Advanced Electrochemical Biosensors
Advanced Electrochemical Biosensors
Advanced Electrochemical Biosensors
Electrochemical
Biosensors
Edited by
www.mdpi.com/journal/applsci
Advanced Electrochemical Biosensors
Advanced Electrochemical Biosensors
Editor
Tae Hyun Kim
MDPI • Basel • Beijing • Wuhan • Barcelona • Belgrade • Manchester • Tokyo • Cluj • Tianjin
Editor
Tae Hyun Kim
Department of Chemistry, Soonchunhyang University
Korea
Editorial Office
MDPI
St. Alban-Anlage 66
4052 Basel, Switzerland
This is a reprint of articles from the Special Issue published online in the open access journal
Applied Sciences (ISSN 2076-3417) (available at: https://www.mdpi.com/journal/applsci/special
issues/advanced electrochemical biosensors).
For citation purposes, cite each article independently as indicated on the article page online and as
indicated below:
LastName, A.A.; LastName, B.B.; LastName, C.C. Article Title. Journal Name Year, Volume Number,
Page Range.
© 2021 by the authors. Articles in this book are Open Access and distributed under the Creative
Commons Attribution (CC BY) license, which allows users to download, copy and build upon
published articles, as long as the author and publisher are properly credited, which ensures maximum
dissemination and a wider impact of our publications.
The book as a whole is distributed by MDPI under the terms and conditions of the Creative Commons
license CC BY-NC-ND.
Contents
Boris Lakard
Electrochemical Biosensors Based on Conducting Polymers: A Review
Reprinted from: Applied Sciences 2020, 10, 6614, doi:10.3390/app10186614 . . . . . . . . . . . . . . 5
Martin Lundblad, David A. Price, Jason J. Burmeister, Jorge E. Quintero, Peter Huettl,
Francois Pomerleau, Nancy R. Zahniser and Greg A. Gerhardt
Tonic and Phasic Amperometric Monitoring of Dopamine Using Microelectrode Arrays in
Rat Striatum
Reprinted from: Applied Sciences 2020, 10, 6449, doi:10.3390/app10186449 . . . . . . . . . . . . . . 43
v
About the Editor
Tae Hyun Kim is a Professor in the Department of Chemistry at Soonchunhyang University
(Republic of Korea). He received his PhD in chemistry at Seoul National University (Republic of
Korea) in 2007. After that, he worked in the Department of Physics at the same university from
2007 to 2009, and in the Department of Bioengineering at University of California, Berkeley (USA)
from 2009 to 2010 as a postdoctoral researcher. His current research is directed toward the pursuit of
developing bio/chemical sensors based on nano-electrochemical systems such as carbon-nanotube-,
graphene-, and nanoparticle-derived sensors.
vii
Preface to ”Advanced Electrochemical Biosensors”
Electrochemical sensors possess various advantages over conventional sensors, such as high
sensitivity and selectivity, simple instrumentation, portability, outstanding compatibility, short
analysis time, and low cost. Thus, various types of sensors based on electrochemical techniques
have been developed for the detection of chemically, biologically, and environmentally important
analytes. With recent developments in advanced material science and electronic technology such as
signal processing and front-end electronic systems, electrochemical sensing methods are comprising
a very wide range of analytical possibilities. Among these, electrochemical biosensors have
attracted significant interest for the detection of biochemical compounds such as biological proteins,
nucleotides, and even tissues due to their practical applications in health care, early diagnosis, and
environmental monitoring. Thus, this Special Issue serves the need to promote exploratory research
and development in emerging electrochemical biosensor technologies while aiming to present the
latest technological and methodological developments in this interdisciplinary field. We invite
contributions on topics that include but are not limited to various state-of-the-art electrochemical
biosensing technologies.
ix
applied
sciences
Editorial
Toward Emerging Innovations in Electrochemical
Biosensing Technology
Tae Hyun Kim 1,2
1 Department of Chemistry, Graduate School, Soonchunhyang University, Asan 31538, Korea; thkim@sch.ac.kr
2 Department of ICT Environmental Health System, Graduate School, Soonchunhyang University,
Asan 31538, Korea
Abstract: With the progress of nanoscience and biotechnology, advanced electrochemical biosensors
have been widely investigated for various application fields. Such electrochemical sensors are
well suited to miniaturization and integration for portable devices and parallel processing chips.
Therefore, advanced electrochemical biosensors can open a new era in health care, drug discovery,
and environmental monitoring. This Special Issue serves the need to promote exploratory research
and development on emerging electrochemical biosensor technologies while aiming to reflect on the
current state of research in this emerging field.
The last decade has been marked by the identification of the rapidly emerging inno-
vations in nanosystems and biotechnology [1–3]. These innovations have accelerated the
creation of new electrochemical biosensors with remarkable improvements in sensitivity,
selectivity, accuracy, and multiplexing capacity, along with significant size reductions [4].
Electrochemical biosensors consist of three parts: a sensitive biocomponent that recognizes
Citation: Kim, T.H. Toward the analyte, an electrochemical signal transducer or detector component that transforms
Emerging Innovations in
the recognition into a measurable electrochemical signal, and an amplification and reader
Electrochemical Biosensing
device (Figure 1). With a rich inventory of advanced material science and electronic technol-
Technology. Appl. Sci. 2021, 11, 2461.
ogy such as signal processing and front-end electronic systems, researchers have overcome
https://doi.org/10.3390/app11062461
the limitations of conventional sensors, such as low sensitivity and lack of availability of
miniaturization and integration to parallel processing chips. This Special Issue is ded-
Received: 5 March 2021
icated to original results, achievements, and reviews by active researchers working on
Accepted: 9 March 2021
Published: 10 March 2021
current state-of-the-art research of electrochemical biosensors. In this editorial, we intend
to introduce the topic of the Special Issue, briefly describe each of the contributions that
Publisher’s Note: MDPI stays neutral
make up this Special Issue, and provide some perspectives on the future development of
with regard to jurisdictional claims in
electrochemical biosensors.
published maps and institutional affil-
One of the ongoing issues met by biosensing devices is the immobilization process
iations. used to intimately connect the bio-specific element onto the transducer without the loss of
selectivity and sensitivity. Boris Lakard summarized the latest efforts to develop efficient
immobilization approaches for biorecognition elements by entirely maintaining their bio-
logical activity, through the utilization of conducting polymers [5]. Conducting polymers
have been employed in developing high-performance electrochemical biosensors owing
Copyright: © 2021 by the author.
to their advantages such as their charge transport properties and chemical versatility. In
Licensee MDPI, Basel, Switzerland.
This article is an open access article
particular, conducting polymers can be easily modified and functionalized, which enables
distributed under the terms and
immobilization of biorecognition molecules efficiently without the inactivation of their
conditions of the Creative Commons biological properties. In his review, Boris Lakard showed the recent progress in the applica-
Attribution (CC BY) license (https:// tion of conducting polymers in the recognition of biotargets leading to the development
creativecommons.org/licenses/by/ of enzymatic biosensors, immunosensors, DNA biosensors, and whole-cell biosensors
4.0/). with cost-effectiveness and high sensitivity. The improvement in the sensitivity can also
Figure 1. Illustration depicting electrochemical biosensors and their signal transduction principle.
Electrochemical sensing devices are highly suitable for miniaturization since they can
be made by conventional microfabrication methods and their analytical performance is
maintained even in reduced size. This enables the electrochemical devices to be imple-
mented in various type of microsystems. In this context, two papers aimed at the utilization
of electrochemical sensing techniques in microelectrode arrays and microfluidic devices.
Lundblad et al. demonstrated a novel microelectrode array approach for monitoring the
release of dopamine in the rat striatum [7]. The proposed approach showed highly sensi-
tive detection of tonic (resting) and phasic release of dopamine with subsecond temporal
resolution in vivo. Meanwhile, Bruijns et al. reported a microfluidic approach for DNA
analysis in forensics [8]. They claimed that the microfluidic devices improve the chain of
custody, reduce the contamination risk, and offer fast analysis, enabling them to be used at
crime scenes. Indeed, they showed that cyclic olefin copolymer (COC)-based microfluidic
device chips could be employed for real-time monitoring of DNA amplification down to
0.01 ng/μL.
Taking advantage of their high sensitivity and selectivity, simple instrumentation,
portability, outstanding compatibility, short analysis time, and low cost, advanced electro-
chemical biosensors have been widely used for various applications in the medical and
healthcare sector, the food industry, and environmental monitoring. As a medical applica-
tion of electrochemical sensors, early diagnosis of metabolic errors was introduced, and the
related research was reviewed by Karastogianni et al. [9]. Their review summarized various
electrochemical biosensors and point-of-care devices for the detection of branched-chain
amino acids which are biomarkers for maple syrup urine disease, an inherited metabolic
disorder in which the body cannot process certain amino acids properly.
To summarize, with the continuous progress of nanobiotechnology and the rapid
development of electronic devices, innovative frontiers on electrochemical sensors have
been launched, enabling prompt utilization of the sensors in various applications, such
as medical diagnosis, drug discovery, environmental monitoring, the food industry, and
light and heavy chemical industries. A forthcoming advancement in electrochemical
biosensors may offer flexible and smooth integration into next-generation ICT systems,
making everyday life smarter and easier.
2
Appl. Sci. 2021, 11, 2461
Acknowledgments: This work was conducted with the support of the Korea Environment Industry
& Technology Institute (KEITI), through its Ecological Imitation-based Environmental Pollution Man-
agement Technology Development Project, and funded by the Korea Ministry of Environment (MOE)
(2019002800001). This work was also supported by the Soonchunhyang University Research fund.
Conflicts of Interest: The author declares no conflict of interest.
References
1. Newberry, D. Nanotechnology Past and Present: Leading to Science, Engineering, and Technology; Synthesis lectures on engineering,
science, and technology; Morgan & Claypool: San Rafael, CA, USA, 2020; ISBN 978-1-68173-861-1.
2. Webster, T.J.; Yazici, H. (Eds.) Biomedical Nanomaterials: From Design to Implementation; Healthcare technologies series; The
Institution of Engineering and Technology: London, UK, 2016; ISBN 978-1-84919-964-3.
3. Salar, R.K. Biotechnology: Prospects and Applications; Springer India: New Delhi, India, 2013; ISBN 978-81-322-1683-4.
4. Zhu, C.; Yang, G.; Li, H.; Du, D.; Lin, Y. Electrochemical sensors and biosensors based on nanomaterials and nanostructures. Anal.
Chem. 2015, 87, 230–249. [CrossRef] [PubMed]
5. Lakard, B. Electrochemical biosensors based on conducting polymers: A review. Appl. Sci. 2020, 10, 6614. [CrossRef]
6. Hamami, M.; Raouafi, N.; Korri-Youssoufi, H. Self-assembled MoS2/SsDNA nanostructures for the capacitive aptasensing of
acetamiprid insecticide. Appl. Sci. 2021, 11, 1382. [CrossRef]
7. Lundblad, M.; Price, D.A.; Burmeister, J.J.; Quintero, J.E.; Huettl, P.; Pomerleau, F.; Zahniser, N.R.; Gerhardt, G.A. Tonic and
phasic amperometric monitoring of dopamine using microelectrode arrays in rat striatum. Appl. Sci. 2020, 10, 6449. [CrossRef]
8. Bruijns, B.; Tiggelaar, R.; Gardeniers, H. A microfluidic approach for biosensing DNA within forensics. Appl. Sci. 2020,
10, 7067. [CrossRef]
9. Karastogianni, S.; Girousi, S. Electrochemical (bio)sensing of maple syrup urine disease biomarkers pointing to early diagnosis:
A review. Appl. Sci. 2020, 10, 7023. [CrossRef]
3
applied
sciences
Review
Electrochemical Biosensors Based on Conducting
Polymers: A Review
Boris Lakard
UFR Sciences et Techniques, University Bourgogne Franche-Comté, Institut Utinam UMR CNRS 6213,
16 Route de Gray, 25030 Besançon, France; boris.lakard@univ-fcomte.fr; Tel.: +33-381-662-046
Abstract: Conducting polymers are an important class of functional materials that has been
widely applied to fabricate electrochemical biosensors, because of their interesting and tunable
chemical, electrical, and structural properties. Conducting polymers can also be designed through
chemical grafting of functional groups, nanostructured, or associated with other functional materials
such as nanoparticles to provide tremendous improvements in sensitivity, selectivity, stability
and reproducibility of the biosensor’s response to a variety of bioanalytes. Such biosensors are
expected to play a growing and significant role in delivering the diagnostic information and therapy
monitoring since they have advantages including their low cost and low detection limit. Therefore,
this article starts with the description of electroanalytical methods (potentiometry, amperometry,
conductometry, voltammetry, impedometry) used in electrochemical biosensors, and continues with
a review of the recent advances in the application of conducting polymers in the recognition of
bioanalytes leading to the development of enzyme based biosensors, immunosensors, DNA biosensors,
and whole-cell biosensors.
1. Introduction
Conducting polymers have attracted much interest since Shirakawa et al. demonstrated in 1977 that
halogen doping of polyacetylene strongly increased its conductivity [1]. Thanks to this revolutionary
research, Shirakawa, MacDiarmid, and Heeger were awarded the Nobel Prize in Chemistry in 2000,
and opened the way to the development of other conducting polymers combining properties of organic
polymers and electronic properties of semiconductors. Another major breakthrough in this field
was achieved by Diaz et al., who reported the electrodeposition of highly conductive, stable and
processable polypyrrole films [2–4]. Following these pioneering studies, numerous conducting
polymers have been prepared and used in various applications, such as polyacetylene, polypyrrole
(PPy), polyaniline (PANI), polycarbazole, polythiophene (PTh), poly(3,4-ethylenedioxythiophene)
(PEDOT), polyphenylene, poly(phenylene vinylene), and polyfluorene (Table 1). All these organic
polymers are characterized by alternating single (σ) and double (π) bonds and by the presence of π
electrons delocalized across their entire conjugated structure, thus resulting in polymers which can
be easily oxidized or reduced [5]. This doping, that can be performed upon oxidation (p-doping) or
reduction (n-doping), increases significantly the conductivity of the polymers since this conductivity
can vary from less than 10−6 S/cm in the neutral state [5] to more than 105 S/cm in the doped state [6,7].
The conductivity of the polymers is also dependent on a number of factors including the nature
and concentration of the dopant [8–10], temperature [11–13], swelling/deswelling [14], polymer
morphology [8], pH and applied potential [15], and polymer chain length [16]. For most heterocyclic
polymers, such as PPy [17] or PTh [18], the mechanism of conduction corresponds to a p-doping and
starts with the removal of one electron from the initial monomer leading to the formation of an unstable
radical cation (named polaron). Then, a second electron is removed from another monomer or from an
oligomer, leading to the formation of a dication (named bipolaron) [19]. Under an applied electric field,
these polarons and bipolarons serve as charge carriers which are delocalized over the polymer chains
and their movement along polymer chains produces electronic conductivity [20].
Table 1. Chemical structures of some common conducting polymers: (a) polyacetylene, (b) polypyrrole,
(c) polyaniline, (d) polycarbazole, (e) polythiophenes, (f) poly(3,4-ethylenedioxythiophene),
(g) polyphenylenes, (h) poly(phenylene vinylene), (i) polyfluorene.
Conducting polymers have become an important class of materials since they combine some
useful properties of organic polymers (such as strength, plasticity, flexibility, toughness or elasticity)
with unusual electronic [5], optical [21,22] and thermoelectric [23,24] properties due to the charge
mobility along the π electron polymer chains. These unique properties explain the use of conducting
polymers in a wide variety of applications including energy storage with rechargeable batteries [25,26]
and supercapacitors [27,28], photovoltaics with solar cells [29–32], light-emitting diodes [33,34],
electrocatalysis [35], anti-corrosion [36,37] or electrochromic applications such as electrochromic
displays [38,39] or rearview mirrors and smart windows [40,41].
6
Appl. Sci. 2020, 10, 6614
a monomer, a solvent and a supporting salt. The electropolymerization can be achieved either with
a potentiodynamic technique such as cyclic voltammetry where the current response to a linearly
cycled potential sweep between two or more set values is measured, with a potentiostatic technique
where a constant potential is applied to initiate the polymerization, or with a galvanostatic technique
where a constant current is applied to initiate polymerization. The potentiostatic technique allows
easy control of the film thickness through Faraday’s law, whereas potentiodynamic techniques lead to
more homogeneous and adherent films on the electrode. Additionally, the galvanostatic technique
is generally considered as the best approach since it allows to follow the growth of the conducting
polymer film by monitoring the potential changes with time which reflects the conductivity.
Conducting polymers have been widely used in the area of bioanalytical and biomedical
science [52,53], drug delivery [54–56], tissue engineering [57–59], and cell culture [60–62] due to
their intrinsic properties and biocompatibility [63–66]. In addition, conducting polymers represent
an attractive sensitive material for biosensors due to their electrical properties that allow to convert
biochemical information into electrical signals. Additionally, conducting polymers can be easily
modified by grafting of functional groups which offers the possibility to enhance their abilities to
detect and quantify bioanalytes or to maximize the interactions between the biomolecules and the
functionalized polymer. Therefore, after a short description of the electrochemical techniques used in
conducting polymer-based biosensors, a series of examples of such biosensors will be described to
highlight the recent advances in the field of conducting polymer-based electrochemical biosensors.
2.2. Strategies for Immobilizing Biological Sensing Elements into Conducting Polymers
Biological sensing element immobilization plays a fundamental role in the performance
characteristics of biosensors since biomolecules must be directly attached to the surface of the
biosensor to obtain a good sensitivity and a long operational life. The most commonly used methods
to immobilize biomolecules to polymers are physical adsorption, covalent attachment and entrapment
(Figure 1). The choice of immobilization strategy mainly depends on the type of biological element.
Indeed, antibodies and ssDNA are preferentially immobilized by adsorption or covalent binding onto
the surface of the conducting polymer films to facilitate the access of the analyte to these biorecognition
molecules when entrapment is generally used to immobilize oxidoreductases within the polymer film
to facilitate the electron transfer from the enzyme’s redox center to the analyte solution surrounding the
conducting polymer and the rapid redox reaction of electroactive species such as hydrogen peroxide
generated by enzymatic catalysis.
The method of covalent immobilization uses the functional groups of biomolecules (such as
–COOH, -NH2 , or -SH) for binding with a conducting polymer. Thus, a biomolecule containing amino
groups has the capacity to form amide bonds with a conducting polymer bearing carboxylic groups.
For example, Kim et al. have developed a glucose biosensor with a conducting electrosynthesized
7
Appl. Sci. 2020, 10, 6614
poly(terthiophene benzoic acid) bearing benzoic acid groups which allow the immobilization of glucose
oxidase (GOx) through amide bond formation [67]. Similarly, Tuncagil et al. electrosynthesized
the conducting polymer 4-(2,5-di(thiophen-2-yl)-1H-pyrrol-1-yl) benzenamine to immobilize GOx
through amide bonds [68]. Moreover, covalent attachment of biomolecules is frequently achieved by
initial synthesis of functionalized monomers with an amino side group, followed by electrochemical
polymerization of these functionalized monomers leading to conducting polymer films with interfacial
attachable side groups that can be covalently bound to biomolecules containing the corresponding
groups. To facilitate the formation of covalent bonds between biomolecules and polymers, crosslinking
agents such as glutaraldehyde [69,70] or 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) [71,72]
are commonly used. The covalent immobilization method has the benefit of providing low diffusional
resistance, giving strong binding force between biomolecule and polymer, thus reducing loss of
biomolecule. Therefore, these electrodes are more stable in time even if it may be difficult in some
cases to retain the biomolecule activity.
The adsorption method is very simple and only consists in the physical adsorption of the
biomolecule on the polymer surface. Sometimes, the presence of opposite charges into the conducting
polymer and the biomolecule facilitates the immobilization of the biomolecule. Thus, negatively
charged glucose oxidase was successfully adsorbed onto positively charged polyaniline-polyisoprene
films at pH 4.5 to provide a material sensitive to glucose concentration changes [73]. This method
has the benefit of providing small perturbation of the biomolecule native structure and function and
so generally leads to very sensitive responses. However, a strong drawback is that direct physical
adsorption of biomolecule on a surface generally leads to poor long-term stability of the sensor because
of biomolecule leakage from the surface when changes in the environment arise (pH, ionic strength)
even if the modification of the surface by a polymer film can slow this leakage [74,75].
Entrapment is another method widely used for the immobilization of enzymes [76,77],
antibodies [78] or DNA [79]. It involves the preparation of an electrolyte solution containing
both monomer and biomolecule, followed by the electropolymerization of the whole solution. Thus,
a polymer film containing biomolecules is formed at the electrode surface. Entrapment is an interesting
technique since it leads to a strong adhesion between biomolecule and polymer film in a single step.
Additionally, this strategy includes the possibility of controlling the amount of entrapped biomolecules
simply by controlling the thickness of the electrodeposited polymer film. Entrapment generally leads
to biosensors with a good sensitivity and a long lifetime. On the contrary, entrapment can generate
problems associated with inaccessibility of the embedded biomolecule. Additionally, some conducting
polymers require very acidic conditions or high oxidation potential during the electropolymerization
process to be prepared but these conditions are not favorable to biomolecules [80]. It is also important
to note that supporting electrolytes are usually used during the electropolymerization process to
increase the conductivity of the monomer solution. Besides, the electrolytes tend to compete with the
biomolecules for the polymer doping sites, and so reduce the amount of biomolecule entrapped which
is a problem especially for costly biomolecules. A solution to this problem is the use of biomolecules as
counter-ions during the growth of the conducting polymer film to allow a more efficient entrapment as
previously done with polypyrrole and GOx enzyme [81]. To enhance the incorporation of enzymes
into polymers during their electropolymerization, it is also possible to use sinusoidal voltages as
evidenced by Lupu et al. who developed dopamine biosensors based on tyrosinase entrapped into
PEDOT film [82].
3. Electroanalytical Methods
When conducting polymers are used as sensitive material in electrochemical sensors, the capture
of a target analyte to a bioreceptor immobilized in a conducting polymer generates an analytical
measurable signal which is converted into an electrical signal (Figure 2). The presence of the conducting
polymer is beneficial for improving sensitivity and selectivity of the biosensor while reducing the effect
of interfering species. The selectivity of the biosensor strongly depends on the presence of specific
8
Appl. Sci. 2020, 10, 6614
interactions between the analyte and the bioreceptor when the quality of the immobilization of the
bioreceptor to the conducting polymer and of the conducting polymer to the surface of the biosensor is
mainly responsible for the long-term efficiency of the biosensor. The sensitivity of the biosensor depends
on many factors, the main one being the intensity of the electrochemical signal generated by the reaction
between the analyte, the bioreceptor and the conducting polymer. This electrochemical signal can be a
change in the value of the voltage, current, conductivity/resistance, impedance, or number of electrons
exchanged through an oxidation or reduction reaction leading to the fabrication of potentiometric,
amperometric, conductimetric, impedimetric and voltametric biosensors, respectively.
3.1. Potentiometry
In potentiometric conducting polymer-based biosensors, the potential between a reference
electrode and an electrode coated either with a conducting polymer and a biorecognition element
is measured using a high impedance voltmeter. The conducting polymer must be sensitive to the
products of a reaction involving the analyte bound to the biorecognition element. This modified
electrode senses the variation in protons (or other ions) amount since potential and pH are linked
by the Nernst equation, leading to a recorded analytical signal which is generally logarithmically
correlated with the analyte concentration.
The most widely studied potentiometric biosensors are enzymatic biosensors that use an enzyme
incorporated in the conducting polymer to catalyze a reaction producing protons. For example,
in potentiometric urea enzymatic biosensors, urease is immobilized in a polymer and is used to catalyze
the conversion of urea to carbon dioxide, ammonia and protons which produce a pH increase detected
by the potentiometric biosensor (see Section 4.1).
3.2. Amperometry
In amperometric conducting polymer-based biosensors, the current produced during the oxidation
or reduction of an electroactive biological element at a constant potential that is applied between a
reference electrode and a polymer-modified electrode is measured, thus providing specific quantitative
analytical information. Such biosensors are inspired by the first and simplest amperometric biosensor
developed by Clark in 1956 who fabricated an amperometric oxygen sensor that produced a current
proportional to the oxygen concentration when a potential of −0.6 V vs. Ag/AgCl electrode was applied
to a platinum electrode [83].
The most widely studied amperometric biosensor is the glucose biosensor. In this system, glucose
oxidase catalyzes the reaction of glucose with oxygen to produce gluconolactone and hydrogen
peroxide. By monitoring the amount of hydrogen peroxide produced by this reaction in the presence
of GOx through amperometric measurements, it is possible to determine the glucose concentration.
In such biosensors, the GOx is immobilized in the conducting polymer either by electropolymerization
of a solution containing a monomer and GOx or by addition of GOx in an electrodeposited conducting
polymer film (see Section 4.1).
9
Appl. Sci. 2020, 10, 6614
3.3. Conductometry
In conductometric conducting polymer-based biosensors, a change in electrical conductivity or
resistivity is measured against the analyte concentration when a constant or sweeping potential is
applied between a reference electrode and a polymer-modified electrode. To increase the sensitivity
of the sensor, the conducting polymer must be highly conductive when it is charged (doped) and
lowly conductive when it is neutral (dedoped), thus leading to a strong conductivity change when
the conducting polymer reacts with the analyte. Furthermore, the morphology of the conducting
polymer is important since the charges that are created within the backbone of the polymer must be
able to interact with the surrounding environment and thus to change the polymer’s conductivity.
However, these biosensors often suffer from their lack of selectivity since any change in conductivity in
the solution modifies their signal.
An example of conductometric biosensor was fabricated by Forzani et al. [84] who coated a
pair of nanoelectrodes with PANI/GOx. Their exposure to glucose resulted in the reduction of GOx
which was spontaneously reoxidized in the presence of oxygen to form hydrogen peroxide which
oxidized the PANI, leading to a change in conductivity that can be monitored and used to determine
the glucose concentration.
3.4. Voltammetry
In voltametric conducting polymer-based biosensors, a current is produced by sweeping the
potential applied between a reference electrode and a polymer-modified electrode over a range that is
associated with the redox reaction of the analyte. This redox reaction generates a change in the peak
current which can be correlated with the analyte concentration, thus providing specific quantitative
analytical information. All the voltametric methods that can be used, such as linear voltammetry,
cyclic voltammetry, differential pulse voltammetry, or square wave voltammetry, have the advantage
of providing both qualitative information deduced from the potential location of the current peak and
quantitative information deduced from the peak current intensity.
For example, the detection of acetylcholine was successfully achieved using a conductive PEDOT
film loaded with Fe3 O4 nanoparticles and reduced graphene oxide since the intensity of the oxidation
peak present in the cyclic voltammograms was linear to the acetylcholine concentration [85]. Similarly,
the detection of serotonin in banana was done by square wave voltammetry using conducting
polypyrrole/Fe3 O4 nanocomposites [86] and the detection of danazol was performed by differential
pulse voltammetry using conducting electrodeposited polyaniline [87].
3.5. Impedancemetry
Electrochemical impedance spectroscopy (EIS) is a sensitive technique for the analysis of
biomolecular recognition events of specific binding proteins, nucleic acids, whole cells, antibodies or
antibody-related substances, occurring at the modified surface [88–90]. In particular, many studies on
impedometric biosensors are focused on immunosensors since the bonding between antibodies and
antigens leads to the formation of an immunocomplex resulting in electron transfers and impedance
changes (see Section 4.2). Moreover, impedometric biosensors allow direct detection of biomolecular
recognition events without using enzyme labels and have the advantages of low cost, ease of use,
portability and ability to perform both screening and online monitoring without being destructive.
In impedometric immunosensors, conducting polymers are generally used to immobilize the antigens,
commonly through covalent attachment, thus allowing the detection of the antibodies due to the high
antigen-antibody affinity [91–93].
10
Appl. Sci. 2020, 10, 6614
11
Appl. Sci. 2020, 10, 6614
for sensing of glucose leading to lower detection limit, higher sensitivity, and greater stability than
those obtained without nanoparticles [104]. Concerning carbon materials, Yuan et al. constructed a
glucose biosensor based on GOx adsorbed onto a film of polyaniline containing multiwall nanotubes
and Pt nanoparticles via covalent interaction with glutaraldehyde [107]. The resulting biosensor
exhibited very high sensitivity because of the synergistic catalytic activity between polyaniline,
multiwall nanotubes and Pt nanoparticles. Another electrochemical glucose biosensor based on
glucose oxidase immobilized on a surface containing Pt nanoparticles electrodeposited on conducting
poly(Azure A) previously electropolymerized on activated screen-printed carbon electrodes has
been developed [108]. The resulting biosensor was validated towards glucose oxidation in real
samples and further electrochemical measurement associated with the generated H2 O2 (Figure 3).
The electrochemical biosensor operated at a low potential (0.2 V vs. Ag/AgCl) and was successfully
applied to glucose quantification in several real samples (commercial juices and a plant cell culture
medium), exhibiting a high accuracy when compared with a classical spectrophotometric method.
Figure 3. Anodic linear scan voltammetry responss of the different electrode modification steps in the
absence (dashed lines) and the presence of 5M of H2 O2 (solid lines) in 0.1 M phosphate buffer solution.
SPCE: Screen-printed carbon electrodes, aSPCE: activated SPCE, PAA: Poly(Azur A), PtNPs: Platinum
Nanoparticles, GOx: glucose oxidase. Reproduced with permission of [108], Copyright 2020, MDPI.
Enzymatic electrochemical biosensors can also be based on a conducting polymer and metal
oxide nanoparticles. For example, a biosensor based on lipase was developed for amlodipine besylate
(AMD) drug using a mixture of polyaniline, iron oxide and gelatin (Figure 4). After preparation of the
sensitive material (step 1), the enzyme was entrapped in the biocomposite matrix film with the aid
of a glutaraldehyde cross-linking reagent (step 2) to establish the immobilization of the lipase (step
3) [109]. Cyclic voltammetry (A) and impedometry (B) were then used for detection experiments which
proved that such material was a good candidate for the construction of a sensitive biosensor for AMD
analysis (Figure 4b). Similarly, another glucose biosensor was prepared from polyaniline, nickel oxide
nanoparticles and graphene oxide in order to exploit the synergy between those kinds of materials
The biosensor showed a good sensitivity, a low detection limit of 0.5 mM, and a good selectively since
12
Appl. Sci. 2020, 10, 6614
glucose could be detected in the presence of common interfering species such as ascorbic acid, uric acid
and dopamine. [110].
(a)
(b)
Figure 4. (a) Schematic representation of the biosensor elaboration using PANI@Fe2 O3 ; (b) Voltammograms
at 50 mV/s (A) and Diagram of Nyquist at −200 mV potential of Pt bare electrode and Pt electrode modified
with an enzymatic membrane in 0.1 M phosphate buffered saline solution in the presence of Fe(CN6 )3−/4− .
(B) impedometry Reproduced with permission of [109], Copyright 2018, MDPI.
13
Appl. Sci. 2020, 10, 6614
electrocatalysis as indicated by its high sensitivity (97 μA·mM−1 ·cm−2 ), fast response time (3 s),
efficient preservation of enzyme activity, and effective discrimination to common interfering species.
The strategy consisting in the use of polymer nanowires was also chosen by Xu et al. who developed
a glucose biosensor, based on the modification of well-aligned polypyrrole nanowires array with Pt
nanoparticles and subsequent surface adsorption of GOx [112]. This biosensor showed evidence of
direct electron transfer due mainly to modification incorporating Pt nanoparticles and allowed either
potentiometric or amperometric detection. Using another strategy, Komathi et al. prepared polyaniline
nanoflowers with protruded whiskers at the edge of the flowers using cetyltrimethylammonium
bromide as a soft template and fine tuning the graft co-polymerization conditions. These nanostructures
exhibited wider linear concentration range, low detection limit, and high sensitivity compared to most
of the previously reported classical enzyme glucose sensors [113].
An ultimate goal of the biosensors is to eliminate the usage of the mediator to lower fabrication
cost and complexity while increasing the durability of the biosensor. Therefore, the third-generation
biosensors based on the direct electron transfer from immobilized enzyme to the working electrode are a
more progressive type of sensor. Such direct electron transfer have been evidenced from redox enzymes
to electrode in conducting polymer-based biosensors by Ramanivicius et al. who reported for the first
time that direct electron-transfer processes between a polypyrrole entrapped quinohemoprotein alcohol
dehydrogenase from Gluconobacter sp. 33 and a platinum electrode take place via the conducting-polymer
network [114]. The cooperative action of the enzyme-integrated prosthetic groups is assumed to allow
this electron-transfer pathway from the enzyme’s active site to the conducting-polymer backbone.
This electron-transfer pathway leads to a significantly increased linear detection range of an ethanol sensor.
Since this work, dehydrogenase based bioelectrocatalysis has been increasingly exploited in order to
develop electrochemical biosensors with improved performances since dehydrogeases are able to directly
exchange electrons with an appropriately designed electrode surface, without the need for an added
redox mediator, allowing bioelectrocatalysis based on a direct electron transfer process [115]. A direct
electron transfer can also occur from immobilized glucose oxidase via grafted and electropolymerized
1,10-phenanthroline [116]. Such polymer-modified biosensor showed superior electron transfer to/from
flavine adenine dinucleotide cofactor of GOx as well as an excellent selectivity towards glucose and a good
operational-stability. Similarly, a biosensor based on electrodeposited polycarbazole was fabricated and
exhibited good electrocatalytic activity toward enzymatic glucose sensors with a high sensitivity, a wide
linear range of detection up to 5 mM due to direct electron transfer from the enzyme to electrode and
direct glucose oxidation on the electrode [117]. Table 2 summarizes the performances of these conducting
polymer-based glucose amperometric biosensors.
Active Layer Linear Range Sensitivity Detection Limit Stability Real Samples? Ref.
Polypyrrole-CNT-chitosan 1–4.7 mM 2860 μA mM−1 cm−2 5.0 μM 45 days serum [101]
Polypyrrole-CNT 1–4.1 mM 54.2 μA mM−1 cm−2 5.0 μM 45 days serum [102]
Polyaniline-Prussian Blue 2–1.6 MM 99.4 μA mM−1 cm−2 0.4 μM. 15 days serum [103]
Polyaniline-Au NP 1–20 mM 14.6 μA mM−1 cm−2 1.0 μM — — [104]
Polyaniline-Pt NP 0.01–8 mM 96.1 μA mM−1 cm−2 0.7 μM — — [106]
Polyaniline-CNT 3–8.2 mM 16.1 μA mM−1 cm−2 1.0 μM 48 days serum [107]
Poly(Azure A)-Pt NP 0.02–2.3 mM 42.7μA mM−1 cm−2 7.6 μM 3 month fruit juice [108]
Polyaniline-Graphene-NiO2 0.02–5.56 mM 376.2 μA mM−1 cm−2 0.5 μM — serum [110]
Polyaniline 0.01–5.5 mM 97.2 μA mM−1 cm−2 0.3 μM 15 days urine [111]
Polypyrrole-Pt NP 0.1–9 mM 34.7 μA mM−1 cm−2 27.7 μM — — [112]
Polyaniline-nanodiamonds 1–30 mM 2.03 mA mM−1 cm−2 18.0 μM 30 days serum [113]
Polycarbazole 0.01–5 mM 14.0 μA mM−1 cm−2 0.2 μM — — [117]
14
Appl. Sci. 2020, 10, 6614
15
Appl. Sci. 2020, 10, 6614
(a). Then, oxidized HSA antibody (d) and BSA (e) were immobilized onto the polyaniline-Au layer.
Finally, the evolution of impedance (g) was used to quantify the amount of HSA (f). The normalized
impedance variation during immunosensing increased linearly with HSA concentration and the
biosensor displayed highly repeatable and highly specific response to HSA concentration [122].
Figure 5. Schematic representation of the protocol for surface modification and immunosensing. SPCE:
Screen-printed carbon electrodes, PANI: polyailine, AuNCs: gold nanocrystals, HSA: human serum
albumin, Ab-HSA: anti-HAS, EIS: electrochemical impedance spectroscopy. (a) screen-printed working
electrode ; (b) polyaniline ; (c) Au nanocrystals (d) oxidized HSA antibody (e) BSA (g) the evolution of
impedance (g) HSA Reproduced with permission of [122], Copyright 2019, MDPI.
Recently, the first immunosensors based on conducting polymer nanostructures using template
methods have been developed. For example, an immunosensor for the determination of
alpha-fetoprotein (AFP) was fabricated based on the three-dimensional macroporous polyaniline doped
with poly (sodium 4-styrene sulfonate) by using a hard-template method [123]. The 3D macroporous
PANI possessed large surface area, high conductivity and many functional groups, which allowed the
immobilization of anti-AFP. Based on differential pulse voltammetry measurements, the prepared AFP
immunosensor showed a wide linear range for AFP from 0.01 to 1000 pg/mL, with a detection limit of
3.7 fg/mL. Table 3 summarizes the performances of these conducting polymer-based immunosensors.
Active Layer Target Detection Mode Linear Range Detection Limit Ref.
Polyaniline-poly(vinylsulfonic
atrazine amperometry 0.12–5 μM 0.1 μg/L [118]
acid)
Polythiophene derivative
Carp vittelogenin impedometry 1–8 μg/L 0.42 μg/L [119]
(with—COOH groups)
Polypyrrole-polythionine neuron-specific enolase voltammetry 0.001–100 pg/mL 0.65 pg/mL [120]
Polypyrrole-polythionine carcinoma antigen-125 1–20 mM 0.0001–1000 U/mL 0.00125 U/mL [121]
voltammetry +
Polyaniline/Au nanocrystals human serumalbumin 3–300 μg/mL 3 μg/mL [122]
impedometry
Polyaniline-poly(sodium
voltammetry 0.01–1000 pg/L 3.7 fg/mL [123]
styrene sulfonate)
16
Appl. Sci. 2020, 10, 6614
hybridization. Conducting polymers are frequently used for fabrication of DNA biosensors since the
immobilization of oligonucleotide (ODN) probes onto conducting polymers generally provides an
electrochemical response which allows a direct way to detect hybridization events.
Adsorption method for probe DNA immobilization into conducting polymers offers the simplest
methodology but suffers from poor stability and response if not properly optimized. One of the most
convincing studies using the adsorption method has been carried out by Dutta et al. who used few
layered MoS2 nanosheets blended with conducting polyaniline to perform DNA sensing via differential
pulse voltammetry technique [124]. This biosensor worked well even at concentrations as low as
10−15 M of target DNA and showed highly satisfactory results in case of serum samples. It is also
possible to use ODN entrapment in conducting polymer films even if this method is not the most
widely used in the area of DNA sensors since it can be difficult for the DNA target to access the
entrapped ODN. However, some works exist such as the one of Eguiluz et al. who entrapped an
ODN probe in a polypyrrole film during its electropolymerization, leading to a low detection limit of
Alicyclobacillus acidoterrestris DNA [125]. Another strategy was used by Tlili et al. who synthesized
a polypyrrole derivative to facilitate the covalent attachment of an ODN. Indeed, the copolymer
poly [3-acetic acid pyrrole, 3-N-hydroxyphthalimide pyrrole)] was electropolymerized, then a direct
chemical substitution of the leaving N-hydroxyphthalimide group by the oligonucleotide was realized
leading to the formation of amide bonds between the ODN probe bearing a terminal amino group on
its 5 phosphorylated position and the copolymer film [126]. The hybridization reactions with the DNA
complementary target and non-complementary target were then investigated by both amperometric
and impedimetric analyses which demonstrated a good sensitivity and low detection limit (1 pmol).
The elaboration of nanocomposites by combination of conducting polymers and metallic or carbon
materials can also be used to covalently attach ODN and enhance the response of DNA biosensors. Thus,
Wilson et al. fabricated a DNA biosensor in which a DNA labelled at 5 end using 6-mercapto-1-hexhane
was covalently immobilized by the Au-thiol chemistry onto a PPy-PANI-Au film obtained by successive
chemical oxidation of PPy and PANI, followed by electrodeposition of gold [127]. This association of
conducting polymers with Au nanoparticles increased the conductivity and provided an enhancement
of the hybridization efficiency. Similarly, the electrochemical DNA hybridization sensing of bipolymer
polypyrrole and PEDOT functionalized with Ag nanoparticles has been investigated [128]. DNA labeled
at 5 end using 6-mercapto-1-hexhane was immobilized on the PPy-PEDOT-Ag surface, and the resulting
impedometric biosensor effectively allowed the detection of target DNA sequences with a wide dynamic
detection range and a low detection limit of 5.4 × 10−15 M. It is also possible to combine polymers
and carbon nanotubes as done by Xu et al. who prepared an impedometric DNA biosensor by
using a composite material of polypyrrole electropolymerized in the presence of carboxylic groups
ended multiwalled carbon nanotubes [129]. Amino group ended single-stranded DNA probe was
linked onto the PPy/MWNTs-COOH using carbodiimide for crosslinking amine and carboxylic acid
group. The PPy/MWNTs-COOH film exhibited a good electronic transfer property and a large specific
surface area and led to a high sensitivity and selectivity of this biosensor. In this work, PPy did not
consist in a film deposited on a substrate but it consisted of nanotubes. This is a recent trend to
use nanostructured polymers for biosensing applications and PANI nanotubes have also be used in
DNA biosensors [130] as well as PANI nanowires [131] or PANI nanofibers [132,133]. Chang et al.
prepared conducting polyaniline nanotubes to induce a signal enhancement compared to classical
polyaniline [130]. A PANI nanotube array with a highly organized structure was fabricated under a
well-controlled nanoscale dimension on a graphite electrode using a nanoporous layer as a template,
and 21-mer oligonucleotide probes were immobilized on these nanotubes. The electrochemical results
showed that the DNA biosensor detected the target oligonucleotide at a concentration as low as 1.0 fM.
In addition, this biosensor demonstrated good capability of differentiating the perfect matched target
ODN from one-nucleotide mismatched ODN even at a low concentration. Another electrochemical
DNA biosensor based on electrochemically fabricated polyaniline nanowires and methylene blue
was used for DNA hybridization [131]. Nanowires of conducting polymers, with diameters in the
17
Appl. Sci. 2020, 10, 6614
range from 80 to 100 nm, were directly synthesized through an electrochemical deposition procedure.
Oligonucleotides with phosphate groups at the 5 end were covalently linked onto the amino groups
of polyaniline nanowires on the electrode. The hybridization events were monitored with differential
pulse voltammetry measurement using methylene blue as an indicator. The approach described here
can effectively discriminate complementary from non-complementary DNA sequence, with a detection
limit of 1.0 × 10−12 mol/L of complementary target, suggesting that the polyaniline nanowires hold
great promises for sensitive electrochemical biosensor applications. Du et al. have electrodeposited
reduced graphene oxide on polyaniline nanofibers, and the formed nanocomposites were applied
to bind ssDNA probe via the non-covalent assembly [132]. After the hybridization of ssDNA probe
with complementary DNA, the response of the biosensor changed obviously, and allowed selective
detection of the sequence-specific DNA of cauliflower mosaic virus gene with a detection limit of
3.2 × 10−14 mol/L. Finally, polyaniline and graphene composite nanofibers (ranging from 90 to 360 nm
in diameter) were prepared by oxidative polymerization in the presence of a solution containing
poly(methyl vinyl ether-alt-maleic acid) (Figure 6). The composite nanofibers with an immobilized DNA
probe were used for the detection of Mycobacterium tuberculosis by using differential pulse voltammetry
method leading to a detection range of 10−6 –10−9 M with the detection limit of 7.8 × 10−7 M under
optimum conditions [133]. These results show that the composite nanofibers have a great potential in
a range of applications for DNA sensors. Table 4 summarizes the performances of these conducting
polymer-based DNA biosensors.
Figure 6. Schematic illustration of the stepwise electrochemical fabrication process for DNA biosensor.
Reproduced with permission of [133], Copyright 2017, MDPI.
18
Appl. Sci. 2020, 10, 6614
Detection
Active Layer Detection Mode Linear Range Ref.
Limit
Polyaniline–MoS2 voltammetry 10−15 –10−6 M 10−15 M [124]
Polypyrrole–Au and Ag NPs voltammetry 7–150 nM 7 nM [125]
poly [3–acetic acid
impedometry 0.05–5.5 nM 1 pM [126]
pyrrole,3–N–hydroxyphthalimide pyrrole)]
Polypyrrole–Polyaniline– impedometry 10−13 –10−6 M 10−13 M [127]
Polypyrrole–PEDOT–Ag NP impedometry 10−15 –10−11 M 5 × 10−15 M [128]
Polypyrrole–CNT–COOH impedometry 10−12 –10−7 M 5 × 10−12 M [129]
Polyaniline voltammetry 10−15 –10−12 M 10−15 M [130]
Polyaniline–methylene blue voltammetry 10−12 –10−10 M 10−12 M [131]
Polyaniline–graphene voltammetry 10−13 –10−7 M 3 × 10−14 M [132]
Polyaniline–graphene voltammetry 10−9 –10−6 M 8 × 10−7 M [133]
19
Appl. Sci. 2020, 10, 6614
conductometric urea biosensor was fabricated which used the change in resistivity generated by an
increase of the pH due to the catalytic action of urease contained in the whole Brevibacterium ammoniagenes
cells previously immobilized in a polystyrene sulphonate–polyaniline (PSS–PANI) conducting
film [146].
20
Appl. Sci. 2020, 10, 6614
and specific antibody for PSA. The ability of proposed biosensor to detect PSA and Myo simultaneously
with high sensitivity and specificity offers an opportunity for a new generation of immunosensors.
5. Conclusions
This review presents an overview of the diverse strategies used for developing electrochemical
biosensors based on conducting polymers and outlines the significant advances in this field.
Indeed, conducting polymers have many advantages including their charge transport properties and
their chemical versatility that can be used to fabricate efficient biosensors through potentiometric,
amperometric, conductometric, voltametric and impedometric detection. Additionally, conductive
polymers with functional groups can be synthesized and used to facilitate the immobilization of
biorecognition molecules through covalent attachment which is the most commonly used method to
immobilize biomolecules, but adsorption or entrapment are also often used. As a result, conducting
polymers are now considered as good sensitive materials for the development of selective, specific,
and stable sensing devices. However, electrodeposited polymers still have many unexplored
possibilities, and so a lot of future research will probably be dedicated to the development of
new polymer-based biosensors. Another promising way for the future is the nanostructuration of
electrodeposited polymers since the electrosynthesis of polymer nanowires or nanotubes recently led
to strong improvements in the sensing properties of conducting polymers. In addition, the landscape
for hybrid conducting polymer systems combining polymers and conducting inorganic materials,
especially metallic nanoparticles and carbon nanomaterials, is rich in potential with numerous
promising materials, each with their own chemical, electrical and physical properties, yet to be explored
for biosensing.
References
1. Shirakawa, H.; Louis, E.J.; MacDiarmid, A.G.; Chiang, C.K.; Heeger, A.J. Synthesis of electrically conducting
organic polymers: Halogen derivatives of polyacetylene, (CH)x . J. Chem. Soc. Chem. Commun. 1977, 578–580.
[CrossRef]
2. Diaz, A. Electrochemical preparation and characterisation of conducting polymers. Chem. Scr. 1981, 17,
145–148.
3. Diaz, A.F.; Kanazawa, K.K. Electrochemical polymerisation of pyrrole. J. Chem. Soc. Chem. Commun.
1979, 635. [CrossRef]
4. Kanazawa, K.K.; Diaz, A.F.; Geiss, R.H.; Gill, W.D.; Kwak, J.F.; Logan, J.A. ‘Organic metals’: Polypyrrole a
stable synthetic ‘metallic’ polymer. J. Chem. Soc. Chem. Commun. 1979, 854. [CrossRef]
5. Le, T.H.; Kim, Y.; Yoon, H. Electrical and Electrochemical Properties of Conducting Polymers. Polymers 2017,
9, 150. [CrossRef]
6. Tsukamoto, J. Recent advances in highly conductive polyacetylene. Adv. Phys. 1992, 41, 509–546. [CrossRef]
7. Tsukamoto, J.; Takahashi, A.; Kawasaki, K. Structure and electrical properties of polyacetylene yielding a
conductivity of 105 S/cm. Jpn. J. Appl. Phys. 1990, 29, 125. [CrossRef]
8. Patois, T.; Lakard, B.; Martin, N.; Fievet, P. Effect of various parameters on the conductivity of free standing
electrosynthesized polypyrrole films. Synth. Met. 2010, 160, 2180–2185. [CrossRef]
9. Zhang, Y.; de Boer, B.; Blom, P.W.M. Controllable molecular doping and charge transport in solution-processed
polymer semiconducting layers. Adv. Funct. Mater. 2009, 19, 1901–1905. [CrossRef]
10. Guimard, N.K.; Gomez, N.; Schmidt, C.E. Conducting polymers in biomedical engineering. Prog. Polym. Sci.
2007, 32, 876–921. [CrossRef]
11. Ahlskog, M.; Reghu, M.; Heeger, A.J. The temperature dependence of the conductivity in the critical regime of
the metal-insulator transition in conducting polymers. J. Phys. Condens. Matter 1997, 9, 4145–4156. [CrossRef]
12. Aleshin, A.; Kiebooms, R.; Menon, R.; Wudl, F.; Heeger, A.J. Metallic conductivity at low temperatures in
poly (3,4-ethylenedioxythiophene) doped with PF6 . Phys. Rev. B 1997, 56, 3659–3663. [CrossRef]
21
Appl. Sci. 2020, 10, 6614
13. Lee, K.; Cho, S.; Heum Park, S.; Heeger, A.J.; Lee, C.W.; Lee, S.H. Metallic transport in polyaniline. Nature
2006, 441, 65–68. [CrossRef] [PubMed]
14. Wataru, T.; Shyam, S.P.; Masaki, F.; Keiichi, K. Cyclic step-voltammetric analysis of cation-driven and
anion-driven actuation in polypyrrole films. Jpn. J. Appl. Phys. 2002, 41, 7532–7536.
15. Paul, E.W.; Ricco, A.J.; Wrighton, M.S. Resistance of polyaniline films as a function of electrochemical
potential and the fabrication of polyaniline-based microelectronic devices. J. Phys. Chem. 1985, 89, 1441–1447.
[CrossRef]
16. Saxena, V.; Malhotra, B.D.; Menon, R. Charge transport and electrical properties of doped conjugated
polymers. In Handbook of Polymers in Electronics; Malhotra, B.D., Ed.; Rapra Technology Limited: Shrewsbury,
Shropshire, UK, 2002; pp. 3–65.
17. Wan, M. Conducting Polymers with Micro or Nanometer Structure; Springer: New York, NY, USA, 2008; pp. 1–13.
18. Li, Y. Conducting polymer. In Organic Optoelectronic Materials; Li, Y., Ed.; Springer International Publishing:
New York, NY, USA, 2015; pp. 23–50.
19. Bredas, J.L.; Chance, R.R.; Silbey, R. Theoretical Studies of Charged Defect States in Doped Polyacetylene
and Polyparaphenylene. Mol. Cryst. Liq. Cryst. 1981, 77, 319–332. [CrossRef]
20. Scrosati, B. Electrochemical Properties of Conducting Polymers. Prog. Solid State Chem. 1988, 18, 1–77.
[CrossRef]
21. Beaujuge, P.M.; Reynolds, J.R. Color Control in π—Conjugated Organic Polymers for Use in Electrochromic
Devices. Chem. Rev. 2010, 110, 268–320. [CrossRef]
22. Moliton, A.; Hiorns, R.C. Review of Electronic and Optical Properties of Semiconducting π-Conjugated
Polymers: Applications in Optoelectronics. Polym. Int. 2004, 53, 1397–1412. [CrossRef]
23. Bharti, M.; Singh, A.; Samanta, S.; Aswal, D.K. Conductive Polymers for Thermoelectric Power Generation.
Prog. Mater. Sci. 2018, 93, 270–310. [CrossRef]
24. Fan, Z.; Ouyang, J. Thermoelectric Properties of PEDOT: PSS. Adv. Electron. Mater. 2019, 5, 1800769.
[CrossRef]
25. Guerfi, A.; Trottier, J.; Boyano, I.; De Meatza, I.; Blazquez, J.; Brewer, S.; Ryder, K.; Vijh, A.; Zaghib, K.
High cycling stability of zinc-anode/conducting polymer rechargeable battery with non-aqueous electrolyte.
J. Power Sources 2014, 248, 1099–1104. [CrossRef]
26. Katz, H.E.; Searson, P.C.; Poehler, T.O. Batteries and Charge Storage Devices Based on Electronically
Conducting Polymers. J. Mater. Res. 2010, 25, 1561–1574. [CrossRef]
27. Ehsani, A.; Shiri, H.M.; Kowsari, E.; Safari, R.; Torabian, J.; Hajghani, S. High performance electrochemical
pseudocapacitors from ionic liquid assisted electrochemically synthesized p-type conductive polymer.
J. Colloid Interface Sci. 2017, 490, 91–96. [CrossRef]
28. Kao, P.; Best, A.S. Conducting-polymer-based supercapacitor devices and electrodes. J. Power Sources 2011,
196, 1–12.
29. Lee, J.; Kang, H.; Kee, S.; Lee, S.H.; Jeong, S.Y.; Kim, G.; Kim, J.; Hong, S.; Back, H.; Lee, K. Long-Term Stable
Recombination Layer for Tandem Polymer Solar Cells Using Self-Doped Conducting Polymers. ACS Appl.
Mater. Interfaces 2016, 8, 6144–6151. [CrossRef] [PubMed]
30. Mengistie, D.A.; Ibrahem, M.A.; Wang, P.C.; Chu, C.W. Highly conductive PEDOT: PSS treated with formic
acid for ITO-free polymer solar cells. ACS Appl. Mater. Interfaces 2014, 6, 2292–2299. [CrossRef]
31. Zhang, J.; Hao, Y.; Yang, L.; Mohammadi, H.; Vlachopoulos, N.; Sun, L.; Hagfeldt, A.; Sheibani, E.
Electrochemically polymerized poly (3, 4-phenylenedioxythiophene) as efficient and transparent counter
electrode for dye sensitized solar cells. Electrochim. Acta 2019, 300, 482–488. [CrossRef]
32. Boudreault, P.L.T.; Najari, A.; Leclerc, M. Processable Low-Bandgap Polymers for Photovoltaic Applications.
Chem. Mater. 2011, 23, 456–469. [CrossRef]
33. Kim, Y.H.; Lee, J.; Hofmann, S.; Gather, M.C.; Müller-Meskamp, L.; Leo, K. Achieving high efficiency and
improved stability in ITO free transparent organic light-emitting diodes with conductive polymer electrodes.
Adv. Funct. Mater. 2013, 23, 3763–3769. [CrossRef]
34. Bhuvana, K.P.; Joseph Bensingh, R.; Abdul Kader, M.; Nayak, S.K. Polymer Light Emitting Diodes: Materials,
Technology and Device. Polym. Plast. Technol. Eng. 2018, 57, 1784–1800. [CrossRef]
35. Dutta, K.; Das, S.; Rana, D.; Kundu, P.P. Enhancements of Catalyst Distribution and Functioning Upon
Utilization of Conducting Polymers as Supporting Matrices in DMFCs: A Review. Polym. Rev. 2015, 55, 1–56.
[CrossRef]
22
Appl. Sci. 2020, 10, 6614
36. Baldissera, A.F.; Freitas, D.B.; Ferreira, C.A. Electrochemical impedance spectroscopy investigation of
chlorinated rubber-based coatings containing polyaniline as anticorrosion agent. Mater. Corros. 2010, 61,
790–801. [CrossRef]
37. Deshpande, P.P.; Jadhav, N.G.; Gelling, V.J.; Sazou, D. Conducting polymers for corrosion protection: A review.
J. Coat. Techn. Res. 2014, 11, 473–494. [CrossRef]
38. Soganci, T.; Gumusay, O.; Soyleyici, H.C.; Ak, M. Synthesis of highly branched conducting polymer
architecture for electrochromic applications. Polymer 2018, 134, 187–195. [CrossRef]
39. Pagès, H.; Topart, P.; Lemordant, D. Wide band electrochromic displays based on thin conducting polymer
films. Electrochim. Acta 2001, 46, 2137–2143. [CrossRef]
40. Barnes, A.; Despotakis, A.; Wong, T.C.P.; Anderson, A.P.; Chambers, B.; Wright, P.V. Towards a ‘smart
window’ for microwave applications. Smart Mater. Struct. 1998, 7, 752. [CrossRef]
41. Barus, D.A.; Sebayang, K.; Ginting, J.; Ginting, R.T. Effect of Chemical Treatment on Conducting Polymer for
Flexible Smart Window Application. J. Phys. Conf. Ser. 2018, 1116, 032006. [CrossRef]
42. Wang, M.; Wang, X.; Moni, P.; Liu, A.; Kim, D.H.; Jo, W.J.; Sojoudi, H.; Gleason, K.K. CVD Polymers for
Devices and Device Fabrication. Adv. Mater. 2017, 29, 1604606. [CrossRef]
43. Park, C.S.; Kim, D.H.; Shin, B.J.; Tae, H.S. Synthesis and Characterization of Nanofibrous Polyaniline Thin
Film Prepared by Novel Atmospheric Pressure Plasma Polymerization Technique. Materials 2016, 9, 39.
[CrossRef]
44. Liu, C.; Goeckner, M.; Walker, A.V. Plasma polymerization of poly (3,4-ethylenedioxyethene) films:
The influence of plasma gas phase chemistry. J. Vac. Sci. Technol. A 2017, 35, 021302. [CrossRef]
45. Loewe, R.S.; Ewbank, P.C.; Liu, J.; Zhai, L.; Mccullough, R.D. Regioregular, Head-to-Tail Coupled
Poly(3-Alkylthiophenes) Made Easy by the GRIM Method: Investigation of the Reaction and the Origin of
Regioselectivity. Macromolecules 2001, 34, 4324–4333. [CrossRef]
46. Tamba, S.; Fuji, K.; Meguro, H.; Okamoto, S.; Tendo, T.; Komobuchi, R.; Sugie, A.; Nishino, T.; Mori, A.
Synthesis of High-Molecular-Weight Head-to-Tail-Type Poly(3-Substituted-Thiophene)s by Cross-Coupling
Polycondensation with [CpNiCl(NHC)] as a Catalyst. Chem. Lett. 2013, 42, 281–283. [CrossRef]
47. Malinauskas, A. Chemical deposition of conducting polymers. Polymer 2001, 42, 3957–3972. [CrossRef]
48. Erdem, E.; Karakisla, M.; Sacak, M. The chemical synthesis of conductive polyaniline doped with dicarboxylic
acids. Eur. Polym. J. 2004, 40, 785–791. [CrossRef]
49. Ramanavicius, A.; Kausaite, A.; Ramanaviciene, A. Polypyrrole-coated glucose oxidase nanoparticles for
biosensor design. Sens. Actuators B 2005, 111, 532–539. [CrossRef]
50. Jha, P.; Koiry, S.P.; Saxena, V.; Veerender, P.; Chauhan, A.K.; Aswal, D.K.; Gupta, S.K. Growth of Free-Standing
Polypyrrole Nanosheets at Air/Liquid Interface Using J-Aggregate of Porphyrin Derivative as in-Situ
Template. Macromolecules 2011, 44, 4583–4585. [CrossRef]
51. Heinze, J.; Frontana-Uribe, B.A.; Ludwigs, S. Electrochemistry of Conducting Polymers—Persistent Models
and New Concepts. Chem. Rev. 2010, 110, 4724–4771. [CrossRef]
52. Park, Y.; Jung, J.; Chang, M. Research Progress on Conducting Polymer-Based Biomedical Applications.
Appl. Sci. 2019, 9, 1070. [CrossRef]
53. Nair, S.S.; Mishra, S.K.; Kumar, D. Recent progress in conductive polymeric materials for biomedical
applications. Polym. Adv. Technol. 2019, 30, 2932–2953. [CrossRef]
54. Geetha, S.; Rao, C.R.K.; Vijayan, M.; Trivedi, D.C. Biosensing and drug delivery by polypyrrole.
Anal. Chim. Acta 2006, 568, 119–125. [CrossRef] [PubMed]
55. Boehler, C.; Oberueber, F.; Asplund, M. Tuning drug delivery from conducting polymer films for accurately
controlled release of charged molecules. J. Control. Release 2019, 304, 173–180. [CrossRef]
56. Krukiewicz, K.; Bednarczyk, B.; Turczyn, R.; Zak, J.K. EQCM verification of the concept of drug immobilization
and release from conducting polymer matrix. Electrochim. Acta 2016, 212, 694–700. [CrossRef]
57. Guo, B.; Ma, P.X. Conducting polymers for tissue engineering. Biomacromolecules 2018, 19, 1764–1782.
[CrossRef] [PubMed]
58. Dong, R.; Ma, P.X.; Guo, B. Conductive biomaterials for muscle tissue engineering. Biomaterials 2020,
229, 119584. [CrossRef]
59. Zarrintai, P.; Bakhshandeh, B.; Saeb, M.R.; Sefat, F.; Rezaeian, I.; Ganjali, M.R.; Ramakrishna, S.; Mozafari, M.
Oligoaniline-based conductive biomaterials for tissue engineering. Acta Biomater. 2018, 72, 16–34. [CrossRef]
23
Appl. Sci. 2020, 10, 6614
60. Inal, S.; Hama, A.; Ferro, M.; Pitsalidis, C.; Oziat, J.; Iandolo, D.; Pappa, A.M.; Hadida, M.; Huerta, M.;
Marchat, D.; et al. Conducting polymer scaffolds for hosting and monitoring 3D cell culture. Adv. Biosyst.
2017, 1, 1700052. [CrossRef]
61. Lakard, S.; Morrand-Villeneuve, N.; Lesniewska, E.; Lakard, B.; Michel, G.; Herlem, G.; Gharbi, T.; Fahys, B.
Synthesis of polymer materials for use as cell culture substrates. Electrochim. Acta 2007, 53, 1114–1126.
[CrossRef]
62. Ateh, D.D.; Navsaria, H.A.; Vadgama, P. Polypyrrole-based conducting polymers and interactions with
biological tissues. J. R. Soc. Interface 2006, 3, 741–752. [CrossRef]
63. He, H.; Zhang, L.; Guan, X.; Cheng, H.; Liu, X.; Yu, S.; Wei, J.; Ouyang, J. Biocompatible conductive polymers
with high conductivity and high stretchability. ACS Appl. Mater. Interfaces 2019, 11, 26185–26193. [CrossRef]
64. Humpolicek, P.; Kasparkova, V.; Pachernik, J.; Stejskal, J.; Bober, P.; Capakova, Z.; Radaszkiewicz, K.A.;
Junkar, I.; Lehocky, M. The biocompatibility of polyaniline and polypyrrole: A comparative study of their
cytotoxicity, embryotoxicity and impurity profile. Mat. Sci. Eng. C 2018, 91, 303–310. [CrossRef]
65. Humpolicek, P.; Kasparkova, V.; Saha, P.; Stejskal, J. Biocompatibility of polyaniline. Synth. Met. 2012, 162,
722–727. [CrossRef]
66. George, P.M.; Lyckman, A.W.; LaVan, D.A.; Hegde, A.; Leung, Y.; Avasare, R.; Testa, C.; Alexander, P.M.;
Langer, R.; Sur, M. Fabrication and biocompatibility of polypyrrole implants suitable for neural prosthetics.
Biomaterials 2005, 26, 3511–3519. [CrossRef] [PubMed]
67. Kim, D.M.; Cho, S.J.; Cho, C.H.; Kim, K.B.; Kim, M.Y.; Shim, Y.B. Disposable all-solid-state pH and glucose
sensors based on conductivepolymer covered hierarchical AuZn oxide. Biosens. Bioelectron. 2016, 79, 165–172.
[CrossRef] [PubMed]
68. Tuncagil, S.; Ozdemir, C.; Demirkol, D.O.; Timur, S.; Toppare, L. Gold nanoparticle modified conducting
polymer of 4-(2,5-di(thiophen-2-yl)-1H-pyrrole-1-l) benzenamine for potential use as a biosensing material.
Food Chem. 2011, 127, 1317–1322. [CrossRef]
69. Kausaite-Minkstimiene, A.; Glumbokaite, L.; Ramanaviciene, A.; Dauskaite, E.; Ramanavicius, A.
An Amperometric Glucose Biosensor Based on Poly (Pyrrole-2-Carboxylic Acid)/Glucose Oxidase
Biocomposite. Electroanalysis 2018, 30, 1642–1652. [CrossRef]
70. Gaikwad, P.; Shirale, D.; Gade, V.; Savale, P.; Kharat, H.; Kakde, K.; Shirsat, M. Immobilization of GOD on
electrochemically synthesized PANI film by cross-linking via glutaraldehyde for determination of glucose.
Int. J. Electrochem. Sci. 2006, 1, 425–434.
71. Lakard, B.; Herlem, G.; Lakard, S.; Antoniou, A.; Fahys, B. Urea potentiometric biosensor based on modified
electrodes with urease immobilized on polyethylenimine films. Biosens. Bioelectron. 2004, 19, 1641–1647.
[CrossRef]
72. Magnin, D.; Callegari, V.; Matefi-Tempfli, S.; Matefi-Tempfli, M.; Glinel, K.; Jonas, A.M.; Demoustier-Champagne, S.
Functionalization of Magnetic Nanowires by Charged Biopolymers. Biomacromolecules 2008, 9, 2517–2522. [CrossRef]
73. Xue, H.G.; Shen, Z.Q.; Li, Y.F. Polyaniline-polyisoprene composite film based glucose biosensor with high
permselectivity. Synth. Met. 2001, 124, 345–349. [CrossRef]
74. Molino, P.J.; Higgins, M.J.; Innis, P.C.; Kapsa, R.M.I.; Wallace, G.G. Fibronectin and bovine serum albumin
adsorption and conformational dynamics on inherently conducting polymers: A QCM-D study. Langmuir
2012, 28, 8433–8445. [CrossRef] [PubMed]
75. Lakard, B.; Magnin, D.; Deschaume, O.; Vanlancker, G.; Glinel, K.; Demoustier-Champagne, S.; Nysten, B.;
Jonas, A.M.; Bertrand, P.; Yunus, S. Urea potentiometric enzymatic biosensor based on charged biopolymers
and electrodeposited polyaniline. Biosens. Bioelectron. 2011, 26, 4139–4145. [CrossRef] [PubMed]
76. Yang, G.; Kampstra, K.L.; Abidian, M.R. High performance conducting polymer nanofiber biosensors for
detection of biomolecules. Adv. Mater. 2014, 26, 4954–4960. [CrossRef] [PubMed]
77. Soares, J.C.; Brisolari, A.; da Cruz Rodrigues, V.; Sanches, E.A.; Gonçalves, D. Amperometric urea biosensors
based on the entrapment of urease in polypyrrole films. React. Funct. Polym. 2012, 72, 148–152. [CrossRef]
78. Minett, A.I.; Barisci, J.N.; Wallace, G.G. Immobilisation of anti-Listeria in a polypyrrole film.
React. Funct. Polym. 2002, 53, 217–227. [CrossRef]
79. Mandli, J.; Amine, A. Impedimetric genosensor for miRNA-34a detection in cell lysates using polypyrrole.
J. Solid State Electrochem. 2018, 22, 1007–1014. [CrossRef]
80. Ramanavicius, A.; Ramanaviciene, A.; Malinauskas, A. Electrochemical sensors based on conducting polymer-
polypyrrole. Electrochim. Acta 2006, 51, 6025–6037. [CrossRef]
24
Appl. Sci. 2020, 10, 6614
81. Adeloju, S.B.; Moline, A.N. Fabrication of ultra-thin polypyrrole–glucose oxidase film from supporting
electrolyte-free monomer solution for potentiometric biosensing of glucose. Biosens. Bioelectron. 2001, 16,
133–139. [CrossRef]
82. Leite, C.; Lakard, B.; Hihn, J.Y.; del Campo, F.J.; Lupu, S. Use of sinusoidal voltages with fixed frequency in the
preparation of tyrosinase based electrochemical biosensors for dopamineelectroanalysis. Sens. Actuators B
2017, 240, 801–809. [CrossRef]
83. Clark, L.C. Monitor and control of blood and tissue oxygen tensions. Trans. Am. Soc. Artif. Intern. Organs
1956, 2, 41–48.
84. Forzani, E.S.; Zhang, H.; Nagahara, L.A.; Amlani, I.; Tsui, R.; Tao, N. A Conducting Polymer Nanojunction
Sensor for Glucose Detection. Nano Lett. 2004, 4, 1785–1788. [CrossRef]
85. Chauhan, N.; Chawla, S.; Pundir, C.S.; Jain, U. An electrochemical sensor for detection of
neurotransmitter-acetylcholine using metal nanoparticles, 2D material and conducting polymer modified
electrode. Biosens. Bioelectron. 2017, 89, 377–383. [CrossRef]
86. Uwaya, G.E.; Fayemi, O.E. Electrochemical detection of serotonin in banana at green mediated PPy/Fe3 O4
NPs nanocomposites modified electrodes. Sens. Bio Sens. Res. 2020, 28, 100338. [CrossRef]
87. Hamid, H.H.; Harb, M.E.; Elshaer, A.M.; Erahim, S.; Soliman, M.M. Electrochemical Preparation and Electrical
Characterization of Polyaniline as a Sensitive Biosensor. Microsyst. Technol. 2018, 24, 1775–1781. [CrossRef]
88. Bahadir, E.B.; Sezgintürk, M.K. A review on impedimetric biosensors. Artif. Cells Nanomed Biotechn. 2016, 44,
248–262. [CrossRef]
89. He, S.; Yuan, Y.; Nag, A.; Feng, S.; Afsarimanesh, N.; Han, T.; Mukhopadhyay, S.C.; Organ, D.R. A Review on
the Use of Impedimetric Sensors for the Inspection of Food Quality. Int. J. Environ. Res. Public Health 2020,
17, 5220. [CrossRef] [PubMed]
90. Leva-Bueno, J.; Peyman, S.A.; Millner, P.A. A review on impedimetric immunosensors for pathogen and
biomarker detection. Med. Microbiol. Immunol. 2020, 209, 343–362. [CrossRef]
91. Grant, S.; Davis, F.; Law, K.A.; Barton, A.C.; Collyer, S.D.; Higson, S.P.J.; Gibson, T.D. Label-free and reversible
immunosensor based upon an ac impedance interrogation protocol. Anal. Chim. Acta 2005, 537, 163–168.
[CrossRef]
92. Aydin, E.B.; Aydin, M.; Sezgintürk, M.K. Highly sensitive electrochemical immunosensor based on
polythiophene polymer with densely populated carboxyl groups as immobilization matrix for detection of
interleukin 1β in human serum and saliva. Sens. Actuators B 2018, 270, 18–27. [CrossRef]
93. Taleat, Z.; Ravalli, A.; Mazloum-Ardakami, M.; Marrazza, G. CA 125 Immunosensor Based on Poly-Anthranilic
Acid Modified Screen-Printed Electrodes. Electroanalysis 2013, 25, 269–277. [CrossRef]
94. Jugovic, B.; Grgur, B.; Antov, M.; Knezevic-Jugovic, Z.; Stevanovic, J.; Gvozdenovic, M. Polypyrrole-based
Enzyme Electrode with Immobilized Glucose Oxidase for Electrochemical Determination of Glucose. Int. J.
Electrochem. Sci. 2016, 11, 1152–1161.
95. Gvozdenovic, M.M.; Jugovic, B.Z.; Bezbradica, D.I.; Antov, M.G.; Knezevic-Jugovic, Z.D.; Grgur, B.N.
Electrochemical determination of glucose using polyaniline electrode modified by glucose oxidase. Food Chem.
2011, 124, 396–400. [CrossRef]
96. Lai, J.; Yi, Y.; Zhu, P.; Shen, J.; Wu, K.; Zhang, L.; Liu, J. Polyaniline-based glucose biosensor: A review.
J. Electroanal. Chem. 2016, 782, 138–153. [CrossRef]
97. Singh, M.; Kathuroju, P.K.; Jampana, N. Polypyrrole based amperometric glucose biosensors. Sens. Actuators B
2009, 143, 430–443. [CrossRef]
98. Lau, K.T.; de Fortescu, S.A.L.; Murphy, L.J.; Slater, J.M. Disposable glucose sensors for flow injection analysis
using substituted 1,4-benzoquinonemediators. Electroanalysis 2003, 15, 975–981. [CrossRef]
99. Qiu, J.D.; Zhou, W.M.; Guo, J.; Wang, R.; Liang, R.P. Amperometric sensor based on ferrocene-modified
multiwalled carbon nanotube nanocomposites as electron mediator for the determination of glucose.
Anal. Biochem. 2009, 385, 264–269. [CrossRef]
100. Jian, L.; Shanhui, S.; Changchun, L.; Shoushui, W. An amperometric glucose biosensor based on a
screen-printed electrode and Os-complex mediator for flow injection analysis. Measurement 2011, 44,
1878–1883.
25
Appl. Sci. 2020, 10, 6614
101. Shrestha, B.K.; Ahmad, R.; Mousa, H.M.; Kim, I.G.; Kim, J.I.; Neupane, M.P.; Park, C.H.; Kim, C.S.
High-performance glucose biosensor based on chitosane-glucose oxidase immobilized polypyrrole/Nafion/
functionalized multi-walled carbon nanotubes bio-nanohybrid film. J. Colloid Interf. Sci. 2016, 482, 39–47.
[CrossRef]
102. Shrestha, B.K.; Ahmad, R.; Shrestha, S.; Park, C.H.; Kim, C.S. Globular Shaped Polypyrrole Doped
Well-Dispersed Functionalized Multiwall Carbon Nanotubes/Nafion Composite for Enzymatic Glucose
Biosensor Application. Sci. Rep. 2017, 7, 16191. [CrossRef]
103. Chen, X.; Chen, Z.; Tian, R.; Yan, W.; Yao, C. Glucose biosensor based on three dimensional ordered
macroporous self-doped polyaniline/Prussian blue bicomponent film. Anal. Chim. Acta 2012, 723, 94–100.
[CrossRef]
104. Chowdhury, A.D.; Gangopadhyay, R.; De, A. Highly sensitive electrochemical biosensor for glucose, DNA and
protein using gold-polyaniline nanocomposites as a common matrix. Sens. Actuators B 2014, 190, 348–356.
[CrossRef]
105. Mazeiko, V.; Kausaite-Minkstimiene, A.; Ramanaviciene, A.; Balevicius, Z.; Ramanavicius, A. Gold Nanoparticle
and Conducting Polymer—Polyaniline—Based Nanocomposites for Glucose Biosensor Design. Sens. Actuators B
2013, 189, 187–193. [CrossRef]
106. Zhai, D.; Liu, B.; Shi, Y.; Pan, L.; Wang, Y.; Li, Y.; Zhang, R.; Yu, G. Highly sensitive glucose sensor based on
Pt nanoparticle/polyaniline hydrogel heterostructures. ACS Nano 2013, 7, 3540–3546. [CrossRef] [PubMed]
107. Zhong, H.; Yuan, R.; Chai, Y.; Li, W.; Zhong, X.; Zhang, Y. In situ chemo-synthesized multi-wall
carbon nanotube-conductive polyaniline nanocomposites: Characterization and application for a glucose
amperometric biosensor. Talanta 2011, 85, 104–111. [CrossRef]
108. Jimenez-Fierrez, F.; Gonzalez-Sanchez, M.I.; Jimenez-Perez, R.; Iniesta, J.; Valero, E. Glucose Biosensor Based
on Disposable Activated Carbon Electrodes Modified with Platinum Nanoparticles Electrodeposited on
Poly(Azure A). Sensors 2020, 20, 4489. [CrossRef]
109. Djaalab, E.; El Hadi Samar, M.; Zougar, S.; Kherrat, R. Electrochemical Biosensor for the Determination of
Amlodipine Besylate Based on Gelatin-Polyaniline Iron Oxide Biocomposite Film. Catalysts 2018, 8, 233.
[CrossRef]
110. Zhuang, X.; Tian, C.; Luan, F.; Wu, X.; Chen, L. One-step electrochemical fabrication of a nickel oxide
nanoparticle/polyaniline nanowire/graphene oxide hybrid on a glassy carbon electrode for use as a
non-enzymatic glucose biosensor. RSC Adv. 2016, 6, 92541–92546. [CrossRef]
111. Wang, Z.; Liu, S.; Wu, P.; Cai, C. Detection of Glucose Based on Direct Electron Transfer Reaction of
Glucose Oxidase Immobilized on Highly Ordered Polyaniline Nanotubes. Anal. Chem. 2009, 81, 1638–1645.
[CrossRef]
112. Xu, G.; Adeloju, S.B.; Wu, Y.; Zhang, X. Modification of polypyrrole nanowires array with platinum
nanoparticles and glucose oxidase for fabrication of a novel glucose biosensor. Anal. Chim. Acta 2012, 755,
100–107. [CrossRef]
113. Komathi, S.; Gopalan, A.I.; Muthuchamy, N.; Lee, K.P. Polyaniline nanoflowers grafted onto nanodiamonds
via a soft template-guided secondary nucleation process for high-performance glucose sensing. RSC Adv.
2017, 7, 15342–15351. [CrossRef]
114. Ramanavicius, A.; Habermüller, K.; Csöregi, E.; Laurinavicius, V.; Schuhmann, W. Polypyrrole-Entrapped
Quinohemoprotein Alcohol Dehydrogenase. Evidence for Direct Electron Transfer via Conducting-Polymer
Chains. Anal. Chem. 1999, 71, 3581–3586. [CrossRef]
115. Bollela, P.; Gorton, L.; Antiochia, R. Direct Electron Transfer of Dehydrogenases for Development of 3rd
Generation Biosensors and Enzymatic Fuel Cells. Sensors 2018, 18, 1319. [CrossRef] [PubMed]
116. Oztekin, Y.; Ramanaviciene, A.; Yazicigil, Z.; Solak, A.O.; Ramanavicius, A. Direct electron transfer from
glucose oxidase immobilized on polyphenanthroline-modified glassy carbon electrode. Biosens. Bioelectron.
2011, 26, 2541–2546. [CrossRef] [PubMed]
117. Bagdziunas, G.; Palinauskas, D. Poly (9H-carbazole) as a Organic Semiconductor for Enzymatic and
Non-Enzymatic Glucose Sensors. Biosensors 2020, 10, 104. [CrossRef] [PubMed]
118. Grennan, K.; Strachan, G.; Porter, A.J.; Killard, A.J.; Smyth, M.R. Atrazine analysis using an amperometric
immunosensor based on single-chain antibody fragments and regeneration-free multi-calibrant measurement.
Anal. Chim. Acta 2003, 500, 287–298. [CrossRef]
26
Appl. Sci. 2020, 10, 6614
119. Darain, F.; Park, D.S.; Park, J.S.; Shim, Y.B. Development of an immunosensor for the detection of vitellogenin
using impedance spectroscopy. Biosens. Bioelectron. 2004, 19, 1245–1252. [CrossRef]
120. Wang, H.; Ma, F. A cascade reaction signal-amplified amperometric immunosensor platform for ultrasensitive
detection of tumour marker. Sens. Actuators B 2018, 254, 642–647. [CrossRef]
121. Zhao, L.; Ma, Z. Facile Synthesis of Polyaniline-Polythionine Redox Hydrogel: Conductive, Antifouling and
Enzyme-Linked Material for Ultrasensitive Label-Free Amperometric Immunosensor toward Carcinoma
Antigen-125. Anal. Chim. Acta 2018, 997, 60–66. [CrossRef]
122. Shaikh, M.O.; Srikanth, B.; Zhu, P.Y.; Chuang, C.H. Impedimetric Immunosensor Utilizing Polyaniline/Gold
Nanocomposite-Modified Screen-Printed Electrodes for Early Detection of Chronic Kidney Disease. Sensors
2019, 19, 3990. [CrossRef]
123. Liu, S.; Ma, Y.; Cui, M.; Luo, X. Enhanced Electrochemical Biosensing of Alpha-Fetoprotein Based on
Three-Dimensional Macroporous Conducting Polymer Polyaniline. Sens. Actuators B 2018, 255, 2568–2574.
[CrossRef]
124. Dutta, S.; Chowdhury, A.D.; Biswas, S.; Park, E.Y.; Agnihotri, N.; De, A.; De, S. Development of an effective
electrochemical platform for highly sensitive DNA detection using MoS2 —polyaniline nanocomposites.
Biochem. Eng. J. 2018, 140, 130–139. [CrossRef]
125. Eguiluz, K.I.V.; Salazar-Banda, G.R.; Elizabeth, M.; Huacca, F.; Alberice, J.V.; Carrilho, E.; Machado, S.A.S.;
Avaca, L.A. Sequence-specific electrochemical detection of Alicyclobacillus acidoterrestris DNA using
electroconductive polymer-modified fluorine tin oxide electrodes. Analyst 2009, 134, 314–319. [CrossRef]
[PubMed]
126. Tlili, C.; Jaffrezic-Renault, N.J.; Martelet, C.; Korri-Youssoufi, H. Direct electrochemical probing of DNA
hybridization on oligonucleotide-functionalized polypyrrole. Mater. Sci. Eng. C 2008, 28, 848–854. [CrossRef]
127. Wilson, J.; Radhakrishnan, S.; Sumathi, C.; Dharuman, V. Polypyrrole-polyaniline-Au (PPy-PANi-Au) nano
composite films for label-free electrochemical DNA sensing. Sens. Actuators B 2012, 171, 216–222. [CrossRef]
128. Radhakrishnan, S.; Sumathi, C.; Umar, A.; Kim, S.J.; Wilson, J.; Dharuman, V. Polypyrrole-poly
(3,4-ethylenedioxythiophene)-Ag (PPy-PEDOT-Ag) nanocomposite films for label-free electrochemical
DNA sensing. Biosens. Bioelectron. 2013, 47, 133–140. [CrossRef] [PubMed]
129. Xu, Y.; Ye, X.; Yang, L.; He, P.; Fang, Y. Impedance DNA biosensor using electropolymerized
polypyrrole/multiwalled carbon nanotubes modified electrode. Electroanalysis 2006, 18, 1471–1478. [CrossRef]
130. Chang, H.; Yuan, Y.; Shi, N.; Guan, Y. Electrochemical DNA biosensor based on conducting polyaniline
nanotube Array. Anal. Chem. 2007, 79, 5111–5115. [CrossRef]
131. Zhu, N.; Chang, Z.; He, P.; Fang, Y. Electrochemically fabricated polyaniline nanowire-modified electrode for
voltammetric detection of DNA hybridization. Electrochim. Acta 2006, 51, 3758–3762. [CrossRef]
132. Du, M.; Yang, T.; Li, X.; Jiao, K. Fabrication of DNA/graphene/polyaniline nanocomplex for label-free
voltammetric detection of DNA hybridization. Talanta 2012, 88, 439–444. [CrossRef]
133. Mohamad, F.S.; Zaid, M.H.M.; Abdullah, J.; Zawawi, R.M.; Lim, H.N.; Sulaiman, Y.; Rahman, N.A.
Synthesis and Characterization of Polyaniline/Graphene Composite Nanofiber and Its Application as an
Electrochemical DNA Biosensor for the Detection of Mycobacterium tuberculosis. Sensors 2017, 17, 2789.
[CrossRef]
134. Ding, L.; Du, D.; Zhang, X.; Ju, H. Trends in Cell-Based Electrochemical Biosensors. Curr. Med. Chem. 2008,
15, 3160–3170. [CrossRef] [PubMed]
135. Wei, Y.; Mo, X.; Zhang, P.; Li, Y.; Liao, J.; Li, Y.; Zhang, J.; Ning, C.; Wang, S.; Deng, X.; et al. Directing
Stem Cell Differentiation via Electrochemical Reversible Switching between Nanotubes and Nanotips of
Polypyrrole Array. ACS Nano 2017, 11, 5915–5924. [CrossRef]
136. Lakard, B.; Ploux, L.; Anselme, K.; Lallemand, F.; Lakard, S.; Nardin, M.; Hihn, J.Y. Effect of ultrasounds on
the electrochemical synthesis of polypyrrole. Application to the adhesion and growth of biological cells.
Bioelectrochemistry 2009, 75, 148–157. [CrossRef] [PubMed]
137. El-Said, W.A.; Yea, C.H.; Choi, J.W.; Kwon, I.K. Ultrathin polyaniline film coated on an indium-tin oxide
cell-based chip for study of anticancer effect. Thin Solid Film 2009, 518, 661–667. [CrossRef]
138. Lee, J.Y.; Lee, J.W.; Schmidt, C.E. Neuroactive conducting scaffolds: Nerve growth factor conjugation on
active ester-functionalized polypyrrole. J. R. Soc. Interface 2009, 6, 801–810. [CrossRef]
139. Nguyen-Vu, T.D.B.; Chen, H.; Cassell, A.M.; Andrews, R.; Meyyappan, M.; Li, J. Vertically Aligned Carbon
Nanofiber Arrays: An Advance toward Electrical-Neural Interfaces. Small 2006, 2, 89–94. [CrossRef]
27
Appl. Sci. 2020, 10, 6614
140. El-Said, W.A.; Yea, C.H.; Jung, M.; Kim, H.C.; Choi, J.W. Analysis of effect of nanoporous alumina substrate
coated with polypyrrole nanowire on cell morphology based on AFM topography. Ultramicroscopy 2010, 110,
676–681. [CrossRef]
141. Apetrei, R.M.; Carac, G.; Bahrim, G.; Camurlu, P. Glucose biosensor based on whole cells of Aspergillus
niger MIUG 34 coated with polypyrrole. J. Biotechnol. 2017, 256, S55–S56. [CrossRef]
142. Cevik, E.; Cerit, A.; Tombuloglu, H.; Sabit, H.; Yildiz, H.B. Electrochemical Glucose Biosensors: Whole Cell
Microbial and Enzymatic Determination based on 10-(4H-dithiyeno [3,2-b:2 ,3 -d]pyroll-4-il) decan-1-amine
Interfaces Glassy Carbon Electrodes. Anal. Lett. 2019, 52, 1138–1152. [CrossRef]
143. Baskurt, E.; Ekiz, F.; Demirkol, D.O.; Timur, S.; Toppare, L. A conducting polymer with benzothiadiazole
unit: Cell based biosensing applications and adhesion properties. Colloids Surf. B 2012, 97, 13–18. [CrossRef]
144. Guler, E.; Soylevici, H.C.; Demirkol, D.O.; Ak, M.; Timur, S. A novel functional conducting polymer as an
immobilization platform. Mat. Sci. Eng. C 2014, 40, 148–156. [CrossRef] [PubMed]
145. Tuncagil, S.; Odaci, D.; Yildiz, E.; Timur, S.; Toppare, L. Design of a microbial sensor using conducting polymer
of 4-(2,5-di(thiophen-2-yl)-1H-pyrrole-1-l) benzenamine. Sens. Actuators B 2009, 137, 42–47. [CrossRef]
146. Jha, S.K.; Kanungo, M.; Nath, A.; D’Souza, S.F.D. Entrapment of live microbial cells in electropolymerized
polyaniline and their use as urea biosensor. Biosens. Bioelectron. 2009, 24, 2637–2642. [CrossRef] [PubMed]
147. Ratautaite, V.; Plausinaitis, D.; Baleviciute, I.; Mikoliunaite, L.; Ramanaviciene, A.; Ramanavicius, A.
Characterization of caffeine-imprinted polypyrrole by a quartz crystalmicrobalance and electrochemical
impedance spectroscopy. Sens. Actuators B 2015, 212, 63–71. [CrossRef]
148. Xing, X.; Liu, S.; Yu, J.; Lian, W.; Huan, J. Electrochemical sensor based on molecularly imprinted film at
polypyrrole-sulfonated graphene/hyaluronic acid-multiwalled carbon nanotubes modified electrode for
determination of tryptamine. Biosens. Bioelectron. 2012, 31, 277–283. [CrossRef]
149. Zhou, H.; Xu, G.; Zhu, A.; Zhao, Z.; Ren, C.; Nie, L.; Kan, X. A multiporous electrochemical sensor for
epinephrine recognition and detection based on molecularly imprinted polypyrrole. RSC Advances 2012, 2,
7803–7808. [CrossRef]
150. Radi, A.E.; El-Naggar, A.E.; Nassef, H.M. Determination of coccidiostat clopidol on an electropolymerized-
molecularly imprinted polypyrrole polymer modified screen printed carbon electrode. Anal. Methods 2014, 6,
7967–7972. [CrossRef]
151. Lai, Y.X.; Zhang, C.X.; Deng, Y.; Yang, G.J.; Li, S.; Tang, C.L.; He, N.Y. A novel alpha-fetoprotein-MIP
immunosensor based on AuNPs/PTh modified glass carbon electrode. Chin. Chem. Lett. 2019, 30, 160–162.
[CrossRef]
152. Karami, P.; Bagheri, H.; Johari-Ahar, M.; Khoshsafar, H.; Arduini, F.; Afkhami, A. Dual-modality
impedimetric immunosensor for early detection of prostate-specific antigen and myoglobin markers
based on antibody-molecularly imprinted polymer. Talanta 2019, 202, 111–122. [CrossRef]
© 2020 by the author. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
28
applied
sciences
Article
Self-Assembled MoS2/ssDNA Nanostructures for the
Capacitive Aptasensing of Acetamiprid Insecticide
Maroua Hamami 1,2 , Noureddine Raouafi 2, * and Hafsa Korri-Youssoufi 2, *
1 Université Paris-Saclay, CNRS, Institut de Chimie Moléculaire et des Matériaux d’Orsay (ICMMO), ECBB,
Bât 420, 2 Rue du Doyen Georges Poitou, 91400 Orsay, France; maroua.hamami@universite-paris-saclay.fr
2 Faculté des Sciences de Tunis El Manar, Laboratoire de Chimie Analytique et Electrochimie (LR99ES15),
Campus Universitaire de Tunis El Manar, Université de Tunis El Manar, Tunis El–Manar 2092, Tunisia
* Correspondence: hafsa.korri-youssoufi@universite-paris-saclay.fr (N.R.);
noureddine.raouafi@fst.utm.tn (H.K.-Y.)
Featured Application: Authors are encouraged to provide a concise description of the specific
application or a potential application of the work. This section is not mandatory.
Abstract: The aim of this work is to detect acetamiprid using electrochemical capacitance spec-
troscopy, which is widely used as a pesticide in agriculture and is harmful to humans. We have
designed aptasensing platform based on the adsorption of a DNA aptamer on lipoic acid-modified
MoS2 nano-sheets. The biosensor takes advantage of the high affinity of single-stranded DNA
sequences to MoS2 nano-sheets. The stability of DNA on MoS2 nano-sheets is assured by covalent
attachment to lipoic acid that forms self-assembled layer on MoS2 surface. The biosensor exhibits
excellent capacitance performances owing to its large effective surface area making it interesting
material for capacitive transduction system. The impedance-derived capacitance varies with the
increasing concentrations of acetamiprid that can be attributed to the aptamer desorption from the
Citation: Hamami, M.; Raouafi, N.; MoS2 nanosheets facilitating ion diffusion into MoS2 interlayers. The developed device showed high
Korri-Youssoufi, H. Self-Assembled analytical performances for acetamiprid detection on electrochemical impedance spectroscopy EIS-
MoS2 /ssDNA Nanostructures for the derived capacitance variation and high selectivity toward the target in presence of other pesticides.
Capacitive Aptasensing of Real sample analysis of food stuff such as tomatoes is demonstrated which open the way to their use
Acetamiprid Insecticide. Appl. Sci. for monitoring of food contaminants by tailoring the aptamer.
2021, 11, 1382. https://doi.org/
10.3390/app11041382 Keywords: aptasensor; MoS2 ; pesticide; neonicotinoid; capacitance
29
have some limitations like high equipment costs, suitable only for laboratory analysis,
time-consuming due to sample preparation and require trained technicians to operate
them. Hence, the development of simple, cost-effective, sensitive, and portable alternatives
is necessary for the fast detection of acetamiprid in environment and agricultural field to
reduce the risk of public health.
Over the last decade, electrochemical biosensors have gained increasing interest in the
field of food monitoring due to their excellent properties and remarkable analytical perfor-
mances [9]. Especially, oligonucleotide-based electrochemical biosensors are increasingly
applied for sensitive detection of pesticide residues [10]. Aptamers are single-stranded
oligonucleotides considered as excellent molecular probes, which are endowed with high
affinity for various target substances, including small molecules [11], viruses [12] pro-
teins [13], and cells [14]. In an attempt to develop electrochemical aptasensors, several
acetamiprid sensing approaches based on the aptamer-target affinity have been developed.
For instance, Shi et al. [15] recently reported a dual signal amplification strategy for the
aptasensing of acetamiprid using reduced graphene oxide and silver nanoparticles. The
electrical signal recorded by cyclic voltammetry was significantly improved after the immo-
bilization of Prussian blue-gold nanoparticles as a catalyst for the redox reaction. In another
competition-based strategy, silica nanoparticles modified dsDNA formed by the perfect
match of the aptamer and a complementary sequence intercalated with methylene blue
(MB) as a redox probe are used. In the presence of acetamiprid, the high affinity of aptamer
toward the target induced the release of MB that is detected electrochemically using an
unmodified gold electrode [16]. In the other work, Fei et al. [17] did not use a redox probe
and proposed a label free impedimetric aptasensor based on complex composites of gold
nanoparticles (AuNPs) decorated MWCNTs and reduced graphene oxide nanoribbons
to detect femtomolar levels of the target. The aforementioned studies showed the use of
conventional electrochemical techniques such as cyclic voltammetry and electrochemical
impedance spectroscopy. Recent efforts focused to optimize and to enhance the signal
sensitivity of these techniques and particularly of electrochemical impedance spectroscopy
that needs theoretical modeling by an equivalent circuit. Accordingly, Santos et al. [18]
have been working intensively on the electrochemical capacitance spectroscopy (ECS) or
impedance-derived capacitance approach as a better alternative. They showed that when
the system is non-faradaic or faradaic regime with an external redox probe (in solution),
the electrochemical capacitance can be represented by the double layer capacitance (Cdl ).
In the case of a redox marker attached to the electrode surface, a pseudo-capacitance called
redox capacitance (Cr ) that depends on the density-of-states of the confined redox marker
was considered instead the Cdl [19]. This can be explained by the fact that measuring
electrochemical impedance spectroscopy (EIS) at the half-wave potential of the confined
redox system, the contribution of Cr is enhanced and the Cdl remains almost constant and
therefore its contribution can be neglected [20]. The Cr element corresponds to the diam-
eter of the semicircle in Nyquist capacitive plots and its value is obtained by converting
the Nyquist EIS plots. This technique has been successfully adapted for various sensing
systems [21]. According to Fernandes et al. [22], the redox capacitance of a faradaic probe
confined within a biological film on the surface, is sensitive to the whole system thus can be
correlated to the analyte concentration when the biological film is capable of recognizing
the target with high specificity. This implies that EIS-derived capacitance signal is based
on the charging signal that is generated from the activity of electroactive tethered groups,
which is related to its electrostatic environment.
The aim of this work was to report a new strategy based on the use of redox-active
nanomaterials that will not only replace the confined redox probe but also will enhance
the biosensor performances by using their capacitance properties. Particularly, two-
dimensional (2D) nanomaterials have shown interesting properties that helped to improve
the sensitivity and analytical performances of the developed biosensors [23]. In fact, MoS2
nanosheets attracted increasing interests for its excellent capacitive properties [24]. Their
sheet-like morphology provides large surface area for charge storage that can potentially
30
Appl. Sci. 2021, 11, 1382
occur via faradaic charge transfer process on the Mo(+IV) metal cation. The Mo center
presenting a range of oxidation states from +2 to +6 can exhibit pseudo-capacitance [25].
Hence, 2D MoS2 is an excellent choice for electrochemical capacitance spectroscopy appli-
cation. Furthermore, the MoS2 possesses an ultrathin plane structure of atomic thickness
making it sensitive to the surrounding environment [26]; thus, an interaction with a target
biomolecule can affect its whole thickness. These properties have been explored for design
of FET biosensing platform [27] as well as electrochemical biosensors [28]. Additionally, it
was demonstrated that MoS2 has a high affinity towards ssDNA oligonucleotides and is
able to spontaneously adsorb them via van der Waals interactions between nucleobases
and the basal plane of MoS2 nano-sheets [29]. This makes MoS2 nano-sheets suitable for
capacitive biosensor.
Herein, we report the design of an aptasensor platform in a two-steps process (Scheme 1)
by assembling the MoS2 and ssDNA aptamer to sensitively detect acetamiprid. To assure
a high stability of DNA on the surface covalent attachment was performed using lipoic
acid (LA) self-assembled to MoS2 surface. The sensing platform uses EIS-derived elec-
trochemical capacitance spectroscopy to transduce the recognition event. The novelty in
this approach is to perform the electrical measurements without any confined redox probe
attached to the surface or in solution as the MoS2 nanosheets exhibit an inherent pseudoca-
pacitance behavior. Upon interaction with acetamiprid, the aptamer will desorb from MoS2
nanosheets to form aptamer/target affinity complex. The aptamer desorption facilitates
ionic diffusion of the electrolytes resulting in a signal ON in ECS. The aptasensing electrode
allows detecting low levels of the target pesticide and demonstrates high selectivity for the
target in presence of competing pesticides. Furthermore, the aptasensor was successfully
applied to detect the pesticides in tomatoes purchased form a local market.
Scheme 1. Building up strategy for the design of acetamiprid aptasensor: (a) LA-MoS2 electrodeposi-
tion, (b) covalent aptamer immobilization, and (c) acetamiprid detection.
31
Appl. Sci. 2021, 11, 1382
synthesized with an amine modification at the 5 end position and purchased from Sigma
Aldrich (Germany). The sequence was originally published by He et al. [30]: 5 -H2 N(CH2 )6 -
TGTAATTTGTCTGCAGCGGTTCTTGATCGCTGACACCATATTATGAAGA-3 .
Phosphate-buffered saline (PBS) solutions 0.01 M (pH = 7.4) were prepared by dissolv-
ing one tablet in 200 mL of deionized water then filtered using a 0.22 μm membrane filter
and stored at 4 ◦ C until use. All chemicals used in this work were of analytical grade and
directly used without additional purification. All solutions were prepared with Milli-Q
water (18 MΩ cm−1 ) from a Millipore system. For the real sample assay, tomatoes were
purchased from a local market (Tunisia).
32
Appl. Sci. 2021, 11, 1382
2.7. Methods
Scanning electron microscope (SEM) micrographs and energy dispersive X-ray (EDX)
spectra were recorded using a FEI Quanta 200 Environmental SEM. Raman spectra were
obtained at room temperature by a Raman Spectrophotometer Horiba Jobin-Yvon equipped
with a liquid nitrogen-cooled CCD detector. FT-IR characterizations were obtained using a
Bruker Vertex FT-IR spectrometer (Bruker, Germany) equipped with a Mercury cadmium-
telluride (MCT) detector and an attenuated total reflectance (ATR) germanium crystal.
382.5 cm−1 (Figure 1a). The pic-to-pic difference of 23.1 cm−1 is consistent with obtaining
one monolayer of MoS2 [35]. To introduce functional group on the surface of MoS2 ,
the nano-sheets were treated with lipoic acid, which forms strong interaction between
molybdenum and thiol group. This will provide functional acid group on the surface of
MoS2 for further aptamer immobilization.
33
Appl. Sci. 2021, 11, 1382
(a) (b)
Figure 1. Spectroscopic characterization of MoS2 and LA–MoS2 : (a) Spectrum of MoS2 after hydrothermal synthesis;
(b) FTIR spectra of MoS2 nanosheets and LA–MoS2 conjugate.
To confirm the presence of lipoic acid moieties on the MoS2 surface, FT-IR analysis
was performed. The spectra displayed in Figure 1b show the characteristic bands attributed
to LA such as the band located at 3500 cm−1 corresponding to O-H vibrations of carboxylic
group, the band at 2925 and 2850 cm−1 corresponding to CH2 and CH stretching vibra-
tion and the band 1670 cm−1 and 1434 cm−1 corresponding to C=O and C-O vibrations,
respectively of carbonyl group [36]. All above mentioned bands are absent in the control
spectrum of MoS2 . Furthermore, the broad band located at 3392 cm−1 corresponds to O-H
stretching vibration of residual solvent in the case of unmodified MoS2 nano-sheets [37].
34
Appl. Sci. 2021, 11, 1382
(a) (b)
(c)
Figure 2. SEM images of: (a) bare screen-printed carbon electrode surface (SPCE); (b) SPCE modified LA–MoS2 Nano-sheets;
(c) EDX analysis of the modified SPCE with MoS2 nano-sheets.
35
Appl. Sci. 2021, 11, 1382
(a) (b)
(a) (b)
Figure 4. (a) Capacitance curves before and after incubation at various acetamiprid concentrations in Phosphate-buffered
saline (PBS); (b) Calibration curve of the biosensor displaying the relative variation of redox capacitance %ΔC /C0 vs. [ACE].
which allows high reproducibility of MoS2 layers in addition of DNA covalent attachment.
This biosensor presents a good performance with comparable analytical performance
with other systems described in introduction without amplification strategy where signal
readout was measured directly after detection. It takes also advantage of the chemical
stability of MoS2 where storage of the MoS2 and LA-MoS2 was checked within long
time without any variation of properties. In addition aptamer are known to have high
stability compared to others biological system [41]. The biosensor is proposed for single
use without regeneration.
This detection domain obtained does not include the concentration values of the
maximum levels of acetamiprid set by US EPA and EFSA. It is worthy to note that reel
samples have to be diluted further before acetamiprid detection, which helps to further
decrease the matrix effect. So, taking into consideration this dilution step, it is of high
interest to develop aptasensor for acetamiprid detection in diluted extracted samples.
3.4.3. Selectivity
The selectivity is an important parameter for analytical sensing devices, which charac-
terizes the ability of the aptamer to detect the specific analyte in a sample containing other
interfering molecules. The aptasensing platform was challenged by testing it with different
interferents such as chlortoluron and copper (II) for copper-based pesticides as only few
analytical method could discriminate the nature of remained contaminant residue [45].
Therefore, the biosensor response obtained with acetamiprid alone was compared with
those obtained in presence of interferents under the same experimental conditions. The
results collected from capacitance curves are presented Figure 5. The response recorded in
the presence of aforementioned interferents did not show any increase of the capacitance
37
Appl. Sci. 2021, 11, 1382
signal. A blocking effect was observed with chlortoluron, leading to decrease in capac-
itance while Cu2+ induced a minor perturbation of the transduction signal leading also
to decrease of ECS response. This study evidences the high selectivity of the aptasensor
toward acetamiprid knowing that the interferents have concentrations 10-fold higher than
that of the target.
Figure 5. Histograms giving the relative variation of redox capacitance variation after incubation
with different interferents.
(a) (b)
Figure 6. (a) Capacitance curves before (a: 0 fM) and (b to e) after incubation with various acetamiprid concentrations in
fortified tomatoes samples (b: ci , c: ci + 55 fM, d: ci + 155 fM and e: ci + 255 fM); (b) Calibration curve of the biosensor
displaying the relative variation of redox capacitance versus the target concentration.
38
Appl. Sci. 2021, 11, 1382
4. Conclusions
We report a platform of aptasensing based on MoS2 nanomaterials and the capacitance
signal readout for the detection of acetamiprid as a pesticide widely used in agriculture.
The device was built on SPCE in two steps to obtain self-assembled MoS2 /ssDNA nanos-
tructures. We demonstrated that the high affinity of MoS2 nanosheets for ssDNA and
their pseudo redox properties enable the biosensor to achieve rapid detection and high
sensitivity. The detection system takes advantage of the adsorption/desorption process
provided by the ssDNA and the aptamer complex with the MoS2 surface. In addition,
this biosensor has demonstrated high analytical performance with a signal “ON” in the
presence of acetamiprid and a detection limit in the fM range, lower than that set by the
UPA and EFSA. The study of the detection of spiked acetamiprid in tomatoes showed
a measurement comparable with those obtained in a buffer and underlines the ability
of this biosensor to measure low levels of pesticides in fresh foodstuffs. These results
demonstrated that the methodology developed with these biosensors can be easily adapted
to detect other targets of interest. This work paves the way for the development of different
highly sensitive and cost-effective aptasensors for food control applications by simply
changing the aptamer specific to other pesticides.
Author Contributions: Conceptualization M.H. and N.R.; methodology M.H., N.R., and M.H.,
validation, N.R. and H.K.-Y.; formal analysis, M.H.; N.R., and H.K.-Y.; writing—original draft
preparation, M.H. and N.R.; writing—review and editing, M.H. and H.K.-Y. Supervision, N.R. and
H.K.-Y.; project administration, H.K.-Y.; funding acquisition, H.K.-Y. All authors have read and
agreed to the published version of the manuscript.
Funding: This research was funded by MEAE and MESRI PHC grand number 39382RE.
Institutional Review Board Statement: Not Applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Data is contained within the article.
Acknowledgments: The authors acknowledge technical support from Instrumental Platform of
ICMMO University Paris-Saclay.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Imamura, T.; Yanagawa, Y.; Nishikawa, K.; Matsumoto, N.; Sakamoto, T. Two cases of acute poisoning with acetamiprid in
humans. Clin. Toxicol. 2010, 48, 851–853. [CrossRef] [PubMed]
2. Kocaman, A.Y.; Topaktaş, M. Genotoxic effects of a particular mixture of acetamiprid and alpha-cypermethrin on chromosome
aberration, sister chromatid exchange, and micronucleus formation in human peripheral blood lymphocytes. Environ. Toxicol.
2010, 25, 157–168. [CrossRef] [PubMed]
3. Qi, Y.; Xiu, F.-R.; Zheng, M.; Li, B. A simple and rapid chemiluminescence aptasensor for acetamiprid in contaminated samples:
Sensitivity, selectivity and mechanism. Biosens. Bioelectron. 2016, 83, 243–249. [CrossRef] [PubMed]
4. U.S. Environmental Protection Agency. Name of Chemical: Acetamiprid Reason for Issuance: Conditional Registration. 2002 Date
Issued: March 15 Acetamiprid Proposed Interim Registration Review Decision Case Number 7617 January 2020, Docket Number
EPA-HQ-OPP-2012-0329. Available online: https://www.epa.gov/sites/production/files/2020-01/documents/acetamiprid_
pid.pdf (accessed on 9 September 2020).
5. Wanatabe, S.; Ito, S.; Kamata, Y.; Omoda, N.; Yamazaki, T.; Munakata, H.; Kaneko, T.; Yuasa, Y. Development of competitive
enzyme-linked immunosorbent assays (ELISAs) based on monoclonal antibodies for chloronicotinoid insecticides imidacloprid
and acetamiprid. Anal. Chim. Acta 2001, 427, 211–219. [CrossRef]
39
Appl. Sci. 2021, 11, 1382
6. Zhang, B.; Pan, X.; Venne, L.; Dunnum, S.; McMurry, S.T.; Cobb, G.P.; Anderson, T.A. Development of a method for the
determination of 9 currently used cotton pesticides by gas chromatography with electron capture detection. Talanta 2008, 75,
1055–1060. [CrossRef]
7. Vichapong, J.; Burakham, R.; Srijaranai, S. Alternative Liquid–Liquid Microextraction as Cleanup for Determination of Neonicoti-
noid Pesticides Prior HPLC Analysis. Chromatographia 2016. [CrossRef]
8. Mateu-Sánchez, M.; Moreno, M.; Arrebola, F.J.; Vidal, J.L.M. Analysis of Acetamiprid in Vegetables Using Gas Chromatography-
Tandem Mass Spectrometry. Anal. Sci. 2003, 19, 701–704. [CrossRef]
9. Zeng, L.; Peng, L.; Wu, D.; Yang, B. Electrochemical Sensors for Food Safety. In Nutrition in Health and Disease—Our Challenges
Now and Forthcoming Time; IntechOpen: London, UK, 2018. [CrossRef]
10. Li, Z.; Mohamed, M.A.; Vinu Mohan, A.M.; Zhu, Z.; Sharma, V.; Mishra, G.K.; Mishra, R.K. Application of Electrochemical
Aptasensors toward Clinical Diagnostics, Food, and Environmental Monitoring: Review. Sensors (Basel) 2019, 19, 5435. [CrossRef]
11. Ben Aissa, S.; Mars, A.; Catanante, G.; Marty, J.-L.; Raouafi, N. Design of a redox-active surface for ultrasensitive redox capacitive
aptasensing of aflatoxin M1 in milk. Talanta 2019, 195, 525–532. [CrossRef]
12. Zou, X.; Wu, J.; Gu, J.; Shen, L.; Mao, L. Application of Aptamers in Virus Detection and Antiviral Therapy. Front. Microbiol. 2019,
10, 1462. [CrossRef]
13. Raouafi, A.; Sánchez, A.; Raouafi, N.; Villalonga, R. Electrochemical aptamer-based bioplatform for ultrasensitive detection of
prostate specific antigen. Sens. Actuators B Chem. 2019, 297, 126762. [CrossRef]
14. Sun, D.; Lu, J.; Zhang, L.; Chen, Z. Aptamer-based electrochemical cytosensors for tumor cell detection in cancer diagnosis: A
review. Anal. Chim. Acta 2019, 1082, 1–17. [CrossRef] [PubMed]
15. Shi, X.; Sun, J.; Yao, Y.; Liu, H.; Huang, J.; Guo, Y.; Sun, X. Novel electrochemical aptasensor with dual signal amplification
strategy for detection of acetamiprid. Sci. Total Environ. 2020, 705, 135905. [CrossRef] [PubMed]
16. Taghdisi, S.M.; Danesh, N.M.; Ramezani, M.; Abnous, K. Electrochemical aptamer based assay for the neonicotinoid insecticide
acetamiprid based on the use of an unmodified gold electrode. Microchim. Acta 2017, 184, 499–505. [CrossRef]
17. Fei, A.; Liu, Q.; Huan, J.; Qian, J.; Dong, X.; Qiu, B.; Mao, H.; Wang, K. Label-free impedimetric aptasensor for detection
of femtomole level acetamiprid using gold nanoparticles decorated multiwalled carbon nanotube-reduced graphene oxide
nanoribbon composites. Biosens. Bioelectron. 2015, 70, 122–129. [CrossRef]
18. Santos, A. Fundamentals and Applications of Impedimetric and Redox Capacitive Biosensors. J. Anal. Bioanal. Tech. 2014, S7.
[CrossRef]
19. Cecchetto, J.; Fernandes, F.C.B.; Lopes, R.; Bueno, P.R. The capacitive sensing of NS1 Flavivirus biomarker. Biosens. Bioelectron.
2017, 87, 949–956. [CrossRef]
20. Lehr, J.; Weeks, J.R.; Santos, A.; Feliciano, G.T.; Nicholson, M.I.G.; Davis, J.J.; Bueno, P.R. Mapping the ionic fingerprints of
molecular monolayers. Phys. Chem. Chem. Phys. 2017, 19, 15098–15109. [CrossRef]
21. Raouafi, A.; Rabti, A.; Raouafi, N. A printed SWCNT electrode modified with polycatechol and lysozyme for capacitive detection
of α-lactalbumin. Microchim. Acta 2017, 184, 4351–4357. [CrossRef]
22. Fernandes, F.C.B.; Góes, M.S.; Davis, J.J.; Bueno, P.R. Label free redox capacitive biosensing. Biosens. Bioelectron. 2013, 50, 437–440.
[CrossRef]
23. Su, S.; Sun, Q.; Gu, X.; Xu, Y.; Shen, J.; Zhu, D.; Chao, J.; Fan, C.; Wang, L. Two-dimensional nanomaterials for biosensing
applications. TrAC Trends Anal. Chem. 2019, 119, 115610. [CrossRef]
24. Patel, R.; Inamdar, A.; Kim, H.; Im, H. In-Situ hydrothermal synthesis of a MoS2 nanosheet electrode for electrochemical energy
storage applications. J. Korean Phys. Soc. 2016, 68, 1341–1346. [CrossRef]
25. Soon, J.M.; Loh, K. Electrochemical Double-Layer Capacitance of MoS2 Nanowall Films. Electrochem. Solid-State Lett. 2007, 10,
A250. [CrossRef]
26. Chen, X.; Park, Y.J.; Kang, M.; Kang, S.-K.; Koo, J.; Shinde, S.M.; Shin, J.; Jeon, S.; Park, G.; Yan, Y.; et al. CVD-grown monolayer
MoS 2 in bioabsorbable electronics and biosensors. Nat. Commun. 2018, 9, 1690. [CrossRef]
27. Liu, J.; Chen, X.; Wang, Q.; Xiao, M.; Zhong, D.; Sun, W.; Zhang, G.; Zhang, Z. Ultrasensitive Monolayer MoS2 Field-Effect
Transistor Based DNA Sensors for Screening of Down Syndrome. Nano Lett. 2019, 19, 1437–1444. [CrossRef] [PubMed]
28. Dalila R, N.; Md Arshad, M.K.; Gopinath, S.C.B.; Norhaimi, W.M.W.; Fathil, M.F.M. Current and future envision on developing
biosensors aided by 2D molybdenum disulfide (MoS2) productions. Biosens. Bioelectron. 2019, 132, 248–264. [CrossRef] [PubMed]
29. Zhu, C.; Zeng, Z.; Li, H.; Li, F.; Fan, C.; Zhang, H. Single-Layer MoS2-Based Nanoprobes for Homogeneous Detection of
Biomolecules. J. Am. Chem. Soc. 2013, 135, 5998–6001. [CrossRef]
30. He, J.; Liu, Y.; Fan, M.; Liu, X. Isolation and Identification of the DNA Aptamer Target to Acetamiprid. J. Agric. Food Chem. 2011,
59, 1582–1586. [CrossRef]
31. Zhang, X.H.; Wang, C.; Xue, M.Q.; Lin, B.C.; Ye, X.; Lei, W.N. Hydrothermal synthesis and characterization of ultrathin MoS2
nanosheets. Chalcogenide Lett. 2016, 13, 27–34. [CrossRef]
32. Jeong, M.; Kim, S.; Ju, S.-Y. Preparation and characterization of a covalent edge-functionalized lipoic acid–MoS2 conjugate. RSC
Adv. 2016, 6, 36248–36255. [CrossRef]
33. Haddaoui, M.; Sola, C.; Raouafi, N.; Korri-Youssoufi, H. E-DNA detection of rpoB gene resistance in Mycobacterium tuberculosis
in real samples using Fe3O4/polypyrrole nanocomposite. Biosens. Bioelectron. 2019, 128, 76–82. [CrossRef] [PubMed]
40
Appl. Sci. 2021, 11, 1382
34. Feier, B.; Băjan, I.; Cristea, C.; Săndulescu, R. Aptamer-based Electrochemical Sensor for the Detection of Ampicillin. In
Proceedings of the International Conference on Advancements of Medicine and Health Care through Technology, Cluj-Napoca,
Romania, 12–15 October 2016; Vlad, S., Roman, N.M., Eds.; Springer International Publishing: Cham, Switzerland, 2017; pp.
107–110.
35. Li, H.; Lu, G.; Yin, Z.; He, Q.; Li, H.; Zhang, Q.; Zhang, H. Optical Identification of Single- and Few-Layer MoS2 Sheets. Small
2012, 8, 682–686. [CrossRef] [PubMed]
36. Nie, C.; Zhang, B.; Gao, Y.; Yin, M.; Yi, X.; Zhao, C.; Zhang, Y.; Luo, L.; Wang, S. Thickness-Dependent Enhancement of Electronic
Mobility of MoS2 Transistors via Surface Functionalization. J. Phys. Chem. C 2020, 124, 16943–16950. [CrossRef]
37. Zhou, K.; Jiang, S.; Bao, C.; Song, L.; Wang, B.; Tang, G.; Hu, Y.; Gui, Z. Preparation of poly(vinyl alcohol) nanocomposites with
molybdenum disulfide (MoS2 ): Structural characteristics and markedly enhanced properties. RSC Adv. 2012, 2, 11695. [CrossRef]
38. Kong, N.; Zhang, S.; Liu, J.; Wang, J.; Liu, Z.; Wang, H.; Liu, J.; Yang, W. The influence of 2D nanomaterials on electron transfer
across molecular thin films. Mol. Syst. Des. Eng. 2019, 4, 431–436. [CrossRef]
39. Rastogi, P.K.; Sarkar, S.; Mandler, D. Ionic strength induced electrodeposition of two-dimensional layered MoS2 nanosheets. Appl.
Mater. Today 2017, 8, 44–53. [CrossRef]
40. Mejri-Omrani, N.; Miodek, A.; Zribi, B.; Marrakchi, M.; Hamdi, M.; Marty, J.-L.; Korri-Youssoufi, H. Direct detection of OTA by
impedimetric aptasensor based on modified polypyrrole-dendrimers. Anal. Chim. Acta 2016, 920, 37–46. [CrossRef]
41. Wang, Y.; Ning, G.; Bi, H.; Wu, Y.; Liu, G.; Zhao, Y. A Novel Ratiometric Electrochemical Assay for Ochratoxin A Coupling Au
Nanoparticles Decorated MoS2 Nanosheets with Aptamer. Electrochim. Acta 2018, 285, 120–127. [CrossRef]
42. Yao, Y.; Wang, G.X.; Shi, X.J.; Li, J.S.; Yang, F.Z.; Cheng, S.T.; Zhang, H.; Dong, H.W.; Guo, Y.M.; Sun, X.; et al. Ultrasensitive
aptamer-based biosensor for acetamiprid using tetrahedral DNA nanostructures. J. Mater. Sci. 2020, 55, 15975–15987. [CrossRef]
43. Madianos, L.; Tsekenis, G.; Skotadis, E.; Patsiouras, L.; Tsoukalas, D. A highly sensitive impedimetric aptasensor for the selective
detection of acetamiprid and atrazine based on microwires formed by platinum nanoparticles. Biosens. Bioelectron. 2018, 101,
268–274. [CrossRef]
44. Jiang, D.; Du, X.; Liu, Q.; Zhou, L.; Dai, L.; Qian, J.; Wang, K. Silver nanoparticles anchored on nitrogen-doped graphene as
a novel electrochemical biosensing platform with enhanced sensitivity for aptamer-based pesticide assay. Analyst 2015, 140,
6404–6411. [CrossRef] [PubMed]
45. Grimalt, S.; Dehouck, P. Review of Analytical Methods for the Determination of Pesticide Residues in Grapes. J. Chromatogr. A
2016, 1433, 1–23. [CrossRef] [PubMed]
46. Kim, H.-J.; Shelver, W.L.; Li, Q.X. Monoclonal antibody-based enzyme-linked immunosorbent assay for the insecticide imidaclo-
prid. Anal. Chim. Acta 2004, 509, 111–118. [CrossRef]
41
applied
sciences
Article
Tonic and Phasic Amperometric Monitoring of
Dopamine Using Microelectrode Arrays in
Rat Striatum
Martin Lundblad 1,† , David A. Price 1,† , Jason J. Burmeister 1,† , Jorge E. Quintero 1 , Peter Huettl 1 ,
Francois Pomerleau 1 , Nancy R. Zahniser 2,‡ and Greg A. Gerhardt 1, *
1 Department of Neuroscience, Center for Microelectrode Technology and Brain Restoration Center,
University of Kentucky Medical Center, MN206, Lexington, KY 40536-0298, USA;
martin.lundblad@gmail.com (M.L.); priced0@gmail.com (D.A.P.); jason@jasonburmeisterconsulting.com (J.J.B.);
george.quintero@uky.edu (J.E.Q.); peter.huettl@uky.edu (P.H.); francois.pomerleau@uky.edu (F.P.)
2 Department of Pharmacology, Neuroscience Program, University of Colorado Denver, Aurora,
CO 80045, USA; nancy.zahniser@ucdenver.edu
* Correspondence: gregg@uky.edu; Tel.: +1-859-323-4531
† Co-First Authors.
‡ Professor Nancy R. Zahniser died unexpectedly on 5 May 2016.
Abstract: Here we report a novel microelectrode array recording approach to measure tonic (resting)
and phasic release of dopamine (DA) in DA-rich areas such as the rat striatum and nucleus accumbens.
The resulting method is tested in intact central nervous system (CNS) and in animals with extensive loss
of the DA pathway using the neurotoxin, 6-hydroxyDA (6-OHDA). The self-referencing amperometric
recording method employs Nafion-coated with and without m-phenylenediamine recording sites
that through real-time subtraction allow for simultaneous measures of tonic DA levels and transient
changes due to depolarization and amphetamine-induced release. The recording method achieves
low-level measures of both tonic and phasic DA with decreased recording drift allowing for enhanced
sensitivity normally not achieved with electrochemical sensors in vivo.
1. Introduction
Dopamine (DA) serves as a principle neurotransmitter for essential brain pathways that regulate
affect, cognition, movement, and reward [1]. Analytical approaches for the detection and quantification
of extracellular levels of brain DA have been of the utmost importance for elucidating its role as
a modulatory neurotransmitter and for advancing our understanding of how brain DA systems
impact ongoing behavior [2,3]. Extracellular DA is present in both synaptic and extrasynaptic
pools, which enables differential modulation of pre- and postsynaptic neuronal signaling [4].
Following activity-dependent release, diffusion mediates spillover of synaptic DA into extrasynaptic
pools where DA transporters (DATs) are involved in “regulating the sphere of influence and lifetime of
released DA beyond a synapse [5].” However, current analytical techniques are unable to measure both
tonic and phasic levels of DA simultaneously and, thus, require the use of a complementary approach
to investigate the “missing” component of extracellular neurotransmitter dynamics. In turn, there is
a need for the effective simultaneous measure and quantitation of synaptic and extra-synaptic DA
levels using neurochemical methods that combine real-time monitoring with high spatial-temporal
resolution and sensitivity.
Microdialysis sampling coupled with powerful analytical technologies has been the conventional
approach for quantifying extracellular neurotransmitter levels in vivo. Once collected, dialysate samples
are processed with separation analytics like high-performance liquid chromatography (HPLC),
providing measurements with excellent chemical selectivity and sensitivity while affording
the opportunity to measure multiple analytes for both acute and chronic in vivo studies [6].
Although high-level chemical selectivity and sensitivity measures have become hallmarks of such
strategies, the low-level spatial-temporal resolution of sampling continues to generate curiosity
regarding the missed neurochemical dynamics that occur between the large inter-sample intervals
(typically 10 min) while spurring controversy as to which extracellular pool of neurotransmitters is
being sampled [7,8]. While sampling rates have continued to undergo refinement towards improving
temporal resolution (e.g., up to 1 sample per 10 s), second-by-second or sub-second monitoring has
not hitherto been achieved [6,9]. Microdialysis probes typically have an active length of 1–4 mm with
tip diameters of 0.2–0.3 mm, which places the sampling resolution of this approach at >0.1 mm3 [6].
Because of its large size, probe-induced tissue damage and neuroinflammation may culminate in
secondary effects on neurotransmitter efflux and resting levels, further complicating the interpretation of
results [10–13]. Thus, despite the tandem use of powerful separation analytical approaches, the low-level
spatial-temporal resolution of microdialysis continues to limit its capabilities for monitoring phasic
neurotransmission in vivo.
In vivo electrochemical approaches have emerged as a complementary collection of techniques
to microdialysis as they “provide answers that are not presently accessible by microdialysis or any
other measurement technique [11].” For example, in vivo electrochemistry has been instrumental to
identifying the presence of spontaneous DA release and regulation of DAT-mediated clearance of
DA [14–18]. Electrochemical sensors are designed for use in freely moving behavioral recordings where
higher resolution is necessary to capture transient DA events. While the chemical selectivity achieved
with powerful separation technologies is irrefutable, the spatial-temporal resolution of electrochemical
techniques greatly exceeds that of microdialysis probes and, thus, enables sub-second measures with
an electrode diameter of 5–200 μm [19]. Importantly, smaller sized electrochemical electrodes produce
less tissue responsiveness and damage post-implantation in the brain [20,21]. Although advances
in electrochemical approaches have opened up new avenues in the area of in vivo neurotransmitter
monitoring including 3D printed carbon electrodes, submicron sized cavity carbon-nanopipette
electrodes, sub-millisecond resolution measuring DA over months, and optogenetic stimulation,
the most significant shortcoming of these approaches for measures of extracellular DA continues to be
the inability to resolve resting neurotransmitter levels [14,22–25].
Here, we describe the development and implementation of ceramic-based microelectrode arrays
(MEAs) for intracranial monitoring of tonic and phasic DA neurotransmission by: (1) demonstrating the
ability of MEAs to measure DA in vitro and in vivo with constant potential amperometry; (2) discussing
in vivo testing through proof-of-concept experiments using normal and denervated striatum in
anesthetized rats; and (3) introducing new developments for the measurement of brain DA through
a conformal MEA design that enable the real-time, simultaneous monitoring of DA from multiple
depths in the rat brain.
2.1. Reagents
Unless stated otherwise, laboratory chemicals were purchased from Fisher Scientific (Waltham,
MA, USA) or Sigma Aldrich (St. Louis, MO, USA).
44
Appl. Sci. 2020, 10, 6449
Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of the
University of Kentucky (IACUC Identification Number: 2019-3387).
45
Appl. Sci. 2020, 10, 6449
0.33 mm
DA Background
Ascorbic m-PD
0.1
acid and
other anions
0.33
Nafion®
0.1
(A)
Ascorbic acid
Dopamine
2 mm
Ascorbic acid
1
Dopamine
1
0.1
(B)
Figure 1. Microelectrode array (MEA) design and function as configured for dopamine (DA)
measurement. Photomicrographs and corresponding schematics of Nafion® -coating and selective
electrodeposition of m-phenylenediamine (m-PD) for a (A) 4-channel S2 MEA (333 × 15 micron pairs)
and (B) 8-channel DSPR8 MEA with reaction schemes are shown. The distance between recording pairs
is also shown for both MEAs.
46
Appl. Sci. 2020, 10, 6449
3. Results
47
Appl. Sci. 2020, 10, 6449
without self-referencing subtraction (range, in nM: S2, 2.7 to 430; DSPR8, 1.9 to 100.0) and showed
similar sensitivity per unit area measurements of DA (range, in pA/μM−1 /mm−2 : S2, −1181 to −24,277;
DSPR8, −696 to −21,437). Importantly, sentinel recording sites (i.e., Nafion® -coated + m-PD) did not
respond to additions of DA or AA. Sensitivity/area is comparable to previous work [29].
Electrode Type n Sensitivity (pA/μM) Sensitivity/Area (pA mM−1 mm−2 ) LOD (nM) R2 Selectivity
S2 23 −42.0 ± 0.0 −8422 ± 954 62.3 ± 21.3 0.976 ± 0.008 1487 ± 194
DSPR8 20 −31.7 ± 7.1 −6349 ± 1423 27.5 ± 5.7 0.965 ± 0.006 2664 ± 358
3.2. Proof-of-Concept for MEA-Based In Vivo Measures of Phasic and Tonic DA Levels
The high level of spatial-temporal resolution imparted by in vivo electrochemical technologies
with microelectrodes has been instrumental to shaping current views of phasic DA neurotransmission
in the areas of release and uptake [11]. The ability of S2 MEAs to measure phasic changes in extracellular
DA was determined in the dSTR of anesthetized rats with and without a 6-OHDA lesion. The in vivo
MEA response was tracked following the local application of DA (100 nL; 200 μM, pH 7.4) in the dSTR
(data not shown). In addition to detecting exogenous DA, MEAs successfully captured active DA
uptake—indicated by the descending portion of the curve. In keeping with previous observations
from our laboratory using carbon fiber microelectrodes, amplitude-matched DA signals were cleared
more slowly in the lesioned vs. non-lesioned dSTR [41]. Figure 2 shows the in vivo MEA response to
repeated applications of KCl (100 nL; 120 mM, pH 7.4) in the dSTR, which stimulates neurotransmitter
release from nerve terminals. Ejection of KCl in the non-lesioned dSTR stimulated endogenous DA
release (peak amplitude in μM: first stimulation, 4.3; second stimulation, 3.1). Importantly, KCl-evoked
DA release in the lesioned dSTR was significantly reduced for both the first and second applications
of KCl (peak amplitude in μM based on the calibration slope calculated in pA/μM: first stimulation,
0.1; second stimulation, 0.05). In addition, while the rat striatum has norepinephrine and serotonin
nerve terminals that can be detected by the MEAs, the KCl-evoked signals are dramatically reduced
in the lesioned striatum showing that the signal recorded is likely predominantly DA. The MEAs
are known to respond to serotonin and norepinephrine in vitro and in vivo, but the levels of these
neurotransmitters in vivo are 40–1000 folds lower than the DA based on the tissue levels of the
monoamines [42]. Collectively, these data support the use of MEAs for traditional measures of in vivo
DA signals.
The inability of in vivo electrochemical techniques to measure tonic DA levels continues to be
a major shortcoming and necessitates that a complementary approach (e.g., microdialysis) be used
to study resting DA levels [7]. While the combined approach escalates the complexity, cost and
commitment to a study, inclusion of one approach and not the other may only be appropriate for
certain experimental designs. MEAs have been routinely utilized to quantify both evoked and resting
glutamate levels in the CNS [30,32–34,43–46]. Therefore, we employed 4-channel S2 MEAs in initial
studies aimed at providing proof-of-concept for measurement of tonic DA levels in the dSTR of
anesthetized rats. Preliminary studies determined that self-referencing alone did not always remove
the intrinsic background current of S2 MEA recording sites in vivo (data not shown). Therefore,
we utilized the small size of the MEA device to record electrochemical signals in brain regions that differ
with regard to dopaminergic innervation—DA innervation is low in the primary motor cortex and high
in the dSTR—in conjunction with the self-referencing approach to establish a baseline electrochemical
signal in the brain microenvironment (Figure 3A). MEAs were first positioned in the cortex, and after
establishing a stable baseline signal (typically ≥90 min), S2 MEAs were lowered ventrally to a final
recording position in the dSTR (Figure 3A). Initially, the self-referenced baseline signal measured by DA
sites appeared to be comparable between the cortex and dSTR (Figure 3B). However, Figure 3B shows
that the dSTR baseline signal is actually greater (i.e., flipped) vs. the cortical baseline signal (in vivo
baseline current, in pA: cortex, 71.7; dSTR, 73.0). Thus, by first recording in the primary motor cortex,
48
Appl. Sci. 2020, 10, 6449
which is void of DA, the electrochemical current in the dSTR and background electrochemical current of
the brain could be distinguished. We next used these basic principles to measure tonic (i.e., resting) DA
levels in the dSTR of rats with and without a 6-OHDA lesion. Following self-referencing, the cortical
baseline signal was subtracted from the dSTR baseline signal to remove the background electrochemical
current to enable resting DA levels to be quantified. The S2 MEA approach showed a significant 88%
decrease of resting DA levels in the dSTR (in nM: non-lesioned, 19.4 ± 2.1; 6-OHDA, 2.3 ± 1.3 ***;
paired t-test, *** p < 0.001). HPLC confirmed a 99% loss of DA tissue content in the denervated dSTR
(in μg/g of tissue: non-lesioned, 6.3 ± 0.8; 6-OHDA, 0.03 ± 0.002). These low nanomolar levels of
resting DA are consistent with studies using no net flux microdialysis [6,47–50] and the recent square
wave voltammetry study by Taylor et al. [51].
PM)
49
Appl. Sci. 2020, 10, 6449
Resting level
recording
Figure 3. Proof-of-concept for MEA-based measures of resting DA levels in vivo. (A) Reconstruction
of differential cortical-striatal recording with a 4-channel S2 MEA. S2 MEAs were positioned in primary
motor cortex and after establishing a baseline signal were lowered ventrally into the dSTR. (B) Baseline
current differences measured in the anesthetized rat primary motor cortex and dSTR following
self-referencing. Recording shows the cortical-striatal baseline current increase between the primary
motor cortex (i.e., low DA innervation) and dSTR (i.e., high DA innervation). The difference between the
baseline current measured in the dSTR vs. cortex represents resting DA levels. (C) The self-referenced
cortical baseline was subtracted from the self-referenced baseline signal in dSTR to calculate differences
in resting DA levels between the non-lesioned and 6-OHDA lesioned dSTR. *** p < 0.001, paired t-test.
Note the low nanomolar detected levels of DA by the method. (D) High-performance liquid
chromatography (HPLC) analysis of DA tissue content from non-lesioned and 6-OHDA lesioned dSTR.
*** p < 0.001, paired t-test (n = 5–7).
3.3. Conformal MEAs for In Vivo Measures of DA from Multiple Recording Depths
The proof-of-principle studies outlined above led us to design a novel 8-channel MEA with
differential spacing of platinum recording site pairs to enable simultaneous measures of DA at multiple
recording depths in the rat brain. The single-sided DSPR8 MEA was designed on earlier studies
using S2 MEAs to measure DA. Figure 4A shows the 1–2 mm spacing between recording pairs on
the DSPR8 MEA, which allows, in this case, one pair of sites to record in the primary motor cortex
while the other three more ventral pairs (≥2 mm from the cortical pair) are positioned to record at
multiple depths in the dSTR (1 mm spacing between each pair in the dSTR). Once the tip of the DSPR8
MEA was lowered to the final DV coordinate, the electrochemical signals were allowed to reach a
stable baseline (typically ≥90 min). Figure 4B–D show the self-referenced DA signal at each recording
depth before and after systemic administration of the psychostimulant d-amphetamine (2 mg/kg, i.p.).
50
Appl. Sci. 2020, 10, 6449
The onset of d-amphetamine changes in DA signaling was quite rapid. In vitro testing showed MEAs
are insensitive to d-amphetamine.
Subject #1
d-Amphetamine
(A) (B)
Subject #2 Subject #3
d-Amphetamine d-Amphetamine
(C) (D)
Figure 4. Conformal MEA design for simultaneous measures of in vivo DA dynamics at multiple
recording depths. (A) Depth profile illustrating location of each MEA pair; (B–D) concentration versus
time plots for subjects 1–3 before and after administration of d-amphetamine (2 mg/kg, i.p.). Time axis
bars are 10 min and concentration axis bars are 100 μM.
The effects of the psychostimulant, d-amphetamine, on DA release have been widely characterized
and are a known way to measure non-calcium dependent release of DA [52]. Therefore, we assessed
the effect of systemic administration of d-amphetamine (2 mg/kg, i.p.) on resting levels of DA in the
anesthetized dSTR of rats. d-Amphetamine caused a rapid extracellular increase in DA. Interestingly,
the elevated levels of resting DA were accompanied by DA transients seen more closely in Figure 5,
51
Appl. Sci. 2020, 10, 6449
which are likely related to the complex actions of d-amphetamine on DA release. The number of spikes
and the amplitudes varied in number and size (range: ~5 nM to 800 nM). Of particular note is that this
pilot study shows the variable response of DA nerve terminals to the d-amphetamine in subregions of
the rat striatum and nucleus accumbens (ventral striatum) of the same animal.
Peak Amplitude (nM)
4. Discussion
In vivo monitoring of neurotransmitters in the CNS during the last decade with ceramic-based
MEAs has primarily focused on the measurement and quantification of non-electroactive chemical
species (e.g., glutamate) through enzyme-mediated conversion to an electroactive reporter molecule
(i.e., H2 O2 ) [30,34,43–45]. Undoubtedly, the success of these approaches for the determination of
phasic and tonic neurotransmitter levels, can be directly attributed to the multi-site configuration of
the MEAs [29,32]. More recently, Nafion® -coated MEAs with m-PD electroplated on select platinum
recording sites were used for the measurement of brain nitric oxide [53]. Here, S2 MEAs were
successfully utilized to measure phasic and tonic DA levels in the anesthetized rat dSTR—extending
the abilities of MEA technology for in vivo monitoring. The confirmation of a hypodopaminergic state
in the 6-OHDA lesion model—attenuated DA uptake, impaired evoked release of DA and depleted
resting DA levels—observed with the S2 MEAs provided a sound platform and proof-of-concept for
further exploring the utility of this approach.
52
Appl. Sci. 2020, 10, 6449
In addition to repelling negatively charged molecules (e.g., AA), thus reducing high-level
background currents in vivo, Nafion® concentrates positively charged molecules (e.g., DA) near the
electrode surface [28,31,32]. During the last decade, the design and fabrication of MEAs has continued
to evolve alongside steps towards understanding the unique performance abilities of the device [54].
When compared with earlier MEA designs, the enhanced performance of the MEA types used here to
measure DA can likely be attributed to improved precision and reproducibility of the Pt recording
sites due to the MEA fabrication process [29]. Subtle differences between individual recording site
performances within a single MEA device, as well as between MEA devices, are not unexpected since
individual pads retain unique physical properties post-fabrication. In this regard, we have recently
shown that the nanostructured surface topography of individual pads contributes to an electroactive
area that is greater than the geometric area [41]. However, dissimilarities regarding the thickness of
Nafion® following dip-coating, which may produce differential diffusion layers, may also contribute
to small differences in the responsiveness of individual recording sites. In addition to confirming the
utility of Nafion® for repelling major CNS interferents, our findings here further support the utility of
m-PD for removing larger organic molecules (e.g., AA), including the analyte of interest (i.e., DA),
for the incorporation of self-referencing approaches [33].
Both Nafion and m-PD were employed on the sentinel recording sites to achieve the self-referencing
configuration to selectively measure resting DA levels This dual-selective layer makes the Pt recording
sites of the MEAs essentially unresponsive to electroactive species that are anionic and larger than
H2 O2 . When the sentinel signal is subtracted from the Nafion-only site a ‘pure’ catecholamine signal
is achieved. In addition, m-PD can be precisely coated onto recording sites even if they are in close
proximity (within microns) to other sites. The resulting electrode pairs have excellent selectivity over
anionic species such as DOPAC and ascorbate. In addition, they display nanomolar detection limits for
DA which are adequate to measure resting levels. However, the subtraction approach employed in this
study achieved improved baseline stability for long recordings in vivo (>2 h) and had an improved
apparent limit of detection (LOD) that far exceeds standard amperometric recordings with the same
MEAs (Table 1). This is similar to self-referenced in vivo glutamate measures where noise that is present
on both sites is removed [55,56]. Our estimated LOD for the S2 and DSRP8 MEAs, employed using
the self-referencing subtraction approach, ranged from 0.3 to 1 nanomolar, which rivals the recent
report of DA detection by Taylor et al. using square-wave voltammetry [51]. This is seen from the
recordings of d-amphetamine-induced DA transients seen in Figure 5, which required no filtering or
signal averaging. The improved stability and enhanced LOD of the recording are attributed to the “real
time” subtraction of the non-Faradaic background current of the Pt recording pairs that achieves the
measures of resting DA. The improved baseline stability and the enhanced LOD exceed the capabilities
of other amperometric recording methods, warranting further investigation and use.
Amperometric recording methods have always been limited due to the inherent problems of the
current signal being composed of both non-Faradaic, background current and the Faradaic response to
analytes [57]. As such, techniques such as differential pulse voltammetry and chronoamperometry were
developed to minimize the analytical shortcomings of the unpredictability of an electrode’s “double
layer” [57]. The present study employed a novel approach to subtract off the apparent “non-Faradaic”
signals of the recording pads by a real-time subtraction approach that measures the differential response
of two nearly identical recording pads. This approach cannot be readily achieved by hand-fabricated
microelectrodes where the active surface area of the electrode cannot always be predicted from the
geometric area of the surface. By contrast, the MEAs are a microfabricated technology that achieves
precision by methods used in the microelectronic industry to build microchips. The manufacturing
process achieves a high level of precision and the MEAs are sorted for their analytical response to
achieve precision so that in essence the Pt recording sites are nearly identical. Thus, in contrast to
many microelectrode technologies, the active recording surfaces are highly reproducible and the active
recording area of the electrode is proportional to the surface area. We stress that the differential recording
method described in this paper will only work with MEAs that have a very high level of recording site
53
Appl. Sci. 2020, 10, 6449
precision. In this study, conformal MEAs were used to compare real-time DA levels from multiple
recording depths in vivo within the same animal following systemic administration of d-amphetamine.
D-amphetamine has been extensively studied and is known to produce a non-calcium-dependent release
of DA through its interaction with the dopamine transporter (DAT) located on the DA presynaptic
terminal [52]. Importantly, DA is released through the reverse transport of DAT [21]. Our study
demonstrated such release in multiple areas of the rat striatum, yielding signals that contained both
slower DA release and evidence of transient DA signals of varying amplitudes and time courses in
some brain regions. Galli and coworkers using electrophysiological methods to study DAT have shown
that d-amphetamine can change the probability of d-amphetamine-induced DA release through the
DAT by a shuttle carrier vs. pore like model [58]. We attribute the more transient spikes of DA release
seen in some to the rat brain areas to be due to enhanced pore function of the DAT. This is an exciting
hypothesis that needs to be further explored.
5. Conclusions
The present study has demonstrated that a differential recording method can be employed in
DA-rich areas of the rat striatum and nucleus accumbens to reliably measure tonic (resting) and phasic
DA release with subsecond temporal resolution and a refined spatial resolution dictated by the size of
the MEA Pt recording sites. Proof of concept studies show that the technique can reliably measure
changes in resting levels and transient changes in DA with improved baseline stability and a greatly
enhanced apparent LOD. The use of the DSRP8 MEAs demonstrates that multisite recordings can
be simultaneously made in brain subregions within the same animal. The enhanced stability of the
recording method and the improved LOD of the method is worthy of further exploration.
Author Contributions: Conceptualization, G.A.G., N.R.Z. and M.L.; methodology, F.P. and J.E.Q.; software, J.J.B.;
validation, M.L., D.A.P. and J.E.Q.; formal analysis, M.L.; investigation, M.L., D.A.P.; resources, P.H.; data curation,
F.P.; writing—original draft preparation, Co-First Authors, M.L., D.A.P., J.J.B.; writing—review and editing,
J.J.B., G.A.G., P.H., F.P., and J.E.Q.; visualization, M.L. and D.A.P.; supervision, J.E.Q.; project administration,
P.H. and J.E.Q.; funding acquisition, G.A.G., N.R.Z. All authors have read and agreed to the published version of
the manuscript.
Funding: This research was funded by NIH CEBRA II DA017186. M.L. was supported by Wenner-Gren
Foundation, Stockholm, Sweden.
Conflicts of Interest: GAG is principal owner of Quanteon LLC, J.E.Q., F.P., P.H., and J.J.B. serve as consultants to
Quanteon LLC. The funders had no role in the design of the study; in the collection, analyses, or interpretation of
data; in the writing of the manuscript; or in the decision to publish the results.
References
1. Siegel, G.J. Basic Neurochemistry: Molecular, Cellular, and Medical Aspects, 7th ed.; Elsevier Academic Press:
Burlington, MA, USA, 2006.
2. Schultz, W. Multiple DA Functions at Different Time Courses. Annu. Rev. Neurosci. 2007, 30, 259–288.
[CrossRef] [PubMed]
3. Perry, M.; Li, Q.; Kennedy, R.T. Review of Recent Advances in Analytical Techniques for the Determination
of Neurotransmitters. Anal. Chim. Acta 2009, 653, 1–22. [CrossRef] [PubMed]
4. Grace, A.A. The Tonic/Phasic Model of DA System Regulation: Its Relevance for Understanding How
Stimulant Abuse Can Alter Basal Ganglia Function. Drug Alcohol Depend. 1995, 37, 111–129. [CrossRef]
5. Cragg, S.J.; Rice, M.E. DAncing Past the DAT at a DA Synapse. Trends Neurosci. 2004, 27, 270–277. [CrossRef]
[PubMed]
6. Watson, C.J.; Venton, B.J.; Kennedy, R.T. In Vivo Measurements of Neurotransmitters by Microdialysis
Sampling. Anal. Chem. 2006, 78, 1391–1399. [CrossRef]
7. Jones, S.R.; Gainetdinov, R.R.; Caron, M.G. Application of Microdialysis and Voltammetry to Assess DA
Functions in Genetically Altered Mice: Correlation with Locomotor Activity. Psychopharmacology 1999, 147,
30–32. [CrossRef]
54
Appl. Sci. 2020, 10, 6449
8. Budygin, E.A.; Kilpatrick, M.R.; Gainetdinov, R.R.; Wightman, R.M. Correlation between Behavior and
Extracellular DA Levels in Rat Striatum: Comparison of Microdialysis and Fast-Scan Cyclic Voltammetry.
Neurosci. Lett. 2000, 281, 9–12. [CrossRef]
9. Parrot, S.; Bert, L.; Mouly-Badina, L.; Sauvinet, V.; Colussi-Mas, J.; Lambás-Señas, L.; Robert, F.; Bouilloux, J.P.;
Suaud-Chagny, M.F.; Denoroy, L.; et al. Microdialysis Monitoring of Catecholamines and Excitatory
Amino Acids in the Rat and Mouse Brain: Recent Developments Based on Capillary Electrophoresis with
Laser-Induced Fluorescence Detection—A Mini-Review. Cell. Mol. Neurobiol. 2003, 23, 793–804. [CrossRef]
10. Clapp-Lilly, K.L.; Roberts, R.C.; Duffy, L.K.; Irons, K.P.; Hu, Y.; Drew, K.L. An Ultrastructural Analysis of
Tissue Surrounding a Microdialysis Probe. J. Neurosci. Methods 1999, 90, 129–142. [CrossRef]
11. Borland, L.M.; Michael, A.C. Electrochemical Methods for Neuroscience; Michael, A.C., Borland, L.M., Eds.;
CRC Press, Taylor and Francis Group: Boca Raton, FL, USA, 2007.
12. Mitala, C.M.; Wang, Y.; Borland, L.M.; Jung, M.; Shand, S.; Watkins, S.; Weber, S.G.; Michael, A.C.; Yang, H.
In Vivo Fast-Scan Cyclic Voltammetry of DA near Microdialysis Probes. J. Neurosci. Methods 2008, 174,
177–185. [CrossRef]
13. Yang, H.; Peters, J.L.; Michael, A.C. Coupled Effects of Mass Transfer and Uptake Kinetics on In Vivo
Microdialysis of DA. J. Neurochem. 1998, 71, 684–692. [CrossRef]
14. Clark, J.J.; Sandberg, S.G.; Wanat, M.J.; Gan, J.O.; Horne, E.A.; Hart, A.S.; Akers, C.A.; Parker, J.G.; Willuhn, I.;
Martinez, V.; et al. Chronic Microsensors for Longitudinal, Subsecond DA Detection in Behaving Animals.
Nat. Methods 2010, 7, 126–129. [CrossRef] [PubMed]
15. Robinson, D.L.; Heien, M.L.; Wightman, R.M. Frequency of DA Concentration Transients Increases in Dorsal
and Ventral Striatum of Male Rats during Introduction of Conspecifics. J. Neurosci. 2002, 22, 10477–10486.
[CrossRef] [PubMed]
16. Garris, P.A.; Ciolkowski, E.L.; Pastore, P.; Wightman, R.M. Efflux of DA from the Synaptic Cleft in the
Nucleus Accumbens of the Rat Brain. J. Neurosci. 1994, 14, 6084–6093. [CrossRef] [PubMed]
17. Michael, A.C.; Borland, L.M.; Mitala, J.J.; Willoughby, B.M.; Motzko, C.M. Theory for the Impact of Basal
Turnover on DA Clearance Kinetics in the Rat Striatum After Medial Forebrain Bundle Stimulation and
Pressure Ejection. J. Neurochem. 2005, 94, 1202–1211. [CrossRef]
18. Zahniser, N.R.; Larson, G.A.; Gerhardt, G.A. In Vivo DA Clearance Rate in Rat Striatum: Regulation by
Extracellular DA Concentration and DA Transporter Inhibitors. J. Pharm. Exp. Ther. 1999, 289, 266–277.
19. Gerhardt, G.A.; Burmeister, J.J. Encyclopedia Analytical Chemistry: Instrumentation and Applications;
Meyers, R.A., Ed.; John Wiley and Sons: Chichester, UK, 2000; pp. 710–731.
20. Hascup, E.R.; af Bjerkén, S.; Hascup, K.N.; Pomerleau, F.; Huettl, P.; Strömberg, I.; Gerhardt, G.A. Histological
Studies of the Effects of Chronic Implantation of Ceramic-Based Microelectrode Arrays and Microdialysis
Probes in Rat Prefrontal Cortex. Brain Res. 2009, 1291, 12–20. [CrossRef]
21. Jaquins-Gerstl, A.; Michael, A.C. Comparison of the Brain Penetration Injury Associated with Microdialysis
and Voltammetry. J. Neurosci. Methods 2009, 183, 127–135. [CrossRef]
22. Yang, C.; Cao, Q.; Puthongkham, P.; Lee, S.T.; Ganesana, M.; Lavrik, N.V.; Venton, B.J. 3D-Printed Carbon
Electrodes for Neurotransmitter Detection. Angew. Chem. 2018, 57, 14255–14259. [CrossRef]
23. Cheng, Y.; Hu, K.; Wang, D.; Zubi, Y.; Lee, S.T.; Puthongkham, P.; Mirkin, M.V.; Venton, B.J.
Cavity Carbon-Nanopipette Electrodes for Dopamine Detection. Anal. Chem. 2019, 91, 4618–4624. [CrossRef]
24. Schwerdt, H.N.; Shimazu, H.; Amemori, K.; Amemori, S.; Tierney, P.L.; Gibson, D.J.; Hong, S.; Yoshida, T.;
Langer, R.; Cima, M.J.; et al. Chronic fast-scan dopamine voltammetry in primates. Proc. Natl. Acad. Sci. USA
2017, 114, 13260–13265. [CrossRef] [PubMed]
25. Liu, C.; Zhao, Y.; Cai, X.; Xie, Y.; Wang, T.; Cheng, D.; Li, L.; Li, R.; Deng, Y.; Ding, H.; et al. A wireless,
implantable optoelectrochemical probe for optogenetic stimulation and dopamine detection. bioRxiv 2020, 6,
1–12. [CrossRef]
26. Schwarting, R.K.W.; Huston, J.P. The Unilateral 6-HydroxyDA Lesion Model in Behavioral Brain Research.
Analysis of Functional Deficits, Recovery and Treatments. Prog. Neurobiol. 1996, 50, 275–331. [CrossRef]
27. Hascup, K.N.; Rutherford, E.C.; Quintero, J.E.; Day, B.K.; Nickell, J.R.; Pomerleau, F.; Huettl, P.; Burmeister, J.J.;
Gerhardt, G.A. Electrochemical Methods for Neuroscience; Michael, A.C., Borland, L.M., Eds.; CRC Press:
Boca Raton, FL, USA, 2007; pp. 407–450. [CrossRef]
28. Paxinos, G.; Watson, C. The Rat Brain in Stereotaxic Coordinates; Elsevier: Amsterdam, The Netherlands, 2007.
55
Appl. Sci. 2020, 10, 6449
29. Burmeister, J.J.; Moxon, K.; Gerhardt, G.A. Ceramic-Based Multisite Microelectrodes for Electrochemical
Recordings. Anal. Chem. 2000, 72, 187–192. [CrossRef]
30. Day, B.K.; Pomerleau, F.; Burmeister, J.J.; Huettl, P.; Gerhardt, G.A. Microelectrode Array Studies of Basal and
Potassium-Evoked Release of L-glutamate in the Anesthetized Rat Brain. J. Neurochem. 2006, 96, 1626–1635.
[CrossRef]
31. Gerhardt, G.A.; Oke, A.F.; Nagy, G.; Moghaddam, B.; Adams, R.N. Nafion-Coated Electrodes with High
Selectivity for CNS Electrochemistry. Brain Res. 1984, 290, 390–395. [CrossRef]
32. Burmeister, J.J.; Gerhardt, G.A. Self-Referencing Ceramic-Based Multisite Microelectrodes for the Detection
and Elimination of Interferences from the Measurement of L-glutamate and Other Analytes. Anal. Chem.
2001, 73, 1037–1042. [CrossRef]
33. Burmeister, J.J.; Pomerleau, F.; Huettl, P.; Gash, C.R.; Werner, C.E.; Bruno, J.P.; Gerhardt, G.A. Ceramic-Based
Multisite Microelectrode Arrays for Simultaneous Measures of Choline and Acetylcholine in CNS.
Biosens. Bioelectr. 2008, 23, 1382–1389. [CrossRef]
34. Hinzman, J.M.; Thomas, T.C.; Burmeister, J.J.; Quintero, J.E.; Huettl, P.; Pomerleau, F.; Gerhardt, G.A.; Lifshitz, J.
Diffuse Brain Injury Elevates Tonic Glutamate Levels and Potassium-Evoked Glutamate Release in Discrete
Brain Regions at Two Days Post-Injury: An Enzyme-Based Microelectrode Array Study. J. Neurotrauma 2010,
27, 889–899. [CrossRef]
35. Cass, W.A.; Zahniser, N.R.; Flach, K.A.; Gerhardt, G.A. Clearance of Exogenous DA in Rat Dorsal Striatum
and Nucleus Accumbens: Role of Metabolism and Effects of Locally Applied Uptake Inhibitors. J. Neurochem.
1993, 61, 2269–2278. [CrossRef]
36. Friedemann, M.N.; Gerhardt, G.A. Regional Effects of Aging on DArgic Function in the Fischer-344 Rat.
Neurobiol. Aging 1992, 13, 325–332. [CrossRef]
37. Hall, M.E.; Hoffer, B.J. Rapid and Sensitive Determination of Catecholamines in Small Tissues Samples
by High Performance Liquid Chromatography Coupled with Dual-Electrode Coulometric electrochemical
detection. LCGC 1989, 7, 258–265.
38. Herrera-Marschitz, M.; Goiny, M.; Utsumi, H.; Ungerstedt, U. Mesencephalic DA Innervation of the
Frontoparietal (Sensorimotor) Cortex of the Rat: A Microdialysis Study. Neurosci. Lett. 1989, 97, 266–270.
[CrossRef]
39. Schwarz, A.J.; Zocchi, A.; Reese, T.; Gozzi, A.; Garzotti, M.; Varnier, G.; Curcuruto, O.; Sartori, I.; Girlanda, E.;
Biscaro, B.; et al. Concurrent Pharmacological MRI and In Situ Microdialysis of Cocaine Reveal a Complex
Relationship between the Central hemodynamic response and Local DA Concentration. Neuroimage 2004, 23,
296–304. [CrossRef] [PubMed]
40. Pomerleau, F.; Day, B.K.; Huettl, P.; Burmeister, J.J.; Gerhardt, G.A. Real time in vivo measures of L-glutamate
in the rat central nervous system using ceramic-based multisite microelectrode arrays. Ann. N. Y. Acad. Sci.
2003, 1003, 454–457. [CrossRef]
41. Van Horne, C.; Hoffer, B.J.; Strömberg, I.; Gerhardt, G.A. Clearance and Diffusion of Locally Applied DA in
Normal and 6-HydroxyDA-Lesioned Rat Striatum. J. Pharm. Exp. Ther. 1992, 263, 1285–1292.
42. Hebert, M.A.; Gerhardt, G.A. Behavioral and neurochemical effects of intranigral administration of glial cell
line-derived neurotrophic factor on aged Fischer 344 rats. J. Pharmacol. Exp. Ther. 1997, 282, 760–768.
43. Hascup, E.R.; Hascup, K.N.; Stephens, M.; Pomerleau, F.; Huettl, P.; Gratton, A.; Gerhardt, G.A.
Rapid Microelectrode Measurements and the Origin and Regulation of Extracellular Glutamate in Rat
Prefrontal Cortex. J. Neurochem. 2010, 115, 1608–1620. [CrossRef]
44. Rutherford, E.C.; Pomerleau, F.; Huettl, P.; Strömberg, I.; Gerhardt, G.A. Chronic Second-by-Second Measures
of L-Glutamate in the Central Nervous System of Freely Moving Rats. J. Neurochem. 2007, 102, 712–722.
[CrossRef]
45. Hascup, K.N.; Hascup, E.R.; Stephens, M.L.; Glaser, P.E.; Yoshitake, T.; Mathé, A.A.; Gerhardt, G.A.; Kehr, J.
Resting Glutamate Levels and Rapid Glutamate Transients in the Prefrontal Cortex of the Flinders Sensitive
Line Rat: A Genetic Rodent Model of Depression. Neuropsychopharmacology 2011, 36, 1769–1777. [CrossRef]
[PubMed]
46. Burmeister, J.J.; Palmer, M.; Gerhardt, G.A. L-Lactate Measures in Brain Tissue with Ceramic-Based Multisite
Microelectrodes. Biosens. Bioelectron. 2005, 20, 1772–1779. [CrossRef] [PubMed]
47. Tang, A.; Bungay, P.M.; Gonzales, R.A. Characterization of probe and tissue factors that influence interpretation
of quantitative microdialysis experiments for dopamine. J. Neurosci. Methods 2003, 126, 1–11. [CrossRef]
56
Appl. Sci. 2020, 10, 6449
48. Chen, N.H.; Lai, Y.J.; Pan, W.H. Effects of different perfusion medium on the extracellular basal concentration
of dopamine in striatum and medial prefrontal cortex: A zero-net flux microdialysis study. Neurosci. Lett.
1997, 225, 197–200. [CrossRef]
49. Parsons, L.H.; Justice, J.B., Jr. Extracellular concentration and in vivo recovery of dopamine in the nucleus
accumbens using microdialysis. J. Neurochem. 1992, 58, 212–218. [CrossRef] [PubMed]
50. Martin-Fardon, R.; Sandillon, F.; Thibault, J.; Privat, A.; Vignon, J. Long-term monitoring of extracellular
dopamine concentration in the rat striatum by a repeated microdialysis procedure. J. Neurosci. Methods 1997,
72, 123–135. [CrossRef]
51. Taylor, I.M.; Patel, N.A.; Freedman, N.C.; Castagnola, E.; Cui, X.T. Direct in Vivo Electrochemical
Detection of Resting Dopamine Using Poly(3,4-ethylenedioxythiophene)/Carbon Nanotube Functionalized
Microelectrodes. Anal. Chem. 2019, 91, 12917–12927. [CrossRef]
52. Arnold, E.B.; Molinoff, P.B.; Rutledge, C.O. The release of endogenous norepinephrine and dopamine from
cerebral cortex by amphetamine. J. Pharmacol. Exp. Ther. 1977, 202, 544–557.
53. Santos, R.M.; Lourenço, C.F.; Pomerleau, F.; Huettl, P.; Gerhardt, G.A.; Laranjinha, J.; Barbosa, R.M.
Brain Nitric Oxide Inactivation Is Governed by the Vasculature. Antioxid. Redox Signal. 2010, 14, 1011–1021.
[CrossRef]
54. Talauliker, P.M.; Price, D.A.; Burmeister, J.J.; Nagarid, S.; Pomerleau, F.; Huettl, P.; Hastings, J.T.; Gerhardt, G.A.
Ceramic-Based Microelectrode Arrays: Recording Surface Characteristics and Topographical Analysis.
J. Neurosci. Methods 2011, 198, 222–229. [CrossRef]
55. Burmeister, J.J.; Pomerleau, F.; Palmer, M.; Day, B.K.; Huettl, P.; Gerhardt, G.A. Improved ceramic-based
multisite microelectrode for rapid measurements of L-glutamate in the CNS. J. Neurosci. Methods 2002, 119,
163–171. [CrossRef]
56. Burmeister, J.J.; Gerhardt, G.A. Ceramic-based multisite microelectrode arrays for in vivo electrochemical
recordings of glutamate and other neurochemicals. Trends Anal. Chem. 2003, 22, 498–502. [CrossRef]
57. Bard, A.; Faulkner, L. Electrochemical Methods: Fundamentals and Applications, 2nd ed.; Wiley & Sons: Hoboken,
NJ, USA, 2000.
58. Williams, J.M.; Galli, A. The dopamine transporter: A vigilant border control for psychostimulant action.
Handb. Exp. Pharmacol. 2006, 175, 215–232. [CrossRef]
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
57
applied
sciences
Article
A Microfluidic Approach for Biosensing DNA
within Forensics
Brigitte Bruijns 1,2, *,† , Roald Tiggelaar 1,3 and Han Gardeniers 1
1 Mesoscale Chemical Systems, MESA+ Institute, University of Twente, Drienerlolaan 5,
7500 AE Enschede, The Netherlands; r.m.tiggelaar@utwente.nl (R.T.); j.g.e.gardeniers@utwente.nl (H.G.)
2 Life Sciences, Life Sciences, Engineering & Design, Saxion University of Applied Sciences,
M. H. Tromplaan 28, 7513 AB Enschede, The Netherlands
3 NanoLab Cleanroom, MESA+ Institute, University of Twente, Drienerlolaan 5,
7500 AE Enschede, The Netherlands
* Correspondence: brigitte.bruijns@micronit.com
† Current address: Micronit Microtechnologies BV, Colosseum 15, 7521 PV Enschede, The Netherlands.
Abstract: Reducing the risk of (cross-)contamination, improving the chain of custody, providing fast
analysis times and options of direct analysis at crime scenes: these requirements within forensic
DNA analysis can be met upon using microfluidic devices. To become generally applied in forensics,
the most important requirements for microfluidic devices are: analysis time, method of DNA detection
and biocompatibility of used materials. In this work an overview is provided about biosensing of
DNA, by DNA profiling via standard short tandem repeat (STR) analysis or by next generation
sequencing. The material of which a forensic microfluidic device is made is crucial: it should for
example not inhibit DNA amplification and its thermal conductivity and optical transparency should
be suitable for achieving fast analysis. The characteristics of three materials frequently used materials,
i.e., glass, silicon and PDMS, are given, in addition to a promising alternative, viz. cyclic olefin
copolymer (COC). New experimental findings are presented about the biocompatibility of COC and
the use of COC chips for multiple displacement amplification and real-time monitoring of DNA
amplification.
1. Introduction
Sampling and securing traces at a crime scene is a crucial step in the police investigation process.
Information obtained at this stage immediately gives direction to the investigation. Nowadays it takes
weeks to get from collection of the evidence to a report provided by a forensic laboratory. By using
microfluidic devices, also called chips, for carrying out (part of) the analysis directly at the crime
scene, valuable information can be available at a much earlier stage in the investigation process.
Such microfluidic devices are portable, need minimal analyte volumes and bring quick analysis times.
Since sample handling in microfluidic devices is done in a sealed microfluidic environment, chips also
improve the chain of custody and lower the risk of (cross-)contamination. As such, (forensic) interest
in DNA analysis in microfluidic devices has arisen, with a preference for single use (disposable) chips.
Several systems have been developed that integrate the complete process from sampling to result
in a single microfluidic device. The focus for these systems is on sequencing [1] or DNA amplification,
often with the detection on-chip, but without the integration of sample preparation [2,3]. Commercial
systems are available, although their deployment is still limited. For instance the RapidHIT produces
a full short tandem repeat (STR) profile for 5–7 samples simultaneously in 90 min [4]. More recently
the ANDE Rapid DNA system has been approved by the Federal Bureau of Investigation, but also
with this machine it takes about 90 min from sample to result [5].
Having a fast analysis is of utmost importance at the scene of crime, for instance in the
case of the identification of human remains or in sexual assault cases [6,7]. This is one of the
motivations for the interest in microfluidic devices, which will be elaborated in the following section.
Subsequently, two microfluidic DNA biosensing examples will be explored, namely DNA profiling
by short tandem repeat (STR) analysis and by next generation sequencing (NGS). The biochemical
compatibility of the materials used for microfluidic devices is an important requirement for forensic
DNA analysis. Three commonly used materials (i.e., silicon, glass and PDMS) will be compared in
terms of biocompatibility, thermal conductivity and optical transparency. The latter two characteristics
play a role in fast amplification protocols and optical detection. An interesting alternative, cyclic
olefin copolymer (COC), will be discussed on the basis of our own experimental findings, which
demonstrates that this promising material can compete with reported materials for disposable forensic
microfluidic devices. Finally, results regarding the use of COC microfluidic devices for multiple
displacement amplification and on-chip real-time fast analysis of DNA amplification will be shown.
3. Biosensing of DNA
In this section various options regarding biosensing of DNA using the microfluidic approach.
To generate DNA profiles STR analysis is the method of use will be described. Recently, with the
introduction of sequencing techniques, also NGS methods are upcoming for forensic DNA profiling.
60
Appl. Sci. 2020, 10, 7067
Chips for PCR can be divided in two categories: well-based and continuous-flow chips [16].
In the first case, a well-based system (Figure 1A), the complete microdevice is sequentially cooled
and heated. Drawback of a well-based system is the long time per cycle, caused by the relatively
large total thermal mass of the system [16,17]. Continuous-flow chips can be further split up in three
categories: fixed-loop, closed-loop and oscillatory chips. A fixed-loop microdevice (Figure 1B) contains
zones with different temperatures through which the sample is moved. The numbers of meanders in
the microdevice defines the number of thermal cycles. The time of each step is typically controlled
by the length of the meander in a specific temperature zone in combination with the flow rate. In a
closed-loop chip (Figure 1D) the circuit is fixed through which the sample is moved, while the number
of thermal cycles can vary. Additionally, in an oscillatory microdevice the number of cycles can be
varied (Figure 1C). The different zones of the microdevice are held at different temperatures and the
sample is shunted back and forth between these different zones [16].
Figure 1. Examples of polymerase chain reaction (PCR) chip designs: (A) well-based (cross-section),
(B) fixed-loop (top view), (C) oscillatory (top view) and (D) closed-loop systems (top view).
The microfluidic amplification chamber (well-based) or channel (continous-flow) is given in grey.
The temperature zones (continuous-flow) are given in the various shades of red.
In order to obtain a STR profile, in forensics there is significant interest in chips for CE to accomplish
this [18]. By using such devices the required reagent and sample volumes are decreased, as well as the
total analysis time [15]. Typical duration times of the separation are about 5–15 min [19–21].
61
Appl. Sci. 2020, 10, 7067
3.2.1. MiSeq/HiSeq
Solexa, later on acquired by Illumina, made a sequencing system based on
sequencing-by-synthesis in combination with reversible dye terminators and a planar solid
glass support. The adapters are placed at the ends of the DNA sequence. [23–26]. Sequences
complementary to the adapters ‘A’ and ‘B’ are present on the complete inside of these flow cell
lanes [27]. Once the other end of the target DNA hybridizes to the complementary sequence present
on the support, a bridge structure arises [24]. Each one of those bridge amplified clusters contains
a unique DNA template, which is subsequently primed and sequenced [26]. There are different
fluorescent labels present on each of the ddNTPs and a removable blocking group. The DNA sequence
can be determined by completing the template one base at a time and recording of the fluorescent
signal with a CCD camera. The HiSeq series, and later the MiSeq series, succeeded the Solexa Genome
Analyzer [28].
3.2.3. Nanopore
A single DNA molecule can be read by the use of nanopores. This can be accomplished without
the need for amplification or expensive fluorescent labels [31]. The detection principle of nanopore
based systems depends on the ion current, which is generated when a charged molecule, such as a
DNA molecule, passes through a nanoscale pore in a membrane resulting in a change of the ionic
current. The four different bases produce four distinct current levels, which can be used for sequencing
the DNA strand [31,32].
3.3. Conclusion
Flow cells, which are part of most NGS machines, have nanopatterned features in the microfluidic
channels. These nanosized wells make it possible to obtain a high data density by patterned clustering
of DNA fragments [33]. Microfluidic devices or flow cells can be used for STR analysis and for NGS,
respectively. With NGS techniques more genetic information can be obtained besides the standard
DNA profile, but the complete analysis process takes longer than standard STR analysis.
62
Table 1. Characteristics of different chip materials.
Applied coating (to avoid PEG 8000, SurfaSil, C3 H9 SiCl, Parylene, BSA [40–44] BSA, PEG [45,46]
inhibition) PVP, EPDMA [47,48] C3 H7 Cl3 Si [49,50]
Transparancy Transparant Opaque [17] Transparant Transparant
Light transmission (350–750 nm) ≈ 91% [51] 0% ≈ 90% [52] ≈ 91% [39,53]
Thermal conductivity Medium High Low Low
W/m · K 1.2 (90 ◦ C) [51,54] 156 (300 K) [55] 0.27 (unknown K) [54,56] 0.12–0.15 (20 ◦ C) [53]
Chemical resistance High High Low High
Affected by HF, NaOH [51] KOH [57] Chloroform, benzene, Non-polar
ethanol, acetone [58,59] organic solvents [39,53]
63
Appl. Sci. 2020, 10, 7067
By using microfluidic devices for the amplification reaction, instead of polypropylene tubes or
well plates in combination with a conventional thermocycler, an enormous gain in time is achieved.
Forensic chips are for single-use only, i.e., disposable, and therefore these chips can be fabricated of a
cheap base-material, provided that it meets all requirements. However, material selection is not always
simple and easy, because the material itself can disadvantageously influence (some of) the steps in the
process of DNA analysis, such as PCR and detection.
Biochemical compatibility of materials for forensic chips is of great importance, since an interaction
of the used chemicals with the walls of a microfluidic channel can result in slowing down of the reaction
or even total inhibition. The high surface-to-volume ratio of microfluidic devices is a disadvantage in
this case. However, such unwanted interaction between the chip material and used chemicals can be
avoided by either passivation of the walls of the reaction chamber prior to use, called passive coating,
or by so-called dynamic coating by adding components to the used chemicals, e.g., in the amplification
mixture [60].
Besides biochemical compatibility, also the wettability of the chip material is of great importance.
Microfluidic devices for droplet PCR are usually made of PDMS [61–66], since the interior of a PDMS
channels is hydrophobic and aqueous droplets-in-oil are easier generated in channels of which the
surface has this wetting state (compared to a hydrophilic state of the surface of a microfluidic channel).
In case of water-in-oil droplets, the template DNA that is present in the aqueous phase cannot adsorb
to the interior of the fluidic channel because of the hydrophobic property of the oil [67]. On the other
hand, the PCR mixture, as well as other reaction mixtures used for DNA analysis (e.g., lysing agents),
are aqueous solutions. By using hydrophilic channel walls it is easier to introduce these kind of
solutions into the chip without bubble formation [17].
Since the fabrication of microfluidic channels in glass and silicon often requires cleanroom
facilities, due to which the production costs for such chips are relatively high, chips made of these
materials are not very suitable as disposables (i.e., for single use only) [17]. Plastic devices can be
made using e.g., hot embossing, micromilling, casting or injection molding, for which a cleanroom
environment is not necessary, which makes such devices cheaper. Due to their relatively low price
plastic chips are (most) appropriate for single-use (i.e., disposable), which in particular circumvents
cross-contamination issues [68,69].
Whereas plastic chips are attractive because of their bio(chemical)compatibility, another advantage
of this material is its low thermal conductivity [70]. Materials with a low thermal conductivity are
desirable for continuous-flow devices for PCR (which requires different temperature zones in the chip),
for which reason plastic as well as glass are attractive [68]. As such, the majority of chips for analysis
of biological fluids is fabricated from PDMS or PMMA [64,71–76], although glass and silicon are also
occasionally utilized [77–79].
The next subsections contain detailed information about various aspects, such as transparency,
thermal conductivity and bio(chemical)compatibility of glass, silicon, COC and PMDS as chip material
for forensic microfluidic devices.
4.1. Glass
Due to its transparency in the visible range, which gives opportunities for optical detection, glass
is widely used a material for (forensic) DNA analysis on-chip. PCR and CE can be easily integrated
on-chip due to the beneficial electro-osmotic-flow/electrical characteristics of glass [17,80,81].
For glass surfaces it is reported that silanization of the surface is required to minimise surface
adsorption of Taq polymerase. Giordano et al. investigated the use of dynamic coating (polyethylene
glycol (PEG) 8000, polyvinylpyrrolidone (PVP) and hydroxyethylcellulose (HEC)) versus passive
(or static) coating (epoxy (poly)dimethylacrylamide (EPDMA)) of the reaction chamber of a PCR
glass chip. Covalent silanization results in 50–120% of product relative to the amount obtained with
conventional PCR in polypropylene tubes. The use of HEC ends in total inhibition of the reaction,
whereas the use of PEG 8000, PVP and EPDMA results in 13%, 78% and 72% of relative product amount,
64
Appl. Sci. 2020, 10, 7067
respectively [48]. Other coatings that can be used to passivate the glass surface are SigmaCote [82] or
dichlorodimethylsilane [83].
4.2. Silicon
Similar to glass, also silicon is frequently used as chip material, because of its high thermal
conductivity. Due to the latter silicon is attractive for the fast heating and cooling as required for
(well-based) PCR cycling [17]. Since silicon is a semiconductor, disadvantage of this material is that it
cannot resist the high potentials needed for CE. Moreover, silicon is not transparent for the wavelengths
of UV-Vis light, for which reason UV-Vis cannot be used for detection [70,84]. Based on a paper of
Cho et al. [70], it is concluded that the majority of well-based PCR chips is made from silicon.
In fact, bare silicon shows inhibitory effects on the PCR reaction, which cannot be circumvented
with the deposition of a silicon nitride layer. A silanizing agent followed by a polymer coating
(e.g., polyglycine or polymaleimide) prevents inhibition, whereby SurfaSil shows better results
than SigmaCote. An oxidised silicon surface can also prevent inhibition of the PCR reaction [49].
Felbel et al. investigated chlorotrimethylsilane, dichlorodimethylsilane, hexamethyldisilazane and
trichloropropylsilane as silanization agents, which all prevent inhibition of the PCR reaction [50].
4.3. PDMS
PDMS is also reported as chip material for the DNA amplification reaction [4,85,86]. PDMS is
stable over a temperature range of −50–200 ◦ C [87]. Moreover, PDMS is biochemically compatible,
easy to shape (by molding) and optically transparent [59,88]. PDMS is very suitable for cell culturing,
since the permeability for gases, like O2 and CO2 , is higher than for any other polymer [39]. However,
PDMS suffers from severe bubble formation during the thermal cycling protocol, due to evaporation
of the PCR mixture (through the PDMS) at temperatures above 90 ◦ C [40,89]. PDMS is not very
compatible with common solvents, such as chloroform, benzene, acetone and ethanol, since PDMS
swells in these chemicals [58,59]. Furthermore, it is reported that surface treatments on PDMS are
often unstable over time [39].
Although PDMS is used as coating for glass PCR chips [90,91], an important drawback of
the use of uncoated PDMS is that, because of its permeability, it might result in inhibition of the
amplification reaction due to absorption or adsorption of components in the amplification mixture
(in particular the enzyme). In fact, this drawback can be bypassed by coating the PDMS with bovine
serum albumin (BSA) [42–44]. To coat PDMS chips, Shin et al. and Prakash et al. used a parylene
(dichlorodiparaxylylene) surface treatment [40,41]. PVP is also applied by Kim et al. to coat a
PDMS/glass PCR chip [92].
4.4. COC
COC, nowadays frequently applied in disposables for medical diagnostics as well as for food
packaging, is a promising and interesting material for chips [39,53,93]. COC is a copolymer based on
linear and cyclic olefins. Since some manufacturers make COC from more than one type of monomer
the ‘copolymer’ part is included in the name [39].
By means of a variety of techniques microfluidic networks can be realized in COC, such as
injection molding, micromilling and hot embossing. The COC grade determines the exact heat
deflection temperature, which lays in the range 70–170 ◦ C [53,94]. Post-processing, two pieces of COC
can be joint using thermal bonding, solvent bonding or gluing [39,93]. COC has a high rigidity and
is optically transparent in the UV-range. Moreover, its water absorptivity is low (<0.01%) and it is
electrically non-conductive. COC withstands a variety of chemicals (e.g., HCl, H2 SO4 , HNO3 , NaOH,
EtOH and (CH3 )2 CO), and the material is only affected by some non-polar solvents (e.g., C6 H14 and
C7 H8 ) [39].
Plastic chips, either PMMA or COC, can be coated with a PEG solution [45]. A chip made from
cyclic olefin polymer (COP) with a glass transition temperature of 138 ◦ C is coated with BSA prior
65
Appl. Sci. 2020, 10, 7067
to the PCR by Koh et al. [46]. Although BSA is widely used as surface treatment to prevent PCR
inhibition, it might influence fluorescence detection, due to the possible interaction between BSA and
the fluorescent dye or probe [17]. Panaro et al. tested the influence of dynamic coating on inhibition by
adding 0.75% w/v PEG 8000 to the PCR mixture. For a large amount of plastics the addition of PEG
8000 improves the concentration of PCR product [47].
4.5. Conclusion
Silicon is a suitable material for well-based PCR systems, due to its good thermal conductivity.
Glass or polymers, on the other hand, have a low thermal conductivity, making these chip materials
suitable for continuous-flow PCR systems. Polymers, like COC, are also attractive for microfluidic
devices for forensic DNA analysis due to their bio(chemical)compatibility, transparency and the
the relatively wide variety of available fabrication techniques, which makes it possible to fabricate
polymer-based chips at relatively low costs, making them suitable as disposables.
Figure 2. The schematic representation of the chips with the channel dimensions of (A) design I and
(B) design II.
Post to milling and drilling, the COC chips are extensively rinsed with MilliQ water and
ultrasonication (15 min) in ethanol, followed by nitrogen gas blow-drying. In order to recover
the optical transparency, the surface roughness of the milled structures is lowered by following
the procedure of Ogilvie et al. [98]: the chips are exposed (1 min) to cyclohexane vapor (60 ◦ C).
66
Appl. Sci. 2020, 10, 7067
Subsequently, the channel of each COC-chip is sealed by applying a piece of PCR foil (Microseal ‘B’
Adhesive Seals, Bio-Rad), which is a robust seal that is appropriate for biological applications [99].
Prior to performing the MDA reaction, some chips of design I are coated with BSA (1% (10 μg/μL)).
The MDA reactions (GenomiPhi V2 kit from GE Healthcare) are carried out in the COC chips that
are incubated in a water bath of 32 ◦ C for 2h. The manufacturer of the MDA kit states that this kit is
optimized for whole genome amplification from at least 10 ng [100]. Next to that an input concentration
of 10 ng/μL is used, since off-chip results showed an enormous increase in the DNA concentration
within 2 h [97]. It is noted that in case of design I 10 μL of the MDA mix (reaction buffer, sample buffer,
enzyme mix, DNA and MilliQ in a ratio of 9:5:1:1:4, respectively) is injected in each chip, whereas the
injected volume is 5 μL in case of design II. Post to loading of the indicated volume of MDA mixture,
the fluidic accesses of the chips are closed with PCR foil. In addition, 10 μL MDA mixture is pipetted
into a 500 μL Eppendorf polypropylene (PP) vial as a control. The concentration of double-stranded
DNA (dsDNA) is determined with the Qubit™ dsDNA HS Assay Kit and the fluorescence is measured
using the Qubit™ 3.0 fluorometer (both from Thermo Fisher Scientific). All samples are measured
in triplicate.
Table 2 summarizes the outcome of the DNA quantification of the experiments with chip design I.
As can be seen, the concentration of DNA in uncoated chips is well above 200 ng/μL (after a 2 h run),
which is in agreement with the control vials, runs in a thermocycler (see [95,97] for more details) and
literature [100–102]. Remarkable is that use of a BSA coating in the COC microfluidic channels clearly
negatively affects the MDA reaction, in fact it results in inhibition, whereas such coating is known as
method to prevent non-specific binding to COC surfaces [46,103–105].
Table 2. The concentration of double-stranded DNA (dsDNA) obtained after 2 h of amplification in the
Eppendorf vials and chips of design I with and without BSA coating.
The adsorption of polymerase on the channel walls can be prevented by the addition of BSA to
the amplification mix or by coating the channel walls with BSA [106–108]. Erill et al. suggest to use
a concentration of 2.5 μg/μL (0.25%) [107]. Taylor et al. state that high BSA concentrations (>0.15%)
result in a lower yield compared to absence of BSA in the amplification mixture and that increasing
the BSA concentration will finally result in total inhibition of the PCR reaction. The optimum BSA
concentration for their silicon chip is found to be to be 0.05% resulting in a 2-fold increase in yield [108].
Kodzius et al. conclude that 2 μg/μL (0.2%) of BSA does not have any negative influence on the PCR
reaction [106]. Kreader et al. recommend to use 0.2–0.4 μg/μL (0.02–0.04%) to relieve the inhibition
of humic acids in PCR [109]. Qin et al. studied the optimal pH and BSA concentration to coat their
Norland Optical Adhesive (NOA) chip. They report that the absorption capacity of the BSA to the
NOA surface does not increase any further after 1 h. An acidic environment (pH 4) of the BSA solution
shows a higher PCR efficiency than neutral pH. A BSA concentration of 5 μg/μL (0.5%) gives the
best results. Using a lower concentration might not be sufficient, while a higher concentration can
lead to PCR inhibition [110]. According to Zhang et al. [17], another reason for obtaining a lower
DNA concentration upon using a BSA coating could be that salts present in the amplification mixtures
(e.g., KCl, MgCl2 , MgSO4 or NaOH) negatively affect the coating.
By using X-ray photo electron spectroscopy and contact angle measurements
Sweryda-Krawiec et al. determined the mode of surface passivation by BSA. On a hydrophilic
substrate BSA surface passivation shows two modes: it covers the surface and it can interact with
67
Appl. Sci. 2020, 10, 7067
an initially deposited layer for further adsorption. Surface passivation of a hydrophobic surface
is reached in one step. The measured contact angle is the same after completion of the adsorption
reaction [111]. Additionally, the BSA surface coverage is at maximum 53% for a complete monolayer
on hydrophobic surfaces, while on hydrophilic surfaces an almost full monolayer can be present [112].
COC is hydrophobic, probably resulting in an incomplete monolayer of BSA.
In this research 10 μg/μL (1%) is used, which is higher than recommended concentrations [106,108,109],
which probably causes (partial) inhibition of the MDA reaction. Additionally, the chip is coated with
BSA (passive coating/static passivation) instead of adding the BSA solution to the amplification
mixture (active coating/dynamic passivation), as a consequence of which the BSA can compete with
the polymerase for adsorption, leading to a lower amplification yield.
The amplification yield of chip design I is compared with that of design II (Table 3), without the
use of any coating. The on-chip amplification with design I shows similar results as shown in Table 2
and the control run in the Eppendorf vial (215 ng/μL). However, the chips with the smaller internal
volume, design II, shows a lower amplification yield in comparison with design I.
Table 3. The concentration of dsDNA obtained after 2 h of amplification with chips of both designs,
without BSA coating.
Although lowering the amplification volume gives better amplification in terms of coverage,
bias and specificity [113–117], the yield is not necessarily higher as shown in these experiments.
The interaction of the polymerase with the channel walls increases upon a higher surface-to-volume
ratio [106]. Chip design I and chip design II have a 6:1 and 4:1 surface-to-volume ratio, respectively.
This 1.5 times larger surface-to-volume ratio of design II is assumed to be the reason for the lower
amplification yield of the chips with design II.
In conclusion, for COC chips with a sufficiently low surface-to-volume ratio (4:1 or lower)
there is no need for (BSA) coating. In case BSA coating is required to make the chip material
bio(chemical)compatible the concentration of BSA has to be dosed to an optimum value.
In fact, the presented COC chips can be used for fast analysis. More specific, design I can
be used for real-time monitoring of DNA amplification with the MDA reaction down to an input
concentration of 0.01 ng/μL. In COC chips of design I, the MDA reaction is performed with different
DNA concentrations. All required measurement and control functionality, i.e., temperature sensors
and photosensors based on amorphous silicon, thin film metallic heaters as well as an interference
filter, for monitoring the reaction in real-time (based on measuring the fluorescence intensity) are
realized onto a so-called system-on-glass. The COC chip is positioned on top of this system-on-glass,
making the setup a compact transportable system, with the potential to be used at a crime scene.
The experimental data indicate that upon using on-chip real-time detection the presence of DNA in
a sample can be observed within approximately 10 minutes [96], i.e., one only has to wait until the
signal exceeds the threshold [118].
6. Conclusions
Microfluidic devices, by having a closed microfluidic network, improve the chain of custody,
reduce the risk of (cross-)contamination and offer fast analysis times, making them very suitable
to be used directly at the crime scene. By choosing the correct chip material such microfluidic
devices offer the required optical transparency, biocompatibility and thermal conductivity. COC is a
bio(chemical)compatible material for which no coating of the microfluidic channel walls is required
(provided that fluidic network has a sufficiently low surface-to-volume ratio) and in which microfluidic
68
Appl. Sci. 2020, 10, 7067
channels can be made at relatively low costs, making them very suitable for single use only for forensic
applications like DNA analysis.
Author Contributions: Conceptualization, B.B.; methodology, B.B.; investigation, B.B.; writing—original draft
preparation, B.B. and R.T.; writing—review and editing, B.B., R.T. and H.G.; supervision, R.T. and H.G.; project
administration, H.G.; funding acquisition, B.B. All authors have read and agreed to the published version of
the manuscript.
Funding: This research received no external funding.
Conflicts of Interest: The authors declare no conflict of interest.
Abbreviations
The following abbreviations are used in this manuscript:
References
1. Tytgat, O.; Gansemans, Y.; Weymaere, J.; Rubben, K.; Deforce, D.; Van Nieuwerburgh, F. Nanopore
Sequencing of a Forensic STR Multiplex Reveals Loci Suitable for Single-Contributor STR Profiling. Genes
2020, 11, 381. [CrossRef]
2. Bruijns, B.; Van Asten, A.; Tiggelaar, R.; Gardeniers, H. Microfluidic devices for forensic DNA analysis:
A review. Biosensors 2016, 6, 41. [CrossRef]
3. Cornelis, S.; Tytgat, O.; Fauvart, M.; Gansemans, Y.; Vander Plaetsen, A.S.; Wiederkehr, R.S.; Deforce, D.;
Van Nieuwerburgh, F.; Stakenborg, T. Silicon μPCR Chip for Forensic STR Profiling with Hybeacon Probe
Melting Curves. Sci. Rep. 2019, 9, 1–9. [CrossRef] [PubMed]
4. Yang, J.; Hurth, C.; Nordquist, A.; Smith, S.; Zenhausern, F. Integrated Microfluidic System for Rapid DNA
Fingerprint Analysis: A Miniaturized Integrated DNA Analysis System (MiDAS)—Swab Sample-In to DNA
Profile-Out. In Microfluidic Electrophoresis; Springer: Berlin, Germany, 2019; pp. 207–224.
5. Ragazzo, M.; Melchiorri, S.; Manzo, L.; Errichiello, V.; Puleri, G.; Nicastro, F.; Giardina, E. Comparative
Analysis of ANDE 6C Rapid DNA Analysis System and Traditional Methods. Genes 2020, 11, 582. [CrossRef]
[PubMed]
6. Turingan, R.; Brown, J.; Kaplun, L.; Smith, J.; Watson, J.; Boyd, D.; Steadman, D.; Selden, R. Identification of
human remains using Rapid DNA analysis. Int. J. Legal Med. 2020, 134, 863–872. [CrossRef]
69
Appl. Sci. 2020, 10, 7067
7. Wolf, K.; Pakulla-Dickel, S.; del Río, A.G.; Prochnow, A.; Elliott, K.; Scherer, M. How the Investigator
Casework GO! Kit provides sensitive, fast and robust direct amplification of low copy number samples.
Forensic Sci. Int. Genet. Suppl. Ser. 2019, 7, 626–628. [CrossRef]
8. Mapes, A.; Kloosterman, A.; Poot, C. DNA in the criminal justice system: The DNA success story in
perspective. J. Forensic Sci. 2015, 60, 851–856. [CrossRef]
9. van Asten, A. On the added value of forensic science and grand innovation challenges for the forensic
community. Sci. Justice 2014, 54, 170–179. [CrossRef] [PubMed]
10. Kloosterman, A.; Mapes, A.; Geradts, Z.; van Eijk, E.; Koper, C.; van den Berg, J.; Verheij, S.; van der Steen, M.;
van Asten, A. The interface between forensic science and technology: how technology could cause a
paradigm shift in the role of forensic institutes in the criminal justice system. Philos. Trans. B 2015,
370, 20140264. [CrossRef]
11. Meulenbroek, A.; Kloosterman, A. DNA-onderzoek van minimale biologische sporen; gevoelige problematiek.
Analyse 2009, 64, 108–120.
12. Kloosterman, A.; Kersbergen, P. Efficacy and limits of genotyping low copy number DNA samples by
multiplex PCR of STR loci. Int. Cong. Ser. 2003, 1239, 795–798. [CrossRef]
13. Mapes, A.; Kloosterman, A.; Marion, V.; Poot, C. Knowledge on DNA success rates to optimize the DNA
analysis process: from crime scene to laboratory. J. Forensic Sci. 2016, 61, 1055–1061. [CrossRef]
14. de Gruijter, M.; de Poot, C.; Elffers, H. Reconstructing with trace information: Does rapid identification
information lead to better crime reconstructions? J. Investig. Psychol. Offender Profil. 2017, 14, 88–103.
[CrossRef]
15. Han, J.; Sun, J.; Wang, L.; Liu, P.; Zhuang, B.; Zhao, L.; Liu, Y.; Li, C. The Optimization of Electrophoresis
on a Glass Microfluidic Chip and its Application in Forensic Science. J. Forensic Sci. 2017, 62, 1603–1612.
[CrossRef]
16. Zhang, Y.; Ozdemir, P. Microfluidic DNA amplification: A review. Anal. Chim. Acta 2009, 638, 115–125.
[CrossRef]
17. Zhang, C.; Xing, D. Miniaturized PCR chips for nucleic acid amplification and analysis: latest advances and
future trends. Nucleic Acids Res. 2007, 35, 4223–4237. [CrossRef]
18. Pascali, J.; Bortolotti, F.; Tagliaro, F. Recent advances in the application of CE to forensic sciences, an update
over years 2009–2011. Electrophoresis 2012, 33, 117–126. [CrossRef]
19. Le Roux, D.; Root, B.; Reedy, C.; Hickey, J.; Scott, O.; Bienvenue, J.; Landers, J.; Chassagne, L.;
de Mazancourt, P. DNA analysis using an integrated microchip for multiplex PCR amplification and
electrophoresis for reference samples. Anal. Chem. 2014, 86, 8192–8199. [CrossRef]
20. Lagally, E.; Emrich, C.; Mathies, R. Fully integrated PCR-capillary electrophoresis microsystem for DNA
analysis. Lab Chip 2001, 1, 102–107. [CrossRef]
21. Liu, P.; Li, X.; Greenspoon, S.; Scherer, J.; Mathies, R. Integrated DNA purification, PCR, sample cleanup,
and capillary electrophoresis microchip for forensic human identification. Lab Chip 2011, 11, 1041–1048.
[CrossRef]
22. Bruijns, B.; Tiggelaar, R.; Gardeniers, H. Massively parallel sequencing techniques for forensics: A review.
Electrophoresis 2018, 39, 2642–2654. [CrossRef]
23. Van Dijk, E.L.; Auger, H.; Jaszczyszyn, Y.; Thermes, C. Ten years of next-generation sequencing technology.
Trends Genet. 2014, 30, 418–426. [CrossRef]
24. Ansorge, W.J. Next-generation DNA sequencing techniques. New Biotechnol. 2009, 25, 195–203. [CrossRef]
25. Glenn, T.C. Field guide to next-generation DNA sequencers. Mol. Ecol. Resour. 2011, 11, 759–769. [CrossRef]
26. Stranneheim, H.; Lundeberg, J. Stepping stones in DNA sequencing. Biotechnol. J. 2012, 7, 1063–1073.
[CrossRef]
27. Buermans, H.; Den Dunnen, J. Next generation sequencing technology: Advances and applications. Biochim.
Biophys. Acta BBA Mol. Basis Dis. 2014, 1842, 1932–1941. [CrossRef]
28. Liu, L.; Li, Y.; Li, S.; Hu, N.; He, Y.; Pong, R.; Lin, D.; Lu, L.; Law, M. Comparison of next-generation
sequencing systems. BioMed Res. Int. 2012, 2012. [CrossRef]
29. Heather, J.M.; Chain, B. The sequence of sequencers: The history of sequencing DNA. Genomics 2016,
107, 1–8. [CrossRef]
30. Merriman, B.; R&D Team, I.T.; Rothberg, J.M. Progress in ion torrent semiconductor chip based sequencing.
Electrophoresis 2012, 33, 3397–3417. [CrossRef]
70
Appl. Sci. 2020, 10, 7067
31. Schneider, G.F.; Dekker, C. DNA sequencing with nanopores. Nat. Biotechnol. 2012, 30, 326. [CrossRef]
32. Venkatesan, B.M.; Bashir, R. Nanopore sensors for nucleic acid analysis. Nat. Nanotechnol. 2011, 6, 615.
[CrossRef]
33. Micronit Microtechnologies BV. Next-Generation Sequencing. 2020. Available online: https://www.
micronit.com/microfluidics/next-generation-sequencing.html (accessed on 24 June 2020).
34. Vicente, C.; André, P.; Ferreira, R. Simple measurement of surface free energy using a web cam. Revista
Brasileira de Ensino de Física 2012, 34, 1–5. [CrossRef]
35. Extrand, C.; Kumagai, Y. An experimental study of contact angle hysteresis. J. Colloid Interface Sci. 1997,
191, 378–383. [CrossRef]
36. Haubert, K.; Drier, T.; Beebe, D. PDMS bonding by means of a portable, low-cost corona system. Lab Chip
2006, 6, 1548–1549. [CrossRef]
37. Stachowiak, T.; Mair, D.; Holden, T.; Lee, L.; Svec, F.; Fréchet, J. Hydrophilic surface modification of
cyclic olefin copolymer microfluidic chips using sequential photografting. J. Sep. Sci. 2007, 30, 1088–1093.
[CrossRef]
38. Roy, S.; Yue, C.; Lam, Y.; Wang, Z.; Hu, H. Surface analysis, hydrophilic enhancement, ageing behavior and
flow in plasma modified cyclic olefin copolymer (COC)-based microfluidic devices. Sens. Actuators B Chem.
2010, 150, 537–549. [CrossRef]
39. Nunes, P.; Ohlsson, P.; Ordeig, O.; Kutter, J. Cyclic olefin polymers: emerging materials for lab-on-a-chip
applications. Microfluid. Nanofluidics 2010, 9, 145–161. [CrossRef]
40. Shin, Y.; Cho, K.; Lim, S.; Chung, S.; Park, S.J.; Chung, C.; Han, D.C.; Chang, J. PDMS-based micro PCR chip
with parylene coating. J. Micromech. Microeng. 2003, 13, 768. [CrossRef]
41. Prakash, A.; Adamia, S.; Sieben, V.; Pilarski, P.; Pilarski, L.; Backhouse, C. Small volume PCR in PDMS
biochips with integrated fluid control and vapour barrier. Sens. Actuators B Chem. 2006, 113, 398–409.
[CrossRef]
42. Crabtree, H.; Lauzon, J.; Morrissey, Y.; Taylor, B.; Liang, T.; Johnstone, R.; Stickel, A.; Manage, D.; Atrazhev, A.;
Backhouse, C.; et al. Inhibition of on-chip PCR using PDMS–glass hybrid microfluidic chips. Microfluid.
Nanofluidics 2012, 13, 383–398. [CrossRef]
43. Niu, Z.; Chen, W.; Shao, S.; Jia, X.; Zhang, W. DNA amplification on a PDMS–glass hybrid microchip.
J. Micromech. Microeng. 2006, 16, 425. [CrossRef]
44. Fernández-Carballo, B.; McGuiness, I.; McBeth, C.; Kalashnikov, M.; Borrós, S.; Sharon, A.; Sauer-Budge, A.
Low-cost, real-time, continuous flow PCR system for pathogen detection. Biomed. Microdevices 2016, 18, 34.
45. Münchow, G.; Dadic, D.; Doffing, F.; Hardt, S.; Drese, K.S. Automated chip-based device for simple and fast
nucleic acid amplification. Expert Rev. Mol. Diagn. 2005, 5, 613–620. [CrossRef]
46. Koh, C.; Tan, W.; Zhao, M.Q.; Ricco, A.; Fan, Z. Integrating polymerase chain reaction, valving,
and electrophoresis in a plastic device for bacterial detection. Anal. Chem. 2003, 75, 4591–4598. [CrossRef]
47. Panaro, N.; Lou, X.; Fortina, P.; Kricka, L.; Wilding, P. Surface effects on PCR reactions in multichip
microfluidic platforms. Biomed. Microdevices 2004, 6, 75–80. [CrossRef]
48. Giordano, B.; Copeland, E.; Landers, J. Towards dynamic coating of glass microchip chambers for amplifying
DNA via the polymerase chain reaction. Electrophoresis 2001, 22, 334–340. [CrossRef]
49. Shoffner, M.; Cheng, J.; Hvichia, G.; Kricka, L.; Wilding, P. Chip PCR. I. Surface passivation of microfabricated
silicon-glass chips for PCR. Nucleic Acids Res. 1996, 24, 375–379. [CrossRef]
50. Felbel, J.; Bieber, I.; Pipper, J.; Köhler, J. Investigations on the compatibility of chemically oxidized silicon
(SiOx )-surfaces for applications towards chip-based polymerase chain reaction. Chem. Eng. J. 2004,
101, 333–338. [CrossRef]
51. Schott. Schott Borofloat 33. 2017. Available online: https://psec.uchicago.edu/glass/borofloat_33_e.pdf
(accessed on 24 June 2020).
52. Stankova, N.; Atanasov, P.; Nikov, R.; Nikov, R.; Nedyalkov, N.; Stoyanchov, T.; Fukata, N.; Kolev, K.;
Valova, E.; Georgieva, J.; et al. Optical properties of polydimethylsiloxane (PDMS) during nanosecond laser
processing. App. Surf. Sci. 2016, 374, 96–103. [CrossRef]
53. TOPAS Advanced Polymers. TOPAS COC Polymers. 2017. Available online: https://topas.com/products/
topas-coc-polymers (accessed on 26 June 2020).
54. Cui, F.; Chen, W.; Wu, X.; Guo, Z.; Liu, W.; Zhang, W.; Chen, W. Design and experiment of a PDMS-based
PCR chip with reusable heater of optimized electrode. Microsyst. Technol. 2017, 23, 3069–3079. [CrossRef]
71
Appl. Sci. 2020, 10, 7067
55. Glassbrenner, C.; Slack, G. Thermal conductivity of silicon and germanium from 3 K to the melting point.
Phys. Rev. 1964, 134, A1058. [CrossRef]
56. Corning, D. Sylgard 184 Silicone Elastomer. 2014. Available online: http://www.dowcorning.com/
DataFiles/090276fe80190b08.pdf (accessed on 26 June 2020).
57. Sato, K.; Shikida, M.; Matsushima, Y.; Yamashiro, T.; Asaumi, K.; Iriye, Y.; Yamamoto, M. Characterization
of orientation-dependent etching properties of single-crystal silicon: Effects of KOH concentration.
Sens. Actuators A Phys. 1998, 64, 87–93. [CrossRef]
58. Lee, J.; Park, C.; Whitesides, G. Solvent compatibility of poly (dimethylsiloxane)-based microfluidic devices.
Anal. Chem. 2003, 75, 6544–6554. [CrossRef] [PubMed]
59. McDonald, J.; Duffy, D.; Anderson, J.; Chiu, D.; Wu, H.; Schueller, O.; Whitesides, G. Fabrication of
microfluidic systems in poly(dimethylsiloxane). Electrophoresis 2000, 21, 27–40. [CrossRef]
60. Christensen, T.; Pedersen, C.; Gröndahl, K.; Jensen, T.; Sekulovic, A.; Bang, D.; Wolff, A. PCR biocompatibility
of lab-on-a-chip and MEMS materials. J. Micromech. Microeng. 2007, 17, 1527. [CrossRef]
61. Pekin, D.; Skhiri, Y.; Baret, J.; Le Corre, D.; Mazutis, L.; Salem, C.; Millot, F.; El Harrak, A.; Hutchison, J.;
Larson, J.; et al. Quantitative and sensitive detection of rare mutations using droplet-based microfluidics.
Lab Chip 2011, 11, 2156–2166. [CrossRef]
62. Marcus, J.; Anderson, W.; Stephen, R. Parallel picoliter RT-PCR assays using microfluidics. Anal. Chem. 2006,
78, 956–958. [CrossRef]
63. Hatch, A.; Fisher, J.; Pentoney, S.; Yang, D.; Lee, A. Tunable 3D droplet self-assembly for ultra-high-density
digital micro-reactor arrays. Lab Chip 2011, 11, 2509–2517. [CrossRef]
64. Kiss, M.; Ortoleva-Donnelly, L.; Beer, N.; Warner, J.; Bailey, C.; Colston, B.; Rothberg, J.; Link, D.; Leamon, J.
High-Throughput Quantitative PCR in Picoliter Droplets. Anal. Chem. 2008, 80, 8975–8981. [CrossRef]
65. Hatch, A.; Ray, T.; Lintecum, K.; Youngbull, C. Continuous flow real-time PCR device using multi-channel
fluorescence excitation and detection. Lab Chip 2014, 14, 562–568. [CrossRef]
66. Geng, T.; Novak, R.; Mathies, R. Single-Cell Forensic Short Tandem Repeat Typing within Microfluidic
Droplets. Anal. Chem. 2014, 86, 703–712. [CrossRef]
67. Nakano, M.; Komatsu, J.; Matsuura, S.; Takashima, K.; Katsura, S.; Mizuno, A. Single-molecule PCR using
water-in-oil emulsion. J. Biotechnol. 2003, 102, 117–124. [CrossRef]
68. Moschou, D.; Vourdas, N.; Kokkoris, G.; Papadakis, G.; Parthenios, J.; Chatzandroulis, S.; Tserepi, A.
All-plastic, low-power, disposable, continuous-flow PCR chip with integrated microheaters for rapid DNA
amplification. Sens. Actuators B Chem. 2014, 199, 470–478. [CrossRef]
69. Aboud, M.; Gassmann, M.; McCord, B. The development of mini pentameric STR loci for rapid analysis of
forensic DNA samples on a microfluidic system. Electrophoresis 2010, 31, 2672–2679. [CrossRef]
70. Cho, Y.K.; Kim, J.; Lee, Y.; Kim, Y.A.; Namkoong, K.; Lim, H.; Oh, K.; Kim, S.; Han, J.; Park, C.; et al. Clinical
evaluation of micro-scale chip-based PCR system for rapid detection of hepatitis B virus. Biosens. Bioelectron.
2006, 21, 2161–2169. [CrossRef]
71. Di Carlo, D.; Ionescu-Zanetti, C.; Zhang, Y.; Hung, P.; Lee, L. On-chip cell lysis by local hydroxide generation.
Lab Chip 2004, 5, 171–178.
72. Nevill, J.; Cooper, R.; Dueck, M.; Breslauer, D.; Lee, L. Integrated microfluidic cell culture and lysis on a chip.
Lab Chip 2007, 7, 1689–1695. [CrossRef]
73. Jen, C.P.; Hsiao, J.H.; Maslov, N. Single-cell chemical lysis on microfluidic chips with arrays of microwells.
Sensors 2011, 12, 347–358. [CrossRef]
74. Tsougeni, K.; Papadakis, G.; Gianneli, M.; Grammoustianou, A.; Constantoudis, V.; Dupuy, B.; Petrou, P.;
Kakabakos, S.; Tserepi, A.; Gizeli, E.; et al. Plasma nanotextured polymeric lab-on-a-chip for highly efficient
bacteria capture and lysis. Lab Chip 2016, 16, 120–131. [CrossRef]
75. Reedy, C.; Price, C.; Sniegowski, J.; Ferrance, J.; Begley, M.; Landers, J. Solid phase extraction of DNA
from biological samples in a post-based, high surface area poly (methyl methacrylate)(PMMA) microdevice.
Lab Chip 2011, 11, 1561–1700. [CrossRef]
76. Zhang, X.; Wu, X.; Peng, R.; Li, D. Electromagnetically controlled microfluidic chip for DNA extraction.
Measurement 2015, 75, 23–28. [CrossRef]
77. Obeid, P.; Christopoulos, T.; Crabtree, H.; Backhouse, C. Microfabricated device for DNA and RNA
amplification by continuous-flow polymerase chain reaction and reverse transcription-polymerase chain
reaction with cycle number selection. Anal. Chem. 2003, 75, 288–295. [CrossRef] [PubMed]
72
Appl. Sci. 2020, 10, 7067
78. Mitnik, L.; Carey, L.; Burger, R.; Desmarais, S.; Koutny, L.; Wernet, O.; Matsudaira, P.; Ehrlich, D. High-speed
analysis of multiplexed short tandem repeats with an electrophoretic microdevice. Electrophoresis 2002,
23, 719–726. [CrossRef]
79. Obeid, P.; Christopoulos, T. Continuous-flow DNA and RNA amplification chip combined with laser-induced
fluorescence detection. Anal. Chim. Acta 2003, 494, 1–9. [CrossRef]
80. Price, C.; Leslie, D.; Landers, J. Nucleic acid extraction techniques and application to the microchip. Lab Chip
2009, 9, 2484–2494. [CrossRef] [PubMed]
81. Duarte, G.; Price, C.; Augustine, B.; Carrilho, E.; Landers, J. Dynamic Solid Phase DNA Extraction and PCR
Amplification in Polyester-Toner (PeT) Based Microchip. Anal. Chem. 2011, 83, 5182–5189. [CrossRef]
82. Hagan, K.; Reedy, C.; Bienvenue, J.; Dewald, A.; Landers, J. A valveless microfluidic device for integrated
solid phase extraction and polymerase chain reaction for short tandem repeat (STR) analysis. Analyst 2011,
136, 1928–1937. [CrossRef]
83. Kopp, M.; Mello, A.; Manz, A. Chemical amplification: continuous-flow PCR on a chip. Science 1998,
280, 1046–1048. [CrossRef]
84. Abgrall, P.; Gue, A. Lab-on-chip technologies: making a microfluidic network and coupling it into a complete
microsystem: A review. J. Micromech. Microeng. 2007, 17, R15. [CrossRef]
85. Frey, O.; Bonneick, S.; Hierlemann, A.; Lichtenberg, J. Autonomous microfluidic multi-channel chip for
real-time PCR with integrated liquid handling. Biomed. Microdevices 2007, 9, 711–718. [CrossRef]
86. Law, I.; Loo, J.; Kwok, H.; Yeung, H.; Leung, C.; Hui, M.; Wu, S.; Chan, H.; Kwan, Y.; Ho, H.; et al. Automated
real-time detection of drug-resistant Mycobacterium tuberculosis on a lab-on-a-disc by Recombinase
Polymerase Amplification. Anal. Biochem. 2018, 544, 98–107. [CrossRef]
87. Bhagat, A.; Jothimuthu, P.; Papautsky, I. Photodefinable polydimethylsiloxane (PDMS) for rapid
lab-on-a-chip prototyping. Lab Chip 2007, 7, 1192–1197. [CrossRef]
88. Morganti, E.; Collini, C.; Potrich, C.; Ress, C.; Adami, A.; Lorenzelli, L.; Pederzolli, C. A Micro Polymerase
Chain Reaction Module for Integrated and Portable DNA Analysis Systems. J. Sens. 2011, 2011, 1–7.
[CrossRef]
89. Yoon, D.; Lee, Y.S.; Lee, Y.; Cho, H.; Sung, S.; Oh, K.; Cha, J.; Lim, G. Precise temperature control and rapid
thermal cycling in a micromachined DNA polymerase chain reaction chip. J. Micromech. Microeng. 2002,
12, 813. [CrossRef]
90. Hu, G.; Xiang, Q.; Fu, R.; Xu, B.; Venditti, R.; Li, D. Electrokinetically controlled real-time polymerase chain
reaction in microchannel using Joule heating effect. Anal. Chim. Acta 2006, 557, 146–151. [CrossRef]
91. Xiang, Q.; Xu, B.; Fu, R.; Li, D. Real time PCR on disposable PDMS chip with a miniaturized thermal cycler.
Biomed. Microdevices 2005, 7, 273–279. [CrossRef]
92. Kim, J.; Lee, J.; Seong, S.; Cha, S.; Lee, S.; Kim, J.; Park, T. Fabrication and characterization of a PDMS–glass
hybrid continuous-flow PCR chip. Biochem. Eng. J. 2006, 29, 91–97. [CrossRef]
93. Kuo, J.; Chiu, D. Disposable microfluidic substrates: transitioning from the research laboratory into the
clinic. Lab Chip 2011, 11, 2656–2665. [CrossRef]
94. Tsao, C.W.; DeVoe, D. Bonding of thermoplastic polymer microfluidics. Microfluid. Nanofluidics 2009, 6, 1–16.
[CrossRef]
95. Bruijns, B.; Veciana, A.; Tiggelaar, R.; Gardeniers, H. Cyclic Olefin Copolymer Microfluidic Devices for
Forensic Applications. Biosensors 2019, 9, 85. [CrossRef]
96. Bruijns, B.; Costantini, F.; Lovecchio, N.; Tiggelaar, R.; Di Timoteo, G.; Nascetti, A.; de Cesare, G.;
Gardeniers, J.; Caputo, D. On-chip real-time monitoring of multiple displacement amplification of DNA.
Sens. Actuators B Chem. 2019, 293, 16–22. [CrossRef]
97. Bruijns, B. Microfluidic Devices for Presumptive Forensic Tests. PhD Thesis, University of Twente, Enschede,
The Netherlands, 2019.
98. Ogilvie, I.; Sieben, V.; Floquet, C.; Zmijan, R.; Mowlem, M.; Morgan, H. Reduction of surface roughness for
optical quality microfluidic devices in PMMA and COC. J. Micromech. Microeng. 2010, 20, 065016. [CrossRef]
99. Serra, M.; Pereiro, I.; Yamada, A.; Viovy, J.L.; Descroix, S.; Ferraro, D. A simple and low-cost chip bonding
solution for high pressure, high temperature and biological applications. Lab Chip 2017, 17, 629–634.
[CrossRef]
73
Appl. Sci. 2020, 10, 7067
100. GE Healthcare. illustra GneomiPhi V2 DNA Amplification Kit, Product Web Protocol. 2006. Available
online: https://www.cytivalifesciences.co.jp/tech_support/manual/pdf/25660030wp.pdf (accessed on 26
June 2020).
101. Dean, F.; Hosono, S.; Fang, L.; Wu, X.; Faruqi, A.; Bray-Ward, P.; Sun, Z.; Zong, Q.; Du, Y.; Du, J.; et al.
Comprehensive human genome amplification using multiple displacement amplification. Proc. Natl. Acad.
Sci. USA 2002, 99, 5261. [CrossRef]
102. Kumar, G.; Garnova, E.; Reagin, M.; Vidali, A. Improved multiple displacement amplification with ϕ29
DNA polymerase for genotyping of single human cells. Biotechniques 2008, 44, 879–890. [CrossRef]
103. Kim, A.R.; Park, T.; Kim, M.; Kim, I.H.; Kim, K.S.; Chung, K.; Ko, S. Functional fusion proteins and
prevention of electrode fouling for a sensitive electrochemical immunosensor. Anal. Chim. Acta 2017,
967, 70–77. [CrossRef]
104. Lee, T.; Han, K.; Barrett, D.; Park, S.; Soper, S.; Murphy, M. Accurate, predictable, repeatable micro-assembly
technology for polymer, microfluidic modules. Sens. Actuators B Chem. 2018, 254, 1249–1258. [CrossRef]
105. Chin, W.; Sun, Y.; Høgberg, J.; Hung, T.; Wolff, A.; Bang, D. Solid-phase PCR for rapid multiplex detection
of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR.
Anal. Bioanal. Chem. 2017, 409, 2715–2726. [CrossRef]
106. Kodzius, R.; Xiao, K.; Wu, J.; Yi, X.; Gong, X.; Foulds, I.and Wen, W. Inhibitory effect of common microfluidic
materials on PCR outcome. Sens. Actuators B Chem. 2012, 161, 349–358. [CrossRef]
107. Erill, I.; Campoy, S.; Erill, N.; Barbé, J.; Aguiló, J. Biochemical analysis and optimization of inhibition and
adsorption phenomena in glass–silicon PCR-chips. Sens. Actuators B Chem. 2003, 96, 685–692. [CrossRef]
108. Taylor, T.; Winn-Deen, E.; Picozza, E.; Woudenberg, T.; Albin, M. Optimization of the performance of the
polymerase chain reaction in silicon-based microstructures. Nucleic Acids Res. 1997, 25, 3164–3168. [CrossRef]
109. Kreader, C. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.
Appl. Environ. Microbiol. 1996, 62, 1102–1106. [CrossRef] [PubMed]
110. Qin, K.; Lv, X.; Xing, Q.; Li, R.; Deng, Y. A BSA coated NOA81 PCR chip for gene amplification. Anal. Methods
2016, 8, 2584–2591. [CrossRef]
111. Sweryda-Krawiec, B.; Devaraj, H.; Jacob, G.; Hickman, J. A new interpretation of serum albumin surface
passivation. Langmuir 2004, 20, 2054–2056. [CrossRef]
112. Jeyachandran, Y.; Mielczarski, E.; Rai, B.; Mielczarski, J. Quantitative and qualitative evaluation of
adsorption/desorption of bovine serum albumin on hydrophilic and hydrophobic surfaces. Langmuir
2009, 25, 11614–11620. [CrossRef] [PubMed]
113. Rhee, M.; Light, Y.; Yilmaz, S.; Adams, P.; Saxena, D.; Meagher, R.; Singh, A. Pressure stabilizer for
reproducible picoinjection in droplet microfluidic systems. Lab Chip 2014, 14, 4533–4539. [CrossRef]
114. Sidore, A.; Lan, F.; Lim, S.; Abate, A. Enhanced sequencing coverage with digital droplet multiple
displacement amplification. Nucleic Acids Res. 2015, 44, e66. [CrossRef]
115. Leung, K.; Klaus, A.; Lin, B.; Laks, E.; Biele, J.; Lai, D.; Bashashati, A.; Huang, Y.F.; Aniba, R.; Moksa, M.;
et al. Robust high-performance nanoliter-volume single-cell multiple displacement amplification on planar
substrates. Proc. Natl. Acad. Sci. USA 2016, 113, 8484–8489. [CrossRef]
116. Kim, S.; Premasekharan, G.; Clark, I.; Gemeda, H.; Paris, P.; Abate, A. Measurement of copy number
variation in single cancer cells using rapid-emulsification digital droplet MDA. Microsyst. Nanoeng. 2017,
3, 17018. [CrossRef]
117. De Bourcy, C.; De Vlaminck, I.; Kanbar, J.; Wang, J.; Gawad, C.; Quake, S. A quantitative comparison of
single-cell whole genome amplification methods. PLoS ONE 2014, 9, e105585. [CrossRef]
118. Andréasson, H.; Gyllensten, U.; Allen, M. Real-time DNA quantification of nuclear and mitochondrial DNA
in forensic analysis. Biotechniques 2002, 33, 402–411. [CrossRef]
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
74
applied
sciences
Review
Electrochemical (Bio)Sensing of Maple Syrup Urine
Disease Biomarkers Pointing to Early Diagnosis:
A Review
Sophia Karastogianni * and Stella Girousi
School of Chemistry, Faculty of Science, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece;
girousi@chem.auth.gr
* Correspondence: skarastogianni@hotmail.com; Tel.: +30-6940440809
Abstract: Metabolic errors are inherited diseases, where genetic defects prevent a metabolic path,
ending up in enzyme malfunction. In correspondence to its remaining or plenitude fall of enzymatic
potency, there is an amassment of dangerous metabolites near the metabolic bar and/or a dearth of
necessary products, inducing a certain disease. These metabolic errors may include deviations such
as point mutations, expunctions or interferences, or further complicated genomic disorders. Based on
these facts, maple syrup urine disease (MSUD) is a scarce metabolic disease, generated by huge
concentrations of branched-chain amino acids (b AAs), i.e., leucine, isoleucine, and valine. In this
situation, these large amounts of b AAs provoke abnormalities such as liver failure, neurocognitive
dysfunctions, and probably death. To overpass those problems, it is crucial to implement a timely
and agile diagnosis at the early stages of life in view of their immutable consequence on neonates.
Thus, this review will describe MSUD and b AAs analysis based on electrochemical (bio)sensing.
Keywords: maple syrup urine disease; branched-chain amino acids; electrochemical (bio)sensing
1. Introduction
Amino acids are important in cellular metabolism, as they constitute the architectural parts for
protein synthesis and metabolites, supplying the components for farther reactions occurring in living
organisms. Amino acids such as aspartic acid (Asp), glutamic acid (Glu), γ-aminobutyric acid (GABA)
and taurine (Tau) operate like neurotransmitters, regulating synaptic transference and recollection [1].
Branched-chain amino acids (b AAs) (leucine (Leu), isoleucine (Ile), and valine (Val)) partake in
proteinic synthesis and protein catabolism. Phenylalanine (Phe) and tyrosine (Tyr) participate in the
formation of trace amines and catecholamines [1].
Meanwhile, most AAs of nutritional significance lies on L-isomers. Natural proteins are entirely
formed from L AAs [2,3]. The body cannot use vitamins or minerals in isolation. The enzymes,
hormones, body tissues, even bones are constructed from AAs with vitamins and minerals hook-ups.
The vitamins and minerals cannot perform this action without free AAs to create the required hook-ups.
Therefore, AAs are necessary for vitamins and minerals to accomplish their task rightly. The free AAs
are also needed to preserve neurotransmitters, as these are remarkably valuable for osmoregulation of
cells and employed as an energy source.
For that matter, human body acquires 20-times more AAs than vitamins and about 4-times
more AAs than minerals [4]. Both the D- and L AAs interconvert one to the other over a period,
reaching the equilibrium by racemization. During food processing, the L AAs may be racemized to
D-isomers. The concentration of L AA can likewise be used as a measure of the nutritive content
of the food. Moreover, the chiral amino acids outline is a profitable mean for scanning countless
fermentation processes alongside with the detection of bacterial action. The D AAs have been thought
as unnatural AAs.
When D AAs are replaced for L AAs in a protein, the protein goes through a switch in structure.
This switch can shift the traits and functions of the protein. It is known that D AAs is a common
element of bacterial cell wall [5]. The excretion of D AA in physiological fluids is aroused by age,
diet, physiological state, and antibiotic therapies. The raised level of D AAs activates nephrotoxicity,
growth inhibition, liver damage, fibrosis, and necrosis of kidney cell together with interference in the
biosynthesis of certain fundamental neurotransmitters [6]. The white and gray matter of Alzheimer
brain incorporates D AA, 1 to 4 times greater than the relevant sector of normal brains [7]. The human
beings with renal breakdown have large levels of D AA in urine and serum [8–10].
On the other hand, rare metabolic diseases appear due to genetic abnormalities in the enzymes
of the metabolic paths of dietary components. Generally, a scarce disorder in the broad populace is
considered when a currency of at most 1 in 20,000 neonates occurs [11]. Presently, 400 million people all
over the world are suffering of a scarce disease, about half of them are toddlers and 30% of those patents
pass away in reach the antecedent of five years of living, as these diseases are exceptionally threatening
in the cradle [12]. The symptoms, prediction, and precise decline of the catabolic paths are utterly
distinctive in different metabolic diseases. Considering the aforementioned reasons, the assortment of
the above-mentioned maladies is not rigorously prescribed and the most prevalent assortment takes
into consideration the dominant molecule influenced (carbohydrates, fatty acids, AA and organic acids),
provoking carbohydrate, fatty acid, amino, and organic acids-based diseases, respectively [13,14].
Amino acids maladies displace an autosomal recessive manner of inheritance which suggests
that the mutation created a metabolic block is existing in the genetic element of both parents. Because
of mutation, the inherited flaw is expressed downstream as a deficiency or a fragmentary biological
activity of enzymes engaged in amino acids metabolism. Therefore, some substrates in these paths
increase or are switched into different paths. Accordingly, amino acids complications are biochemically
outlined by unusual levels of single or several amino acids and their downstream plasma and/or urine
metabolites. Amino acid abnormalities are performed with variable and often nonspecific clinical
symptoms. In alliance with medical assistance, these disorders are handled by nutritional constraints,
supplements, and pharmaceutical food. In this sense, diseases due to amino acid disorders are one of
the most dangerous metabolic diseases owed to their deadly repercussions on nurslings.
In particular, the most common diseases due to amino acid disorders are phenylketonuria (PKU),
tyrosinemia, homocystenuria, arginase deficiency and maple syrup urine smelling disease (MSUD).
All the particular strokes enjoy resemblances in clinical expression, generating mental obstruction in
neonates, dementia, or are correlated with syndromes such as Parkinson’s disease. They can also induce
liver failure, rickets, hepatocarcinoma and death without medication in the early stage of essence [15,16].
Equivalently, a lack of these items can produce hypochondria, depression or albinism [16,17].
The case of MSUD is a scarce metabolic malady alongside a preponderance of 1:200,000 living
childbirth [15]. It is provoked by tremendous amounts of the L-branched-chain amino acid (b AAs),
such as leucine, isoleucine, and valine (Leu, Ile, and Val, biomarkers) [18]. In aforementioned malady,
these excessive elevations of b AAs provoke complications liver illness, neurological impairments,
and indeed death. To prevent these problems, it is particularly notable to obtain a timely and rapid
diagnosis in the prime periods of life [14,15].
The most common methodologies that are used in the determination of branched-chain amino
acids and therefore MSUD, are MS/MS, enzyme activity assays, HPLC, capillary electrophoresis,
and genetic testing [19–27]. Notwithstanding, all the practices are time exhausting and, in a few
incidents, crave a huge sample volume. A supplementary obstacle relevant to the diagnosis is the
matter that for the newborn the monitoring criteria are different among various countries, and indeed
vary in the same country, which makes it more troublesome to diagnose MSUD. In addition, there is
no end treatment, but dietary constraints are pinpointed and accordingly, repeated monitoring of the
target molecule should be performed during the patient’s life to evade injurious influences.
76
Appl. Sci. 2020, 10, 7023
Problems related to the diagnosis and monitoring of MSUD or the detection of L b AAs underscore
the need for developing new diagnostic methods using easier-to-use, low-sample-volume approaches,
which is particularly important in neonates [28–30]. These requirements are met by electrochemical
methods and electrochemical (bio)sensors, which are a reliable and profitable appliance for the
determination of metabolic biological markers, in order to facilitate their use in the diagnosis and
monitoring of this scarce disease, due to their ease of use, simplicity, selectivity, sensibility and low
cost [31,32]. In this manner, electrochemical method could be expanded in early diagnosis of other
inborn errors of metabolism, including carbohydrate, fatty acid, and amino and organic acids-based
diseases [33].
As it can be seen by the lack of literature, electrochemical sensors have been rarely used in the
detection of b AAs related to rare diseases such as MSUD clinical diagnostics. Therefore, in this review,
electrochemical (bio)sensors for the determination of branched-chain amino acids are summarized.
Aminoacidopathies (amino acids disorders) are a class of hereditary flaws of metabolism strokes,
induced by the acquired deformities in paths engaged in amino acid metabolism. Primary amino acids
disorders are caused due to mutations, resulting a metabolic block in both parents [34]. Consequently,
the flaw is expressed downstream as a shortfall or a limited biological activity of enzymes engaged
in amino acids metabolism [34]. Therefore, part of substrates in the particular paths acquire or are
whirled toward surrogate paths. In other words, these maladies are biochemically outlined by irregular
amounts of single or several amino acids and their metabolites. Aminoacidopathies bear a range
of nonspecific clinical symptoms [34]. In alliance to therapeutic alimentation, these afflictions are
handled by dietary constraints, supplements, and pharmaceutical foods, reducing the expenditure of a
disturbing amino acid or in number incidents, protein expenditure [34,35].
MSUD is an autosomal relapsing disease which is the product of the lack of branched-chain α-keto
acid dehydrogenase complex (bkAD) in the second step of catabolic path of b AAs [35]. MSUD is
performed alongside five clinical phenotypes without a precise genotype-phenotype relationship.
MSUD types can be classified according to the age at onset, the harshness of symptoms, the reply
to thiamine supplementation and the biochemical outcomes [35]. In neonatal period classic and
E3-deficient MSUD ordinarily appears, while the intermediate, intermittent, and thiamine-responsive
types occur in any time of life [35]. It is presented by neurological and developmental delay,
encephalopathy, feeding problems, and a maple syrup odor to the urine. It is as well biochemically
described by risen plasma b AAs [34,35]. It is regulated by dietary leucine constraints; thus, all b AAs
and allo-isoleucine are customarily monitored and alongside prompt medication, inmates generally
enjoy satisfying clinical results [34,35].
Biallelic pathogenic variations in the catalytic segments of bkAD reduce its activity with reinforcing
b AA amounts and inducing toxicity inward skeletal muscle and brain tissue [36,37]. b AA catabolism
77
Appl. Sci. 2020, 10, 7023
is imperative for regular functions [38]. The prime step happens in the mitochondria and includes
the alteration of leucine, isoleucine, and valine into their related α-ketoacids by branch-chain
aminotransferase. b AAs can be identified in protein-rich nutrition and rest in the family of the
nine amino acids indispensable for mankind, presenting influential provinces in protein synthesis and
function, cellular signaling, and glucose metabolism [39,40].
On the next step in b AA catabolism, the bkAD complex commence oxidative decarboxylation
of α-ketoacids [14], resulting in the alteration of α-ketoacids into acetoacetate, acetyl-CoA,
and succinyl-CoA. The bkAD complex is composed of different segments, incorporating subunits E1α
and E1β, E2, and E3. Reinforced b AA concentrations in the body renounce in these ingredients inducing
MSUD [14,37,38]. Mouse models were used [41] as well as MSUD patients [42], where exaggerated
loads of b AAs emerged and can generate serious tissue corruption if omitted without treatment.
Abnormalities in b AA metabolism may induce implementations in glutamate synthesis, causing
neurological implications [35]. The solution in preventing this symptomatology is the control of plasma
concentrations of b AAs. In addition, the accretion of Leu is extremely neurotoxic [37] and excessive
concentration of Leu may influence water homeostasis into the subcortical gray matter, resulting in
bloating within the brain, convert nitrogen homeostasis farther draining glutamate amounts, reinforce
oxidative stress, and wrestle along other amino acids, such as Tyr, in the central nervous system (CNS),
which is engaged in protein signaling [35]. Moreover, α-ketoisocaproic acid, which is regarded to be
an intervening in the metabolism of Leu, is a neurotoxin, advancing the encephalopathic disorder [35].
78
Appl. Sci. 2020, 10, 7023
on systems posing slow-reaction kinetics, whereas SWV is usually administered on the examination
of reversible processes (rapid reaction kinetics systems) [56,57]. Electrochemical sensors have been
hardly practiced in the detection of b AAs such as Leu, Ile, and Val, associated with rare diseases
clinical diagnostics. This is expounded by the evidence that these substances are electrochemically
inert on bare electrodes [33]. Thus, in the subsequence chapters, electrochemical (bio)sensors for the
determination of b AA are summarized.
79
Appl. Sci. 2020, 10, 7023
a wide dynamic range, and good long-term stability. The response to Leu was studied by the
current-voltage (I-V) technique. The calibration plot was linear between 0.1 nM to 0.1 mM. The sensitivity
was equal to 2.53 nA·μM−1 ·cm−2 , and the limit of detection was calculated and found equal to
37.5 ± 0.2 pM. The sensor was applied to real samples such as L-Leu spiked urine, milk, and serum,
giving acceptable results.
Another useful tool on b AA analysis is multiwall carbon nanotubes. On this matter, Rezaei and
Zare [63] developed a simple and sensitive leucine voltammetric detection assay in blood and urine
samples. In their study a GCE was used and modified with MWNTs. The CV measurements revealed
that MWNTs enhanced the oxidation of Leu GCE. They revealed that Leu was oxidized following
multistep mechanism on the proposed electrode. A calibration curve was plotted under the optimum
condition, and the sensor had a linear response in the range 9.0 × 10−6 – 1.5 × 10−3 mol L−1 . The LOD
was found equal to 3.0 × 10−6 mol L−1 and a relative standard deviation (RSD%) was estimated below
3.0% (n = 5).
The use of metal nanowires (NWs) gives some advantages in clinical diagnosis such as
simplicity, rapid sensor response and short total analysis time, and low sample consumption.
Recently, García-Carmona et al. [77] demonstrated the fabrication of vertically aligned nickel
nanowires-based electrochemical sensors (v-NiNWs) for fast determination of b AA, aiming to
noninvasive screening of MSUD. v-NiNWs. The analytical features of the proposed methodology
(for Leu as representative b AA in MSUD) such as LOD (8 mM) and linear range (25–700 mM)
demonstrate that v-NiNWs are suitable disposable features for monitoring b AA in MSUD due to their
ability to differentiate healthy and MSUD penitents. In addition, the results pointed an excellent intra
and inter-electrodes repeatability. Total b AAs were also determined in positive samples with accuracy
in just 5 min and using only 250 mL.
Furthermore, NiO NPs were electrochemically immobilized on a GCE and a platinum electrode [78].
In the particular study, CV in a flow cell was used, evaluating the sensors’ capability to detect Val
among other amino acid. The LOD was estimated to be 4 mM. In this work it was found that Val was
electroactive sporadically.
80
Appl. Sci. 2020, 10, 7023
biosensor was fabricated with the on-line coupling of millimeter size motors (m-motors) and
chronoamperometry for real-time analysis of b AAs in MSUD samples. Thus, an integrated cell
device, including reservoirs for motors movement and electrochemical determination, was constructed.
L-amino acid oxidase was introduced in m-motors by capillarity without coating chemistry, which is
necessary for the enantioselective identification, and afterwards the released H2 O2 was electrochemically
screened with copper microwires. The results showed that the innate m-motor “self-micro mixing”
characteristics and the extended delivery of new and free enzyme had the advantage on the one hand
of avoiding the agitation or the physical adsorption of the enzyme, as well as its chemical bonding on
transducer’s surface and on any other way it reduced the investigation time.
Stefan-van Staden et al. [82] proposed four amperometric diamond paste-based biosensors and
then used in the detection of are for the enantiopurity of Leu [82]. Biosensors’ layout used physical
accumulation of L- and D-oxidases on the proposed electrodes. In this paper, the characteristics of the
different proposed sensors were examined in contrast. The results showed that the sensors were linear
in pmol/L to nmol/L level. It was also found that the proposed sensor was reliable in detecting the
enantiopurity using Leu as a raw material.
Moreover, Labroo and Cui [83] reported the fabrication of an amperometric bienzyme biosensor
based on screen-printed electrodes and used it in the detection of Leu. The proposed biosensor was
constructed by immobilizing p-hydroxybenzoate hydroxylase (HBH) and Leu dehydrogenase (LDH)
on the proposed electrode, using NADP+ and p-hydroxybenzoate as cofactors. The operating principle
of this biosensor relied on the catalytic ability of LDH towards the specific dehydrogenation of Leu.
The resulted NADPH prompts the hydroxylation of p-hydroxybenzoate by HBH in the existence
of oxygen to generating 3,4-dihydroxybenzoate, developing an alteration in electron density on the
proposed electrode. They claim that this sensor was linear in the range 10–600 μM and LOD was
estimated to equal to 2 μM. Conclusively, they found that the sensor was rapid and reproducible with
a total analysis time of 5–10 s.
Finally, the fabrication and analytical effectiveness of a bienzyme biosensors for the selective
detection of AAs enantiomers using amperometric transduction is described in the literature [84].
The studied enzymes of the proposed method, as well as the mediator (L-Amino acid oxidase,
horseradish peroxidase, ferrocene, respectively) was accumulated on a graphite-Teflon electrode
with physical insertion in a graphite-Teflon solution. Experiments were made with and without
the regeneration of electrode’s surface on the useful lifetime of one single biosensor and on the
reproducibility in the fabrication of different biosensors and gave evidence that the constructed
biosensor, was robust and reproducible. The proposed modified electrode was employed in the
successful detection of enantiomers of AAs in racemic mixtures which was indicative of the selectivity
of the method, and to the evaluation of AAs in muscatel grapes.
81
Appl. Sci. 2020, 10, 7023
biosensors [88,89]. Molecular imprinting is the innovation of these designs, as they enjoy plentiful
improved traits: they are sensible, fast, simple and can be portable [90,91].
Meanwhile, cellulose nanocrystals polymers, usually are used to upgrade sensitivity and selectivity
of b AAs detection and may be an alternative solution [92]. This strategy counts on a rod-like
network of eminently crystalline fibers and owns a huge specific surface area, contributing valuable
electrical and optical attributes. Hence, Bi et al. [90] proposed an electrochemical sensor depended on
2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO)-oxidized cellulose nanocrystals (TOCNCs). In this study,
L-Cys modified Au electrode (TOCNC/L-Cys/Au) was formulated for determination and differentiation
of the enantiomers of Phe, Leu, as well as Val. CV and DPV experiments showed that the constructed
electrode had a peak current difference for the selected enantiomers. The proposed modifier was
outlined by its various interactions with the different enantiomers, obtaining the identification of
the enantiomers.
On the other hand, microfluidic chips (MCs) provide many advantages in diagnostics due to theirs
fast response, the use of small quantities of sample with good reproducibility, opening new boundaries
on point-of-care diagnostics (POC). In addition, electrochemical transducers are convenient for these
devices because of their inherent miniaturization and sensitivity. In this sense, conjugated MCs with
electrochemical methods which are simple, rapid, and cost-effective, is an attractive approach for a
POC device that can be used in metabolic diseases such as MSUD [30,93].
Based on these, an electrochemical microfluidic assay was practiced in the partition, as well as the
determination of AAs enantiomers of D-Met and D-Leu by Batalla et al. [94]. The proposed device
admitted the adjusted microfluidic D AA partition, as well as the particular reaction among D-amino
acid oxidase (DAAO) and one by one AA on a sole arrangement of a MC. The proposed system was
claimed to be consistent with small sample expenditure, averting the need for supplements for the
partition of enantiomers, and the covalent accumulation of the enzyme on the wall channels or on
the electrode surface. Hybrid polymer/graphene-based electrodes were end-channel capped to the
microfluidic apparatus, advancing the traits of the procedure. D-Leu were fortuitously determined,
adopting the introduced system. D-Leu was detected indirectly by the detection of H2 O2 . The proposed
method was claimed to have superlative precision in migration times and in peak heights, revealing the
satisfying stability of the proposed sensor. It was found that the proposed sensor had also selectivity,
due to the inactiveness of L AAs.
5. Conclusions
In this review, electrochemical (bio)sensors for the detection of b AAs were summarized.
Electrochemical (bio)sensors as well as POC devices are relatively new avenues for reliable, accurate,
sensitive, selective, green, cheap on the detection of b AA, involved in metabolic diseases such as
MSUD, and are in line with current European and worldwide developments, concerning public health
issues and representing the state of art on developing analytical methodologies. However, the use
of electrochemical (bio)sensors in the detection of b AA have been poorly studied, as it can be seen
from the lack of relevant studies in the literature. Although years of research have provided a lot
of information on conventional analytical methods such as MS, limited research was made in the
field of electrochemical (bio)sensors, which could improve the analytical features of b AA detection.
Furthermore, investigating the prospects of increasing the accuracy, the sensitivity, the selectivity,
the simplicity as well as minimizing the cost and toxicity of present b AA analytical methods is also an
innovative approach to an old need for the world clinical diagnostics and electrochemical (bio)sensor
are suitable tools towards this direction. In Table 1 selected studies in electrochemical (bio)sensing
MSUD and b AA are summarized.
82
Appl. Sci. 2020, 10, 7023
Meanwhile, greater analytical features are attained when electrochemical techniques are coupled
with NPs. To that end, the great antifouling trait of NP electrodes is notably meaningful, considering
that they are skilled to execute a considerable number of detections without the loss of their analytical
features as has been disclosed by their valuable repeatability. This particular trait awards them
respectable facilities to be practiced on the determination of biomarkers in real samples.
Notwithstanding, the dominant challenge continues existing, when real samples are to be analyzed,
due to problems related to reproducibility, stability, as well as interferences. These elements can be
worked out by evolving innovative sensors built on chiral nanostructured components, favoring the
selectivity of the determination. Admirable analytical enforcement may be brought about through the
coupling of enzymes to NPs and electroactive arbiters.
Conclusively, the captious prospects of the leading edge on the determination of b AAs,
clearly launches innovative frontiers on electrochemical sensors for rapid monitoring of a disease,
initiating modern concepts in diagnostics. A forthcoming advancement in electrochemical sensing
may be the growth of implantable sensors for prolonged disease screening. Thus, novel (bio)materials
must integrate into devices, achieving stability and limiting the infections with unwanted substances.
Late determination methodologies, such as ultra-fast CV may be occupied for real-time b AA monitoring.
The advancement of mercantile arrangements on b AA monitoring predicated on electrochemical
(bio)sensors and chromatographic or electrophoretic techniques may be the next step in the field.
Author Contributions: S.K.; investigation, S.K.; writing—original draft preparation, S.K.; writing—review and
editing, S.K.; visualization, S.K.; funding acquisition, S.K.; review S.G.; supervision. All authors have read and
agreed to the published version of the manuscript.
Funding: This research is co-financed by Greece and the European Union (European Social Fund—ESF) through
the Operational Programme «Human Resources Development, Education and Lifelong Learning» in the context
of the project “Reinforcement of Postdoctoral Researchers—2nd Cycle” (MIS-5033021), implemented by the State
Scholarships Foundation (IKΥ), grant number MIS 5033021.
Conflicts of Interest: The authors declare no conflict of interest and the funders had no role in the design of the
study; in the writing of the manuscript, or in the decision to publish this review.
References
1. Song, Y.; Xu, C.; Kuroki, H.; Liao, Y.; Tsunoda, M. Recent trends in analytical methods for the determination
of amino acids in biological samples. J. Pharm. Biomed. Anal. 2018, 147, 35–49. [CrossRef] [PubMed]
2. Meister, A. Intermediary metabolism of the amino acids. Biochem. Amino Acids 1965, 593–1020. [CrossRef]
3. Marchelli, R. The potential of enantioselective analysis as a quality control tool. Trends Food Sci. Technol. 1996,
7, 113–119. [CrossRef]
4. Kwan, R.C.; Hon, P.Y.; Renneberg, R. Amperometric biosensor for rapid determination of alanine.
Anal. Chim. Acta 2004, 523, 81–88. [CrossRef]
83
Appl. Sci. 2020, 10, 7023
5. Khoronenkova, S.V.; Tishkov, V.I. D-Amino acid oxidase: Physiological role and applications. Biochemistry
2008, 73, 1511–1518. [CrossRef] [PubMed]
6. Friedman, M. Origin, microbiology, nutrition, and pharmacology of D-amino acids. Chem. Biodivers.
2010, 7, 1491–1530. [CrossRef]
7. Kasai, H.; Fukuda, M.; Watanabe, S.; Hayashi-Takagi, A.; Noguchi, J. Structural dynamics of dendritic spines
in memory and cognition. Trends Neurosci. 2010, 33, 121–129. [CrossRef]
8. Kawazoe, T.; Tsuge, H.; Pilone, M.S.; Fukui, K. Crystal structure of human Damino acid oxidase:
Context-dependent variability of the backbone conformation of the VAAGL hydrophobic stretch located at
the si-face of the flavin ring. Protein Sci. 2006, 15, 2708–2717. [CrossRef]
9. Bruckner, H.; Hausch, M. D-amino acids in dairy products: Detection, origin and nutritional aspects. I. Milk,
fermented milk, fresh cheese and acid curd cheese. Milchwissenschaft 1990, 45, 357–360.
10. Bruckner, H.; Schieber, A. Determination of free D-amino acids in mammalian by chiral gas
chromatography–mass spectrometry. J. High Resol. Chromatogr. 2000, 23, 576–582. [CrossRef]
11. Pavan, S.; Rommel, K.; Marquina, M.E.M.; Hohn, S.; Lanneau, V.; Rath, A. Clinical Practice Guidelines for
Rare Diseases: The Orphanet Database. PLoS ONE 2017, 12, e0170365. [CrossRef] [PubMed]
12. Piras, D.; Locci, E.; Palmas, F.; Ferino, G.; Fanos, V.; Noto, A.; D’aloja, E.; Finco, G. Rare disease: A focus on
metabolomics. Expert Opin. Orphan Drugs 2016, 4, 1229–1237. [CrossRef]
13. Jumbo-Lucioni, P.P.; Garber, K.; Kiel, J.; Baric, I.; Berry, G.T.; Bosch, A.; Burlina, A.; Chiesa, A.; Pico, M.L.C.;
Estrada, S.C.; et al. Diversity of approaches to classic galactosemia around the world: A comparison of
diagnosis, intervention, and outcomes. J. Inherit. Metab. Dis. 2012, 35, 1037–1049. [CrossRef]
14. Burrage, L.C.; Nagamani, S.C.; Campeau, P.M.; Lee, B.H. Branched-chain amino acid metabolism: From rare
Mendelian diseases to more common disorders. Hum. Mol. Genet. 2014, 23, R1–R8. [CrossRef] [PubMed]
15. Scott, C.R. The genetic tyrosinemias. Am. J. Med. Genet. Part C Semin. Med. Genet. 2006, 142C, 121–126.
[CrossRef] [PubMed]
16. García-Cazorla, A.; Wolf, N.; Serrano, M.; Moog, U.; Perez-Duenas, B.; Poo, P.; Pineda, M.; Campistol, J.;
Hoffmann, G. Mental retardation and inborn errors of metabolism. J. Inherit. Metab. Dis. 2009, 32, 597–608.
[CrossRef] [PubMed]
17. Harms, E.; Olgemöller, B. Neonatal Screening for Metabolic and Endocrine Disorders. Dtsch. Arztebl. Int.
2011, 108, 11–22. [CrossRef]
18. Fujimoto, A.; Okano, Y.; Miyagi, T.; Isshiki, G.; Oura, T. Quantitative Beutler Test for Newborn Mass Screening
of Galactosemia Using a Fluorometric Microplate Reader T. Clin. Chem. 2000, 46, 806–810. [CrossRef]
[PubMed]
19. Avilov, V.; Zeng, Q.; Shippy, S.A. Threads for tear film collection and support in quantitative amino acid
analysis. Anal. Bioanal. Chem. 2016, 408, 5309–5317. [CrossRef]
20. Borowczyk, K.; Chwatko, G.; Kubalczyk, P.; Jakubowski, H.; Kubalska, J.; Glowacki, R. Simultaneous
determination of methionine and homocysteine by on-column derivatization with o-phtaldialdehyde. Talanta
2016, 161, 917–924. [CrossRef]
21. Azuma, K.; Hirao, Y.; Hayakawa, Y.; Murahata, Y.; Osaki, T.; Tsuka, T.; Imagawa, T.; Okamoto, Y.; Ito, N.
Application of pre-column labeling liquid chromatography for canine plasma-free amino acid analysis.
Metabolites 2016, 6, 3. [CrossRef] [PubMed]
22. Jeong, J.; Yoon, H.; Hong, S. Development of a new diagnostic method for galactosemia by high-performance
anion-exchange chromatography with pulsed amperometric detection. J. Chromatogr. A 2007, 1140, 157–162.
[CrossRef] [PubMed]
23. Acquaviva, A.; Romero, L.M.; Castells, C.B. Analysis of citrulline and metabolic related amino acids in
plasma by derivatization and RPLC. Application of the extrapolative internal standard calibration method.
Microchem. J. 2016, 129, 29–35. [CrossRef]
24. Castellanos, M.; van Eendenburg, C.V.; Gubern, C.; Sanchez, J.M. Ethyl-bridged hybrid column as
an efficient alternative for HPLC analysis of plasma amino acids by pre-column derivatization with
6-aminoquinolyl-N-hydroxysuccinimidyl carbamate. J. Chromatogr. B 2016, 1029, 137–144. [CrossRef]
[PubMed]
25. Tuma, P.; Gojda, J. Rapid determination of branched chain amino acids in human blood plasma by
pressure-assisted capillary electrophoresis with contactless conductivity detection. Electrophoresis 2015,
36, 1969–1975. [CrossRef] [PubMed]
84
Appl. Sci. 2020, 10, 7023
26. Ulusoy, S.; Ulusoy, H.I.; Pleissner, D.; Eriksen, N.T. Nitrosation and analysis of amino acid derivatives by
isocratic HPLC. RSC Adv. 2016, 6, 13120–13128. [CrossRef]
27. Blau, N.; Shen, N.; Carducci, C. Molecular genetics and diagnosis of phenylketonuria: State of the art.
Expert Rev. Mol. Diagn. 2014, 14, 655–671. [CrossRef]
28. Dincer, C.; Bruch, R.; Kling, A.; Dittrich, P.S.; Urban, G.A. Multiplexed Point-of-Care Testing—xPOCT.
Trends Biotechnol. 2017, 35, 728–742. [CrossRef]
29. Luppa, P.B.; Bietenbeck, A.; Beaudoin, C.; Giannetti, A. Clinically relevant analytical techniques,
organizational concepts for application and future perspectives of point-of-care testing. Biotechnol. Adv.
2016, 34, 139–160. [CrossRef]
30. Zhang, W.; Guo, S.; Carvalho, W.S.P.; Jiang, Y.; Serpe, M.J. Portable point-of-care diagnostic devices.
Anal. Methods 2016, 8, 7847–7867. [CrossRef]
31. Lv, J.; Li, C.; Feng, S.; Chen, S.-M.; Ding, Y.; Chen, C.; Hao, Q.; Yang, T.-H.; Lei, W. A novel electrochemical
sensor for uric acid detection based on PCN/MWCNT. Ionics 2019, 25, 4437–4445. [CrossRef]
32. Zhang, W.; Zhang, X.; Zhang, L.; Chen, G. Fabrication of carbon nanotube-nickel nanoparticle hybrid
paste electrodes for electrochemical sensing of carbohydrates. Sens. Actuators B Chem. 2014, 192, 459–466.
[CrossRef]
33. Sandlers, Y. The future perspective: Metabolomics in laboratory medicine for inborn errors of metabolism.
Trans. Res. 2017, 189, 65–75. [CrossRef]
34. García-Carmona, L.; González, M.C.; Escarpa, A. Nanomaterial-based electrochemical (bio)-sensing: One step
ahead in diagnostic and monitoring of metabolic rare diseases. TrAC Trends Anal. Chem. 2019, 118, 29–42.
[CrossRef]
35. Blackburn, P.R.; Gass, J.M.; Vairo, F.P.E.; Farnham, K.M.; Atwal, H.K.; Macklin, S.; Klee, E.W.; Atwal, P.S.
Maple syrup urine disease: Mechanisms and management. Appl. Clin. Genet. 2017, 10, 57–66. [CrossRef]
[PubMed]
36. Lang, C.H.; Lynch, C.J.; Vary, T.C. BCATm deficiency ameliorates endotoxin-induced decrease in muscle
protein synthesis and improves survival in septic mice. Am. J. Physiol. Regul. Integr. Comp. Physiol.
2010, 299, R935–R944. [CrossRef]
37. Yudkoff, M.; Daikhin, Y.; Nissim, I.; Horyn, O.; Luhovyy, B.; Lazarow, A. Brain amino acid requirements and
toxicity: The example of leucine. J. Nutr. 2005, 135, 1531S–1538S. [CrossRef]
38. Lynch, C.J.; Adams, S.H. Branched-chain amino acids in metabolic signalling and insulin resistance.
Nat. Rev. Endocrinol. 2014, 10, 723–736. [CrossRef]
39. Brosnan, J.T.; Brosnan, M.E. Branched-chain amino acids: Enzyme and substrate regulation. J. Nutr. 2006,
136, 207S–211S. [CrossRef]
40. Harper, A.E.; Miller, R.H.; Block, K.P. Branched-chain amino acid metabolism. Annu. Rev. Nutr. 1984, 4, 409–454.
[CrossRef]
41. Vogel, K.R.; Arning, E.; Wasek, B.L.; McPherson, S.; Bottiglieri, T.; Gibson, K.M. Brain-blood amino acid
correlates following protein restriction in murine maple syrup urine disease. Orphanet J. Rare Dis. 2014, 9, 73.
[CrossRef] [PubMed]
42. Zinnanti, W.J.; Lazovic, J. Interrupting the mechanisms of brain injury in a model of maple syrup urine
disease encephalopathy. J. Inherit. Metab. Dis. 2012, 35, 71–79. [CrossRef] [PubMed]
43. Song, Y.; Takatsuki, K.; Isokawa, M.; Sekiguchi, T.; Mizuno, J.; Funatsu, T.; Shoji, S.; Tsunoda, M. Fast and
quantitative analysis of branched-chain amino acids in biological samples using a pillar array column.
Anal. Bioanal. Chem. 2013, 405, 7993–7999. [CrossRef] [PubMed]
44. Sharma, G.; Attri, S.V.; Behra, B.; Bhisikar, S.; Kumar, P.; Tageja, M.; Sharda, S.; Singhi, P.; Singhi, S. Analysis of
26 amino acids in human plasma by HPLC using AQC as derivatizing agent and its application in metabolic
laboratory. Amino Acids 2014, 46, 1253–1263. [CrossRef] [PubMed]
45. Lorenzo, M.P.; Navarrete, A.; Balderas, C.; Garcia, A. Optimization and validation of a CE-LIF method for
amino acid determination in biological samples. J. Pharm. Biomed. Anal. 2013, 73, 116–124. [CrossRef]
46. Delgado-Povedano, M.M.; Calderon-Santiago, M.; Priego-Capote, F.; Luque de Castro, M.D. Study of sample
preparation for quantitative analysis of amino acids in human sweat by liquid chromatography-tandem
mass spectrometry. Talanta 2016, 146, 310–317. [CrossRef]
85
Appl. Sci. 2020, 10, 7023
47. Yin, B.; Li, T.; Zhang, S.; Li, Z.; He, P. Sensitive analysis of 33 free amino acids in serum, milk, and muscle by
ultra-high-performance liquid chromatography-quadrupole-orbitrap high resolution mass spectrometry.
Food Anal. Methods 2016, 9, 2814–2823. [CrossRef]
48. Tuma, P.; Sustkova-Fiserova, M.; Opekar, F.; Pavlicek, V.; Malkova, K. Large-volume sample stacking
for in vivo monitoring of trace levels of gamma-aminobutyric acid, glycine and glutamate in micro
dialysates of periaqueductal gray matter by capillary electrophoresis with contactless conductivity detection.
J. Chromatogr. A 2013, 1303, 94–99. [CrossRef]
49. Liu, Y.; Liang, Y.; Yang, R.; Li, J.; Qu, L. A highly sensitive and selective electrochemical sensor based on
polydopamine functionalized graphene and molecularly imprinted polymer for the 2,4-dichlorophenol
recognition and detection. Talanta 2019, 195, 691–698. [CrossRef]
50. Ciriello, R.; De Gennaro, F.; Frascaro, S.; Guerrieri, A. A novel approach for the selective analysis of L-lysine
in untreated human serum by a co-crosslinked L-lysine–α-oxidase/overoxidized polypyrrole bilayer based
amperometric biosensor. Bioelectrochemistry 2018, 124, 47–56. [CrossRef]
51. Anibal, C.V.D.; Odena, M.; Ruisáncheza, I.; Callao, M.P. Determining the adulteration of spices with Sudan
I-II-II-IV dyes by UV–visible spectroscopy and multivariate classification techniques. Talanta 2009, 79, 887–892.
[CrossRef] [PubMed]
52. Zainudin, N.S.; Yaacob, M.H.; Md Muslim, N.Z.; Othman, Z. Voltammetric determination of reactive black 5
(RB5) in waste water samples from the Batik industry. Mal. J. Anal. Sci. 2016, 20, 1254–1268.
53. Jäntschi, L.; Nas, cu, H.-I. Chapter 4-Metode electrochimice. In Chimie Analitică şi Instrumentală; Academic
Press & Academic Direct: Cluj-Napoca, Romania, 2009; pp. 47–67.
54. Narayan, R.J. Part One-Fundamentals of medical biosensors for POC applications. In Medical Biosensors for
Point of Care (POC) Applications; Woodhead Publishing: Sawston, UK, 2016; pp. 27–42.
55. Apetrei, I.; Apetrei, C. A modified nanostructured graphene-gold nanoparticle carbon screen-printed
electrode for the sensitive voltammetric detection of rutin. Measurement 2018, 114, 37–43. [CrossRef]
56. Settle, F.A. Chapter 37-Voltammetric Techniques. In Handbook of Instrumental Techniques for Analytical
Chemistry; Prentice Hall PTR: Upper Saddle River, NJ, USA, 1997; pp. 709–725.
57. Scholz, F. Voltammetric techniques of analysis: The essentials. ChemTexts 2015, 1, 17. [CrossRef]
58. Marsili, E.; Baron, D.B.; Shikhare, I.D.; Coursolle, D.; Gralnick, J.A.; Bond, D.R. Shewanella secretes flavins
that mediate extracellular electron transfer. Proc. Natl. Acad. Sci. USA 2008, 105, 3968–3973. [CrossRef]
59. Hasanzadeh, M.; Shadjou, N.; Omidinia, E. Mesoporous silica (MCM-41)-Fe2 O3 as a novel magnetic
nanosensor for determination of trace amounts of amino acids. Colloids Surf. B Biointerfaces 2013, 108, 52–59.
[CrossRef]
60. Saghatforoush, L.; Hasanzadeh, M.; Shadjou, N.; Khalilzadeh, B. Deposition of new thia-containing
Schiff-base iron (III) complexes onto carbon nanotube modified glassy carbon electrodes as a biosensor for
electrooxidation and determination of amino acids. Electrochim. Acta 2011, 56, 1051–1061. [CrossRef]
61. Hasanzadeh, M.; Karim-Nezhad, G.; Shadjou, N.; Hajjizadeh, M.; Khalilzadeh, B.; Saghatforoush, L.;
Abnosi, M.H.; Babaei, A.; Ershad, S. Cobalt hydroxide nanoparticles modified glassy carbon electrode as a
biosensor for electrooxidation and determination of some amino acids. Anal. Biochem. 2009, 389, 130–137.
[CrossRef]
62. Hussain, M.M.; Rahman, M.M.; Asir, A.M. Sensitive L-leucine sensor based on a glassy carbon electrode
modified with SrO nanorods. Microchim Acta 2016, 183, 3265–3273. [CrossRef]
63. Rezaei, B.; Zare, Z.M. Modified Glassy Carbon Electrode with Multiwall Carbon Nanotubes as a Voltammetric
Sensor for Determination of Leucine in Biological and Pharmaceutical Samples. Anal. Let. 2008, 41, 2267–2286.
[CrossRef]
64. Yang, D.X.; Zhu, L.D.; Jiang, X.Y. Electrochemical reaction mechanism and determination of Sudan I at a multi
wall carbon nanotubes modified glassy carbon electrode. J. Electroanal. Chem. 2010, 640, 17–22. [CrossRef]
65. Li, J.; Kuang, D.; Feng, Y.; Zhang, F.; Xu, Z.; Liu, M.; Wang, D. Green synthesis of silver
nanoparticles–graphene oxide nanocomposite and its application in electrochemical sensing oftryptophan.
Biosen. Bioelectr. 2013, 42, 198–206. [CrossRef] [PubMed]
66. Barnes, W.L.; Dereux, A.; Ebbesen, T.W. Surface plasmon subwavelength optics. Nat. Cell Biol. 2003, 424, 824–830.
[CrossRef] [PubMed]
86
Appl. Sci. 2020, 10, 7023
67. Lai, G.; Zhang, H.; Yong, J.; Yu, A. In situ deposition of gold nanoparticles on polydopamine functionalized silica
nanosphere for ultrasensitive nonenzymatic electrochemical immunoassay. Biosen. Bioelectr. 2013, 47, 178–183.
[CrossRef]
68. García-Barrasa, J.; López-De-Luzuriaga, J.M.; Monge, M. Silver nanoparticles: Synthesis through chemical
methods in solution and biomedical applications. Cent. Eur. J. Chem. 2011, 9, 7–19. [CrossRef]
69. Krishnaraj, C.; Jagan, E.G.; Rajasekar, S.; Selvakumar, P.; Kalaichelvan, P.T.; Mohan, N. Synthesis of silver
nanoparticles using Acalypha indica leaf extracts and its antibacterial activity against water borne pathogens.
Colloids Surf. B Biointerfaces 2010, 76, 50–56. [CrossRef]
70. Singha, S.; Saikia, J.P.; Buragohaina, A.K. A novel ‘green’ synthesis of colloidal silver nanoparticles (SNP)
using Dillenia indica fruit extract. Colloids Surf. B Biointerfaces 2013, 102, 83–85. [CrossRef]
71. Gargi, D.; Dipankar, H.; Atanu, M. Synthesis of Gold Colloid using Zingiber officinale: Catalytic Study.
NanoMatChemBioDev 2018, 1, 24–29.
72. Pulit, J.; Banach, M. Preparation of nanocrystalline silver using gelatin and glucose as stabilizing and reducing
agents, respectively. Dig. J. Nanomater. Biostruct. 2013, 8, 787–795.
73. Prabakaran, E.; Pandian, K. Amperometric detection of Sudan I in red chili powder samples using Ag
nanoparticles decorated graphene oxide modified glassy carbon electrode. Food Chem. 2015, 166, 198–205.
[CrossRef]
74. Liu, X.; Luo, L.; Ding, Y.; Kang, Z.; Ye, D. Simultaneous determination of L-cysteine and L-tyrosine using
Au-nanoparticles/poly-eriochrome black T film modified glassy carbon electrode. Bioelectrochemistry 2012,
86, 38–45. [CrossRef] [PubMed]
75. Prabakaran, E.; Sheela Violet Rani, V.; Brabakaran, A.; Pandian, K.; Jesudurai, D. A Green Approach to
the Synthesis of Eriochrome Black-T Capped Silver Nanoparticles and Its Electrochemical Detection of
L-Tryptophan and L-Tyrosine in Blood Sample and Antibacterial Activity. J. Adv. Electrochem. 2016, 2, 78–84.
76. Karastogianni, S.; Girousi, S. A novel electrochemical bioimprinted sensor for butyl paraben on a modified
carbon paste electrode with safranine-O capped with silver nanoparticles. Int. J. Cur. Res. 2017, 9, 61118–61124.
77. García-Carmona, L.; González, M.C.; Escarpa, A. Electrochemical On-site Amino Acids Detection of Maple
Syrup Urine Disease Using Vertically Aligned Nickel Nanowires. Electroanalysis 2018, 30, 1505–1510.
[CrossRef]
78. Tooley, C.A.; Gasperoni, C.H.; Marnoto, S.; Halpern, J.M. Evaluation of Metal Oxide Surface Catalysts for the
Electrochemical Activation of Amino Acids. Sensors 2018, 18, 3144. [CrossRef]
79. Nguyen, H.H.; Lee, S.H.; Lee, U.J.; Fermin, C.D.; Kim, M. Immobilized Enzymes in Biosensor Applications.
Materials 2019, 12, 121. [CrossRef]
80. Clark, L.C.; Lyons, C. Electrode systems for continuous monitoring in cardiovascular surgery. Ann. N. Y.
Acad. Sci. 1962, 102, 29–45. [CrossRef]
81. García-Carmona, L.; González, M.C.; Escarpa, A. On-line coupling of millimeter size motors and
chronoamperometry for real time bio-sensing of branched-chain amino acids in maple syrup urine disease
clinical samples. Sens. Actuators B Chem. 2019, 281, 239–244. [CrossRef]
82. Stefan-van Staden, R.-I.; Muvhulawa, L.S. Determination of L- and D-Enantiomers of Leucine Using
Amperometric Biosensors Based on Diamond Paste. Instr. Sci. Technol. 2006, 34, 475–481. [CrossRef]
83. Labroo, P.; Cui, Y. Amperometric bienzyme screen-printed biosensor for the determination of leucine.
Anal. Bioanal. Chem. 2014, 406, 367–372. [CrossRef]
84. Domınguez, R.; Serra, B.; Reviejo, A.; Pingarron, J. Chiral analysis of amino acids using electrochemical
composite bienzyme biosensors. Anal. Biochem. 2001, 298, 275–282.
85. Cosnier, S.; Lepellec, A. Biosensors based on electropolymerized films: New trends. Anal. Bioanal. Chem.
2003, 377, 507–520. [CrossRef] [PubMed]
86. Garnier, F. Functionalized Conducting Polymers—Towards Intelligent Materials. Angew. Chem. 1989,
101, 529–533. [CrossRef]
87. Luo, J.; Fan, C.; Wang, X.; Liu, R.; Liu, X. A novel electrochemical sensor for paracetamol based on molecularly
imprinted polymeric micelles. Sens. Act. B Chem. 2013, 188, 909–916. [CrossRef]
88. Kan, X.; Zhou, H.; Li, C.; Zhu, A.; Xing, Z.; Zhao, Z. Imprinted electrochemical sensor for dopamine recognition
and determination based on a carbon nanotube/polypyrrole film. Electrochim. Acta 2012, 63, 69–75. [CrossRef]
87
Appl. Sci. 2020, 10, 7023
89. Ghasemi-Varnamkhasti, M.; Apetrei, C.; Lozano, J.; Anyogu, A. Potential use of electronic noses, electronic
tongues and biosensors as multisensor systems for spoilage examination in foods. Trends Food Sci. Technol.
2018, 80, 71–92. [CrossRef]
90. Apetrei, I.-M.; Apetrei, C. Application of voltammetric e-tongue for the detection of ammonia and putrescine
in beef products. Sens. Actuators B Chem. 2016, 234, 371–379. [CrossRef]
91. Wang, Z.; Chen, H.; Li, J.; Xue, Z.; Wu, B.; Lu, X. Acetylsalicylic acid electrochemical sensor based on
PATP–AuNPs modified molecularly imprinted polymer film. Talanta 2011, 85, 1672–1679. [CrossRef]
92. Bi, Q.; Dong, S.; Sun, Y.; Lu, X.; Zhao, L. An electrochemical sensor based on cellulose nanocrystal for the
enantioselective discrimination of chiral amino acids. Anal. Biochem. 2016, 508, 50–57. [CrossRef]
93. Ríos, A.; Zougagh, M.; Avila, M. Miniaturization through lab-on-a-chip: Utopia or reality for routine
laboratories? A review. Anal. Chim. Acta 2012, 740, 1–11. [CrossRef]
94. Batalla, P.; Martín, A.; López, M.A.; González, M.C.; Escarpa, A. Enzyme-based microfluidic chip coupled to
graphene electrodes for the detection of D-amino acid enantiomer-biomarkers. Anal. Chem. 2015, 87, 5074–5078.
[CrossRef] [PubMed]
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
88
MDPI
St. Alban-Anlage 66
4052 Basel
Switzerland
Tel. +41 61 683 77 34
Fax +41 61 302 89 18
www.mdpi.com