
sequenced, and the enrichment or depletion of each mutant binding, were not conserved (light gray). These data suggest
Cell 187, 1–13, August 8, 2024 3

ll
OPEN ACCESS Article
A B
120 25
25
100
% IL-23 stimulation
20 20
Response (nm)
15
80
15 10
60 5
10 0
40 0 500 1,000 1,500
5
20
0 0
10-2 10-1 100 101 102 103 104 105 106 0 2,500 5,000 7,500 10,000
[Inhibitor] (nM) Time (s)
120 25
100
% IL-23 stimulation
20
Response (nm)
25
80
15 20
60 15
10 10
40 5
20 5 0
0 500 1,000 1,500
0 0
10-2 10-1 100 101 102 103 104 105 106 0 2,500 5,000 7,500 10,000 12,500
[Inhibitor] (nM) Time (s)
C E
1.2 1.2 1.2
1.0 1.0 1.0

Fraction Folded
0.8 0.8 0.8
0.6 0.6 0.6
0.4 0.4 0.4
0.2 0.2 0.2
0.0 0.0 0.0

25 60 95 25 60 95 0 2 4 6
Temperature (°C) Temperature (°C) [Gdn] (M)
D
1.2 1.2 1.2
1.0 1.0 1.0

Fraction Folded
0.8 0.8 0.8
0.6 0.6 0.6
0.4 0.4 0.4
0.2 0.2 0.2
0.0 0.0 0.0

25 60 95 25 60 95 0 2 4 6
Temperature (°C) Temperature (°C) [Gdn] (M)
Figure 2. In vitro potency and stability of the IL-23R minibinders

(A) Minibinders block IL-23-mediated cell signaling in an engineered IL-23 reporter cell line. Representative curves are shown above (n R 2), and IC50 values
reported as mean ± SD of at least two independent experiments (N R 2).
(B) The binding affinities of 23R-72 and 23R-91 were determined using SPR.
(C and D) (C) 23R-1 and derivatives, and (D) 23R-2 and derivatives were denatured with heat and/or chemical denaturant guanidinium (Gdn) hydrochloride, and
helicity (signal at 222 nm) was monitored using circular dichroism. Signal is plotted as a fraction of reference sample (0 M Gdn at 25 C).
(E) Molecular design and optimization workflow. See Figures S1 and S3 for binding data and Figure S4 for biophysical characterization of IL-23R minibinder
variants.
that the minibinders are folded and bind the targets as in the tion at concentrations that saturate the target and, in this case,
computational design models. compete with the native ligand. We therefore sought to further
improve the minibinders’ potency and resistance to intestinal
In vitro evolution and computational design dramatically proteases. Combinatorial libraries were designed including the
improve potency and stability mutations most enriched for high-affinity binding in the SSMs,
Orally administered protein antagonist therapeutics must be suf- and high-affinity variants were selected via multiple successive
ficiently potent and stable in GI conditions to reach the site of ac- rounds of FACS. The most enriched variants in the final sort
4 Cell 187, 1–13, August 8, 2024

ll
Article OPEN ACCESS
C D
Figure 3. In vitro potency and stability of the IL-17 minibinders

(A) Minibinders block cell signaling mediated by hIL-17A (left), hIL-17F (middle), or hIL-17A/F (right) in an engineered IL-17 reporter cell line. Representative curves
are shown above (n R 2), and IC50 values are reported as mean ± SD of at least two independent experiments (N R 2; ND = no data).
(B) The binding affinity of lead IL-17A minibinder 17-53 was determined using BLI. We note that the instrument (ForteBio Octet RED96) is not sensitive enough to
accurately determine picomolar equilibrium dissociation constants (KDs), but the data nonetheless indicate the very high affinity and slow dissociation rate of 17–
53. Data plotted are representative of three independent experiments (N = 3).
(C) Each minibinder was denatured with heat or chemical denaturant guanidinium (Gdn) hydrochloride, and helicity (signal at 222 nm) was monitored using circular
dichroism. Signal is plotted as a fraction of reference sample (0 M Gdn at 25 C).
(D) Molecular design and optimization workflow. See Figures S1 and S3 for binding analysis and Figure S2 for potency and stability data for other IL-17A
minibinder variants.
were selected for expression in E. coli and biophysical charac- cellular potency (Figure 3A). Combinatorial variant sequences
terization. Affinity-optimized combinatorial variants were ranked were different from parent computational designs by 15%–
by binding affinity using a single-concentration BLI screen 19% (8–10 mutations; Table S1).
(Figures S3B and S3C), and for the best variants, kinetic and Minibinder stability was assessed using CD as well as timed
equilibrium binding constants were determined. The highest af- degradation in simulated gastric and intestinal fluids (SGF and
finity IL-23R minibinder variants had 100- to 1,000-fold higher SIF) containing physiological proteases. The affinity-optimized
binding affinities compared with the parent computational de- combinatorial variants had similar resistance to heat and
signs (Figure S1), and 30- to 300-fold higher cellular potencies chemical denaturant as their precursor computational designs
(Figure 2A). The highest affinity IL-17A minibinder variants had (compare computational design 17-1 to affinity-optimized
approximately 60-fold improvement in affinity (Figure S1) and variant 17-16 in Figure S2C, computational design 17-2 to
Cell 187, 1–13, August 8, 2024 5

ll
OPEN ACCESS Article
Figure 4. In vitro and in vivo GI stability of IL-23R minibinders

(A) Each minibinder or control protein V565, an oral nanobody in development for IBD, were digested in SIF or SGF at 37 C for up to 24 h (N R 2). In some
instances, indicated by white spaces, lanes were isolated to maintain consistent order of ladder and samples.
(B) SIF and SGF digests were sampled at the indicated time points, diluted to 10 nM minibinder (assuming no degradation), and BLI was used to measure residual
binding to hIL-23R (N R 2). See Figure S5 for binding analysis after SGF and SIF digest for other IL-23R minibinder variants.
(C) A single oral 20 mg/kg dose of 23R-72 or 23R-91 formulated in either PBS or GI-protective vehicle (GPV) was administered in healthy rats and minibinder
concentration measured in serum and target tissues 6 h after dosing. Mean ± SD, n = 2 technical replicates in analysis, N = 5 animals per group. Samples falling
below the limit of detection (BLOD) were assigned a value of 0 for calculation of group averages and standard deviations.
(D) A single oral 140 mg/kg dose of 23R-91 in PBS was administered in healthy rats, and serum concentration of minibinder measured at the indicated time points.
Mean ± SD, n = 2 technical replicates in analysis, N = 6 animals per group. All samples at the 6-h time point (*) were BLOD. See Table S5 for values and Figure S7
for ELISA standard curves.
affinity-optimized variant 17-35 in Figure 3C, computational similar SIF stability and modestly decreased SGF stability
design 23R-1 to affinity-optimized variants 23R-3 through compared with 23R-2 (Figure 4A). To improve minibinder sta-
23R-15 in Figure S4A, and computational design 23R-2 to af- bility while retaining high affinity, intramolecular disulfide(s)
finity-optimized variants 23R-17 through 23R-24 in Fig- were computationally designed in affinity-optimized combina-
ure S4B). 23R-2-derived combinatorial variant 23R-20 showed torial variants. Adding one disulfide to IL-17A combinatorial
6 Cell 187, 1–13, August 8, 2024

ll
Article OPEN ACCESS
Figure 5. The crystal structure of 23R-91 is

very close to the design model
Both chains in the crystal structure asymmetric unit
were aligned via Ca atoms to the computational
model of 23R-91, with 0.7 Å (chain A) and 0.4 Å
(chain B) RMSD. The core binding interface,
including native hotspot W3, is indicated with a
dashed box. See Table S4 for data collection and
refinement stats.
weight of 23R-72 as well as precursor

23R-64 early in the SIF digest, which likely
indicates cleavage of the inert C-terminal
poly-histidine tag as binding to hIL-23R
is retained (Figures 4B and S5). 23R-72
has 75 pM affinity for IL-23R (Figure 2B)
and similar cellular potency as precursor
23R-64 (Figure 2A). Stability-optimized
variant 23R-91, 8 mutations (15%) from
precursor 23R-49, shows improved SIF
variant 17-35 (yielding 17-51) significantly improved stability, stability, with t1/2 60 min and excellent SGF stability (t1/2
increasing the Tm from approximately 70 C to 95 C and simi- 4–24 h; Figure 4A). 23R-91 has a binding affinity lower than
larly increasing resistance to chemical denaturant (Figure 3C). the detection limit of the instrument (<1 pM; Biacore 8K) due
23R-64, an affinity-optimized variant of 23R-1 with one added to an immeasurably slow dissociation rate (Figure 2B), and
disulfide, showed significantly improved SIF and SGF stability, cellular potency was modestly improved compared with the
with half-lives (t1/2) of approximately 30 min and 4 h, respec- precursor 23R-49 (Figure 2A). Both 23R-72 and 23R-91 are
tively, compared with 23R-1 with t1/2 < 5 min in both SIF extremely resistant to heat and chemical denaturant, showing
and SGF (Figure 4A). Adding two disulfides to IL-23R combi- minimal loss of helicity even at 95 C in 6 M Gdn (Figures 2C,
natorial variant 23R-20 (yielding 23R-49) significantly improved 2D, and S4).
SGF stability, increasing the t1/2 of full-length minbinder from
approximately 30 min to >24 h, but decreasing SIF stability The crystal structure of 23R-91 is very close to the
to a t1/2 of about 5 min. To further optimize 23R-64 and design model
23R-49, SSM libraries were generated and transformed into The crystal structure of the most potent IL-23R minibinder,
yeast for surface display. Naive libraries were incubated in 23R-91, was solved to 1.9 Å resolution and has two copies of
SIF, then washed and incubated with labeled IL-23R. Variants 23R-91 in the asymmetric unit (Figure 5; Table S4). The two
that retained binding to IL-23R after SIF treatment were chains have 0.7 Å (chain A) and 0.4 Å (chain B) Ca root mean
selected via FACS. Mutations most enriched for SIF stability square deviation (RMSD) to the design model. In the design
and affinity were included in combinatorial libraries, which model, side chain rotamers in the hydrophobic core match
were sorted under similar conditions as the SSMs, each suc- those of one or both chains of the crystal structure, while ro-
cessive selection increasing the SIF incubation time or con- tamers of surface residues show greater deviation from the
centration of proteases, or decreasing the concentration crystal structure. The geometry of the disulfide bonds in the
of labeled IL-23R. Combinatorial variants most enriched in design model matches one (C31–C40) or both (C12–C21)
the final sort per library, as well as several variants hand- chains of the crystal structure. Size exclusion high performance
selected based on SSM data incorporating one to three of liquid chromatography (SE-HPLC) and liquid chromatography-
the most enriching mutations, were expressed and character- mass spectrometry (LC-MS) analyses confirmed that 23R-91
ized in vitro. is monomeric in solution and has the expected molecular
The best stability-optimized variants, 23R-72 and 23R-91, weight (Figures S4F and S4H).
showed significant improvement in SIF resistance (Figure 4A)
and maintained or improved potency (Figures 2A and 2B). Connecting two hIL-17A-binding domains with a flexible
23R-72 includes three hand-picked mutations (M1P, R8Q, peptide linker increases potency 2,800-fold through
and K35W) that were highly enriched in the SIF-treated SSM avidity
of 23R-64, and together improved SIF t1/2 from approximately We sought to further improve the potency of the hIL-17A mini-
30 min (23R-64) to 4–24 h (23R-72), on par with that of V565, binder by connecting two copies of 17-51 with a flexible peptide
an oral anti-TNF-a nanobody in clinical development for IBD linker to avidly bind the hIL-17A cytokine homodimer at both
(Sorriso Pharmaceuticals) used as a positive control in this symmetric binding sites. The best single-chain minibinder dimer
assay (Figure 4A). The mutations also modestly improved SGF (17-53) has much higher affinity (low picomolar with an extremely
stability. SDS PAGE shows a small decrease in the molecular slow dissociation rate [Figure 3B]) than the low nanomolar
Cell 187, 1–13, August 8, 2024 7

ll
OPEN ACCESS Article
monomer 17-51 (Figure S1). 17-53 shows a 2,800-fold increase competing IL-23R antagonist peptide PTG-200 (Protagonist
in potency compared with the minibinder monomer (17-51) and Therapeutics/Janssen; Figure S6B). However, 23R-101 is 30
60,000-fold increase compared with the parent computational times less potent than the best 7–8 kDa minibinder, 23R-91,
design (17-2; Figure 3A). 17-53 is 200- and 4-fold more potent and would therefore need to reach concentrations at least 30
in blocking hIL-17A-mediated signaling than clinical mAbs secu- times that of 23R-91 in target tissues to achieve similar efficacy.
kinumab and bimekizumab, respectively. The linked construct We therefore prioritized the 7–8 kDa minibinders for further
with the shortest linker, 17-52 [linker (GS)10], showed weaker po- in vitro and in vivo characterization.
tency than constructs with longer linkers 17-53 [(PAS)8], 17-54 These results suggest a general strategy for peptide therapeu-
[(PAS)12], and 17-55 [(PAS)20], which may indicate that there is tic discovery: design of larger, high-affinity minibinders followed
a minimum linker length for sterically unhindered engagement by grafting of critical binding residues or motifs onto smaller,
of both hIL-17A homodimer binding sites (Figure S2B). 17-51 structured peptide scaffolds.
and 17-53 show significantly weaker inhibition of mouse IL-
17A than the human homolog (Figure S2E). Minibinders block IL-23- or IL-17-mediated
17-53 is highly specific to homodimeric hIL-17A, showing inflammation in primary cell culture and human
negligible inhibition of hIL-17F- or hIL-17A/F-mediated cell organoids
signaling (Figure 3A). The monomer (17-51) and dimer fusion Next we determined whether the minibinders could block IL-
(17-53) minibinders block the hIL-17A/F heterodimeric cytokine 23- or IL-17A-mediated cell signaling in in vitro systems that
with similar relatively weak potency, indicating that the 17-51 mimic the target in vivo environments. IL-23 and IL-17A antag-
binding domain likely only binds weakly to one of the two asym- onists are used to treat a variety of autoimmune indications,
metric receptor binding sites of hIL-17A/F. Neither 17-51 nor 17- including IBD (IL-23 only) and psoriasis (IL-17A and IL-23).
53 bind to homodimeric hIL-17F. As the hIL-17F homodimeric IBD is characterized by intestinal injury driven by local inflam-
cytokine is also a clinically relevant target, we screened the matory processes in the intestinal lamina propria (LP). 23R-91
hIL-17A minibinder combinatorial libraries for cross-reactivity efficiently blocked IL-23-mediated cell signaling in cell sus-
with hIL-17F, and hits were further optimized for affinity and pensions from the colon LP and nearby mesenteric lymph no-
specificity to hIL-17F by in vitro evolution. The most potent des (mLNs) that were isolated from healthy rats and stimulated
hIL-17F inhibitor, 17-40, blocks hIL-17F-mediated signaling ex vivo with anti-CD3 and recombinant rat IL-23 (Figure 6A).
with potency 300-fold greater than hIL-17A-specific minibinder The minibinder also blocked signaling in rat splenocytes (Fig-
17-51, 3-fold greater than secukinumab and 1,000-fold worse ure 6A). Similarly, IL-23R minibinders blocked IL-23-mediated
than bimekizumab (Figure 3A). signaling in primary human CD4+ T cells (Figure 6B).
Psoriasis is characterized by skin inflammation, and therefore
3–4 kDa peptide inhibitors of IL-23R are structured and we used organoids generated from human skin epithelium to
block IL-23-mediated cell signaling study the effect of IL-17A minibinder 17-51. Organoids were
Drug molecular weight influences intestinal permeability and tis- cultured and stimulated with recombinant human IL-17A
sue diffusivity, so we sought to reduce the size of the 7–8 kDa IL- (15 nM). Minibinder 17-51 (75 nM) was added to culture media
23R minibinders to ultimately increase the concentration of the simultaneously with IL-17A, or 1 or 3 h after addition of IL-17A.
drug at the site of action after oral administration. Design models After overnight incubation, organoids were analyzed by qPCR
of the highest affinity 7–8 kDa minibinders were used to seed for downstream markers CCL20, CXCL8 (IL-8), and S100A7.
computational design of 3–4 kDa variants. A small fragment of Minibinder 17-51 significantly inhibited production of down-
the 7–8 kDa minibinder central binding helix, including the native stream markers in all conditions (Figure 6C).
Trp hotspot and de novo hotspots, was isolated and then grafted
onto 26–32 residue structurally validated peptide scaffolds.12 IL-23R minibinders reach therapeutically relevant
Designs were filtered using the same computational metrics as concentrations in the GI and serum after oral
in the minibinder design workflow described above, and genes administration in rats
encoding the top 3,883 were synthesized and transformed into The integrity of the intestinal barrier is likely to impact the phar-
yeast for surface display and selected for binding to labeled IL- macokinetics (PK) of oral protein therapies. In IBD patients with
23R, with or without pre-incubation in SIF. active disease, the barrier is disrupted and more permeable,
SSM analysis of the three most enriched designs, 26-residue while patients in remission have a more intact, less permeable
EEH folds with two stabilizing disulfides, demonstrate they are barrier. To support the use of oral IL-23R minibinders as induc-
likely folded and bind via the designed interface (Figure S6A). tion therapy for IBD patients with active disease, as well as main-
Residues in the hydrophobic core, at the binding interface, tenance therapy for patients in remission, we studied the
and cysteines designed to form disulfide bonds are conserved, behavior of 23R-72 and 23R-91 in rats with an intestinal barrier
while surface positions distal to the binding interface are not disrupted by intrarectal treatment with 2,4,6-trinitrobenzen sul-
conserved. We generated combinatorial libraries, including fonic acid (TNBS) and in rats with a healthy, intact intestinal bar-
SSM mutants favoring high-affinity binding and stability, and rier. Rats were used to capture target-mediated drug deposition,
screened them as described above for binding to IL-23R after as the IL-23R minibinders cross-react with rat but not mouse IL-
SIF treatment. The most enriched variants were chemically syn- 23R (Figures S7C and S7D).
thesized and characterized. The best 26-residue IL-23R mini- In healthy rats, 6 h after a single 20 mg/kg oral dose, mini-
binder, 23R-101 (3.2 kDa) is 40 times more potent than a binder concentration was measured in the intestinal tissues
8 Cell 187, 1–13, August 8, 2024

ll
Article OPEN ACCESS
Figure 6. IL-23R and IL-17 minibinders block

cell signaling in primary cells and organoids
derived from human skin cells
(A) Cell suspensions were prepared from the colon,
mLN, and spleen of healthy rats, then stimulated
with anti-CD3 and rIL-23 (1 mg/mL for colon,
10 ng/mL for mLN and spleen), with or without
minibinder 23R-91 (100 nM). After 24 h incubation,
IL-17A was measured in culture supernatants with
ELISA. Anti-CD3 only treatment served as a control
showing the extent of IL-23-independent IL-17A
production, which is not expected to be inhibited by
23R-91. Mean values ± SD are shown (n = 3 repli-
cates per stimulation condition per N = 2 indepen-
dent experiments).
(B) IL-23R minibinders block IL-23 signaling in pri-
mary human CD4+ T cells with low nanomolar IC50s.
Cells were stimulated with recombinant IL-23 with
or without a titration of each minibinder for 20 min,
and stained for CD4 and phosphorylated STAT3.
Mean fluorescence intensity (MFI) of pSTAT3 in
CD4+ cells was measured by flow cytometry. Mean
values ± SD are shown (n = 3).
(C) Human epithelial organoids were treated with IL-
17A (15 nM) with or without minibinder 17-51
(75 nM) and analyzed by qPCR for downstream markers CCL20, CXCL8 (IL-8), and S100A7. Gene expression data were normalized to housekeeping gene
HPRT1. Fold change was calculated relative to an untreated control group and is presented as a percent of the response seen with IL-17A-only treatment. Three
organoids per stimulation condition were pooled for qPCR analysis in triplicate (n = 3) in each of two independent experiments with unique donors (N = 2). Mean
values ± SD are shown.
and contents, mLN, or serum using a custom ELISA method. The observed absorption of minibinders compares favorably to
Minibinders were detected at 50–100 nM in the small intestinal that of other oral biologic modalities. Antibodies are generally too
contents and not in colon contents, and detected at higher large (203 the size of minibinders) and susceptible to degrada-
concentrations in the small intestinal tissue (40–200 nM) than tion in GI conditions to achieve therapeutic concentrations at a
colon tissue (2–20 nM), consistent with known transit times in reasonable oral dose without sophisticated formulation27,28 or de-
rats (Figure 4C; Table S5).26 Formulation in GI-protective livery technologies.29–31 Oral nanobodies and peptides engi-
vehicle (GPV; 0.1 M sodium bicarbonate, 200 mg/mL nonfat neered for GI stability have shown similar tissue and serum con-
dry milk) did not significantly impact minibinder concentration centrations as our oral minibinders in preclinical studies. Low to
in contents or tissues; both minibinders appear to be equally mid-nanomolar V565 nanobody (13 kDa) was detected 7 h after
resistant to GI proteases in vivo. Minibinders were not detected a liquid oral dose of 5–10 mg/kg in colon contents of both healthy
in serum at this dose in healthy rats. After a higher single oral and TNBS mice and in the serum of TNBS (but not healthy) mice,
dose (140 mg/kg) in healthy rats, 23R-91 was present at a con- and in the serum of two out of three healthy monkeys dosed by
centration of 73 nM in serum 15 min after dose, after which V565 tablet at 40 mg/kg.32,33 Control nanobodies not engineered
serum concentration decreased rapidly with a half-life of for GI stability were quickly degraded in GI fluids in vitro and were
approximately 15 min, falling near or below the limit of detec- not studied in vivo. Low- to mid-nanomolar anti-IL-23R peptides
tion from 3 to 24 h (Figure 4D). Minibinder was not measured (1.5–3 kDa) have also been detected 6 h after a single oral dose
in tissues in this study. of 10 mg/kg in the colon and intestinal tissue, and occasionally
In TNBS rats, 23R-72 was administered by oral gavage, and in the serum, of healthy rats, and a phase 1 trial with IL-23R pep-
23R-91 was injected via catheter directly into the cecum, tide JNJ-77242113 demonstrated peak serum concentrations of
mimicking colonic release formulation. After 9 days of up to 10 nM in healthy volunteers.34,35 Engineered nanobodies,
20 mg/kg three times daily (TID) dosing, rats were sacrificed peptides, and minibinders are all capable of reaching low- to
6 h after the last dose and tissues and serum analyzed for mini- mid-nanomolar concentrations in target tissues and serum at
binder with ELISA. Generally, both minibinders reached low similar oral doses; whether these concentrations are adequate
nanomolar concentrations in GI tissues and demonstrated low for therapy, however, depends on the potency of the molecule.
systemic bioavailability after oral or intracecal administration, Continuous inhibition of IL-23R over time requires that the
with concentrations near the limit of detection of the assay drug reaches an initial concentration that saturates the target
(1–5 nM) in mLN or serum (Table S5). GI tissue concentrations and the subsequent maintenance of saturation over time. Li-
observed in TNBS rats are generally lower than observed in gands theoretically reach 99% saturation of the target at con-
healthy rats; in IBD and preclinical models of colitis, GI transit centrations 1003 the equilibrium dissociation constant (KD) of
time is accelerated relative to a healthy GI, which decreases resi- the ligand:target interaction; with KD < 1 pM, 23R-91 would reach
dence time and could therefore decrease uptake. 99% saturation at <100 pM.36 In our preclinical studies, 23R-91
Cell 187, 1–13, August 8, 2024 9

ll
OPEN ACCESS Article
A Figure 7. Evaluation of 23R-91 in the NSG-IBD

humanized mouse model of colitis
(A) NSG-IBD study design and schematic. N R 5
animals per group in at least 2 independent studies
per condition.
(B) On the last day of the study, each animal was
assigned a clinical score of overall health. At sacri-
fice, the colon was dissected and assigned a
macroscopic score of inflammation, then prepared
for histology to assess microscopic features of
inflammation and fibrosis. Scores are plotted as
mean ± SD. Treatment groups were compared with
challenged control using non-parametric Wilcoxon
matched-pair tests (ns = no significance, *p < 0.033,
**p < 0.002, 95% confidence interval).
B
See Table S6 for scoring matrices.
Oral IL-23R minibinder is as effective

as clinical mAb in a humanized
mouse model of colitis
We compared the efficacy of oral 23R-91
to systemically administered guselkumab,
a mAb in phase 3 clinical trials for ulcerative
colitis and Crohn’s disease, in a humanized mouse model of co-
reaches concentrations orders of magnitude higher than 100 pM litis (Figure 7A). In this model, NOD/SCID/IL2rgnull (NSG) mice
in target tissues and serum. When the drug is cleared over time deficient in T, B, and natural killer (NK) cells were reconstituted
and the free drug concentration goes below the target-saturating with peripheral blood mononuclear cells (PBMCs) from patients
concentration, maintenance of IL-23R inhibition depends on the with IBD.43 In NSG-IBD mice, cells expressing IL-23 and IL-23R
minibinder:target complex half-life and receptor recycling. The are primarily human-derived, allowing us to study 23R-91, which
extremely slow dissociation rate of 23R-91 measured by SPR binds human IL-23R but not the mouse homolog (Figures S7C
(<1 3 105 s1) corresponds to a 23R-91:IL-23R complex half- and S7D), and a competing clinical (human-targeted) mAb. After
life of >19 h,37 meaning IL-23R remains inhibited by 23R-91 for engraftment of human PBMCs (day 1), mice were challenged
hours after free drug is cleared. We expect 23R-91 to block IL- with intrarectal ethanol on days 7 and 14 to induce colitis. 23R-
23R recycling, which is induced by interaction with IL-23.38 As 91 (8 or 80 mg/kg) was administered once daily by oral gavage
free 23R-91 is quickly cleared from the blood (Figure 4D), on days 6, 7, and 13–17. Guselkumab (4 mg/kg) was adminis-
measuring target engagement over time will further inform the tered by intraperitoneal (i.p.) injection on days 6 and 13. On
development of a clinical formulation and dose regimen that re- day 18, animals were sacrificed, and study endpoints assessed,
sults in continuous IL-23R blockade. including a clinical score of overall health, colon macroscopic
score of inflammation, and colon histopathology (scoring
23R-91 has low predicted immunogenicity matrices Table S6; study schematic Figure 7A).
Immunogenicity is an important consideration for any protein ther- Oral 23R-91 at both 8 and 80 mg/kg showed statistically sig-
apeutic. We hypothesize that the general high stability and solubi- nificant improvement in disease scores compared with un-
lity of engineered proteins reduces uptake, digestion to frag- treated control and a numerically greater improvement than i.p.
ments, and subsequent presentation of fragments by major guselkumab (Figure 7B). As expected, colon fibrosis was not
histocompatibility complex (MHC) class II in antigen presenting significantly reduced by any treatment. These data demonstrate
cells, thereby reducing immunogenicity. Several designed pro- that oral 23R-91, a 7 kDa protein, reaches sufficient concentra-
teins have generated very low or undetectable levels of anti-mini- tions in target tissues beyond the gut epithelial barrier to impact
binder IgG after repeated systemic dosing in mice14–16 and disease. This is the first demonstration that a once-daily oral pro-
repeated oral dosing in humans.39 A systemically administered tein drug can achieve efficacy in a model of colitis; however, we
de novo-designed IL-2 mimic did not elicit a strong anti-drug note that a competing oral anti-IL-23R peptide, JNJ-2113,
response in human clinical trials.40 23R-91 is highly soluble (Fig- recently demonstrated efficacy in a rat model of colitis with an
ure S4G), a characteristic associated with low immunogenicity.41 unknown dose regimen and clinical efficacy in psoriasis with
As demonstrated above, 23R-91 is stable at low pH and resistant once- or twice-daily dosing.35,44
to proteases with diverse recognition sequences, and is therefore An oral dose of 8 mg/kg is clinically feasible, corresponding to
unlikely to be efficiently digested to fragments upon endocytosis. a human of average weight (65 kg) taking a pill with 520 mg active
If some degree of uptake and digest do occur, 23R-91 fragments ingredient. Although 20, 80, and 140 mg/kg doses used here in
have low predicted binding affinity to a variety of MHC class II mol- PK and efficacy studies are near or beyond the limit of clinical
ecules, which is associated with low immunogenicity (Table S7).42 feasibility, similar uptake can likely be achieved at lower mg/kg
10 Cell 187, 1–13, August 8, 2024

ll
Article OPEN ACCESS
doses by using a clinical solid oral dosage form (tablet or B Data and code availability
capsule) that increases local lumenal drug concentration d EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS
B Cell culture
compared with the relatively dilute, high-volume liquid doses
B Rodent models
formulated simply in PBS used herein. Common polymer coat- d METHOD DETAILS
ings for tablets or capsules that enable site-specific release in B Computational design
the desired GI compartment could further concentrate the drug B Yeast library preparation
at the site of optimal uptake. B Fluorescence-activated cell sorting (FACS)

B Deep mutational scanning
B Protein expression and purification
Conclusions B Size exclusion high performance liquid chromatography (SE-HPLC)
Here, we demonstrate the potential of de novo-designed pro- B Liquid chromatography-mass spectrometry (LC-MS)
teins as oral therapeutics for blocking TH17-mediated inflamma- B Circular dichroism
tion. Our designed 7 kDa IL-23R minibinder has antibody-like po- B Biolayer interferometry and surface plasmon resonance
tency and extreme resistance to heat, acid, and proteolysis, and B Simulated gastrointestinal fluids digest
B X-ray crystallography
our IL-17A minbinder has 200-fold greater potency than the clin-
B IL-23 reporter in vitro signaling assay
ical mAb secukinumab and prevents IL-17A-mediated inflamma-
B IL-17 reporter in vitro signaling assay
tory signaling in human epithelial organoids. The orally adminis- B Human PBMC in vitro IL-23 signaling assay
tered IL-23R minibinder is effective in a mouse model of colitis B ELISA method for detection of IL-23R minibinders
with a clinically relevant dosing scheme (8 mg/kg once daily), B Ex vivo rat tissue signaling assay
and reaches concentrations likely to saturate IL-23R in the serum B Pharmacokinetics and biodistribution of IL-23R minibinders in rats
B Human skin-derived epithelial organoid culture
and intestinal tissues of healthy and TNBS rats after oral admin-
B NSG-IBD humanized mouse model of colitis
istration. Although 23R-91 is quickly cleared from the blood, its
B Immunogenicity prediction
extremely high affinity and slow dissociation rate may enable d QUANTIFICATION AND STATISTICAL ANALYSIS
continuous target saturation with convenient, once-daily oral
dosing without engineering for serum half-life extension. The
SUPPLEMENTAL INFORMATION
large size of antibodies compared with minibinders limits effi-
cient penetration of the gut epithelial barrier and diffusion into Supplemental information can be found online at https://doi.org/10.1016/j.cell.
target tissues, and peptides generally must incorporate chemis- 2024.05.052.
tries that are not genetically encodable to confer GI resistance,
resulting in expensive manufacturing. Minibinders such as our ACKNOWLEDGMENTS
IL-23R binder combine the advantages of small size for diffusion
Funding for this research was provided by the Washington Research Founda-
into target tissues with high stability, affinity, and genetic encod-
tion Translational Research Grants (S.B., F.S., L.A., C.S., A.B., and D.B.), the
ability and are thus attractive candidates for development as oral Center for Washington Entrepreneurial Research Evaluation & Commercializa-
biologics. tion Hub (WE-REACH; S.B. and L.A.), The Audacious Project at the Institute for
Protein Design (L.C., R.R., M.M., and D.B.), and the Howard Hughes Medical
Limitations of the study Institute (D.B.). This research was also supported by Mopac Biologics, Inc.
Crystallographic diffraction data were collected at the Northeastern Collabora-
Although minibinder 23R-91 showed efficacy in the NSG-IBD
tive Access Team beamlines at the Advanced Photon Source, which are
model of colitis with once-daily oral dosing, free 23R-91 is
funded by the National Institute of General Medical Sciences from the National
quickly cleared from the blood after oral administration. Further Institutes of Health (P30 GM124165). This research used resources of the
investigation and development will be necessary to explore the Advanced Photon Source, a US Department of Energy (DOE) Office of Science
use of oral minibinders for GI and non-GI indications in which User Facility operated by Argonne National Laboratory under contract no. DE-
sustained extraintestinal inhibition of IL-23R is desired. High AC02-06CH11357. The NYULH Center for Biospecimen Research and Devel-
doses of minibinders were used in both PK and efficacy studies. opment and the Histology and Immunohistochemistry Laboratory are sup-
ported in part by the Laura and Isaac Perlmutter Cancer Center Support Grant:
Solid oral dosage forms that enrich lumenal minibinder concen-
NIH/NCI P30 CA016087 (D.R., L.G.-M., and S.N.).
trations at the site of optimal uptake and can thereby decrease
the required dose should be evaluated in preclinical species to AUTHOR CONTRIBUTIONS
support the clinical use of oral minibinders. We have not demon-
strated in vivo efficacy of the IL-17 minibinders; these additional S.B., F.S., T.-Y.Y., H.Y., D.R., L.G.-M., C.G., C.S., R.R., M.M., A.K., and A.K.B.
studies will bolster the generality of minibinders as an oral bio- designed and performed experiments. M. Aydin, L.A., A.B., and M. Ahlrichs
logic modality. performed experiments. S.B. prepared the original draft of the manuscript.
All authors reviewed the manuscript. S.B., L.C., I.S.P., K.C.G., S.N., J.S.,
F.B., M.S., R.G., and D.B. supervised research. S.B., L.S., and D.B. secured
STAR+METHODS
funding.
Detailed methods are provided in the online version of this paper and include
the following: DECLARATION OF INTERESTS
d KEY RESOURCES TABLE S.B., T.-Y.Y., I.S.P., L.S., and D.B. are co-founders and shareholders of Mopac
d RESOURCE AVAILABILITY Biologics, Inc. S.B., F.S., T.-Y.Y., and D.B. are co-inventors on a patent
B Lead contact describing the IL-23R minibinders (PCT/US2021/039122), licensed to Mopac
B Materials availability Biologics. S.B. is a board member and paid consultant of Mopac Biologics.
Cell 187, 1–13, August 8, 2024 11

ll
OPEN ACCESS Article
Received: December 4, 2023 15. Silva, D.-A., Yu, S., Ulge, U.Y., Spangler, J.B., Jude, K.M., Labão-Almeida,
Revised: April 9, 2024 C., Ali, L.R., Quijano-Rubio, A., Ruterbusch, M., Leung, I., et al. (2019). De
Accepted: May 29, 2024 novo design of potent and selective mimics of IL-2 and IL-15. Nature 565,
Published: June 26, 2024 186–191. https://doi.org/10.1038/s41586-018-0830-7.
16. Case, J.B., Chen, R.E., Cao, L., Ying, B., Winkler, E.S., Johnson, M., Gor-
REFERENCES eshnik, I., Pham, M.N., Shrihari, S., Kafai, N.M., et al. (2021). Ultrapotent
miniproteins targeting the SARS-CoV-2 receptor-binding domain protect
1. Feagan, B.G., Sandborn, W.J., Gasink, C., Jacobstein, D., Lang, Y., Fried- against infection and disease. Cell Host Microbe 29, 1151–1161.e5.
man, J.R., Blank, M.A., Johanns, J., Gao, L.-L., Miao, Y., et al. (2016). Uste- https://doi.org/10.1016/j.chom.2021.06.008.
kinumab as induction and maintenance therapy for Crohn’s disease. N. Engl. 17. Vignali, D.A.A., and Kuchroo, V.K. (2012). IL-12 family cytokines: immuno-
J. Med. 375, 1946–1960. https://doi.org/10.1056/NEJMoa1602773. logical playmakers. Nat. Immunol. 13, 722–728. https://doi.org/10.1038/
2. Sands, B.E., Sandborn, W.J., Panaccione, R., O’Brien, C.D., Zhang, H., ni.2366.
Johanns, J., Adedokun, O.J., Li, K., Peyrin-Biroulet, L., Van Assche, G., 18. Glassman, C.R., Mathiharan, Y.K., Jude, K.M., Su, L., Panova, O., Lupar-
et al. (2019). Ustekinumab as induction and maintenance therapy for ulcer- dus, P.J., Spangler, J.B., Ely, L.K., Thomas, C., Skiniotis, G., et al. (2021).
ative colitis. N. Engl. J. Med. 381, 1201–1214. https://doi.org/10.1056/ Structural basis for IL-12 and IL-23 receptor sharing reveals a gateway for
NEJMoa1900750. shaping actions on T versus NK cells. Cell 184, 983–999.e24. https://doi.
3. Yang, H., Li, B., Guo, Q., Tang, J., Peng, B., Ding, N., Li, M., Yang, Q., org/10.1016/j.cell.2021.01.018.
Huang, Z., Diao, N., et al. (2022). Systematic review with meta-analysis: 19. Cua, D.J., Sherlock, J., Chen, Y., Murphy, C.A., Joyce, B., Seymour, B.,
loss of response and requirement of ustekinumab dose escalation in in- Lucian, L., To, W., Kwan, S., Churakova, T., et al. (2003). Interleukin-
flammatory bowel diseases. Aliment. Pharmacol. Ther. 55, 764–777. 23 rather than interleukin-12 is the critical cytokine for autoimmune
https://doi.org/10.1111/apt.16802. inflammation of the brain. Nature 421, 744–748. https://doi.org/10.1038/
4. Roblin, X., Duru, G., Papamichael, K., Cheifetz, A.S., Kwiatek, S., Berger, nature01355.
A.-E., Barrau, M., Waeckel, L., Nancey, S., and Paul, S. (2023). Develop- 20. Kikly, K., Liu, L., Na, S., and Sedgwick, J.D. (2006). The IL-23/Th(17) axis:
ment of antibodies to ustekinumab is associated with loss of response therapeutic targets for autoimmune inflammation. Curr. Opin. Immunol.
in patients with inflammatory bowel disease. J. Clin. Med. 12, 3395. 18, 670–675. https://doi.org/10.1016/j.coi.2006.09.008.
https://doi.org/10.3390/jcm12103395.
21. Fleishman, S.J., Whitehead, T.A., Ekiert, D.C., Dreyfus, C., Corn, J.E.,
5. Janssen Biotech, Inc. (2016). Stelara (ustekinumab) [package insert]. Strauch, E.-M., Wilson, I.A., and Baker, D. (2011). Computational design
www.accessdata.fda.gov/drugsatfda_docs/label/2016/761044lbl.pdf. of proteins targeting the conserved stem region of influenza hemaggluti-
6. Shah, D.K., and Betts, A.M. (2013). Antibody biodistribution coefficients: nin. Science 332, 816–821. https://doi.org/10.1126/science.1202617.
inferring tissue concentrations of monoclonal antibodies based on the 22. Berger, S., Procko, E., Margineantu, D., Lee, E.F., Shen, B.W., Zelter, A.,
plasma concentrations in several preclinical species and human. mAbs Silva, D.-A., Chawla, K., Herold, M.J., Garnier, J.-M., et al. (2016). Compu-
5, 297–305. https://doi.org/10.4161/mabs.23684. tationally designed high specificity inhibitors delineate the roles of BCL2
7. U.S. Food and Drug Administration (2019). Xeljanz, Xeljanz XR family proteins in cancer. eLife 5, e20352. https://doi.org/10.7554/eL-
(tofacitinib): drug Safety Communication. https://www.fda.gov/safety/ ife.20352.
medical-product-safety-information/xeljanz-xeljanz-xr-tofacitinib-drug- 23. Cao, L., Coventry, B., Goreshnik, I., Huang, B., Sheffler, W., Park, J.S.,
safety-communication-due-increased-risk-blood-clots-and-death. Jude, K.M., Markovic , I., Kadam, R.U., Verschueren, K.H.G., et al.
8. Drakos, A., Torres, T., and Vender, R. (2024). Emerging oral therapies for (2022). Design of protein-binding proteins from the target structure alone.
the treatment of psoriasis: a review of pipeline agents. Pharmaceutics Nature 605, 551–560. https://doi.org/10.1038/s41586-022-04654-9.
16, 111. https://doi.org/10.3390/pharmaceutics16010111. 24. Linsky, T., Noble, K., Tobin, A., Crow, R., Carter, L., Urbauer, J., Baker, D.,
9. Warren, R.B. (2023). DC-806, an oral IL-17A inhibitor: proof-of-concept in and Strauch, E.M. (2021). Sampling of structure and sequence space of
adults with mild to moderate psoriasis. In AAD Annual Meeting. March 17– small protein folds. Preprint at bioRxiv. https://doi.org/10.1101/2021.03.
21, 2023 (New Orleans). 10.434454.
10. Linsky, T.W., Noble, K., Tobin, A.R., Crow, R., Carter, L., Urbauer, J.L., 25. Tobin, A.R., Crow, R., Urusova, D.V., Klima, J.C., Tolia, N.H., and Strauch,
Baker, D., and Strauch, E.-M. (2022). Sampling of structure and sequence E.-M. (2023). Inhibition of a malaria host-pathogen interaction by a compu-
space of small protein folds. Nat. Commun. 13, 7151. https://doi.org/10. tationally designed inhibitor. Protein Sci. 32, e4507. https://doi.org/10.
1038/s41467-022-34937-8. 1002/pro.4507.
11. Rocklin, G.J., Chidyausiku, T.M., Goreshnik, I., Ford, A., Houliston, S., Le- 26. Dalziel, J.E., Young, W., Bercik, P., Spencer, N.J., Ryan, L.J., Dunstan,
mak, A., Carter, L., Ravichandran, R., Mulligan, V.K., Chevalier, A., et al. K.E., Lloyd-West, C.M., Gopal, P.K., Haggarty, N.W., and Roy, N.C.
(2017). Global analysis of protein folding using massively parallel design, (2016). Tracking gastrointestinal transit of solids in aged rats as pharmaco-
synthesis, and testing. Science 357, 168–175. https://doi.org/10.1126/sci- logical models of chronic dysmotility. Neurogastroenterol. Motil. 28, 1241–
ence.aan0693. 1251. https://doi.org/10.1111/nmo.12824.
12. Bhardwaj, G., Mulligan, V.K., Bahl, C.D., Gilmore, J.M., Harvey, P.J., Che- 27. Dodoo, C.C., Wang, J., Basit, A.W., Stapleton, P., and Gaisford, S. (2017).
neval, O., Buchko, G.W., Pulavarti, S.V.S.R.K., Kaas, Q., Eletsky, A., et al. Targeted delivery of probiotics to enhance gastrointestinal stability and in-
(2016). Accurate de novo design of hyperstable constrained peptides. Na- testinal colonisation. Int. J. Pharm. 530, 224–229. https://doi.org/10.1016/
ture 538, 329–335. https://doi.org/10.1038/nature19791. j.ijpharm.2017.07.068.
13. Cao, L., Goreshnik, I., Coventry, B., Case, J.B., Miller, L., Kozodoy, L., 28. Maurer, J.M., Hofman, S., Schellekens, R.C.A., Tonnis, W.F., Dubois,
Chen, R.E., Carter, L., Walls, A.C., Park, Y.-J., et al. (2020). De novo design A.O.T., Woerdenbag, H.J., Hinrichs, W.L.J., Kosterink, J.G.W., and Frijlink,
of picomolar SARS-CoV-2 miniprotein inhibitors. Science 370, 426–431. H.W. (2016). Development and potential application of an oral ColoPulse
https://doi.org/10.1126/science.abd9909. infliximab tablet with colon specific release: A feasibility study. Int. J.
14. Chevalier, A., Silva, D.-A., Rocklin, G.J., Hicks, D.R., Vergara, R., Murapa, Pharm. 505, 175–186. https://doi.org/10.1016/j.ijpharm.2016.03.027.
P., Bernard, S.M., Zhang, L., Lam, K.-H., Yao, G., et al. (2017). Massively 29. Abramson, A., Frederiksen, M.R., Vegge, A., Jensen, B., Poulsen, M.,
parallel de novo protein design for targeted therapeutics. Nature 550, Mouridsen, B., Jespersen, M.O., Kirk, R.K., Windum, J., Hubálek, F.,
74–79. https://doi.org/10.1038/nature23912. et al. (2022). Oral delivery of systemic monoclonal antibodies, peptides
12 Cell 187, 1–13, August 8, 2024

ll
Article OPEN ACCESS
and small molecules using gastric auto-injectors. Nat. Biotechnol. 40, clear cells from patients with Crohn’s disease reflect the human patholog-
103–109. https://doi.org/10.1038/s41587-021-01024-0. ical phenotype. Immun. Inflam. Dis. 9, 1631–1647. https://doi.org/10.
30. Dhalla, A.K., Al-Shamsie, Z., Beraki, S., Dasari, A., Fung, L.C., Fusaro, L., 1002/iid3.516.
Garapaty, A., Gutierrez, B., Gratta, D., Hashim, M., et al. (2022). A robotic 44. Bissonnette, R., Pinter, A., Ferris, L.K., Gerdes, S., Rich, P., Vender, R.,
pill for oral delivery of biotherapeutics: safety, tolerability, and perfor- Miller, M., Shen, Y.-K., Kannan, A., Li, S., et al. (2024). An oral inter-
mance in healthy subjects. Drug Deliv. Transl. Res. 12, 294–305. https:// leukin-23-receptor antagonist peptide for plaque psoriasis. N. Engl. J.
doi.org/10.1007/s13346-021-00938-1. Med. 390, 510–521. https://doi.org/10.1056/NEJMoa2308713.
31. Lee, S.N., Stork, C., Valenzuela, R., Walker, M., Smith, B., Smith, J., Quin- 45. Kabsch, W. (2010). XDS. Acta Crystallogr. D 66, 125–132. https://doi.org/
tana, N., Wahl, C., and Singh, S. (2023). Evaluation of the pharmacoki- 10.1107/S0907444909047337.
netics of glucagon-like-peptide-1 (GLP-1) receptor agonist delivered 46. Emsley, P., and Cowtan, K. (2004). Coot: model-building tools for molec-
through the BioJet oral biotherapeutic delivery platform in a porcine ular graphics. Acta Crystallogr. D 60, 2126–2132. https://doi.org/10.1107/
model. In 59th Annual Meeting of the European Association for the Study S0907444904019158.
of Diabetes, October 2–6, 2023, Hamburg, Germany.
47. Williams, C.J., Headd, J.J., Moriarty, N.W., Prisant, M.G., Videau, L.L.,
32. Crowe, J.S., Roberts, K.J., Carlton, T.M., Maggiore, L., Cubitt, M.F., Clare, Deis, L.N., Verma, V., Keedy, D.A., Hintze, B.J., Chen, V.B., et al. (2018).
S., Harcourt, K., Reckless, J., MacDonald, T.T., Ray, K.P., et al. (2018). MolProbity: more and better reference data for improved all-atom structure
Preclinical development of a novel, orally-administered anti-tumour necro- validation. Protein Sci. 27, 293–315. https://doi.org/10.1002/pro.3330.
sis factor domain antibody for the treatment of inflammatory bowel dis-
48. McCoy, A.J., Grosse-Kunstleve, R.W., Adams, P.D., Winn, M.D., Storoni,
ease. Sci. Rep. 8, 4941. https://doi.org/10.1038/s41598-018-23277-7.
L.C., and Read, R.J. (2007). Phaser crystallographic software. J. Appl.
33. Nurbhai, S., Roberts, K.J., Carlton, T.M., Maggiore, L., Cubitt, M.F., Ray,
Crystallogr. 40, 658–674. https://doi.org/10.1107/S0021889807021206.
K.P., Reckless, J., Mohammed, H., Irving, P., MacDonald, T.T., et al.
(2019). Oral anti-tumour necrosis factor domain antibody V565 provides 49. Kabsch, W. (2010). XDS. Acta Crystallogr D. Biol Crystallogr 66, 125–132.
high intestinal concentrations, and reduces markers of inflammation in ul- 50. Procko, E., Hedman, R., Hamilton, K., Seetharaman, J., Fleishman, S.J.,
cerative colitis patients. Sci. Rep. 9, 14042. https://doi.org/10.1038/ Su, M., Aramini, J., Kornhaber, G., Hunt, J.F., Tong, L., et al. (2013).
s41598-019-50545-x. Computational design of a protein-based enzyme inhibitor. J. Mol. Biol.
34. Bhandari, A., Bourne, G., Cheng, X., Frederick, B.T., Zhang, J., Patel, D.V., 425, 3563–3575. https://doi.org/10.1016/j.jmb.2013.06.035.
and Liu, D. (2020). Peptide inhibitors of interleukin-23 receptor and their 51. Chao, G., Lau, W.L., Hackel, B.J., Sazinsky, S.L., Lippow, S.M., and
use to treat inflammatory diseases. US Patent 10787490B2. Wittrup, K.D. (2006). Isolating and engineering human antibodies using
35. Fourie, A., Cheng, X., Change, L., Greving, C., Patrick, A., Knight, B., Po- yeast surface display. Nat. Protoc. 1, 755–768. https://doi.org/10.1038/
lidori, D., Patch, R., Bhandari, A., Liu, D., et al. (2023). First-in-class oral nprot.2006.94.
peptide systemically targeting the IL-23 pathway. In International Soci- 52. Maguire, J.B., Haddox, H.K., Strickland, D., Halabiya, S.F., Coventry, B.,
eties for Investigative Dermatology Meeting, May 10–13, 2023, To- Griffin, J.R., Pulavarti, S.V.S.R.K., Cummins, M., Thieker, D.F., Klavins,
kyo, Japan. E., et al. (2021). Perturbing the energy landscape for improved packing
36. Salahudeen, M.S., and Nishtala, P.S. (2017). An overview of pharmacody- during computational protein design. Proteins 89, 436–449. https://doi.
namic modelling, ligand-binding approach and its application in clinical org/10.1002/prot.26030.
practice. Saudi Pharm. J. 25, 165–175. https://doi.org/10.1016/j.jsps. 53. Benatuil, L., Perez, J.M., Belk, J., and Hsieh, C.-M. (2010). An improved
2016.07.002. yeast transformation method for the generation of very large human anti-
37. Corzo, J. (2006). Time, the forgotten dimension of ligand binding teaching. body libraries. Protein Eng. Des. Sel. 23, 155–159. https://doi.org/10.
Biochem. Mol. Biol. Educ. 34, 413–416. https://doi.org/10.1002/bmb. 1093/protein/gzq002.
2006.494034062678. 54. Fowler, D.M., Araya, C.L., Gerard, W., and Fields, S. (2011). Enrich: soft-
38. Sun, R., Hedl, M., and Abraham, C. (2020). IL23 induces IL23R recycling ware for analysis of protein function by enrichment and depletion of vari-
and amplifies innate receptor-induced signalling and cytokines in human ants. Bioinformatics 27, 3430–3431. https://doi.org/10.1093/bioinformat-
macrophages, and the IBD-protective IL23R R381Q variant modulates ics/btr577.
these outcomes ibd. Gut 69, 264–273. https://doi.org/10.1136/gutjnl- 55. Jantratid, E., Janssen, N., Reppas, C., and Dressman, J.B. (2008). Disso-
2018-316830. lution media simulating conditions in the proximal human gastrointestinal
39. Pultz, I.S., Hill, M., Vitanza, J.M., Wolf, C., Saaby, L., Liu, T., Winkle, P., and tract: an update. Pharm. Res. 25, 1663–1676. https://doi.org/10.1007/
Leffler, D.A. (2021). Gluten degradation, pharmacokinetics, safety, and s11095-008-9569-4.
tolerability of TAK-062, an engineered enzyme to treat celiac disease. 56. Winn, M.D., Ballard, C.C., Cowtan, K.D., Dodson, E.J., Emsley, P., Evans,
Gastroenterology 161, 81–93.e3. https://doi.org/10.1053/j.gastro.2021. P.R., Keegan, R.M., Krissinel, E.B., Leslie, A.G.W., McCoy, A., et al. (2011).
03.019. Overview of the CCP4 suite and current developments. Acta Crystallogr. D
40. Neoleukin Therapeutics, Inc. (2022). Neoleukin Therapeutics Announces 67, 235–242. https://doi.org/10.1107/S0907444910045749.
Third Quarter 2022 Financial Results and Corporate Update. Globe- 57. Adams, P.D., Afonine, P.V., Bunkóczi, G., Chen, V.B., Davis, I.W., Echols,
Newswire. https://www.globenewswire.com/en/news-release/2022/11/ N., Headd, J.J., Hung, L.-W., Kapral, G.J., Grosse-Kunstleve, R.W., et al.
14/2555436/0/en/Neoleukin-Therapeutics-Announces-Third-Quarter- (2010). Phenix: a comprehensive Python-based system for macromolec-
2022-Financial-Results-and-Corporate-Update.html. ular structure solution. Acta Crystallogr. D 66, 213–221. https://doi.org/
41. Snapper, C.M. (2018). Distinct immunologic properties of soluble versus 10.1107/S0907444909052925.
particulate antigens. Front. Immunol. 9, 598. https://doi.org/10.3389/ 58. Boonekamp, K.E., Kretzschmar, K., Wiener, D.J., Asra, P., Derakhshan,
fimmu.2018.00598. S., Puschhof, J., López-Iglesias, C., Peters, P.J., Basak, O., and Clevers,
42. Jensen, K.K., Andreatta, M., Marcatili, P., Buus, S., Greenbaum, J.A., Yan, H. (2019). Long-term expansion and differentiation of adult murine
Z., Sette, A., Peters, B., and Nielsen, M. (2018). Improved methods for pre- epidermal stem cells in 3D organoid cultures. Proc. Natl. Acad. Sci. USA
dicting peptide binding affinity to MHC class II molecules. Immunology 116, 14630–14638. https://doi.org/10.1073/pnas.1715272116.
154, 394–406. https://doi.org/10.1111/imm.12889. 59. Weß, V., Schuster-Winkelmann, P., Karatekin, Y.H., Malik, S., Beigel, F.,
43. Unterweger, A.-L., Rüscher, A., Seuß, M., Winkelmann, P., Beigel, F., Ko- Kühn, F., and Gropp, R. (2023). Humanized NSG mouse models as a pre-
letzko, L., Breiteneicher, S., Siebeck, M., Gropp, R., and Aszodi, A. (2021). clinical tool for translational research in inflammatory bowel diseases. Int.
NOD/scid IL-2Rgnull mice reconstituted with peripheral blood mononu- J. Mol. Sci. 24, 12348. https://doi.org/10.3390/ijms241512348.
Cell 187, 1–13, August 8, 2024 13

ll
OPEN ACCESS Article
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Anti-CD28 Biolegend 302943; RRID:AB_2616667
Anti-Myc-FITC Immunology Consultants CMYC-45F
Laboratory
Anti-pSTAT3 AF647 BD 557815; RRID:AB_647144
Anti-rat CD3 BD 556970; RRID:AB_396542
Bimekizumab MedChemExpress HY-P99280
Guselkumab Creative Biolabs TAB-752
Secukinumab MedChemExpress HY-P9927
Bacterial and virus strains
CVB-T7 POL chemically competent E. coli Avidity CVB-T7 POL
OneShot BL21 Star (DE3) chemically Invitrogen C601003
competent E. coli
SHuffle T7 Express competent E.coli New England Biolabs C3029J
Biological samples
Human foreskin (surgical discards) The NYULH Center for RRID:SCR_018304 RRID:SCR_017930
Biospecimen Research
and Development, and
Histology and
Immunohistochemistry
Laboratory
Human PBMCs, IBD patients LMU University Hospital N/A
Human peripheral blood mononuclear cells Stanford Blood Bank N/A
(PBMCs), healthy volunteers
Chemicals, peptides, and recombinant proteins
1-step Ultra TMB-ELISA substrate solution Thermo 34028
2-mercaptoethanol Sigma M6250
Advanced DMEM/F-12 Gibco 12634010
B-27 Supplement (50X), serum free Gibco 17504044
Biotin Sigma B4501-1G
Blood collection tube, trisodium citrate solution S-Monovette 102332
Blotting grade blocker non-fat dry milk Bio-rad 1706404XTU
Carbonate-bicarbonate buffer, powder Thermo 28382
Casamino acids Gibco Bacto DF0231-17-2
Cell freezing medium-DMSO serum free Sigma C6295-50mL
Chloramphenicol Sigma C1919
Chymotrypsin Sigma C4129-250MG
Complete supplement mixture -ura -trp MP Biomedicals 114520512-CF
Cultrex basement membrane extract, PathClear R&D 3432-010-01
Cultrex HA-R-Spondin1-Fc supernatant from R&D 3710-001-01
293T cells, organ harvesting solution
Dispase (5U/ml) STEMCELL Technologies 7913
DMEM Gibco 10938025
DMEM Fisher 11-965-092
(Continued on next page)
e1 Cell 187, 1–13.e1–e11, August 8, 2024

ll
Article OPEN ACCESS
Continued
Dropout base medium MP Biomedicals 114025012-CF
ExtrAvidin-Peroxidase Sigma E2886
Forskolin Tocris 1099
Galactose Thermo AAA1281318
GlutaMAX Gibco/Corning 35050061
HBSS Sigma H9394
HEK-Blue selection reagent Invivogen hb-sel
Heparin Solution Stem Cells Technologies 7980
HEPES (1 M) Gibco 15630106
HisPur NiNTA Superflow Agarose Thermo 25214
IL-23 Bioassay (reporter cell line, Promega JA2511
single-use vial)
In vitro biotinylation kit Avidity BirA500
IPTG Sigma 5800-OP
Kanamycin sulfate Sigma 60615
KGM gold keratinocytes growth Lonza 192060
medium bulletKit
MEM non-essential amino acids Gibco 11140050
N-Acetyl-Lcysteine Sigma-Aldrich A9165-5G
Normicin Invivogen ant-nr-05
One Shot heat inactivated FBS Thermo A3160401
Penicillin-Streptomycin (5,000 U/mL) Gibco 15070063
Penicillin-Streptomycin (5,000 U/mL) Thermo 15070063
Pepsin, procine stomach Thermo J6167906
Pierce EDTA-free protease inhibitor tablets Thermo A32965
Primocin Invivogen ant-pm-05
PTG-200 WuXi Apptec N/A
QUANTI-Blue, SEAP substrate Invivogen rep-qbs
for HEK-Blue
Recombinant cynomolgus IL-23R R&D 10306-IR-050
Recombinant human FGF-10 R&D 345-FG-025/CF
Recombinant human IL-17A R&D 7955-IL
(HEK-Blue IL-17 assay)
Recombinant human IL-17A PeproTech 200-17
(human epithelial organoid)
Recombinant human IL-17A/F R&D BT5837-025
Recombinant human IL-17F R&D 1335-INS
Recombinant human IL-23 R&D 1290-IL
Recombinant human IL-23R ECD expressed and N/A
purified in-house
Recombinant human Noggin R&D 6057-NG-025
Recombinant mouse IL-17A WuXi Biologics N/A
Recombinant mouse IL-23R ECD expressed and N/A
purified in-house
Recombinant rat IL-23 R&D 3136-RL
Recombinant rat IL-23R WuXi Biologics N/A
RPMI 1640 Corning 15-040-CV
RPMI 1640 with GlutaMAX Gibco 61870036
Streptavidin-PE Invitrogen S866
Cell 187, 1–13.e1–e11, August 8, 2024 e2

ll
OPEN ACCESS Article
Continued
Terrific Broth II medium MP Biomedicals 113046022-CF
Trypsin (0.25%), phenol red Gibco 15050065
Tween 20 Fisher MP1TWEEN201
V565, anti-TNF nanobody Expressed and N/A
purified in-house,
using sequence from
Crowe et al.32
Xylocain gel AstraZenica 1138060
Y-27632 dihydrochloride Sigma-Aldrich Y0503
Yeast nitrogen base without amino acids BD Difco DF0335-15-9
Critical commercial assays
Anti-Rat IFNg ELISA Thermo ERIFNG
Anti-Rat IL-17 ELISA Thermo BMS635
EasySep rat total CD3+ T-cell isolation kit StemCell 19641
PowerUp SYBR Green Master Mix for qPCR Applied Biosystems A25742
RNeasy Plus Mini Kit Qiagen 74134
SuperScript VILO cDNA synthesis kit Invitrogen 11754050
Deposited data
23R-91 crystal structure RCSB PDB Accession ID 8UTK
Raw (fastq) and processed data from NGS experimnts NCBI GEO Accession ID GSE263250
Source data for main and supplemental figures Mendeley Data https://doi.org/10.17632/2n9gstvrsy.1
Experimental models: Cell lines
EBY-100 ATCC MYA-4941
Expi239F Thermo A14527
HEK-Blue IL-17 cells Invivogen hkb-il17
IL-23 reporter cell line, see commercial assays See above See above
Experimental models: Organisms/strains
Lewis rats Envigo RRID:RGD_737922
NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ mice Charles River Laboratories RRID:IMSR_JAX:005557
Sprague Dawley rats Charles River Laboratories RRID:RGD_737891
Oligonucleotides
CCL20 fwd: AAGTTGTCTGTGTGCGCAAATCC Integrated DNA Technologies Custom
CCL20 rev: CCATTCCAGAAAAGCCACAGTTTT Integrated DNA Technologies Custom
CXCL8 (IL-8) fwd: GAGAGTGATTGAGAGTGGACCAC Integrated DNA Technologies Custom
CXCL8 (IL-8) rev: CACAACCCTCTGCACCCAGTTT Integrated DNA Technologies Custom
HPRT1 fwd: CATTATGCTGAGGATTTGGAAAGG Integrated DNA Technologies Custom
HPRT1 rev: CTTGAGCACACAGAGGGCTACA Integrated DNA Technologies Custom
S100A7 fwd: AGAAGCCAAGCCTGCTGACGAT Integrated DNA Technologies Custom
S100A7 rev: GTCCTTTTTCTCAAAGACATCGGC Integrated DNA Technologies Custom
Recombinant DNA
Design and SSM libraries, oligo pools of Agilent Custom, sequences available upon request
full-length genes
Human or mouse IL-23R cloned in CMVR plasmid GenScript Custom, sequences available upon request
Overlapping primers for construction of Integrated DNA Technologies Custom, sequences available upon request
combinatorial libraries
pET29b(+) plasmid backbone Novagen 69872
pETCON plasmid backbone Addgene (unpublished) RRID: Addgene_41522
e3 Cell 187, 1–13.e1–e11, August 8, 2024

ll
Article OPEN ACCESS
Continued
pETCON4 plasmid backbone Maguire 2020 Proteins Custom
(derivative of pETCON selected
for increased resistance to
trypsin and chymotrypsin)
Software and algorithms
CCP4 Kabsch45 https://www.ccp4.ac.uk/
Coot Emsley and Cowtan46 https://www2.mrc-lmb.cam.ac.uk/
personal/pemsley/coot/
GraphPad Prism version 10.1.1 GraphPad N/A
MolProbity Williams et al.47 http://molprobity.biochem.duke.edu/
NetMHCII version 2.3 Technical University of Denmark https://services.healthtech.dtu.dk/
services/NetMHCII-2.3
Phaser McCoy et al.48 https://www.phaser.cimr.cam.ac.uk/index.php/
Phaser_Crystallographic_Software
Phoenix WinNonlin, Version 6.3 Pharsight Corp https://www.certara.com/software/
phoenix-winnonlin/
Rosetta molecular modeling suite and Cao et al.23 https://www.rosettacommons.org/
scripts for protein design software/license-and-download
XDS Kabsh49 https://xds.mr.mpg.de/
RESOURCE AVAILABILITY
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Stephanie
Berger (berger389@gmail.com).
Materials availability
DNA sequences of E. coli, yeast and mammalian expression plasmids are available upon request.
Data and code availability

This study did not generate new code. Source data for main and supplemental figures, raw and processed data from deep mutational
scanning experiments, and crystal structure data are publicly accessible. Source data for main and supplemental figures and original
SDS PAGE images for Figure 4A have been deposited in the Mendeley Data repository with https://doi.org/10.17632/2n9gstvrsy.1.
Raw and processed data from deep mutational scanning experiments have been deposited in the NCBI GEO repository with acces-
sion ID GSE263250. Data deposition, atomic coordinates, and structure factors reported for the crystal structure of 23R-91 have
been deposited in the Protein Data Bank (PDB), http://www.rcsb.org/ with accession ID 8UTK. Any additional information required
to reanalyze the data reported in this paper is available from the lead contact upon request.
EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS
Cell culture
E. coli strains BL21 Star (DE3) (Invitrogen), SHuffle T7 Express (New England Biolabs), and CVB-T7-POL (Avidity) were transformed
with plasmid for minibinder expression using the manufacturer’s procedure. Successful transformants were selected by culture on
2% agar containing 50-100 mg/mL kanamycin (for selection of pET29b plasmid) and optionally 10 mg/mL chloramphenicol (CVB-T7-
POL only, for selection of pBirAcm plasmid) at 37 C (BL21, CVB-T7-POL) or 30 C (SHuffle T7 Express). A single colony was used to
inoculate Terrific Broth II (TBII) media (MP Biomedicals) containing selection antibiotic and grown to confluence overnight at at 37 C
(BL21, CVB-T7-POL) or 30 C (SHuffle T7 Express). For expression cultures, TBII media was inoculated with overnight culture at a
ratio of 1:50 to 1:100 starter culture:expression media and grown to OD600 0.6-0.8 at 37 C (BL21, CVB-T7-POL) or 30 C (SHuffle
T7 Express), then expression was induced with IPTG added to 0.5-1 mM overnight at growth temperature of 18-37 C. 10 mM biotin
prepared in TBII and sterile-filtered was added to CVB-T7-POL media at induction.
EBY-100 S. cerevisiae were initially cultured in dropout base medium (MP Biomedicals 114025012-CF) with complete supplement
mixture lacking ura and trp (MP Biomedicals 114520512-CF) selective for the yeast strain (-ura) and the transforming plasmid (-trp).
Yeast were passaged and subsequently cultured in SDCAA medium (20 g/L dextrose, 6.7 g/L Difco yeast nitrogen base, 5 g/L Bacto
Cell 187, 1–13.e1–e11, August 8, 2024 e4

ll
OPEN ACCESS Article
casamino acids, 5.4 g/L Na2HPO4, 8.56 g/L NaH2PO4) and protein expression was induced with 2% galactose in SGCAA medium
(SDCAA with 20 g/L galactose rather than dextrose).
Expi293F cells (Life Technologies) were grown in Expi293 Expression Medium (Life Technologies), cultured at 37 C with 8% CO2
and shaking at 150 rpm.
IL-23 (IL-23 Bioassay, Promega) reporter cell line was cultured according to the manufacturer’s protocol for single-use assay
format. Briefly, cells were thawed and transferred to the culture medium provided with the assay kit and incubated at 37 C with
5% CO2. Cells were not propagated.
IL-17 (HEK-Blue IL-17, Invivogen) reporter cell line was cultured according to the manufacturer’s protocol. Briefly, cells were incu-
bated (37 C, 5% CO2) in growth medium [DMEM, 4.5 g/l glucose, 2 mM L-glutamine, 10% (v/v) heat-inactivated fetal bovine serum,
100 U/ml penicillin, 100 mg/ml streptomycin, 100 mg/ml Normocin (Invivogen ant-nr-05)] including 1x HEK-Blue selection reagent
(Invivogen hb-sel), and passaged at approximately 70% confluency.
Peripheral mononuclear cells (PBMCs) from healthy human donors were obtained from the Stanford Blood Bank and cultured in
complete RPMI: RPMI 1640-glutaMAX (Gibco) supplemented with 10% FBS (Gibco), 50 mM 2-mercaptoethanol (bME, Sigma), MEM
non-essential amino acids (Gibco), sodium pyruvate (Gibco), 15mM HEPES (Gibco), and penicillin-streptomycin (Gibco) at 37 C with
5% CO2.
Primary rat cells were cultured in RPMI-1640 (Corning) supplemented with 10% FBS (VWR), 1x GlutaMAX (Corning), and penicillin-
streptomycin (Corning) at 37 C with 5% CO2.
Human keratinocytes were isolated from neonatal foreskin as described below and cultured in KGM medium (Lonza). Cells were
passaged at 65-70% confluency and frozen after two passages using a serum-free cell freezing medium. Epithelial organoids were
generated from human keratinocytes as described below and cultured in organoid culture medium [Advanced DMEM/F12 supple-
mented with 10 mM HEPES, GlutaMAX, 1% pen/strep, 10% R-spondin1 containing conditioning media (in house), 0.2% Primocin,
100 ng/mL rh-Noggin,1mM N-Acetyl-L-cysteine, 1 mM Y27632, 100 ng/ml rh-FGF, 100 ng/mL Forskolin, 2% B-27 supplement and
2 mg/ml heparin solution] at 37 C with 5% CO2.
Rodent models
Male Sprague-Dawley rats (Charles River Laboratories) were acclimated to study conditions for eight to sixteen days prior to dose
administration. At dosing, animals were eight weeks of age. Animals were group housed in polycarbonate cages with hardwood chip
bedding. Certified Rodent Diet #2016C and 2016CM (Envigo) were provided ad libitum. Water was provided fresh daily, ad libitum.
Environmental controls for the animal room were set to maintain a temperature of 20 to 26 C, a relative humidity of 50 ± 20%, and a
12-hour light/12-hour dark cycle. As necessary, the 12-hour dark cycle was interrupted to accommodate study procedures. Animal
care including room, cage, and equipment sanitation conformed to the guidelines cited in institutional SOPs.
Female Lewis rats (Envigo) were acclimated to study conditions for at least seven days prior to study start. Animals were 6-8 weeks
old at arrival and were housed 4 to 5 per cage in polycarbonate cages with wire tops, wood chip bedding, and suspended food and
water bottles. The rats were housed either in large or small rectangular cages (static airflow, approximately 0.10 or 0.15 m2 floor
space) or in pie-shaped cages (passive airflow, approximately 0.16 m2 floor space w/mezzanine level included). During the acclima-
tion and study periods, the animals were housed in a laboratory environment with temperatures ranging 19 C to 25 C and relative
humidity of 50 ± 20% and a 12-hour light/12-hour dark cycle. The animals were allowed access ad libitum to Envigo Teklad 8640
diet and fresh municipal tap water. Animal care including room, cage, and equipment sanitation conformed to the guidelines cited
in institutional SOPs.
Six- to eight-week-old NOD.Cg-Prkdcscid Il2rgtm1WjI/SzJ mice (NSG; Charles River Laboratories) were kept under specific path-
ogen-free conditions in individually ventilated cages in a facility controlled according to the Federation of Laboratory Animal Science
Association (FELASA) guidelines.
METHOD DETAILS
Computational design
We used the crystal structure of human IL-23R in complex with IL-23p19 and IL-23p40 (PDB 5MZV) as a starting point for design.
Because specific inhibition of IL-23 and not IL-12 is desired, we aimed to bind IL-23R, the IL-23-specific receptor subunit, and inhibit
its interaction with IL-23p19, the IL-23-specific cytokine subunit. From the crystal structure, we first isolated IL-23R and p19 native
hotspots L56, W156, L160, and L161. To supplement the native hotspots, a rotamer interaction field (RIF) of de novo hotspots was
generated around selected IL-23R residues near the surface of interest: G24, I25, T26, N27, I28, N29, C30, S31, G32, H33, I34, V36,
T40, I50, A54, A55, I56, K57, N58, C59, Q60, P61, K63, L64, H65, F66, Y67, K68, N69, G70, I71, K72, P95, H96, A97, S98, M99, Y100,
C101, T102, A103, E104, C105, P106, K107, H108, F109, Q110, E111, T112, L113, I114, C115, G116, K117, D118, I119, S120. The
RIF residues (disembodied amino acid side chains) were generated such that the side chain atoms form favorable polar and apolar
interactions with the given IL-23R surface residues.
Similarly, we used the crystal structure of human IL-17A in complex with IL-17RA (PDB 4HSA) as a starting point for design, with the
surface of interest including residues from both chains of the IL-17A homodimer. From chain 1: N40, R44, V46, Q117, E118, I119,
e5 Cell 187, 1–13.e1–e11, August 8, 2024

ll
Article OPEN ACCESS
L120, R134, L135, K137, I138, L139. From chain 2: L49, N50, I51, H52, N53, N55, T56, T58, R78, E80, P82, E83, R84, Y85, P86, S87,
V88, I89, W90, Q117, I119, L120, L122, R123, R124, E125, P126, P127, P130, N131, S132, F133, R134, L135, V140.
In parallel, 12,345 scaffold proteins (inert de novo designed proteins with experimentally validated stability) were roughly placed at
the desired IL-23R or IL-17A interaction surface using PatchDock. After RIF generation and initial scaffold placement, scaffolds were
docked with higher resolution at the interaction surface such that the backbone atoms of the native hotspot and/or de novo hotspots
were matched with appropriate backbone atoms of each scaffold protein, replacing the amino acid previously at that scaffold posi-
tion. All other scaffold residues, previously computationally optimized for the lowest monomer free energy, were retained. This step
generated 130,343 (IL-23R) and 409,045 (IL-17A) docked configurations.
Each docked configuration was input into a Rosetta design protocol to optimize additional scaffold residues at the target interface
for high-affinity binding. Only scaffold side chains within 8 Å of the target surface were allowed to mutate. Scaffold sidechains at sur-
face positions further than 8 Å were not allowed to mutate, but were allowed to optimize rotamer conformation. Target residues within
8 Å of the scaffold were allowed to optimize rotamer conformation. All target and scaffold backbone atoms, all scaffold monomer core
side chains, and target side chains further than 8 Å from the scaffold were not allowed to move.
Designed target:inhibitor complexes were filtered on metrics thought to predict high-affinity binding, including but not limited to
inhibitor monomer free energy, binding energy, shape complementary of the inhibitor to the target surface, buried apolar surface
area at the interface, and buried unsatisfied polar atoms. Designs with the best metrics were selected for experimental testing.
Yeast library preparation

DNA encoding the initial design library was commercially synthesized (Agilent). For site saturation mutagenesis (SSM) libraries, in
some instances full-length genes were commercially synthesized (Agilent), and in other instances libraries were prepared using over-
lap PCR with custom primers (Integrated DNA Technologies) as described previously.50 Combinatorial libraries were prepared by
gene assembly from custom oligos; oligos were designed such that all included mutations (Table S2) were represented either indi-
vidually or as degenerate codons encoding two or more desired mutations. Oligo overlap regions had a minimum length of 12 bp and
minimum melt temperature of 40 C, enabling efficient gene assembly.
All yeast libraries, including the initial design library, SSM libraries, and combinatorial libraries, were prepared with 5’ and 3’ over-
hangs >20 bp to enable homologous recombination with the plasmid backbone (pETCON) for yeast expression and surface display
via fusion to Aga2p.51 For initial SSM and combinatorial libraries for affinity-maturation, the reported pETCON3 vector was used. For
SSM and combinatorial libraries built with the objective of enhancing stability in simulated intestinal fluid (SIF), a pETCON variant
optimized for enhanced proteolytic stability of Aga2p and Myc-tag was used.52
IL-23R and IL-17 minibinder and IL-23R peptide sequences selected from the initial design library and combinatorial libraries for
expression in E. coli and further characterization can be found in Table S1.
Fluorescence-activated cell sorting (FACS)

Yeast strain EBY100 was transformed with each library and vector by electroporation and grown in minimal media selective for the
yeast strain (-ura) and the transforming plasmid (-trp).53 Expression was induced with 2% galactose. Surface expression was de-
tected with anti-Myc-FITC (Immunology Consultants Laboratory) conjugate, and binding to biotinylated target was detected with
streptavidin-PE (Invitrogen).
Selection scheme and sort conditions for each library are detailed in Table S3. The initial design library, and SSM and combinatorial
libraries meant for affinity selection were prepared for selection as follows: after 16-24 hours induction, yeast were spun down,
washed with PBS with 1% fetal bovine albumin (PBSF), and incubated for 30-60 minutes with biotinylated target at the given con-
centration. Yeast were then washed with PBSF and incubated for 2-5 minutes with stain solution (1:100 each anti-Myc-FITC and
streptavidin-PE), washed, and resuspended for analysis and selection by FACS. FACS consecutive gates were set as follows: (1)
cell granularity and size, selecting for yeast cells (BSC vs. FSC); (2) cell morphology, selecting singlets (FSC-height vs. FSC-width);
(3) expression, selecting expressors by proxy of the Myc-tag (FITC fluorescence histogram); and (4) binding signal, selecting the top
1-5% relative to total population (PE vs. FITC).
SIF SSM and combinatorial libraries were prepared as follows: after 16-24 hours induction, yeast were spun down, washed with
PBSF, resuspended in SIF (recipe described below) at an OD of 2.0, and incubated at 30 C shaking for 30-90 minutes as noted. After
SIF digest, cells were spun down and washed 4 times with 800 uL PBSF, manually aspirating the supernatant each time to ensure
complete washing to remove proteases. SIF-treated cells were then treated with biotinylated IL-23R as described above. FACS gates
were set similarly, but gate 3 (expressors) was excluded, as the vast majority of pools showed populations of Myc-negative, bind-
ing(PE)-positive cells, indicating that the Myc-tag was cleaved leaving binding-competent design variants displayed on the cell
surface.
Generally, design and combinatorial libraries were sorted to convergence in 4-7 consecutive rounds, and SSM libraries were
sorted in two consecutive rounds and deep sequenced. The concentration of target protein was generally decreased as sorting
rounds progressed in order to efficiently separate the highest-affinity variants. In the case of SIF SSM and combinatorial libraries,
protease concentrations in SIF as well as the digest duration were increased with consecutive rounds, in addition to decreasing con-
centration of target.
Cell 187, 1–13.e1–e11, August 8, 2024 e6

ll
OPEN ACCESS Article
Deep mutational scanning

From SSM naive and sorted pools, DNA was prepared and sequenced as follows: yeast were lysed with 125 U/ml Zymolase at 37 C
for 5 hr, and DNA was harvested (Zymoprep kit from Zymo Research). Genomic DNA was digested with 2 U/ml Exonuclease I and
0.25 U/ml Lambda exonuclease (New England Biolabs) for 90 min at 30 C, and plasmid DNA purified with a QIAquick kit (Qiagen).
Minibinder genes were PCR amplified using primers that annealed to external regions within the plasmid, followed by a second round
of PCR to add flanking sequences for annealing to the Illumina flow cell oligonucleotides and a 6 bp sample identification sequence,
or barcode. PCR rounds were 12 cycles each with high-fidelity Phusion polymerase. Barcodes were read on a MiSeq or NextSeq
sequencer using either a 300-cycle or 600-cycle reagent kit (Illumina), and sequences were analyzed with adapted scripts from
Enrich.54
Protein expression and purification

All minibinders were cloned into the pET29b plasmid for expression from the T7 promoter, between NdeI and XhoI cut sites, incor-
porating a C-terminal 6-histidine tag for purification by affinity chromatography. E. coli were transformed with the resulting plasmids:
strain BL21 Star (DE3) (Invitrogen) for minibinders without disulfides and strain Shuffle T7 Express (New England Biolabs) for mini-
binders containing disulfide(s). E. coli were grown to OD600 in Terrific Broth II media (MP Biomedicals) at 37 C (BL21 Star DE3)
or 30 C (Shuffle T7 Express), then expression was induced with IPTG added to 0.5-1 mM overnight at growth temperature of 18-
37 C. Cells were harvested, lysed by sonication, and lysate cleared by centrifugation. Cleared lysate was incubated with NiNTA resin
for 30 minutes rocking to allow binding of recombinant protein via the 6-histidine tag, then applied to a gravity column (Biorad),
washed and eluted, concentrated and either exchanged into PBS by dialysis or further purified by gel filtration chromatography
into PBS (AKTA Pure, Cytiva; Superdex 75 Increase and Superdex S200 Increase columns, Cytiva).
Recombinant human, mouse, or rat IL-23R with an N-terminal secretion tag (BM40) and a C-terminal polyhistidine tag followed by
an avi-tag was cloned into the CMVR plasmid for secreted expression in Expi293F cells. hIL-23R was purified from culture superna-
tants by IMAC, dialyzed into PBS containing 5% glycerol, and concentrated. To support BLI experiments described below, purified
hIL-23R was then site-specifically biotinylated via the avi-tag in a reaction catalyzed by recombinant BirA, a biotin ligase (Avidity).
Non-biotinylated hIL-23R was used in the custom ELISA method described below.
To support the custom ELISA method described below, 23R-10 was expressed with a C-terminal avi-tag followed by a 6-histidine
tag (23R-10-AH) in E. coli strain CVB-T7 POL (Avidity), harboring another plasmid from which the biotin ligase BirA is co-expressed in
order to enzymatically biotinylate target protein in the E. coli cytosol. 23R-10-AH was purified from cell lysate with IMAC, dialyzed into
PBS, snap-frozen and stored at -80C.
Size exclusion high performance liquid chromatography (SE-HPLC)

To determine minibinder purity, high performance liquid chromatography was used with a size exclusion column and running buffer.
Due to the high pI of minibinder 23R-91, it was necessary to use a running buffer consisting of phosphate-buffered saline (10 mM
Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, pH 7.4) with 500 mM arginine to reduce non-specific interactions with the column (Super-
dex 75 10/300 GL column, GE). 20 mL of sample at 2 mg/mL in PBS at pH 7.4 was injected and analyzed with an isocratic elution at
0.75 mL/min with a run time of 32 minutes. The instrument used was an Agilent 1260 system and absorbance at 280 nm and 260 nm
was monitored during the run.
Liquid chromatography-mass spectrometry (LC-MS)

To verify the molecular mass of minibinders, intact LC-MS was used. 5 uL of sample at 0.1 mg/mL was injected onto a Waters Acquity
CSH C18 UPLC column and analyzed with an AB Sciex 5600 QTOF. Mobile phase A was H2O with 0.1% formic acid, mobile phase B
was acetonitrile with 0.1% formic acid. A gradient elution was performed from 10% B to 100% B over 4 minutes.
Circular dichroism
CD spectra were recorded with a J-1500 Circular Dichroism Spectrometer (JASCO). Proteins were assayed at 40 mM in DPBS free of
MgCl2 and CaCl2 (Life Technologies) with guanidinium hydrochloride from 0 to 6 M, and wavelength scans from 260 to 190 nm were
measured at 25 C. For temperature melts, proteins at 40 mM were heated from 25 C to 95 C over approximately 1.5 hours, with CD
signal at 222 nm measured every 2 degrees, and wavelength scans from 260 to 190 nm measured every 10 degrees.
Biolayer interferometry and surface plasmon resonance

Qualitative and quantitative assessment of binding affinity was performed using biolayer interferometry (BLI; ForteBio Octet RED96
and associated analysis software) and surface plasmon resonance (SPR; Biacore 8K and associated analysis software). Enzymat-
ically biotinlyated target protein (30 nM) was immobilized on streptavidin-coated sensor tips (BLI) or chip (SPR), or target protein
fused to Fc domain was immobilized on anti-human IgG tips. BLI sensor tips were then sequentially dipped in wells with: buffer
only (baseline), minibinder in solution (association), and buffer only (dissociation). Similar solutions were flowed over the SPR sensor
chip. Kinetic constants were determined from the mathematical fit of a 1:1 binding model.
e7 Cell 187, 1–13.e1–e11, August 8, 2024

ll
Article OPEN ACCESS
Simulated gastrointestinal fluids digest

Simulated intestinal fluid (SIF) was prepared as recommended by Jantratid et al. (termed FaSSIFv2) with the addition of proteases
trypsin and chymotrypsin each at 30 mg/mL.55 This composition is denoted as ‘‘1x SIF’’ in the text and in Table S3 describing SIF
SSM and combinatorial library selection conditions. In some instances, protease concentrations were increased to improve differ-
entiation between minibinders and controls; these solutions are denoted as ‘‘#x SIF’’, where for example ‘‘2x SIF’’ contains 60 mg/mL
each trypsin and chymotrypsin. Simulated gastric fluid (SGF) was prepared per the US Pharmacopeia standard: 600 ug/mL pepsin
and 34.2 mM NaCl in water, with HCl added to adjust pH to 2.
For qualitative assessment of proteolytic stability, pure recombinant proteins were digested at 37 C for 24 hours and proteolytic
cleavage assessed by SDS PAGE. From concentrated stock solutions, recombinant proteins were added to stock SGF and SIF so-
lutions to a final concentration of 1 mg/mL. At each indicated time point, samples were removed, immediately mixed with load dye
and boiled for 5 minutes at 95 C to quench protease activity. 5 mg protein per sample (assuming no loss to degradation) was run on
16% Tris-tricine or 4-20% Tris-glycine (TGX) polyacrylamide gels (Biorad) alongside 5 mL Precision Plus Protein Dual Xtra Pre-
stained Protein Standards (Biorad).
X-ray crystallography
Crystallization experiments for 23R-91 were conducted using the sitting drop vapor diffusion method. Crystallization trials were set
up in 200 nL drops using the 96-well plate format at 20 C. Crystallization plates were set up using a Mosquito LCP from SPT Labtech,
then imaged using UVEX microscopes from JAN Scientific. Diffraction quality crystals formed in 0.2 M Lithium sulfate 0.1 M Sodium
acetate pH 4.5 and 50% (v/v) PEG 400.
Diffraction data were collected at the Advanced Photon Source at beamline 24ID-C. Crystal diffracted to 1.9 Å resolution. X-ray
intensities and data reduction were evaluated and integrated using XDS45 and merged/scaled using Pointless/Aimless in the
CCP4 program suite.56 Structure determination and refinement starting phases were obtained by molecular replacement using
Phaser48 using the designed model structure. Following molecular replacement, the models were improved using phenix.auto-
build.57 Structures were refined in Phenix.57 Model building was performed using COOT.46 The final model was evaluated using Mol-
Probity.47 Data collection and refinement statistics are recorded in the Table S4. Data deposition, atomic coordinates, and structure
factors reported for in this paper have been deposited in the Protein Data Bank (PDB), http://www.rcsb.org/ with accession
code 8UTK.
IL-23 reporter in vitro signaling assay

Commercial IL-23 reporter cells (Promega IL-23 Bioassay) engineered to express luciferase downstream of IL-23R were used to
assess inhibition of IL-23-mediated cell signaling. Cells were plated in the inner wells of 96-well tissue culture treated white plates
suitable for reading luminescence. Cells were pre-incubated for 30 minutes with a dilution series of each inhibitor, then treated
with the EC80 stimulatory concentration (8 ng/mL) of recombinant human IL-23 cytokine (R&D 1290-IL) determined in preceding ex-
periments. After 6 hours incubation with human IL-23, luciferase substrate (Bio-Glo) was added and luminescence read. Inhibitor
response was plotted as percent maximum IL-23 or IL-17 stimulation vs. inhibitor concentration, and IC50 values determined using
a four-parameter nonlinear curve fit analysis in Prism.
IL-17 reporter in vitro signaling assay

Commercial IL-17 reporter cells (HEK-Blue IL-17, Invivogen) engineered to express secreted embryonic alkaline phosphatase (SEAP)
downstream of the IL-17 receptor were used to assess inhibition of IL-17-mediated cell signaling. Cells were cultured per manufac-
turer’s protocol. Cells were treated with the EC80 stimulatory concentration of recombinant hIL-17A (0.56 ng/mL; R&D 7955-IL), hIL-
17F (1.29 ng/mL; R&D 1335-INS), or hIL-17A/F (6.9 ng/mL; R&D BT5837-025) and a titration of each inhibitor or control (media): cyto-
kine and inhibitor were pre-incubated at 37 C for 30 minutes at 10x assay concentration, after which 20 uL of each condition was
added to 180 uL cell suspension in media (300,000 cells/mL) in a 96-well tissue culture treated microplate. After overnight incubation
at 37 C (5% CO2), 180 uL of supernatant from each well was transferred to a clear 96-well microplate with 20 uL of chromogenic
SEAP substrate (QUANTI-Blue, Invivogen) and incubated at 37 C for 2 hours. SEAP activity, as a proxy for IL-17 signaling, was deter-
mined by measuring absorbance at 620 nM. Inhibitor response was plotted as percent maximum IL-23 or IL-17 stimulation vs. inhib-
itor concentration, and IC50 values determined using a four-parameter nonlinear curve fit analysis in Prism.
Human PBMC in vitro IL-23 signaling assay

Human PBMCs were activated for three days with plate-bound anti-CD3 (2.5 mg/mL Biolegend 317326)/ anti-CD28 (5 mg/mL Bio-
legend 302943) and 100 IU/mL IL-2, rested overnight in complete RPMI and serum-starved for 2 hours. Cells were stimulated
with 20 nM recombinant hIL-23 with or without a titration of minibinder for 20 min at 37 C. After incubation, cells were stained
with anti-CD4 Pacific Blue (Biolegend 300521), then fixed with 4% PFA (Electron Microscopy Sciences 15710) in PBS for 10 min
at room temperature, permeabilized with ice cold methanol, and stained for phosphorylated STAT3 AF647 (BD 557815) as a down-
stream marker of IL-23 signaling. Cells were analyzed by flow cytometry and pSTAT3 mean fluorescence intensity in CD4+ T cells
plotted vs. inhibitor concentration. IC50 values were determined using a three-parameter nonlinear curve fit analysis in Prism.
Cell 187, 1–13.e1–e11, August 8, 2024 e8

ll
OPEN ACCESS Article
ELISA method for detection of IL-23R minibinders

A competitive ELISA method was developed in which the concentration of IL-23R minibinder in a sample is quantified by measuring
the inhibition of binding human IL-23R (hIL-23R) to a labeled, high-affinity IL-23R minibinder, 23R-10-AH. Preparation of the custom
reagents used in this assay, hIL-23R and 23R-10-AH, are described above in Protein expression and purification.
96-well plates (Nunc Maxisorp) were coated with hIL-23R: 100 mL of coating solution (7.2 mg/mL hIL-23R, 40 mM carbonate-bicar-
bonate pH 9.4, 0.025% BSA) was added to each well, and the plate was sealed and stored overnight at 4 C. Coating solution was
decanted, and the plate washed 3x with 300 mL wash buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.05% Tween 20) per well. The plate
was blocked by adding 300 mL blocking buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.05% Tween 20, 0.5% nonfat dry milk) per well,
incubating for 1 hour at room temperature (RT), then solution decanted and the plate blotted on clean paper towels. Blocked plates
were then immediately used for the assay. 100 mL of each standard (diluted in appropriate matrix) or sample was added to each well
of the assay plate and incubated at RT for 1 hour. Samples were decanted, and the plate washed 3x. 100 mL of solution containing the
peroxidase-linked hIL-23R ligand (750 pM 23R-10-AH, 1:1000 dilution of ExtrAvidin-Peroxidase [Millipore Sigma], prepared in block-
ing buffer) was added to each well and incubated at RT for 15 minutes, then decanted, and the plate washed 3x. 100 uL of peroxidase
substrate solution (1-step Ultra TMB, ThermoFisher), pre-equilibrated to RT, was added to each well and incubated at RT in the dark
for 30 minutes. 100 mL stop solution (0.16 M sulfuric acid) was added per well, and absorbance at 450 nm measured using a
SpectraMax M5 plate reader.
A standard curve was included per assay plate, prepared by spiking minibinder in undiluted serum or tissue homogenate super-
natants at the indicated concentrations spanning the dynamic range of the assay (see Figure S12 for standard curves per minibinder,
per biological matrix). Quality control samples – minibinder spiked in the relevant matrix at known concentrations – were included in
each assay plate, and the assay was deemed valid if each QC value fell within 25% of the expected value. Per assay, the lower limit of
detection (LLOD) was defined as the concentration corresponding to 95% of the top best fit A450 value. The upper limit of detection
was defined as the concentration corresponding to the bottom best fit A450 value plus 5% of the top best fit value. Standard curves,
QC samples, and study samples were all assayed in duplicate technical replicates.
Specimen preparation for ELISA analysis: immediately after collection, blood samples were allowed to clot at ambient temperature
prior to centrifugation to obtain serum. When applicable, at sacrifice small intestine and colon contents were separately collected.
Small intestine and colon tissues were then rinsed gently with sterile PBS to remove any residual contents before they were snap-
frozen and stored at -70-80C. mLN were dissected, trimmed of fat, snap-frozen and stored at -70-80C. Tissues were homogenized:
tissue samples were thawed at ambient temperature until just thawed, then submerged in 4 mL homogenization buffer (ice cold sterile
PBS containing one Pierce EDTA-Free Protease Inhibitor Tablet [ThermoFisher cat #A32965] per 50 mL) per 1 g tissue. Tissues
were homogenized using a handheld homogenizer (OMNI International, with 7 mm tip) at max speed for 30 seconds. Homogenate
was centrifuged for 20 minutes at 15,000 x g, 4C, and supernatant transferred to clean microtubes, snap-frozen and stored
at -70-80C for later analysis.
Ex vivo rat tissue signaling assay

From healthy rats, cell suspensions were prepared from the colon, mLN, and spleen. All tissues were homogenized in C tubes using a
Miltenyi gentleMACS instrument. Lamina propria cells were further isolated from colon homogenates with Liberase and DNAse digest
followed by density gradient centrifugation. Spleen homogenates were enriched for CD3+ cells using the EasySep Total Rat CD3 kit.
Cells were washed and counted, then 106 cells were transferred to each well of a 24-well treated tissue culture plate. Cells were pre-
incubated for 30 minutes with 23R-91 or vehicle (PBS), then transferred to a new 24-well treated tissue culture plate for stimulation
with anti-CD3 (plate pre-coated with 2.5 mg/mL for >2 hours) with or without recombinant rat IL-23 (1 mg/mL for colon cells, 10 ng/mL
for mLN cells and splenocytes), or vehicle (no anti-CD3 coating, PBS), as noted (n=3 wells per treatment). Cells were incubated for 24
hours at 37 C (5% CO2). Supernatant was analyzed for rat IL-17A and rat IFNɣ with ELISA (Thermo cat. # BMS635 and ERIFNG). Cells
were stained (BD fixable viability stain, FVS450) and viability measured using a CytoFlex flow cytometer (Beckman).
Pharmacokinetics and biodistribution of IL-23R minibinders in rats

All rats were handled according to established guidelines and approved protocols. Male Sprague Dawley rats (Charles River Labo-
ratories) were acclimated to study conditions for at least three days prior to dosing. Animals were 6–8 weeks old at administration and
were not fasted prior. A single 20 mg/kg dose of 23R-72 or 23R-91, formulated in PBS or in GI-protective vehicle (GPV; 0.1 M sodium
bicarbonate, 200 mg/mL nonfat dry milk) was administered by oral gavage, and blood was drawn at 15, 30, 60, 180, and 360 minutes.
A single 4 mg/kg dose of 23R-91 was administered intravenously, and blood was drawn at 5, 15, 30, 60, and 120 minutes. Six (oral) or
four (IV) hours after dosing, animals were sacrificed by exsanguination (cardiac puncture) under isoflurane anesthesia.
Female Lewis rats (Envigo) were acclimated to study conditions for at least seven days prior to study start. Animals were 6-8 weeks
at arrival. On study day -3, rats were distributed into treatment groups based on bodyweight. On study day -2 through 6, rats were
given 20 mg/kg 23R-72 or 23R-91, formulated in PBS, administered by oral gavage three times per day (TID) approximately 6 hours
apart. On study day -1, rats were fasted for 12-16 hours prior to intrarectal TNBS challenge (20 mg/rat in 50% ethanol/PBS solution)
on study day 0. On study day 7, animals were given a final timed dose of test articles as above, then sacrificed under isoflurane
e9 Cell 187, 1–13.e1–e11, August 8, 2024

ll
Article OPEN ACCESS
anesthesia by bleeding to exsanguination followed by bilateral pneumothorax. In another study, female Lewis rats as described
above were administered a single 140 mg/kg dose of 23R-91 by oral gavage, and serum was collected from 15 minutes to 24 hours
post dose for minibinder analysis with ELISA.
Minibinder concentration in serum and tissue homogenate supernatants was quantified using the custom ELISA method
described above.
Human skin-derived epithelial organoid culture

Epidermal keratinocytes were isolated from foreskin (neonatal circumcision) cut into thin strips and incubated overnight at 4 C with
Dispase (STEMCELL Technologies) containing Penicillin-Streptomycin (Gibco). Epidermis was separated from the dermis with fine
forceps, cut into small pieces with scissors and transferred into a 15 mL falcon tube containing 2 mL of warm 0,25% Trypsin/EDTA
(Gibco). The epidermis was incubated at 37 C for 1-2 min with gentle shaking to allow detachment of the basal layer of keratinocytes.
The supernatant was transferred into 5 mL of DMEM supplemented with pen/strep and 10% FBS to inactivate trypsin. This step was
repeated 4-5 times. Suspension was filtered through 70 mm to remove undigested pieces of tissues, the cells were collected by
centrifugation 5 min at 1200 rpm. Cells were resuspended into DMEM supplemented with 10% FBS and pen/strep and transferred
to a 25 cm2 cell culture flask. The next day, cells were washed with warm PBS, and KGM medium (Lonza, serum-free medium for
keratinocytes) was added. Cells were passaged when reaching 65-70% confluency and frozen after 2 passages using a serum-
free cell freezing medium (Sigma).
Epithelial organoids were generated from human keratinocytes isolated from foreskin (neonatal circumcision) as described for
mouse epithelial organoids with few modifications.58 Briefly, four days after seeding in Cultrex Basement membrane extract (BME
type 2, R&D), rhIL-17A (15 nM, Peprotech) or PBS was added to the organoid culture medium [Advanced DMEM/F12 supplemented
with 10 mM HEPES, GlutaMAX, 1% Penicillin/Streptomycin, 10% R-spondin1 containing conditioning media (in house), 0.2% Primo-
cin, 100 ng/mL rh-Noggin,1mM N-Acetyl-L-cysteine, 1 mM Y27632, 100 ng/ml rh-FGF, 100 ng/mL Forskolin, 2% B-27 supplement
and 2 mg/ml heparin solution] and cultured at 37 C with 5% CO2. For inhibition experiments, 0.75 nM of IL-17A minibinder 17-51 was
added either simultaneously, 1 hour or 3 hours after addition of rhIL-17A. After overnight incubation (16 hours), organoids were har-
vested using a nonenzymatic Cultrex organoid harvesting solution (R&D Systems). Total RNA was extracted from organoids using
RNeasy Plus Mini Kit (Qiagen), and equal amounts of RNA were reverse-transcribed using the superscript VILO cDNA synthesis
kit (Invitrogen).
Expression of human CCL20, IL-8, S100A7, and HPRT1 was quantified using PowerUp SYBR Green PCR Master Mix (Applied Bio-
systems) and gene-specific primers (see key resources table). Amplification was performed from a 5 ng cDNA template in a final vol-
ume of 20 mL in a 96-well PCR plate. Expression of markers downstream of IL-17A (CCL20, IL-8, and S100A7) was normalized to
housekeeping gene HPRT1. Fold change was calculated relative to an untreated control group and was plotted as a percent of
the response seen with hIL-17A-only treatment using the following formula:
ðfold change of sampleÞ -- ðmean fold change of untreated groupÞ
% of IL 17A response = 100
ðmean fold change IL 17 only groupÞ -- ðmean fold change of untreated groupÞ
NSG-IBD humanized mouse model of colitis

From ulcerative colitis patients, 60 mL of peripheral blood was collected into trisodium citrate solution (S-Monovette, Sarstedt, Nürn-
berg, Germany; cat. no.102332.0). Each human donor can provide PBMCs to reconstitute a maximum of 26 mice. Thus, the data
presented herein are compiled among multiple donors. As it is not feasible to coordinate PBMC donations from multiple donors
on the same day, mice were reconstituted and treated on staggered timelines per donor. Untreated and anti-IL-23 controls were
tested per donor, thus the N for these groups is higher than for 23R-91 treatment groups. N=11, as in the 80 mg/kg oral 23R-91 group,
was determined to be sufficient to reach significance.
The blood was diluted with Hank’s balanced salt solution (HBSS, Sigma-Aldrich, Deisenhofen, Germany) at a 1:1 ratio. The sus-
pension was loaded onto LeucoSep tubes (Greiner Bio One, Frickenhausen, Germany; cat. no. Z642843). PBMCs were isolated
through iterative centrifugation and resuspended in PBS to attain a concentration of 4 3 106 cells per 100 mL.
Six- to eight-week-old NOD.Cg-Prkdcscid Il2rgtm1WjI/SzJ mice (NSG; Charles River Laboratories, Sulzfeld, Germany) were kept un-
der specific pathogen-free conditions in individually ventilated cages in a facility controlled according to the Federation of Laboratory
Animal Science Association (FELASA) guidelines. Mice were engrafted with 100 mL cell solution into the tail vein on Day 1 of the
study.59 Mice were presensitized by rectal application of 150 mL of 10% ethanol on Day 7 using a 1 mm cat catheter (Henry Schein,
Hamburg, Germany; cat. no. 2734651). The catheter was lubricated with Xylocain Gel 2% (AstraZeneca, Wedel, Germany; cat. no.
01138060). Rectal application was performed under general anesthesia using 4% isoflurane (Zoetis, Berlin, Germany). After applica-
tion, mice were kept at an angle of 30 to avoid ethanol dripping. On Day 14, mice were challenged by rectal application of 50%
ethanol, following the same protocol. On Day 18, mice were sacrificed. Guselkumab (4 mg/kg, 100 mL; Creative Biolabs) was admin-
istered by i.p. on Days 6 and 13. 23R-91 (8 or 80 mg/kg, 150 mL in 1% methylcellulose gel) was administered once daily by oral gavage
on Days 6, 7, and 13-17.59
The clinical assessment of colitis severity was performed daily according to the scoring system described in Weß et al.,59 detailed
in Table S6. Daily scores were incorporated into a running total. Animals who suffered from weight loss >20%, rectal bleeding, rectal
Cell 187, 1–13.e1–e11, August 8, 2024 e10

ll
OPEN ACCESS Article
prolapse, self-isolation or a severity total score >7 were euthanized immediately and not considered in the calculation. All scores were
added for statistical analysis.
After euthanizing the mice, their colons were excised, photographed, and a macroscopic score of inflammation was determined
based on the criteria described in Table S6.59 The distal sections of the colon were initially preserved in 4% formaldehyde for 24
hours, followed by storage in 70% ethanol, and subsequently underwent standard paraffin embedding. Samples were then sectioned
into 3 mm slices, stained with hematoxylin and eosin (H&E) and Sirius Red (SR), and histological disease score assessed based on the
criteria described in Table S6.
Group averages 土 standard deviations were plotted and each treatment group compared to the challenged control group using
the non-parametric Wilcoxon matched-pairs test with GraphPad Prism 10.
Immunogenicity prediction
NetMHCII version 2.3 was used in this study.42 This software was trained to predict MHCII binding based on the Immune Epitope
DataBase (IEDB) which contains binding data for over 100,000 peptides to MHCII molecules. The software predicts binding of pep-
tides derived from the input sequence (e.g., 23R-91) to the most common MHCII variants, including 25 alleles for HLA-DR, 20 alleles
for HLA-DQ, and 9 alleles for HLA-DP, that have the largest amount of binding data in the IEDB. A percent rank was calculated for
each potential binding peptide by comparing its predicted binding affinity to that of one million random peptides. This allowed for the
classification of predicted peptide binding as strong (top 2% of predicted binders), weak (top 2-10%), and non-binding (lower 90%).
As a benchmark, the 23R-91 sequence (62 amino acids) was compared to that of Neo-2/15 (100 amino acids) and Kuma062 (553
amino acids), two engineered proteins with previously demonstrated low immunogenicity in animals or humans.15,39 Software output
values can be found in Table S7.
QUANTIFICATION AND STATISTICAL ANALYSIS
Numbers of technical and biological replicates can be found in the figure legends.
GraphPad Prism version 10.1.1 was used to compute non-parametric Wilcoxon matched-pair tests among groups of the NSG-IBD
mouse efficacy study. P values (P* <0.033, P** <0.002, P*** P<0.0001) define significance.
e11 Cell 187, 1–13.e1–e11, August 8, 2024

ll
Article OPEN ACCESS
Supplemental figures
Figure S1. Binding affinities (KD) of IL-23R and IL-17A minibinders, related to Figures 1, 2, and 3
BLI was used to quantitatively determine the binding constants of initial computational designs (IL-23R: 23R-1, 23R-2; IL-17A: 17-1, 17-2, and 17-3), combi-
natorial variants derived from 23R-1 (23R-10, 23R-13, and 23R-15), 23R-2 (23R-19, 23R-22, and 23R-24), and 17-2 (17-35), a disulfide-stabilized variant of 17-35
(17-51), and a single-chain linked dimer of 17-51 (17-53). Sample data were fit to a single 1:1 binding equation for all IL-23R binders and IL-17A binder 17-53. For
all other IL-17A binders, data were fit to a 2:1 binding equation, which reflects that two minibinder molecules in solution may bind to each of two binding sites on
immobilized hIL-17A, which are known to have unique affinities that may be influenced by the first binding event. Reported KDs are an average of the KDs
determined for the two unique interactions. Plots are representative of at least two independent experiments.
ll
OPEN ACCESS Article
Figure S2. In vitro potency, stability, and species cross-reactivity of IL-17A minibinders, related to Figure 3
(A and B) The cellular potencies of (A) 17-1, related affinity-optimized variant 17-16, and related disulfide-stabilized variant 17-45, and (B) single-chain linked
dimers of 17-53 having the indicated linker compositions were measured using an engineered IL-17 reporter cell line. Representative curves are shown above
(n R 2), and IC50 values are reported as mean ± SD of at least two independent experiments (N R 2).
(C and D) (C) 17-1 and derivatives described above, and (D) additional 17-1 derivative optimized variants were denatured with heat or chemical denaturant
guanidinium (Gdn) hydrochloride, and helicity (signal at 222 nm) was monitored using circular dichroism. Signal is plotted as a fraction of the reference sample
(0 M Gdn at 25 C).
(E) 17-51 and 17-53 inhibit mouse IL-17A with much weaker potency than human IL-17A in the IL-17 reporter cell assay.
ll
Article OPEN ACCESS
Figure S3. Saturation mutagenesis of IL-23R and IL-17A minibinders and BLI screening of affinity-optimized combinatorial variants, related
to Figures 1, 2, and 3
(A) The relative affinity of each mutation to computational designs targeting IL-23R (23R-B) or IL-17A (17-02 and 17-03) was determined using deep mutational
scanning. The enrichment (blue) or depletion (red) of each mutation, depicted in 2D heatmaps, represents its impact on affinity relative to the original minibinder
sequence (set to 0, white). Positional conservation scores are depicted in a 1D heatmap from minimum (light gray) to maximum (dark gray) per design. Asterisks
indicate native and de novo hotspots.
(B) Binding of computational designs (23R-1 and 23R-2, black dashed line) and affinity-optimized variants (23R-1 derivatives 23R-3 to 23R-15, 23R-2 derivatives
23R-17 to 23R-22, 23R-24 to 23R-28, colored lines) to hIL-23R immobilized on the BLI sensor tip was measured at 200 nM with BLI.
(C) Binding of computational design (17-1, black dashed line) and combinatorial variants (17-1 derivatives 17-4 to 17-20, 17-2 derivatives 17-21 to 17-36, colored
lines) to hIL-17A immobilized on the BLI sensor tip was measured at 500 nM.
ll
OPEN ACCESS Article
Figure S4. Additional biophysical characterization of IL-23R minibinders, related to Figure 2

(A–D) CD data, collected and represented as described in Figure 2, for affinity-optimized combinatorial IL-23R minibinders derived from (A) 23R-1 and (B) 23R-2,
and stability-optimized minibinders derived from (C) 23R-1 and (D) 23R-2.
(E) Raw CD data for lead IL-23R minibinders 23R-72 and 23R-91 after denaturation with heat. CD signal at 222 nm (helicity) was measured every 2 (left), and full
wavelength scans from 250 to 200 nm (right) were performed every 10 as well as after the sample was cooled to 25 C after heating. Dotted vertical lines mark
222 nm.
(F) SE-HPLC: 20 mL of 23R-91 at 2 mg/mL was injected onto a Superdex 75 10/300 GL column. The major peak eluted at 20.078 min, consistent with the monomer
molecular weight of 7,206 Da. A small second peak eluted at 23.845 min; LC-MS analysis identified this peak as 23R-91 with one of the two intramolecular
disulfides reduced (2 Da; data not shown).
(G) 23R-91 is soluble at >100 mg/mL; potency of 23R-91 in the IL-23 reporter cell assay is unchanged after concentration to >100 mg/mL.
(H) LC-MS analysis of 23R-91 yielded the expected molecule weight (7,206.8 Da), as well as a species likely to be 23R-91 with a formyl methionine adduct likely
caused by exposure to formic acid during the analytical method (+28 Da). SE-HPLC and LC-MS analyses were performed in at least three independent ex-
periments with various lots of 23R-91.
ll
Article OPEN ACCESS
Figure S5. IL-23R minibinders retain binding capacity after SGF or SIF digest, related to Figure 4
Stability-optimized IL-23R minibinders (23R-64 derivatives 23R-70, -72, -80, -81, and -82; 23R-49 derivatives 23R-83, -84, -85, -86, -87, -90, -91, and -92) were
tested for binding to hIL-23R after digest in SIF or SGF at the indicated time points, using BLI.
ll
OPEN ACCESS Article
Figure S6. Peptides derived from minibinders are folded and block IL-23R-mediated cell signaling, related to Figure 1
(A) Saturation mutagenesis suggests that 26-residue IL-23R binding peptides (23R-95, 23R-96, and 23R-97) have the predicted conformation and binding mode.
SSM libraries based on each peptide design sequence were sorted for improved binding to IL-23R, and relative enrichment or depletion of each mutation was
determined by deep sequencing the naive and sorted pools. The enrichment (blue) or depletion (red) of each mutation, depicted in 2D heatmaps, represents its
impact on affinity relative to the original peptide sequence (set to 0, white). Positional conservation scores are depicted in a 1D heatmap from minimum (light gray)
to maximum (dark gray) per design. Asterisks indicate native and de novo hotspots.
(B) Combinatorial libraries including enriching mutations were generated (Table S2) and sorted for improved IL-23R affinity (Table S3). The potency of the highest
affinity peptide, 23R-101, in the IL-23 reporter cell assay is shown compared with that of the best 7–8 kDa minibinder (23R-91) and a competing oral anti-IL-23R
peptide PTG-200. Representative curves are shown above, and IC50 values are reported as mean ± SD of at least three independent experiments.
ll
Article OPEN ACCESS
Figure S7. ELISA method standard curves for 23R-72 and 23R-91 in biological matrices and species cross-reactivity of 23R-91, related to
Figure 4
(A and B) Each 96-well ELISA assay plate included a standard curve of 23R-72 (A) or 23R-91 (B), prepared by spiking the minibinder in undiluted serum or tissue
homogenate supernatant at the indicated concentrations spanning the dynamic range of the assay (n = 2). The ELISA method was performed as described in
STAR Methods. Fit curves were calculated using four parameter logistic regression with Prism.
(C) Binding of 23R-91 to human IL-23R or orthologs from species commonly used in preclinical development was compared using BLI. 23R-91 shows high-affinity
binding to human, macaque, and rat IL-23R, but negligible binding to mouse IL-23R. Recombinant human or mouse IL-23 cytokines were used as positive
controls.
(D) The model of 23R-91 bound to human IL-23R is shown with positions differing from mouse IL-23R, highlighted in pink. Corroborating the BLI data, mouse IL-
23R has a single small-to-large mutation (S98Y) at the binding interface, likely responsible for abrogating binding to 23R-91. Rat and macaque IL-23R have no
mutations at the core interface (models not shown).

PIIS0092867424006317

Uploaded by

Copyright:

Available Formats

PIIS0092867424006317

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

PIIS0092867424006317

Uploaded by

Copyright:

Available Formats

Article

Preclinical proof of principle for orally delivered

d IL-23R minibinders are extremely resistant to heat, acid, and

d Oral IL-23R minibinder is as effective as a clinical mAb in

Berger et al., 2024, Cell 187, 1–13

*Correspondence: berger389@gmail.com (S.B.), dabaker@uw.edu (D.B.)

INTRODUCTION 30% of IBD patients receiving the anti-IL-23 monoclonal anti-

2 Cell 187, 1–13, August 8, 2024

Figure 1. Computational design of IL-23R and IL-17A minibinders

Cell 187, 1–13, August 8, 2024 3

1.0 1.0 1.0

0.8 0.8 0.8

0.6 0.6 0.6

0.4 0.4 0.4

0.2 0.2 0.2

0.0 0.0 0.0

1.0 1.0 1.0

0.8 0.8 0.8

0.6 0.6 0.6

0.4 0.4 0.4

0.2 0.2 0.2

0.0 0.0 0.0

Figure 2. In vitro potency and stability of the IL-23R minibinders

4 Cell 187, 1–13, August 8, 2024

Figure 3. In vitro potency and stability of the IL-17 minibinders

Cell 187, 1–13, August 8, 2024 5

Figure 4. In vitro and in vivo GI stability of IL-23R minibinders

6 Cell 187, 1–13, August 8, 2024

Figure 5. The crystal structure of 23R-91 is

weight of 23R-72 as well as precursor

Cell 187, 1–13, August 8, 2024 7

8 Cell 187, 1–13, August 8, 2024

Figure 6. IL-23R and IL-17 minibinders block

Cell 187, 1–13, August 8, 2024 9

A Figure 7. Evaluation of 23R-91 in the NSG-IBD

Oral IL-23R minibinder is as effective

10 Cell 187, 1–13, August 8, 2024

at the site of optimal uptake. B Fluorescence-activated cell sorting (FACS)

Cell 187, 1–13, August 8, 2024 11

12 Cell 187, 1–13, August 8, 2024

Cell 187, 1–13, August 8, 2024 13

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

e1 Cell 187, 1–13.e1–e11, August 8, 2024

Cell 187, 1–13.e1–e11, August 8, 2024 e2

e3 Cell 187, 1–13.e1–e11, August 8, 2024

Data and code availability

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Cell 187, 1–13.e1–e11, August 8, 2024 e4

e5 Cell 187, 1–13.e1–e11, August 8, 2024

Yeast library preparation

Fluorescence-activated cell sorting (FACS)

Cell 187, 1–13.e1–e11, August 8, 2024 e6

Deep mutational scanning

Protein expression and purification

Size exclusion high performance liquid chromatography (SE-HPLC)

Liquid chromatography-mass spectrometry (LC-MS)

Biolayer interferometry and surface plasmon resonance

e7 Cell 187, 1–13.e1–e11, August 8, 2024

Simulated gastrointestinal fluids digest