Immune determinants of CAR-T cell expansion in solid tumor patients receiving GD2 CAR-T cell therapy (科研通-ablesci.com)

Article
Immune determinants of CAR-T cell expansion in

solid tumor patients receiving GD2 CAR-T cell
therapy
Graphical abstract Authors
Sabina Kaczanowska, Tara Murty,
Ahmad Alimadadi, ...,
Crystal L. Mackall,
Sneha Ramakrishna,
Rosandra N. Kaplan
Correspondence
ramakrs@stanford.edu (S.R.),
rosie.kaplan@nih.gov (R.N.K.)
In brief
Chimeric antigen receptor T cell (CAR-T)
therapy targeting GD2 in osteosarcoma
and neuroblastoma in a Phase I clinical
trial shows feasibility and safety but
limited efficacy. Kaczanowska et al.
analyze baseline, product and post-
treatment patient samples and
demonstrate myeloid and T cell
phenotypes associated with CAR-T
expansion.
Highlights
d GD2 CAR-T Phase I trial shows feasibility and safety in
osteosarcoma and neuroblastoma
d Multi-omic analyses identify immune contributors to CAR-T

expansion in patients
d Good expanders had increased naive T cells and CXCR3+

monocytes at baseline
d Poor expanders had more CXCR3– monocytes at baseline

and exhausted CAR-T product
Kaczanowska et al., 2024, Cancer Cell 42, 1–17

January 8, 2024 ª 2023 Published by Elsevier Inc.
https://doi.org/10.1016/j.ccell.2023.11.011 ll
Please cite this article in press as: Kaczanowska et al., Immune determinants of CAR-T cell expansion in solid tumor patients receiving GD2 CAR-T cell
therapy, Cancer Cell (2023), https://doi.org/10.1016/j.ccell.2023.11.011
ll
Article
Immune determinants of CAR-T cell expansion
in solid tumor patients receiving
GD2 CAR-T cell therapy
Sabina Kaczanowska,1,14 Tara Murty,2,14 Ahmad Alimadadi,3,4,5,14 Cristina F. Contreras,1,13 Caroline Duault,6
Priyanka B. Subrahmanyam,6 Warren Reynolds,2 Norma A. Gutierrez,3 Reema Baskar,7 Catherine J. Wu,8,9
Franziska Michor,8 Jennifer Altreuter,8 Yang Liu,8 Aashna Jhaveri,8 Vandon Duong,2 Hima Anbunathan,2 Claire Ong,1
Hua Zhang,1 Radim Moravec,10 Joyce Yu,9 Roshni Biswas,9 Stephen Van Nostrand,9 James Lindsay,9 Mina Pichavant,4
Elena Sotillo,2 Donna Bernstein,1 Amanda Carbonell,1 Joanne Derdak,1 Jacquelyn Klicka-Skeels,1 Julia E. Segal,1
Eva Dombi,1 Stephanie A. Harmon,11 Baris Turkbey,11 Bita Sahaf,2 Sean Bendall,5 Holden Maecker,4 Steven L. Highfill,12
David Stroncek,12 John Glod,1 Melinda Merchant,1 Catherine C. Hedrick,3,4,5 Crystal L. Mackall,2
Sneha Ramakrishna,2,15,* and Rosandra N. Kaplan1,15,16,*
1Pediatric Oncology Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA
2Center for Cancer Cell Therapy, Stanford Cancer Institute, Stanford University School of Medicine, Stanford, CA, USA
3La Jolla Institute for Immunology, La Jolla, CA, USA
4Immunology Center of Georgia, Augusta University, Augusta, GA, USA
5Georgia Cancer Center, Medical College of Georgia at Augusta University, Augusta, GA, USA
6Stanford Human Immune Monitoring Center, Stanford University School of Medicine, Stanford, CA, USA
7Department of Pathology, Stanford University, Stanford, CA, USA
8Broad Institute, Cambridge, MA, USA
9Dana-Farber Cancer Institute, Boston, MA, USA
10Cancer Therapy Evaluation Program, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA
11Artificial Intelligence Resource, Molecular Imaging Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA
12Center for Cellular Engineering, Department of Transfusion Medicine, National Institutes of Health Clinical Center, Bethesda, MD, USA
13Department of Oncology, University of Oxford, Oxford, UK
14These authors contributed equally
15Senior author
16Lead contact
*Correspondence: ramakrs@stanford.edu (S.R.), rosie.kaplan@nih.gov (R.N.K.)

https://doi.org/10.1016/j.ccell.2023.11.011
SUMMARY
Chimeric antigen receptor T cells (CAR-Ts) have remarkable efficacy in liquid tumors, but limited responses in
solid tumors. We conducted a Phase I trial (NCT02107963) of GD2 CAR-Ts (GD2-CAR.OX40.28.z.iC9),
demonstrating feasibility and safety of administration in children and young adults with osteosarcoma and
neuroblastoma. Since CAR-T efficacy requires adequate CAR-T expansion, patients were grouped into
good or poor expanders across dose levels. Patient samples were evaluated by multi-dimensional proteo-
mic, transcriptomic, and epigenetic analyses. T cell assessments identified naive T cells in pre-treatment
apheresis associated with good expansion, and exhausted T cells in CAR-T products with poor expansion.
Myeloid cell assessment identified CXCR3+ monocytes in pre-treatment apheresis associated with good
expansion. Longitudinal analysis of post-treatment samples identified increased CXCR3– classical mono-
cytes in all groups as CAR-T numbers waned. Together, our data uncover mediators of CAR-T biology and
correlates of expansion that could be utilized to advance immunotherapies for solid tumor patients.
INTRODUCTION neuroblastoma has seen improvement in overall survival for

high-risk patients using a disialoganglioside glycoprotein 2
Children and young adults with recurrent, metastatic, or unre- (GD2)-targeting monoclonal antibody, which is now part of front-
sectable osteosarcoma or neuroblastoma experience dismal line therapy.8 Based on this, several trials have tested GD2-tar-
outcomes, with little progress in osteosarcoma treatment op- geting chimeric antigen receptor T cells (CAR-Ts) in neuroblas-
tions over the last several decades.1–7 In these patients, immu- toma and have shown safety, but limited efficacy.9–12
notherapy provides an enticing opportunity to change the treat- Understanding the basis of this limited efficacy is crucial for
ment paradigm by targeting tumor-specific antigens. In fact, the progress of solid tumor CAR-T therapies. Experience with
Cancer Cell 42, 1–17, January 8, 2024 ª 2023 Published by Elsevier Inc. 1
ll
Article
Table 1. Patient Demographics and Baseline Characteristics

Number of patients enrolled in Number of patients who received
Characteristic clinical trial (n=15) GD2 CAR-Ts (n=13)
Age Median (range) 17 (8 - 28) years 18 (10 - 28) years
Sex Female/Male 3/12 3/10
Race White 9 7
African American 3 3
Asian 1 1
Hispanic 1 1
Multiple Race 1 1
Tumor Type Osteosarcoma 12 11
Neuroblastoma 3 2
Prior Therapies Surgery 14 12
Chemotherapy 15 13
Radiation 8 6
Immunotherapy / Targeted Therapy 6 5
Autologous Stem Cell Transplant 3 2
Total Lines of Prior Systemic Therapy
1– 2 5 5
3–4 7 6
5 or more 3 2
Performance Status ECOG 0 3 3
ECOG 1 10 9
ECOG 2 2 1
CAR-T therapies in both solid and hematologic malignancies has tance of deeper investigation into their roles to unlock the full po-
identified CAR-T expansion as an essential first step toward tential of immunotherapy for solid tumor patients.
CAR-T efficacy.13 As such, progress in solid tumor CAR-Ts re- Here, we demonstrate the safety and feasibility of adminis-
quires understanding mediators of CAR-T expansion. Therefore, tering a third-generation GD2.CD28.OX40.z CAR-T to GD2+ os-
we report a GD2.CD28.OX40.z CAR-T trial in neuroblastoma and teosarcoma and neuroblastoma patients. Naive and memory
osteosarcoma, where we performed robust correlative studies T cell as well as CXCR3+ myeloid populations in pre-treatment
to shed light on mediators of CAR-T expansion in patients. apheresis show striking correlation with CAR-T expansion and
Biomarker evaluations of CAR-Ts in acute lymphoblastic leu- may be predictive of patient response to immunotherapies.
kemia and chronic lymphocytic leukemia correlate early memory These findings highlight the power of integrating clinical out-
T cell phenotypes in patient pre-treatment apheresis with CAR-T comes with robust correlative analyses to provide insight into
success.14,15 Conversely, less abundant early memory T cell the T cell and myeloid immune milieu modulating CAR-T activity
populations correlate with decreased T cell expansion poten- in solid tumor patients.
tial.16 Additionally, exhausted T cells are associated with poor
clinical response.17,18 In the clinical solid tumor space, compre- RESULTS
hensive immune cell analyses are scarce. Thus far, central mem-
ory cells in patient GD2.CD3z CAR-T products are associated Patient characteristics and CAR-T manufacturing
with more durable remissions,10 and pre-clinical models of feasibility
GD2 CAR-Ts identify tonic signaling and exhaustion as a limita- Fifteen patients, twelve with osteosarcoma and three with neuro-
tion of CAR-T activity.19,20 As CAR-T therapies continue to gain blastoma, were enrolled in this Phase I single center clinical trial
traction in the treatment of solid tumors, it will be important to (NCT02107963) testing GD2.CD28.OX40.z CAR-Ts (Table 1,
validate and expand on these potential biomarkers of CAR-T ac- Figures 1A, 1B, and Table S1). The median age was 17 (range
tivity specifically in the context of solid tumors. 8–28), and these patients were all heavily pre-treated prior to
In addition to identifying features of T cells, there is a shift in enrollment with multiple modalities of therapies (Table 1). Disease
focus as the contributions of myeloid cells to cancer progression burden at baseline varied on the metrics of tumor size, number of
and immunotherapy efficacy become increasingly apparent.21 In metastatic lesions, and number of sites involved (Tables 2 and 3).
patients treated with GD2.CD28.OX40.z CAR-Ts, myeloid popula- Thirteen patients received the intended GD2 CAR-Ts at the
tions expand after CAR-T administration.11 Moreover, in patients four planned dose levels (1 x 105, 1 x 106, 3 x 106, and 1 x 107
with diffuse midline glioma treated with GD2.41BB.z CAR-T ther- transduced GD2 CAR-Ts/kg), and two patients died prior to
apy, suppressive myeloid cells may have limited CAR-T activity.22 CAR-T administration. GD2 CAR-Ts were manufactured using
These insights into myeloid populations underscore the impor- a retroviral vector (iC9-2A-14G2A.CD28.OX40Z), activated by
2 Cancer Cell 42, 1–17, January 8, 2024

ll
Article
A B
C D
Figure 1. GD2 CAR-T administration results in varying levels of CAR-T expansion

(A) Schematic of GD2 CAR-T construct.
(B) Timeline of treatment and sample collection for patients receiving GD2 CAR-T.
(legend continued on next page)
Cancer Cell 42, 1–17, January 8, 2024 3
ll
Article
CD3/CD28 beads and expanded in the presence of IL-2 (Fig- Table 2. Disease Burden Score
ure S1A). The cell selection process prior to manufacturing
Size of largest tumor Number of metastatic Number of sites
changed from bead selection to elutriation + ACK lysis for the lesion lesions R 1 cm in size involved*
last four treated patients to reduce myeloid populations during
% 2.5 cm; 0 points % 3; 0 point 1; 0 point
the manufacturing culture process,23 which resulted in improved
> 2.5 cm, % 5 cm; >3, % 6; 1 point 2-3; 1 point
GD2 CAR-T expansion during manufacturing (Figures S1A and
1 point
S1B). One patient’s cells failed transduction/expansion based
on the final number of GD2 CAR-T-transduced cells (6 x 106 cells > 5 cm; 3 points > 6; 3 points 4 or more; 3 points
at harvest), but the product was able to be re-manufactured with Scoring:
the addition of Ficoll density gradient and monocyte-adhesion Total score % 2, small disease burden
Total score R 3, large disease burden
steps. All GD2 CAR-T products were manufactured within
*Sites: CNS (brain and spine), head/neck (not CNS), chest, abdomen,
10–11 days and met release criteria as specified on the clinical
pelvis, upper extremity, lower extremity
trial protocol (Table S2).
all Phase I clinical trials, enrolled patients who were relapsed and
Toxicity and response
frequently metastatic, but demonstrated considerable differences
Safety was assessed during the study through the evaluation of
in disease burden. We developed a disease burden score, based
treatment emergent adverse events (TEAEs), laboratory profiles,
on metrics of tumor size, number of metastatic lesions, and
physical examinations, and vital signs. TEAEs were graded ac-
number of sites involved at time of trial enrollment (Table 2). This
cording to the National Cancer Institute Common Terminology
score correlated closely with an AI-generated disease burden
Criteria for Adverse Events, version 4.0. Overall, GD2 CAR-Ts
quantification28 and together may be useful to quantify tumor
were very well tolerated without significant evidence of toxicity
burden and potentially correlate with treatment response in the
attributed to CAR-T (Table S3). 15.4% (2/13) of patients experi-
clinical trial setting. Surprisingly, these patient disease burden met-
enced grade-1 cytokine release syndrome without signs of neuro-
rics did not correlate with GD2 CAR-T expansion in patients (Fig-
logical toxicities. No dose-limiting toxicities attributed to the IND
ure S1F and Table 3). Importantly, peak GD2 CAR-T expansion
research were observed in any of the dose levels of administration.
(maximum level detected at available time points) above 1,000
No patients required administration of the iCasp9 suicide gene
GD2 CAR copies/100 ng DNA did associate with increased
switch, AP1903 (rimiducid), for unacceptable toxicity possibly,
cytokine levels in patient plasma on day 10 ± 4 days (range day
probably, or likely related to GD2 CAR-Ts. On day 28 following
7–14), suggesting a functional difference in these patients’
GD2 CAR-T infusion, 16.7% (2/12) of evaluable patients had pro-
CAR-Ts and confirming the importance of common cytokine
gressive disease and 83.3% (10/12) had stable disease (SD).
receptor g-chain family of cytokines, such as IL-15, as drivers of
30% (3/10) of SD patients remained stable at 60 days post-GD2
T cell expansion, consistent with other adoptive cell therapy
CAR-T infusion, but all patients eventually progressed (Figure 1C).
studies24 (Figures 1F and S2). Additionally, all patients with
CAR-T expansion over 1,000 copies/100 ng DNA demonstrated
CAR-T kinetics and activity stable disease, whereas 3 of 5 patients with CAR-T expansion
While subsequent CAR-T trials have since implemented fludara- below 1,000 copies/100 ng DNA had progressive disease within
bine and cyclophosphamide for lymphodepletion, this trial used the 28-day window (Figure 1C).
only cyclophosphamide at 1800 mg/m2/day for two days, resulting Based on these findings, we categorized patients into those with
in a nadir in absolute lymphocyte count occurring between day good CAR-T expansion (peak CAR-T expansion >1,000 GD2 CAR
0 and 7 in all patients (Figure S1C) and was shorter than patients copies/100 ng DNA) versus poor CAR-T expansion (peak CAR-T
receiving a fludarabine/cyclophosphamide regimen.24 We expansion <1,000 GD2 CAR copies/100 ng DNA) (Figure 1E). To
measured the expansion and persistence of GD2 CAR-Ts in the profile the cellular correlates of CAR-T expansion and activity in
peripheral blood using qPCR. GD2 CAR-Ts expanded in all pa- these patients, we performed comprehensive phenotypic (cytom-
tients receiving treatment, half of whom had expansion above etry by time-of-flight [CyTOF]), transcriptomic (RNA sequencing
1,000 GD2 CAR copies/100 ng DNA, a level similar to that seen [RNA-seq]), and epigenetic (assay for transposase-accessible
in clinically active CD19 and CD22 CAR-Ts,25–27 but the GD2 chromatin with high-throughput sequencing [ATAC-seq]) analyses
CAR-Ts had limited persistence (Figures 1D and 1E). CAR-T of patient pre-treatment apheresis (apheresis), CAR-T product
expansion in patients did not associate with dose level, CAR (product), and peripheral blood mononuclear cells collected
transduction efficiency, nor CD4/8 ratio in the CAR-T product between day 1 and 60 after CAR-T infusion (post-treatment)
(Figures S1D, S1E, and Table S2). Importantly, this trial, similar to (Figure 1G).
(C) Swimmer’s plot representing patient response from time of GD2 CAR-T infusion.
(D) Levels of CAR-T detected in the peripheral blood of patients as measured by qPCR of the GD2 CAR-T construct.
(E) Stratification of patients into good and poor CAR-T expanders based on peak (maximum) level of GD2 CAR-T detected by qPCR. Boxplot represents all
patients (dots) with median (line) and range (whiskers).
(F) Fold change of cytokines in the plasma of patients on day 10 ± 4 (range day 7–14) following CAR-T administration over day 0 prior to CAR-T administration.
Boxplot represents all patients (dots) with median (line) and range (whiskers). Statistical analysis conducted by Mann-Whitney test (n = 13).
(G) Schematic of patient samples pre-treatment apheresis, CAR-T product, and post-treatment (day 1–60 after CAR-T infusion) multi-dimensional analyses,
including proteomic (mass cytometry or CyTOF), transcriptomic (RNA-seq), and epigenetic (ATAC-seq) assays. Also see Figures S1, S2, and Tables S1–S3.

ll
Article
Table 3. Disease burden at baseline does not correlate with CAR-T Peak Expansion
Patient SUV max Total Lesion Glycolysis (SUVbw*ml) Volume (ml) Disease burden score GD2 CAR-T Peak Expansion
1 4.49 11.71 5.34 1, small 237.2
2 27.96 7997.11 1304.95 7; large N/A (no CAR)
3 11.83 4559.04 1054.72 7; large 494.9
4 102.88 2102.47 355.8 7; large 0.0
5 16.08 129.47 28.52 2; small 237.3
6 14.18 348.3 90.93 5; large 3331.7
7 *incomplete imaging for evaluation *small 34400.0
8 10.89 167.46 42.31 1; small 11500.0
9 3.72 4.44 2.23 0; small 10875.0
10 11.03 1405.28 413.2 5; large 3100.0
11 *incomplete imaging for evaluation *large N/A (no CAR)
12 9.03 576.05 182.21 4; large 1185.6
13 11.26 101.18 20.16 1; small 29269.0
14 5.4 253.56 83.21 1; small 100.6
15 15.59 330.98 85.41 3; large 471.5
Good and poor expanders exhibit shared immune cell esis samples represent the detailed circulating immune milieu
populations in CAR-T products and post-treatment of patients at baseline. Phenotypic profiling of the apheresis
samples samples by CyTOF using the T cell Phenotype Panel identified
CyTOF analysis of GD2 CAR-T products using a robust T cell twelve distinct clusters from all viable CD45+ cells, ten of them
Phenotype Panel identified 8 distinct clusters, none of which within the T cell compartment (Figures 3A—3C and S3E). Com-
were differentially represented between good and poor expanders parison of samples originating from good versus poor expanders
(Figures 2A—2C, S3A, and S3B). Interestingly, two clusters identified two significantly differentially abundant clusters: clus-
comprised an average of 63% of each patient’s CAR-T product ter 1, a naive CD8 T cell population (CD45RA+CCR7+) associated
(Figure 2D). These GD2 CAR+ T cell clusters define a proliferating, with good CAR-T cell expansion, and cluster 4, a terminal
activated population of CD4 T cells (cluster 3; CD39+KI67+ effector TEMRA CD8 T cell population (CD45RA+CCR7 CD38+
CD45RO+ CD95+OX40+CTLA4+CD38+TBET+BTLA+) and CD8 TBET+CD11b+CD122+) trended with poor CAR-T expansion
T cells (cluster 6; CD39+KI67+CD45RO+CD95+CTLA4+CD38+ (Figure 3D). Manual gating of apheresis memory populations
TBET+BTLA+) (Figure 2D). Application of a CAR-T Exhaustion based on expression of CD45RA and CCR7 confirmed that
Score based on bulk RNA-seq data (Figure S3C), developed naive (CD45RA+CCR7+) CD4 and CD8 T cells trend toward
from a previously published dataset,29 suggested trends of increased proportions in good expanders, while effector
increased activation signatures in good expanders and increased TEMRA (CD45RA+CCR7-) and effector (CD45RA CCR7-) CD4
exhaustion signatures in poor expanders (Figure 2E). Finally, and CD8 T cell populations were predominant in poor expanders
epigenetic analyses of CAR-T products via ATAC-seq also (Figure 3E). Random forest analysis of surface markers
demonstrated limited differences in the open chromatin measured by CyTOF identified CD38, previously implicated in
(Figures 2F and S4), but showed enrichment in good expander antigen-induced T effector function,33 as a prominent marker in
CAR-T products of AP-1 factor transcription factor (TF) motifs, apheresis associated with poor expansion (Figure S3F).
such as BATF, JUN, and FOS, signals previously implicated in Although transcriptomic analysis by RNA-seq resulted in a small
exhaustion-resistant T cells29 (Figure 2G). When evaluating post- number of differentially expressed genes between good and
treatment samples by CyTOF, poor expanders demonstrated a poor expanders (Figure S3G), Gene Set Enrichment Analysis
trend of increased CD39 and Helios protein expression, consistent (GSEA) focusing on transcriptomic profiles that define T cell sub-
with exhaustion30,31 and T regulatory cells (Tregs)32 (Figure S3D). types identified enrichment of gene sets associated with naive or
Together, these data demonstrate that while all CAR-T products central memory phenotypes in apheresis from good expanders
have similar proteomic exhaustion signatures, poor expanders compared to poor expanders (Figure 3F). Conversely, GSEA
have increased transcriptomic signatures of exhaustion and analysis demonstrated enrichment of Treg and IL-4 gene sets
good expanders have increased epigenetic signatures of exhaus- in poor CAR-T expanders, a finding aligned with recent publica-
tion resistance, potentially contributing to CAR-T expansion and tions identifying Tregs as a potential inhibitor of CAR-T
persistence in patients. response34,35 (Figure 3F). These findings illustrate that naive
T cell populations in apheresis correlate with good CAR-T
Good CAR-T expansion associates with increased T cell expansion, whereas TEMRA T cell populations in apheresis
memory subsets in apheresis prior to CAR-T associate with poor expansion.
manufacturing Finally, we profiled the epigenetic landscape of apheresis
Prior to CAR-T manufacturing, patient cells are collected via samples by ATAC-seq. Principal component analysis separated
apheresis for CAR-T production. We posited that these apher- samples according to their expansion and showed increased

ll
Article
A B C
D E
F G
Figure 2. CAR-T product samples display features of T cell exhaustion

(A) UMAP plot of T cell populations in GD2 CAR-T product using the T cell Phenotype CyTOF Panel (n = 12 patients).
(B) Feature plots showing the distribution of expression of select CyTOF markers among the T cell populations.
(C) Heatmap of hierarchical clustering of median marker expression in GD2 CAR-T product by CyTOF represented per patient.
(D) Proportion of total cells represented in T cell Phenotype Panel clusters 3 and 6. Boxplot represents all patients (dots) with median (line) and range (whiskers).
Statistics calculated by Mann-Whitney test (n = 12 patients).

ll
Article
genome-wide accessibility of chromatin in good versus poor ex- classical monocytes, as well as CXCR3+Slan+ and CXCR3+
panders (Figures 3G, 3H, and Figure S4). TFs associated with Slan non-classical monocytes (nMo: CD14 CD16+), were
T cell dysfunction and regulatory roles, including Epas1, TCF4, significantly increased in good expanders; meanwhile, CXCR3–
and Gli2, were enriched in poor expanders36 (Figure 3I). Good classical monocytes (cMo: CD14+CD16 ) and both clusters of
expanders demonstrated enrichment of RUNX3, a TF known to intermediate monocytes (iMo: CD14dimCD16+) were significantly
inhibit Th2 lineage differentiation and increase Th1 effector increased in poor expanders (Figure 5A). Overall, non-classical
molecules, such as IFNG.37 RUNX3 overexpression is also asso- CXCR3+ monocytes correlated positively with CAR-T expansion,
ciated with downregulation of ApoE and CCL2 immune-suppres- while CXCR3– classical and intermediate (iMo2) monocyte pop-
sive programs in myeloid cells.38 In fact, the apheresis epigenetic ulations negatively correlated with CAR-T expansion (Fig-
landscape demonstrated myeloid signatures across both good ure S5C). Pseudotime trajectory analysis demonstrated progres-
and poor expanders, including IRF3, which is essential for the sion from classical to intermediate to non-classical monocytes
innate immune response,39 Ets2, which drives myeloid suppres- and from CXCR3– to CXCR3+ populations, suggesting that
sive populations,40 and KLF6, which regulates macrophage po- poor CAR-T expanders displayed a less-differentiated monocyte
larization41 (Figure 3I). In poor expanders, Gli1 was enriched, phenotype (Figures S5D and S5E). Multidimensional scaling of
which is implicated in the regulation of inflammation and involved these samples demonstrated that patients with poor expansion
in the CD47-SIRPa pathway.42 Given the crucial role that myeloid cluster together, indicating commonalities in the apheresis
cells play in orchestrating immune responses and a growing of poor expanders, while good expanders have more diversity
body of literature that myeloid cells can limit immune responses (Figure 5B). In agreement with the T cell Phenotype Panel
in solid tumors,43 we sought to robustly characterize the myeloid analyses, the Myeloid Panel analyses identified that patients
populations in patients receiving GD2 CAR-T therapy. with good CAR-T expansion had increased expression of
CCR7, CD45RA, and GITR/CD357 prior to CAR-T manufacturing
Myeloid cell populations in apheresis are associated (Figure 5C). Random forest analysis showed that CXCR3 on
with CAR-T expansion myeloid cells is the most important feature distinguishing
We evaluated apheresis and post-treatment patient samples for good CAR-T expansion from poor CAR-T expansion (Figure 5D).
potential myeloid contributors to CAR-T expansion. Phenotyping In contrast, patients who experienced poor CAR-T cell expan-
patient apheresis using an in-depth Myeloid CyTOF Panel demon- sion had increased myeloid expression of the canonical
strated significantly reduced frequencies of monocytes and den- monocyte markers CD11b and CD14, the MDSC marker
dritic cells (DCs) in patients with good versus poor CAR-T expan- CD33, which mirrors pathways observed in the transcriptomic
sion (Figure 4A). CIBERSORT RNA-seq analysis corroborated analyses and metabolic dearrangements reported in MDSCs
these findings that monocytes were associated with poor (Figure 5C).44–46,48,49
CAR-T expansion (Figure 4B). Using previously published data-
sets that characterized myeloid populations in the setting of can- Post-treatment patient sample characterization
cer, we found that poor responders had increased gene signa- suggests myeloid molecular signatures associate with
tures associated with CD16 monocytes44 and myeloid-derived poor CAR-T expansion and persistence
suppressor cells (MDSCs),45–47 which was validated by surface Extending beyond differences of myeloid populations prior to
phenotyping (Figures 4C and 4D). Further, apheresis samples of treatment that could contribute to CAR-T expansion, we interro-
patients with poor CAR-T expansion enriched for a gene signature gated whether myeloid populations changed in response to
similar to that of monocytes from non-responders to PD-L1 inhibi- CAR-T administration. Consistent with previous reports,11 com-
tion,48 suggesting a monocyte phenotype that limits other immu- plete blood count analysis showed that the absolute monocyte
notherapeutic approaches beyond CAR-Ts (Figure 4C). GSEA count was significantly increased in poor CAR-T expanders
indicated that samples from patients with poor CAR-T expansion 2 weeks after treatment relative to those patients with good
were enriched in pathways associated with myeloid cell immune CAR-T expansion (Figure 6A). Cytokine analysis indicated that
suppression in response to strong activation, such as LPS and good expanders had increased plasma levels of GM-CSF and
TREM1-mediated phenotypes,49 in parallel with reduced adaptive IL-12, which are associated with monocyte differentiation and
T and B cell immune signatures relative to myeloid populations, antitumor responses, respectively (Figure 6B). Moreover, post-
suggesting myeloid skewing in the circulating immune milieu (Fig- treatment IL-12 strongly associated with the presence of
ure 4E). These findings are consistent with observations that CXCR3+ myeloid populations (Figure S6A). Myeloid Panel
myeloid cells demonstrate marked plasticity, and by integrating CyTOF analysis of peripheral blood immune populations
signals from multiple stimuli can strongly modulate the T cell showed significant increases in CXCR3– cMo and iMo2 clusters,
compartment and tailor the immune response.50 with a significant decrease in the CXCR3hi cMo cluster, following
To further study the monocyte and DC populations, we per- CAR-T cell infusion (Figures 6C and 6D). Of note, poor ex-
formed a sub-clustering analysis of the myeloid populations at panders did not have differences in their monocyte populations
apheresis (Figures 5A, S5A, and S5B). CXCR3+ and CXCR3hi pre- versus post-treatment, while the good expanders had
(E) The Activation Score based on Panther dataset. The Exhaustion Score was based on dataset of a previously described CAR-T model of exhaustion.29 Boxplot
represents all patients (dots) with median (line) and range (whiskers). Statistical analysis conducted by Mann-Whitney test (n = 8 patients).
(F) Volcano plot of CAR-T products demonstrates 60 chromatin features higher in accessibility in good or poor expanders based on FDR-adjusted p value%0.05
and log2FC > 2 (n = 11 patients).
(G) Open transcription factor motifs identified by combination of log(qvalue) and odds ratio (n = 11 patients). Also see Figures S3, S4, and Table S2.

ll
Article
A B C
D E
F G
H I
Figure 3. Apheresis memory T cell signatures correlate with CAR-T expansion in patients
(A) UMAP clusters of immune cell populations in apheresis from the T cell Phenotype CyTOF Panel (n = 10 patients).
(B) Median marker gene expression in populations in apheresis from the T cell Phenotype CyTOF Panel (n = 10 patients).
ll
Article
monocyte populations that shifted from a favorable pre-treat- DISCUSSION

ment phenotype to a phenotype that resembles the poor ex-
panders following CAR-T treatment (Figure 6D). In fact, this Here, we report on a Phase I trial of a third-generation GD2
shift was consistent when evaluating CXCR3 expression on all CAR-T therapy for GD2+ solid tumor in pediatric and young adult
myeloid cells (Figure 6E). These data suggest that the CXCR3– patients with osteosarcoma and neuroblastoma. This trial met its
monocyte population associated with poor CAR-T expansion primary objectives with successful manufacturing of CAR-Ts
may also be responsible for limited CAR-T persistence in pa- from fifteen patients and safe administration of GD2 CAR-Ts to
tients who experienced good initial CAR-T expansion. eleven patients with osteosarcoma and two with neuroblastoma.
Given CXCR3 expression may represent a marker of an acti- Despite all patients on study eventually experiencing disease
vated immune response, we explored CXCR3 expression in progression, a portion of patients exhibited GD2 CAR-T expan-
other inflammatory settings. We identified a trend of higher sion similar to that seen in clinically active leukemia patient
CXCR3 expression in monocytes of hospitalized COVID-19 pa- CAR-T trials.25–27 Although there were no objective responses,
tients as compared to those not hospitalized,51 suggesting three patients had stable disease beyond day 90 and all
increased immune activation in these patients (Figure 6F). As three had good CAR-T expansion. Therefore, we performed
CXCR3 expression was the most significant indicator of CAR-T multi-dimensional correlative studies on pre-treatment apher-
expansion in our patients, we queried the TARGET-OS dataset52 esis, CAR-T product, and post-infusion peripheral blood pa-
and found that high CXCR3 expression was associated with tient samples to identify central mechanisms of CAR-T expan-
significantly increased survival in patients with osteosarcoma; sion and explore immune mediators of CAR-T persistence and
conversely, low CXCR3 expression was associated with efficacy.
reduced survival (Figures 6G, S6B, and S6C). Together, these While the causes of inadequate CAR-T expansion in solid tu-
data demonstrate that monocyte populations, specifically mors are likely multifactorial, experience in preclinical models
CXCR3+ or CXCR3hi classical monocytes, are associated with and hematologic malignancies suggests that T cell exhaustion
good CAR-T expansion in patients and provide evidence for a and inadequate memory potentially play an integral role.53 In
T cell-extrinsic, monocyte-dependent mechanism contributing this study, we demonstrate that increased baseline naı̈ve T cell
to CAR-T efficacy. subsets are associated with good CAR-T expansion. These
To begin to understand interactions of these myeloid popula- findings align with studies showing early memory T cells in pre-
tions and T cell populations, we tested whether direct interac- manufacturing apheresis as a biomarker of CAR-T success in
tion of CXCR3-expressing monocytes with GD2 CAR-Ts would pediatric acute lymphoblastic leukemia14,54 and chronic lympho-
have an impact on CAR-T function. Given CXCR3 expression cytic leukemia.15 Single-cell RNA-seq analyses of CD19 CAR-T
can be induced by interferon signaling, and immune cells pro- products from lymphoma patients also found the presence of
duce interferon upon activation, we investigated whether inter- memory T cells to be associated with good clinical response.17
ferons could be predominantly responsible for the upregulation Our study expands these discoveries to solid tumors, where a
of CXCR3 on primary human monocytes. Exposure to neither favorable T cell population prior to CAR-T manufacturing could
recombinant interferon alpha (IFN a) nor interferon gamma enhance CAR-T activity. Suppressive T cell populations may
(IFN g) in vitro significantly altered CXCR3 expression on pri- also contribute to poor CAR-T activity, as evidenced by elevation
mary human monocytes from three healthy donors or the of Helios protein expression in post-treatment time points, sug-
THP-1 monocyte cell line, suggesting multiple CXCR3 ligands gesting regulatory T cells contributing to poor CAR-T function-
beyond IFNs may be at play in the in vivo tumor microenviron- ality, in line with recent identification of these populations in
ment setting (Figure S6D). Further, we established a stable CD19 CAR-T-treated patients.34,35 Finally, our patients demon-
CXCR3-expressing THP-1 (CXCR3+ THP-1) cell line by viral strated exhaustion signatures that may explain the inability of
transduction (Figure S6E) and co-cultured these CXCR3+ CAR-Ts to persist. This observation was present across all pa-
THP-1 cells or untransduced THP-1 (UTD THP-1) cells with tient product samples with exhaustion significantly increasing
GD2 CAR-Ts in the presence of GD2+ 143B osteosarcoma tu- in the context of manufacturing and may help explain lack of effi-
mor cells. UTD THP-1 cells cultured with GD2 CAR-Ts and cacy observed. These patient findings confirm previous preclini-
143B tumor cells reduced IFNg production by GD2 CAR-Ts, cal models of GD2 CAR-Ts showing tonic signaling and exhaus-
while co-culture with CXCR3+ THP-1 cells maintained IFN g tion as a limitation of CAR-T activity,19 and highlight the potential
production (Figure S6F). These data suggest CXCR3 expres- benefit of incorporating approaches to reduce tonic signaling and
sion on monocytes can impact CAR-T function, underscoring exhaustion, such as with use of dasatinib in preclinical models55
an area of great interest and continued investigation. and in new GD2 CAR-T clinical trials22 (NCT04539366 and
(C) Violin plots of marker expression levels in each cell cluster from the T cell Phenotype CyTOF Panel (n = 10 patients).
(D) Difference in proportion of cells in cluster 1 and cluster 4 in good versus poor expanders. Boxplot represents all patients (dots) with median (line) and range
(whiskers). Statistical calculations by generalized linear mixed model. p values calculated as FDR-adjusted p values (n = 10 patients).
(E) CyTOF manual gating characterization of memory CD8 and CD4 T cell populations based on CD45RA and CCR7 (n = 10 patients).
(F) Selected C7 pathways significantly enriched in the transcriptome of good versus poor expanders (n = 10 patients). Statistical analysis calculated by Wilcoxon
rank-sum test.
(G) Principal component analysis (PCA) plot of patient samples analyzed by ATAC-seq colored by expansion (blue = good; orange = poor) (n = 11 patients).
(H) Volcano plot of CAR-T products demonstrate 60 chromatin features up higher in accessibility in good or poor based on FDR-adjusted p value % 0.05 and
log2FC > 2 (n = 11 patients).
(I) Open transcription factor motifs identified by combination of log(qvalue) and odds ratio (n = 11 patients). Also see Figures S3 and S4.

ll
Article
Figure 4. Apheresis myeloid cells and myeloid cell activation programs are associated with poor CAR-T expansion
(A) UMAP clusters and boxplots of immune cell populations in apheresis from the Myeloid CyTOF Panel. Boxplot represents all patients (dots) with median (line)
and range (whiskers). Statistical calculations by generalized linear mixed model. p values calculated as FDR-adjusted p values (n = 8).
(B) Stacked bar plots of CIBERSORT data from RNA-seq analysis delimitating predicted immune cell composition in apheresis (n = 10 patients).
(C) Enriched gene signatures stratified by CAR-T expansion. Boxplot represents all patients (dots) with median (line) and range (whiskers). Statistical calculations
by FDR-adjusted p value (n = 10 patients).
ll
Article
NCT04196413). Identifying these T cell phenotypes that correlate brain tumors. The main limitation of this pediatric solid tumor trial
with CAR-T expansions provides an opportunity to understand is the small study size, which is a function of the relatively small
the mechanisms of CAR-T failure and craft approaches to total number of eligible patients with osteosarcoma or neuro-
improve CAR-T activity. blastoma with metastatic or relapsed refractory disease,60,61 a
While most CAR-T studies have focused exclusively on T cell reflection of the log-fold lower scale of pediatric oncology to
populations, our study extensively evaluates myeloid cell adult oncology. The patients represented in this study are
subsets as they relate to CAR-T expansion. Our transcriptomic consistent with the majority of patients in pediatric and adult
analysis identified elevated MDSC signatures in the apheresis relapsed, refractory solid tumor Phase I studies, where patients
of patients who went on to experience poor CAR-T expansion, tend to be diverse in tumor type, disease burden, and baseline
a population that, when targeted, can improve CAR-T activity progression rate. We have developed a disease burden assess-
in solid tumor mouse models.56 Further, GSEA points to an ment score (Table 2), and this score trended with our AI-gener-
inflammatory activation of monocyte populations in poor ex- ated disease burden quantification (Table 3), which provides a
panders, with enrichment of lymphocytes over myeloid cell pro- mechanism for comparing heterogeneous early phase clinical
grams in good expanders. Using high-dimensional proteomic trial patients in this and future work. In light of the limitations of
profiling of myeloid populations, we identified that classical small study size and diversity in disease burden, the statistical
monocytes were significantly elevated in the pre-treatment significance of our key findings underscores their biological
apheresis of patients with poor CAR-T expansion, while non- importance and provides a starting point and motivation for vali-
classical monocytes were significantly increased in good ex- dation in subsequent studies.
panders. The contribution of monocyte subsets in cancer pro- The comprehensive correlative analyses that we performed
gression has not been well defined to date. A key finding of our can serve as a roadmap for cell therapy clinical trial correlative
work is the identification of CXCR3 expression on monocytes studies. Understanding the T and myeloid cell molecular drivers
at baseline as the most important feature associated with good of CAR-T expansion in solid tumor patients will aid in the identi-
CAR-T cell expansion. This CXCR3+ monocyte population was fication of modifiable pathways to improve CAR-T efficacy for
reduced post CAR-T therapy in parallel with loss of CAR-T patients and opens the door for the addition of myeloid-based
persistence, suggesting that the myeloid program has marked interventions.
plasticity and can modulate changes in T cell activation states
and other inflammatory cues. Our findings were validated in STAR+METHODS
TARGET-OS patient data, where high CXCR3 expression was
associated with a survival benefit in osteosarcoma patients as Detailed methods are provided in the online version of this paper
well as other malignancies. CXCR3 has been extensively studied and include the following:
on T cells, but its function on myeloid populations is yet to be fully
explored, with contradictory evidence reported in the literature of d KEY RESOURCES TABLE
both pro-tumorigenic and antitumor functions.57–59 Preliminary d RESOURCE AVAILABILITY
mechanistic in vitro studies suggest that CXCR3 expression on B Lead contact
monocytes can maintain CAR-T functionality, but CAR-T IFN g B Materials availability
production is reduced by monocytes not expressing CXCR3. B Data and code availability
Further work is needed to understand the CXCR3 signaling d EXPERIMENTAL MODEL AND STUDY PARTICIPANT
pathway in myeloid cells and its modulation in the CAR-T immu- DETAILS
notherapy setting. The results of our study demonstrate that the B Trial design
peripheral immune environment, in particular, the myeloid milieu d METHOD DETAILS
prior to CAR-T administration, may effectively predict and modu- B CAR-T Cell manufacturing
late CAR-T expansion in patients. Further, patients with poor B Cytokine assay
CAR-T expansion had significantly elevated absolute monocyte B qPCR assay
counts in circulation following CAR-T administration, indicating B Mass cytometry, cytometry by time of flight (CyTOF),
that monocytes are expanding in response to treatment and assay and analysis
may be a central factor limiting CAR-T persistence. When B RNA-sequencing assay and analysis
expanded to brain tumor immunotherapy, myeloid populations B ATAC-seq assay and analysis
appear to similarly dictate CAR-T expansion, cytokine kinetics, B Primary monocyte assays
and activity.22 These findings deepen our biological understand- B Cell lines
ing of myeloid population kinetics and contributions to immuno- B Co-culture assays
therapy outcomes. B Disease burden assessments
As the use of CAR-Ts expands beyond hematologic malig- d QUANTIFICATION AND STATISTICAL ANALYSIS
nancies, it is imperative to perform in depth reverse translational B CyTOF analysis
evaluations to identify mediators of CAR-T efficacy in solid and B RNA-seq analysis
(D) Flow cytometry analysis of Myeloid-Derived Suppressor Cell (MDSC) phenotype in patients’ pre-treatment apheresis samples (n = 9). Statistical analysis
calculated by Mann-Whitney test.
(E) Selected C7 myeloid pathways significantly enriched in poor expanders compared to good expanders (n = 10 patients). Statistical analysis calculated by
Wilcoxon rank-sum test.

ll
Article
Figure 5. Apheresis CXCR3 expression on monocytes is a marker of good CAR-T expansion

(A) UMAP clusters and boxplots (median and range) of myeloid cell subpopulations in apheresis from the Myeloid CyTOF Panel. Boxplot represents all patients (dots)
with median (line) and range (whiskers). Statistical calculations by generalized linear mixed model. p values calculated as FDR-adjusted p values (n = 7 patients).
(B) MDS plots of myeloid cell subpopulations in apheresis labeled by patient and colored by expansion (blue = good expansion; orange = poor expansion) (n = 7
patients).
(C) Density plots showing expression of select markers (blue = good expansion; orange = poor expansion) (n = 7 patients).
(D) Boxplot of importance scores from 30 iterations of random forest analysis depicting the strength of association of markers with CAR-T expansion and
representative CyTOF expression plots. Markers are sorted by average importance scores. Boxplot represents all iterations (dots) with median (line) and range
(whiskers) (n = 7 patients). Also see Figure S5.

ll
Article
Figure 6. Myeloid populations shift in response to CAR-T treatment

(A) Absolute monocyte count in peripheral blood 14 ± 3 days post CAR-T infusion. Boxplot represents all patients (dots) with median (line) and range (whiskers).
Statistical analysis by Mann-Whitney test (n = 13).
(B) Protein levels of GM-CSF and IL-12p70 in the plasma of patients 7–14 days and 25–27 days following CAR-T administration, respectively. Boxplot represents
all patients (dots) with median (line) and range (whiskers). Statistical analysis by Mann-Whitney test (n = 13).
(C) Stacked bar plots of patient samples by cluster from the Myeloid CyTOF Panel (n = 7 patients).
(D) Boxplots of immune cell populations in pre- and post-treatment samples from the Myeloid CyTOF Panel. Boxplot represents all patients (dots) with median
(line) and range (whiskers). Statistical calculations by generalized linear mixed model. p values calculated as FDR-adjusted p values (n = 7 patients).
(E) Boxplot of CXCR3 expression on myeloid cells in pre- and post-treatment samples from the Myeloid CyTOF Panel. Boxplot represents all patients (dots) with
median (line) and range (whiskers). Statistical calculations by linear mixed model. p values calculated as FDR-adjusted p values (n = 7 patients).
(F) CXCR3 expression on myeloid cells in patients hospitalized versus not hospitalized with COVID-19. Boxplot represents all patients (dots) with median (line) and
range (whiskers). Statistical calculations by linear mixed model. p value calculated as FDR-adjusted p value (p = 0.117; n = 27 patients).
(G) Overall survival of patients in TARGET-OS dataset stratified by expression level of CXCR3. Statistical analysis on group survival differences was performed
utilizing the log rank test. Also see Supplemental Figure S5 and S6.

ll
Article
B Expression analysis on publicly available datasets C.C.H., S.R., and R.N.K. performed the experiments and analyzed the data.
B ATAC-seq analysis S.K., T.M., A.A., C.F.C., C.D., W.R., N.A.G., R.B., C.J.W., F.M., J.A., Y.L.,
d ADDITIONAL RESOURCES A.J., V.D., H.A., C.O., E.S., J.K.-S., J.E.S., E.D., S.A.M., B.S., S.B., H.M.,
S.L.H., M.M., C.C.H., C.L.M., S.R., and R.N.K. wrote or edited the manuscript.
SUPPLEMENTAL INFORMATION
DECLARATION OF INTERESTS
Supplemental information can be found online at https://doi.org/10.1016/j.
ccell.2023.11.011. C.J.W. receives research funding from Pharmacyclics and hold equity in
BioNTech, Inc. F.M. is a cofounder of and has equity in Harbinger Health,
has equity in Zephyr AI, and serves as a consultant for Harbinger Health,
ACKNOWLEDGMENTS
Zephyr AI, and Red Cell Partners and Exscientia. F.M. declares that none of
these relationships are directly or indirectly related to the content of this manu-
We are grateful to the study participants and their families, referring medical
script. E.S. consults for and holds equity in Lyell Immunopharma and consults
care teams, the faculty and staff of the NIH, and the data managers involved
for Lepton Pharmaceuticals and Galaria. M.S.M. is currently employed at Nor-
with this work. The clinical trial was supported in part by the Intramural
munity and holds stock in AstraZeneca; her contributions to this work were
Research Program, the National Cancer Institute, NIH Clinical Center, and
made prior to these industry positions which are not relevant to the content
the National Institutes of Health (NIH NCI ZIABC011332-06 and NIH NCI
of this manuscript. C.L.M. is an inventor on numerous patents and patents
ZIABC011334-10 to R.N.K.). Scientific and financial support for the Cancer Im-
pending related to CAR-T cell therapies. C.L.M. holds equity in and receives
mune Monitoring and Analysis Centers - Cancer Immunologic Data Commons
research funding from Lyell Immunopharma and holds equity in and consults
(CIMAC-CIDC) Network are provided through the National Cancer Institute
for CARGO Therapeutics and Link Cell Therapies. C.L.M. consults for Im-
(NCI) Cooperative Agreements: U24CA224331 (to the Dana-Farber Cancer
matics, Mammoth, Ensoma, and Red Tree Venture Capital.
Institute CIMAC), U24CA224309 (to the Stanford University CIMAC), and
U24CA224316 (to the CIDC at Dana-Farber Cancer Institute). The myeloid an-
alyses presented in this study were supported in part by NCI U01 CA224766 (to INCLUSION AND DIVERSITY
C.C.H., R.N.K., and D.S.) and NCI R01 CA202987 (to C.C.H.). C.F.C. was sup-
ported by the NIH Oxford-Cambridge Scholars Program and the Center for We support inclusive, diverse, and equitable conduct of research. One or more
Cancer Research Center for Cell-based Therapy Cancer Moonshot Initiative. of the authors of this paper self-identifies as an underrepresented ethnic mi-
Scientific and financial support for the Partnership for Accelerating Cancer nority in their field of research or within their geographical location. One or
Therapies (PACT) public-private partnership (PPP) are made possible through more of the authors of this paper self-identifies as a gender minority in their
funding support provided to the FNIH by AbbVie, Amgen, Boehringer-Ingel- field of research. One or more of the authors of this paper received support
heim Pharma GmbH & Co. KG, Bristol-Myers Squibb, Celgene Corporation, from a program designed to increase minority representation in their field of
Genentech, Gilead, GlaxoSmithKline plc, Janssen Pharmaceutical Companies research. One or more of the authors of this paper self-identifies as a member
of Johnson & Johnson, Novartis Institutes for Biomedical Research, Pfizer, and of the LGBTQIA+ community.
Sanofi. T.M. received support from the Stanford Medical Scientist Training
Program grant T32GM007365, the NCI under Award Number F30CA271797, Received: January 10, 2023
the Stanford Interdisciplinary Graduate Fellowship, and the Stanford Revised: September 18, 2023
ChEM-H Chemistry/Biology Interface Predoctoral Training Program and the Accepted: November 22, 2023
Stanford ChEM-H O’Leary-Thiry Graduate Fellowship. We also thank Sam Published: December 21, 2023
Pollock, Hayley Lyon, Srin Ranasinghe, project managers of the Broad Insti-
tute genomics platform, and DFCI and the Childhood Cancer Data Initiative REFERENCES
team in the intramural research program, National Cancer Institute. Some of
the computing for this project was performed on the Sherlock cluster. We 1. Louis, D.N., Perry, A., Reifenberger, G., von Deimling, A., Figarella-
would like to thank Stanford University and the Stanford Research Computing Branger, D., Cavenee, W.K., Ohgaki, H., Wiestler, O.D., Kleihues, P.,
Center for providing computational resources and support that contributed to and Ellison, D.W. (2016). The 2016 World Health Organization
these research results. Graphical abstract and schematics in figures were Classification of Tumors of the Central Nervous System: a summary.
created with BioRender.com. Acta Neuropathol. 131, 803–820.
2. Perkins, S.M., Shinohara, E.T., DeWees, T., and Frangoul, H. (2014).
AUTHOR CONTRIBUTIONS
Outcome for children with metastatic solid tumors over the last four de-
S.R. and R.N.K. conceived the project. C.L.M. and R.N.K. were the principal cades. PLoS One 9, e100396.
investigators of the trial. S.R., R.N.K., and C.C.H. designed the correlative 3. Ceschel, S., Casotto, V., Valsecchi, M.G., Tamaro, P., Jankovic, M.,
studies. S.K., T.M., A.A., C.C.H., S.R., and R.N.K. generated, edited, and over- Hanau, G., Fossati, F., Pillon, M., Rondelli, R., Sandri, A., et al. (2006).
saw all the figures. D.B., A.C., J.D., M.M., J.G., C.L.M., and R.N.K. designed, Survival after relapse in children with solid tumors: a follow-up study
performed, analyzed all patient clinical and radiographic data, and supervised from the Italian off-therapy registry. Pediatr. Blood Cancer 47, 560–566.
clinical trial. T.M., C.D., P.B.S., B.S., S.B., H.M., C.L.M., S.R., and R.N.K. per-
4. Meyers, P.A., Schwartz, C.L., Krailo, M.D., Healey, J.H., Bernstein, M.L.,
formed and analyzed all the T cell CyTOF studies. S.K., A.A., C.F.C., N.A.G.,
Betcher, D., Ferguson, W.S., Gebhardt, M.C., Goorin, A.M., Harris, M.,
C.C.H., S.R., and R.N.K. performed and analyzed all the myeloid cell CyTOF
et al. (2008). Osteosarcoma: the addition of muramyl tripeptide to chemo-
studies. S.K., T.M., A.A., C.F.C., J.A., Y.L., A.J., V.D., H.A., C.C.H., S.R., and
therapy improves overall survival–a report from the Children’s Oncology
R.N.K. designed, performed, and analyzed the RNA-seq-related studies.
Group. J. Clin. Oncol. 26, 633–638.
T.M. and A.A. conducted random forest AI analyses. S.K., C.F.C., and C.O.
generated the CXCR3+ THP-1 cell line. S.A.H. and T.B. performed the quanti- 5. Cooney, T., Lane, A., Bartels, U., Bouffet, E., Goldman, S., Leary, S.E.S.,
tative AI-assisted total lesion glycolysis score. J.K.-S., J.E.S., E.D., and R.N.K. Foreman, N.K., Packer, R.J., Broniscer, A., Minturn, J.E., et al. (2017).
developed the tumor burden assessment score and analyzed the patient clin- Contemporary survival endpoints: an International Diffuse Intrinsic
ical and radiographic data to score each patient. T.M., W.R., R.B., E.S., B.S., Pontine Glioma Registry study. Neuro Oncol. 19, 1279–1280.
C.L.M., and S.R. performed and analyzed all the ATAC sequencing. M.P., S.B., 6. Fisher, P.G., Breiter, S.N., Carson, B.S., Wharam, M.D., Williams, J.A.,
H.M., C.L.M., S.R., and R.N.K. secured funding for CyTOF, ATAC-seq, and Weingart, J.D., Foer, D.R., Goldthwaite, P.T., Tihan, T., and Burger, P.C.
RNA-seq assays. S.K., T.M., A.A., C.F.C., C.D., P.B.S., W.R., N.A.G., R.B., (2000). A clinicopathologic reappraisal of brain stem tumor classification.
J.A., Y.L., A.J., V.D., H.A., C.O., H.Z., R.M., J.Y., R.B., S.V.N., J.L., M.P., Identification of pilocystic astrocytoma and fibrillary astrocytoma as
E.S., J.K.-S., J.E.S., E.D., S.A.H., B.T., B.S., S.B., H.M., S.L.H., F.N.G., distinct entities. Cancer 89, 1569–1576.

ll
Article
7. Chou, A.J., Merola, P.R., Wexler, L.H., Gorlick, R.G., Vyas, Y.M., Healey, (2022). GD2-CAR T cell therapy for H3K27M-mutated diffuse midline gli-
J.H., LaQuaglia, M.P., Huvos, A.G., and Meyers, P.A. (2005). Treatment omas. Nature 603, 934–941.
of osteosarcoma at first recurrence after contemporary therapy: the 23. Stroncek, D.F., Lee, D.W., Ren, J., Sabatino, M., Highfill, S., Khuu, H.,
Memorial Sloan-Kettering Cancer Center experience. Cancer 104, Shah, N.N., Kaplan, R.N., Fry, T.J., and Mackall, C.L. (2017). Elutriated
2214–2221. lymphocytes for manufacturing chimeric antigen receptor T cells.
8. Yu, A.L., Gilman, A.L., Ozkaynak, M.F., London, W.B., Kreissman, S.G., J. Transl. Med. 15, 59.
Chen, H.X., Smith, M., Anderson, B., Villablanca, J.G., Matthay, K.K., 24. Gyurdieva, A., Zajic, S., Chang, Y.-F., Houseman, E.A., Zhong, S., Kim, J.,
et al. (2010). Anti-GD2 antibody with GM-CSF, interleukin-2, and isotreti- Nathenson, M., Faitg, T., Woessner, M., Turner, D.C., et al. (2022).
noin for neuroblastoma. N. Engl. J. Med. 363, 1324–1334. Biomarker correlates with response to NY-ESO-1 TCR T cells in patients
9. Pule, M.A., Savoldo, B., Myers, G.D., Rossig, C., Russell, H.V., Dotti, G., with synovial sarcoma. Nat. Commun. 13, 5296.
Huls, M.H., Liu, E., Gee, A.P., Mei, Z., et al. (2008). Virus-specific T cells en- 25. Maude, S.L., Frey, N., Shaw, P.A., Aplenc, R., Barrett, D.M., Bunin, N.J.,
gineered to coexpress tumor-specific receptors: persistence and antitumor Chew, A., Gonzalez, V.E., Zheng, Z., Lacey, S.F., et al. (2014). Chimeric an-
activity in individuals with neuroblastoma. Nat. Med. 14, 1264–1270. tigen receptor T cells for sustained remissions in leukemia. N. Engl. J. Med.
10. Louis, C.U., Savoldo, B., Dotti, G., Pule, M., Yvon, E., Myers, G.D., Rossig, 371, 1507–1517.
C., Russell, H.V., Diouf, O., Liu, E., et al. (2011). Antitumor activity and long-
26. Fry, T.J., Shah, N.N., Orentas, R.J., Stetler-Stevenson, M., Yuan, C.M.,
term fate of chimeric antigen receptor-positive T cells in patients with neu-
Ramakrishna, S., Wolters, P., Martin, S., Delbrook, C., Yates, B., et al.
roblastoma. Blood 118, 6050–6056.
(2018). CD22-targeted CAR T cells induce remission in B-ALL that is naive
11. Heczey, A., Louis, C.U., Savoldo, B., Dakhova, O., Durett, A., Grilley, B., or resistant to CD19-targeted CAR immunotherapy. Nat. Med. 24, 20–28.
Liu, H., Wu, M.F., Mei, Z., Gee, A., et al. (2017). CAR T Cells https://www.nature.com/articles/nm.4441#supplementary-information.
Administered in Combination with Lymphodepletion and PD-1 Inhibition
27. Lee, D.W., Kochenderfer, J.N., Stetler-Stevenson, M., Cui, Y.K., Delbrook,
to Patients with Neuroblastoma. Mol. Ther. 25, 2214–2224.
C., Feldman, S.A., Fry, T.J., Orentas, R., Sabatino, M., Shah, N.N., et al.
12. Del Bufalo, F., De Angelis, B., Caruana, I., Del Baldo, G., De Ioris, M.A., Serra, (2015). T cells expressing CD19 chimeric antigen receptors for acute
A., Mastronuzzi, A., Cefalo, M.G., Pagliara, D., Amicucci, M., et al. (2023). lymphoblastic leukaemia in children and young adults: a phase 1 dose-
GD2-CART01 for Relapsed or Refractory High-Risk Neuroblastoma. escalation trial. Lancet 385, 517–528.
N. Engl. J. Med. 388, 1284–1295.
28. Foster, B., Bagci, U., Mansoor, A., Xu, Z., and Mollura, D.J. (2014). A re-
13. Porter, D.L., Hwang, W.T., Frey, N.V., Lacey, S.F., Shaw, P.A., Loren, view on segmentation of positron emission tomography images.
A.W., Bagg, A., Marcucci, K.T., Shen, A., Gonzalez, V., et al. (2015). Comput. Biol. Med. 50, 76–96.
Chimeric antigen receptor T cells persist and induce sustained remissions
29. Lynn, R.C., Weber, E.W., Sotillo, E., Gennert, D., Xu, P., Good, Z.,
in relapsed refractory chronic lymphocytic leukemia. Sci. Transl. Med. 7,
Anbunathan, H., Lattin, J., Jones, R., Tieu, V., et al. (2019). c-Jun overex-
303ra139.
pression in CAR T cells induces exhaustion resistance. Nature 576,
14. Singh, N., Perazzelli, J., Grupp, S.A., and Barrett, D.M. (2016). Early mem- 293–300.
ory phenotypes drive T cell proliferation in patients with pediatric malig-
30. Canale, F.P., Ramello, M.C., Núñez, N., Araujo Furlan, C.L., Bossio, S.N.,
nancies. Sci. Transl. Med. 8, 320ra3. 320ra323-320ra323.
Gorosito Serrán, M., Tosello Boari, J., Del Castillo, A., Ledesma, M.,
15. Fraietta, J.A., Lacey, S.F., Orlando, E.J., Pruteanu-Malinici, I., Gohil, M.,
Sedlik, C., et al. (2018). CD39 Expression Defines Cell Exhaustion in
Lundh, S., Boesteanu, A.C., Wang, Y., O’Connor, R.S., Hwang, W.T.,
Tumor-Infiltrating CD8(+) T Cells. Cancer Res. 78, 115–128.
et al. (2018). Determinants of response and resistance to CD19 chimeric
antigen receptor (CAR) T cell therapy of chronic lymphocytic leukemia. 31. Gupta, P.K., Godec, J., Wolski, D., Adland, E., Yates, K., Pauken, K.E.,
Nat. Med. 24, 563–571. Cosgrove, C., Ledderose, C., Junger, W.G., Robson, S.C., et al. (2015).
CD39 Expression Identifies Terminally Exhausted CD8+ T Cells. PLoS
16. Das, R.K., Vernau, L., Grupp, S.A., and Barrett, D.M. (2019). Naı̈ve T-cell
Pathog. 11, e1005177.
Deficits at Diagnosis and after Chemotherapy Impair Cell Therapy
Potential in Pediatric Cancers. Cancer Discov. 9, 492–499. 32. Thornton, A.M., Korty, P.E., Tran, D.Q., Wohlfert, E.A., Murray, P.E.,
Belkaid, Y., and Shevach, E.M. (2010). Expression of Helios, an Ikaros
17. Deng, Q., Han, G., Puebla-Osorio, N., Ma, M.C.J., Strati, P., Chasen, B.,
transcription factor family member, differentiates thymic-derived from
Dai, E., Dang, M., Jain, N., Yang, H., et al. (2020). Characteristics of anti-
peripherally induced Foxp3+ T regulatory cells. J. Immunol. 184,
CD19 CAR T cell infusion products associated with efficacy and toxicity
3433–3441.
in patients with large B cell lymphomas. Nat. Med. 26, 1878–1887.
33. Piedra-Quintero, Z.L., Wilson, Z., Nava, P., and Guerau-de-Arellano, M.
18. Finney, O.C., Brakke, H.M., Rawlings-Rhea, S., Hicks, R., Doolittle, D.,
(2020). CD38: An Immunomodulatory Molecule in Inflammation and
Lopez, M., Futrell, R.B., Orentas, R.J., Li, D., Gardner, R.A., and Jensen,
Autoimmunity. Front. Immunol. 11, 597959.
M.C. (2019). CD19 CAR T cell product and disease attributes predict leu-
kemia remission durability. J. Clin. Invest. 129, 2123–2132. 34. Good, Z., Spiegel, J.Y., Sahaf, B., Malipatlolla, M.B., Ehlinger, Z.J., Kurra,
S., Desai, M.H., Reynolds, W.D., Wong Lin, A., Vandris, P., et al. (2022).
19. Long, A.H., Haso, W.M., Shern, J.F., Wanhainen, K.M., Murgai, M.,
Post-infusion CAR TReg cells identify patients resistant to CD19-CAR
Ingaramo, M., Smith, J.P., Walker, A.J., Kohler, M.E., Venkateshwara,
therapy. Nat. Med. 28, 1860–1871.
V.R., et al. (2015). 4-1BB costimulation ameliorates T cell exhaustion
induced by tonic signaling of chimeric antigen receptors. Nat. Med. 21, 35. Haradhvala, N.J., Leick, M.B., Maurer, K., Gohil, S.H., Larson, R.C., Yao,
581–590. N., Gallagher, K.M.E., Katsis, K., Frigault, M.J., Southard, J., et al. (2022).
20. Gargett, T., Yu, W., Dotti, G., Yvon, E.S., Christo, S.N., Hayball, J.D., Distinct cellular dynamics associated with response to CAR-T therapy for
Lewis, I.D., Brenner, M.K., and Brown, M.P. (2016). GD2-specific CAR T refractory B cell lymphoma. Nat. Med. 28, 1848–1859.
Cells Undergo Potent Activation and Deletion Following Antigen 36. Furmanski, A.L., Barbarulo, A., Solanki, A., Lau, C.I., Sahni, H., Saldana,
Encounter but can be Protected From Activation-induced Cell Death by J.I., D’Acquisto, F., and Crompton, T. (2015). The transcriptional activator
PD-1 Blockade. Mol. Ther. 24, 1135–1149. Gli2 modulates T-cell receptor signalling through attenuation of AP-1 and
21. Kaczanowska, S., Beury, D.W., Gopalan, V., Tycko, A.K., Qin, H., NFkB activity. J. Cell Sci. 128, 2085–2095.
Clements, M.E., Drake, J., Nwanze, C., Murgai, M., Rae, Z., et al. (2021). 37. Korinfskaya, S., Parameswaran, S., Weirauch, M.T., and Barski, A. (2021).
Genetically engineered myeloid cells rebalance the core immune suppres- Runx Transcription Factors in T Cells—What Is Beyond Thymic
sion program in metastasis. Cell 184, 2033–2052.e21. Development? Front. Immunol. 12, 701924.
22. Majzner, R.G., Ramakrishna, S., Yeom, K.W., Patel, S., Chinnasamy, H., 38. Menezes, A.C., Jones, R., Shrestha, A., Nicholson, R., Leckenby, A.,
Schultz, L.M., Richards, R.M., Jiang, L., Barsan, V., Mancusi, R., et al. Azevedo, A., Davies, S., Baker, S., Gilkes, A.F., Darley, R.L., and Tonks,

ll
Article
A. (2022). Increased expression of RUNX3 inhibits normal human myeloid Factors Mediating Long-Term Persistence of CAR T-cell Therapy.
development. Leukemia 36, 1769–1780. Cancer Discov. 11, 2186–2199.
39. Tamura, T., Yanai, H., Savitsky, D., and Taniguchi, T. (2008). The IRF family 55. Weber, E.W., Parker, K.R., Sotillo, E., Lynn, R.C., Anbunathan, H., Lattin,
transcription factors in immunity and oncogenesis. Annu. Rev. Immunol. J., Good, Z., Belk, J.A., Daniel, B., Klysz, D., et al. (2021). Transient rest re-
26, 535–584. stores functionality in exhausted CAR-T cells through epigenetic remodel-
ing. Science 372, eaba1786.
40. Zabuawala, T., Taffany, D.A., Sharma, S.M., Merchant, A., Adair, B.,
Srinivasan, R., Rosol, T.J., Fernandez, S., Huang, K., Leone, G., and 56. Long, A.H., Highfill, S.L., Cui, Y., Smith, J.P., Walker, A.J., Ramakrishna,
Ostrowski, M.C. (2010). An Ets2-Driven Transcriptional Program in S., El-Etriby, R., Galli, S., Tsokos, M.G., Orentas, R.J., and Mackall, C.L.
Tumor-Associated Macrophages Promotes Tumor Metastasis. Cancer (2016). Reduction of MDSCs with All-trans Retinoic Acid Improves CAR
Res. 70, 1323–1333. Therapy Efficacy for Sarcomas. Cancer Immunol. Res. 4, 869–880.
41. Date, D., Das, R., Narla, G., Simon, D.I., Jain, M.K., and Mahabeleshwar, 57. Abron, J.D., Singh, N.P., Murphy, A.E., Mishra, M.K., Price, R.L., Nagarkatti,
G.H. (2014). Kruppel-like Transcription Factor 6 Regulates Inflammatory M., Nagarkatti, P.S., and Singh, U.P. (2018). Differential role of CXCR3 in
Macrophage Polarization. J. Biol. Chem. 289, 10318–10329. inflammation and colorectal cancer. Oncotarget 9, 17928–17936.
58. Butler, K.L., Clancy-Thompson, E., and Mullins, D.W. (2017). CXCR3+
42. Sheng, M., Lin, Y., Xu, D., Tian, Y., Zhan, Y., Li, C., Farmer, D.G., Kupiec-
monocytes/macrophages are required for establishment of pulmonary
Weglinski, J.W., and Ke, B. (2021). CD47-Mediated Hedgehog/SMO/GLI1
metastases. Sci. Rep. 7, 45593.
Signaling Promotes Mesenchymal Stem Cell Immunomodulation in Mouse
Liver Inflammation. Hepatology 74, 1560–1577. 59. Russo, E., Santoni, A., and Bernardini, G. (2020). Tumor inhibition or tumor
promotion? The duplicity of CXCR3 in cancer. J. Leukoc. Biol. 108, 673–685.
43. Mantovani, A., Marchesi, F., Jaillon, S., Garlanda, C., and Allavena, P.
(2021). Tumor-associated myeloid cells: diversity and therapeutic target- 60. Liu, S., Yin, W., Lin, Y., Huang, S., Xue, S., Sun, G., and Wang, C. (2023).
ing. Cell. Mol. Immunol. 18, 566–578. Metastasis pattern and prognosis in children with neuroblastoma. World J.
Surg. Oncol. 21, 130.
44. Mulder, K., Patel, A.A., Kong, W.T., Piot, C., Halitzki, E., Dunsmore, G.,
61. Tian, H., Cao, J., Li, B., Nice, E.C., Mao, H., Zhang, Y., and Huang, C.
Khalilnezhad, S., Irac, S.E., Dubuisson, A., Chevrier, M., et al. (2021).
(2023). Managing the immune microenvironment of osteosarcoma: the
Cross-tissue single-cell landscape of human monocytes and macro-
outlook for osteosarcoma treatment. Bone Res. 11, 11.
phages in health and disease. Immunity 54, 1883–1900.e5.
62. Good, Z., Sarno, J., Jager, A., Samusik, N., Aghaeepour, N., Simonds,
45. Veglia, F., Hashimoto, A., Dweep, H., Sanseviero, E., De Leo, A.,
E.F., White, L., Lacayo, N.J., Fantl, W.J., Fazio, G., et al. (2018). Single-
Tcyganov, E., Kossenkov, A., Mulligan, C., Nam, B., Masters, G., et al.
cell developmental classification of B cell precursor acute lymphoblastic
(2021). Analysis of classical neutrophils and polymorphonuclear
leukemia at diagnosis reveals predictors of relapse. Nat. Med. 24,
myeloid-derived suppressor cells in cancer patients and tumor-bearing
474–483.
mice. J. Exp. Med. 218, e20201803.
63. Sahaf, B., Pichavant, M., Lee, B.H., Duault, C., Thrash, E.M., Davila, M.,
46. Loeuillard, E., Yang, J., Buckarma, E., Wang, J., Liu, Y., Conboy, C., Fernandez, N., Millerchip, K., Bentebibel, S.E., Haymaker, C., et al. (2021).
Pavelko, K.D., Li, Y., O’Brien, D., Wang, C., et al. (2020). Targeting tu- Immune Profiling Mass Cytometry Assay Harmonization: Multicenter
mor-associated macrophages and granulocytic myeloid-derived suppres- Experience from CIMAC-CIDC. Clin. Cancer Res. 27, 5062–5071.
sor cells augments PD-1 blockade in cholangiocarcinoma. J. Clin. Invest.
64. Finck, R., Simonds, E.F., Jager, A., Krishnaswamy, S., Sachs, K., Fantl,
130, 5380–5396.
W., Pe’er, D., Nolan, G.P., and Bendall, S.C. (2013). Normalization of
47. Alicea-Torres, K., Sanseviero, E., Gui, J., Chen, J., Veglia, F., Yu, Q., mass cytometry data with bead standards. Cytometry A. 83, 483–494.
Donthireddy, L., Kossenkov, A., Lin, C., Fu, S., et al. (2021). Immune sup-
65. Lun, A.T.L., Richard, A.C., and Marioni, J.C. (2017). Testing for differential
pressive activity of myeloid-derived suppressor cells in cancer requires
abundance in mass cytometry data. Nat. Methods 14, 707–709.
inactivation of the type I interferon pathway. Nat. Commun. 12, 1717.
66. Nowicka, M., Krieg, C., Crowell, H.L., Weber, L.M., Hartmann, F.J.,
48. Zhang, Y., Chen, H., Mo, H., Hu, X., Gao, R., Zhao, Y., Liu, B., Niu, L., Sun, Guglietta, S., Becher, B., Levesque, M.P., and Robinson, M.D. (2017).
X., Yu, X., et al. (2021). Single-cell analyses reveal key immune cell subsets CyTOF workflow: differential discovery in high-throughput high-dimen-
associated with response to PD-L1 blockade in triple-negative breast can- sional cytometry datasets. F1000Res. 6, 748.
cer. Cancer Cell 39, 1578–1593.e8.
67. Van Gassen, S., Callebaut, B., Van Helden, M.J., Lambrecht, B.N.,
49. Dower, K., Ellis, D.K., Saraf, K., Jelinsky, S.A., and Lin, L.L. (2008). Innate im- Demeester, P., Dhaene, T., and Saeys, Y. (2015). FlowSOM: Using self-
mune responses to TREM-1 activation: overlap, divergence, and positive organizing maps for visualization and interpretation of cytometry data.
and negative cross-talk with bacterial lipopolysaccharide. J. Immunol. Cytometry A. 87, 636–645.
180, 3520–3534. €chler, M., Bolker, B., and Walker, S. (2014). Fitting Linear
68. Bates, D., Ma
50. Bassler, K., Schulte-Schrepping, J., Warnat-Herresthal, S., Aschenbrenner, Mixed-Effects Models using lme4. Preprint at arXiv. https://doi.org/10.
A.C., and Schultze, J.L. (2019). The Myeloid Cell Compartment—Cell by Cell. 48550/arXiv.1406.5823.
Annu. Rev. Immunol. 37, 269–293. €ttner, M., Theis, F.J., Marr, C., and Buettner,
69. Angerer, P., Haghverdi, L., Bu
51. Padgett, L.E., Dinh, H.Q., Chee, S.J., Olingy, C.E., Wu, R., Araujo, D.J., F. (2016). destiny: diffusion maps for large-scale single-cell data in R.
Vijayanand, P., Ottensmeier, C.H., and Hedrick, C.C. (2020). Interplay of Bioinformatics 32, 1241–1243.
Monocytes and T Lymphocytes in COVID-19 Severity. Preprint at 70. Liaw, A., and Wiener, M.C. (2007). Classification and Regression by
bioRxiv. https://doi.org/10.1101/2020.07.17.209304. randomForest.
ka, K., McDade, F., Kamath,
52. Goldman, M.J., Craft, B., Hastie, M., Repec 71. Kuhn, M. (2008). Building Predictive Models in R Using the caret Package.
A., Banerjee, A., Luo, Y., Rogers, D., Brooks, A.N., et al. (2020). J. Stat. Software 28, 1–26.
Visualizing and interpreting cancer genomics data via the Xena platform. 72. Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S.,
Nat. Biotechnol. 38, 675–678. Batut, P., Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast univer-
53. Ramakrishna, S., Barsan, V., and Mackall, C. (2020). Prospects and chal- sal RNA-seq aligner. Bioinformatics 29, 15–21.
lenges for use of CAR T cell therapies in solid tumors. Expet Opin. Biol. 73. Wang, L., Wang, S., and Li, W. (2012). RSeQC: quality control of RNA-seq
Ther. 20, 503–516. experiments. Bioinformatics 28, 2184–2185.
54. Chen, G.M., Chen, C., Das, R.K., Gao, P., Chen, C.H., Bandyopadhyay, S., 74. Patro, R., Duggal, G., Love, M.I., Irizarry, R.A., and Kingsford, C. (2017).
Ding, Y.Y., Uzun, Y., Yu, W., Zhu, Q., et al. (2021). Integrative Bulk and Salmon provides fast and bias-aware quantification of transcript expres-
Single-Cell Profiling of Premanufacture T-cell Populations Reveals sion. Nat. Methods 14, 417–419.

ll
Article
75. Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold 80. Corces, M.R., Trevino, A.E., Hamilton, E.G., Greenside, P.G., Sinnott-
change and dispersion for RNA-seq data with DESeq2. Genome Biol. Armstrong, N.A., Vesuna, S., Satpathy, A.T., Rubin, A.J., Montine, K.S.,
15, 550. Wu, B., et al. (2017). An improved ATAC-seq protocol reduces back-
ground and enables interrogation of frozen tissues. Nat. Methods 14,
76. Yu, G., Wang, L.G., Han, Y., and He, Q.Y. (2012). clusterProfiler: an R
959–962.
package for comparing biological themes among gene clusters. OMICS
16, 284–287. 81. Smith, J.P., Corces, M.R., Xu, J., Reuter, V.P., Chang, H.Y., and Sheffield,
N.C. (2021). PEPATAC: An optimized pipeline for ATAC-seq data analysis
77. Liberzon, A., Birger, C., Thorvaldsdóttir, H., Ghandi, M., Mesirov, J.P., and
with serial alignments. Preprint at bioRxiv. https://doi.org/10.1101/2020.
Tamayo, P. (2015). The Molecular Signatures Database (MSigDB) hallmark
10.21.347054.
gene set collection. Cell Syst. 1, 417–425.
82. Ignatiadis, N., Klaus, B., Zaugg, J.B., and Huber, W. (2016). Data-driven
78. Chen, B., Khodadoust, M.S., Liu, C.L., Newman, A.M., and Alizadeh, A.A. hypothesis weighting increases detection power in genome-scale multiple
(2018). Profiling Tumor Infiltrating Immune Cells with CIBERSORT. testing. Nat. Methods 13, 577–580.
Methods Mol. Biol. 1711, 243–259.
83. Baskar, R., Chen, A.F., Favaro, P., Reynolds, W., Mueller, F., Borges, L.,
79. Sturm, G., Finotello, F., and List, M. (2020). Immunedeconv: An R Package Jiang, S., Park, H.S., Kool, E.T., Greenleaf, W.J., and Bendall, S.C.
for Unified Access to Computational Methods for Estimating Immune Cell (2022). Integrating transcription-factor abundance with chromatin acces-
Fractions from Bulk RNA-Sequencing Data. Methods Mol. Biol. 2120, sibility in human erythroid lineage commitment. Cell Rep. Methods 2,
223–232. 100188.

ll
Article
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Mouse anti-human CD45, clone HI30 BioLegend Cat# 304002; RRID: AB_314390
Mouse anti-human HLA-DR, clone L243 BioLegend Cat# 307602; RRID: AB_314680
Mouse anti-human CD41, clone HIP8 BioLegend Cat# 303702; RRID: AB_314372
Mouse anti-human CD235a, clone HIR2 BioLegend Cat# 306602; RRID: AB_314620
Mouse anti-human CD1c, clone L161 BioLegend Cat# 331502; RRID: AB_1088996
Mouse anti-human CD19, clone HIB19 Standard BioTools Cat # 3142001B; RRID: AB_2651155
Mouse anti-human CD123, clone 6H6 Standard BioTools Cat # 314014B; RRID: AB_2811081
Mouse anti-human CD69, clone F50 Standard BioTools Cat# 3144018B; RRID: AB_2687849
Mouse anti-human CD3, clone OKT3 BioLegend Cat# 317302; RRID: AB_571927
Mouse anti-human CD11c, clone 3.9 Standard BioTools Cat# 3146014B
Mouse anti-human CD182/CXCR2, clone 5E8 Standard BioTools Cat# 3147010B
Mouse anti-human CD274/PDL1, clone 29E.2A3 Standard BioTools Cat# 3148017B
Mouse anti-human CD45RA, clone HI100 BioLegend Cat# 304143; RRID: AB_2562822
Mouse anti-human CD206, clone 15-2 BioLegend Cat# 321102; RRID: AB_571923
Mouse anti-human CD103, clone Ber-ACT8 BioLegend Cat# 3151011B; RRID: AB_2756418
Mouse anti-human CD66b, clone 80H3 Standard BioTools Cat# 3152011B; RRID: AB_2661795
Mouse anti-human CD192/CCR2, clone K036C2 Standard BioTools Cat# 3153023B
Mouse anti-human CD142, clone Ny2 BioLegend Cat# 365202; RRID: AB_2564564
Mouse anti-human CD36, clone 5-271 Standard BioTools Cat# 3155012B; RRID: AB_2756286
Mouse anti-human CXCR3, clone G025H7 Standard BioTools Cat# 3156004B; RRID: AB_2687646
Mouse anti-human CD33, clone WM53 Standard BioTools Cat# 3158001B; RRID: AB_2661799
Mouse anti-human CD357, clone 621 Standard BioTools Cat# 3159020B; RRID: AB_2858232
Mouse anti-human CD14, clone M5E2 Standard BioTools Cat# 3160001B; RRID: AB_2687634
Mouse Ultra-LEAF anti-human CD253 (Trail), clone RIK-2 BioLegend Cat# 308213; RRID: AB_2814154
Mouse anti-human CD273 (PD-L2), clone MIH18 BioLegend Cat# 345502; RRID: AB_1953319
Mouse anti-human CD33, clone WM53 Standard BioTools Cat# 3163023B; RRID: AB_2687857
Mouse anti-human CD15/SSEA-1, clone W6D3 Standard BioTools Cat# 3164001B; RRID: AB_2810970
Mouse anti-human CD16, clone 3G8 Standard BioTools Cat# 3165001B; RRID: AB_2802109
Mouse anti-human CD279 (PD-1), clone EH12.2H7 BioLegend Cat# 329902; RRID: AB_940488
Mouse anti-human CD197/CCR7, clone G043H7 Standard BioTools Cat# 3167009A; RRID: AB_2858236
Mouse anti-human Lymphotoxin beta Receptor, BioLegend Cat# 322002; RRID: AB_2139071
clone 31G4D8
Mouse anti-human Slan (M-DC8), clone DD-1 Miltenyi Biotec Cat# 130-099-128; RRID: AB_2660075
Mouse anti-human CD152/CTLA4, clone 14D3 Standard BioTools Cat# 3170005B; RRID: AB_2858238
Mouse anti-human CD9, clone SN4 C3-3A2 Standard BioTools Cat# 3171009B; RRID: AB_2877094
Mouse anti-human Ki67, clone B56 Standard BioTools Cat# 3172024B; RRID: AB_2858243
Mouse anti-human CD141 (Thrombomodulin), clone M80 BioLegend Cat# 344102; RRID: AB_2201808
Mouse anti-human CD169 (Siglec-1), clone 7-239 BioLegend Cat# 346002; RRID: AB_2189031
Mouse anti-human CD10, clone HI10a BioLegend Cat# 312202; RRID: AB_314913
Mouse anti-human CD56, clone NCAM16.2 Standard BioTools Cat# 3176008B; RRID: AB_2938870
Mouse anti-human CD11b/Mac-1, clone ICRF44 Standard BioTools Cat# 3209003B; RRID: AB_2687654
Mouse anti-human CD45, clone HI30 BioLegend Cat# 304028; RRID: AB_893338
Mouse anti-human CD3, clone UCHT1 BioLegend Cat# 300472; RRID: AB_2687178
Mouse anti-human CD4, clone SK3 BioLegend Cat# 980812; RRID: AB_2820224
(Continued on next page)
e1 Cancer Cell 42, 1–17.e1–e8, January 8, 2024

ll
Article
Continued
Mouse anti-human CD8, clone SK1 BioLegend Cat# 980902; RRID: AB_2616623
Mouse anti-human CD95, clone DX2 BioLegend Cat# 305624; RRID: AB_2561830
Mouse anti-human CD45RA, clone HI100 StemCell Cat# 100-0317
Mouse anti-human CD197 (CCR7), clone 150503 BD Biosciences Cat# 561271; RRID: AB_1056167
Mouse anti-human CD62L (L-selectin), clone DREG-56 BD Biosciences Cat# 562720; RRID: AB_2744441
Mouse anti-human CD25, clone M-A251 BioLegend Cat# 356138; RRID: AB_2632781
Rat anti-mouse/human CD11b, clone M1/70 BioLegend Cat# 101243; RRID: AB_2561373
Mouse anti-human CD33, clone P67.6 BioLegend Cat# 366612; RRID: AB_2566405
Mouse anti-human CD14, clone 63D3 BioLegend Cat# 367140; RRID: AB_2814323
Mouse anti-human CD15 (SSEA-1), clone W6D3 BioLegend Cat# 323008; RRID: AB_756014
Mouse anti-human CD16, clone B73.1 BioLegend Cat# 360710; RRID: AB_2562952
Mouse anti-human HLA-DR, clone L243 BioLegend Cat# 307636; RRID: AB_2561831
Mouse anti-human CD183 (CXCR3), clone G025H7 BioLegend Cat# 353706; RRID: AB_10962912
Mouse anti-human Slan (M-DC8), clone DD-1 Miltenyi Biotec Cat# 130-117-371; RRID: AB_2733608
Mouse anti-human Lineage Cocktail (CD3, CD20, CD19, BioLegend Cat# 363601; RRID: AB_2916117
CD56), clones UCHT1, HIB19, 2H7, 5.1H11
Mouse anti-human CD66b, clone 6/40c BioLegend Cat# 392904; RRID: AB_2750201
Mouse anti-human CD45, clone HI30 Standard BioTools Cat# 3089003B; RRID: AB_2938863
Mouse anti-human CD27, clone O323 BioLegend Cat# 302839; RRID: AB_2562817
Mouse anti-human CD57, clone HCD57 BioLegend Cat# 322325; RRID: AB_2563757
Mouse anti-human CD11b/Mac-1, clone ICRF44 Standard BioTools Cat# 3144001B; RRID: AB_2714152
Mouse anti-human CD4, clone RPA-T4 Standard BioTools Cat# 3145001B; RRID: AB_2661789
Mouse anti-human CD8, clone RPA-T8 Standard BioTools Cat# 3146001B; RRID: AB_2687641
Mouse anti-human CD28, clone CD28.2 BioLegend Cat# 302937; RRID: AB_2563737
Mouse anti-human CD274/PD-L1, clone 29E.2A3 Standard BioTools Cat# 3175017B; RRID: AB_2687638
Mouse anti-human CD45RO, clone UCHL1 Standard BioTools Cat# 3149001B; RRID: AB_2687851
Mouse anti-human CD134/OX40, clone ACT35 Standard BioTools Cat# 3150023B; RRID: AB_2938869
Mouse anti-human CD244/2B4, clone C1.7 BioLegend Cat# 329502; RRID: AB_1279194
Mouse anti-human CD38, clone HIT2 BioLegend Cat# 303535; RRID: AB_2562819
Mouse anti-human TIGIT, clone MBSA43 Standard BioTools Cat# 3153019B; RRID: AB_2756419
Mouse anti-human PARP, clone QA17A17 BioLegend Cat# 669902; RRID: AB_2814517
Mouse anti-human CD183/CXCR3, clone G025H7 Standard BioTools Cat# 3156004B; RRID: AB_2687646
Mouse anti-human CD137 (4-1BB), clone 4B4-1 Standard BioTools Cat# 3158013B; RRID: AB_2888927
Mouse anti-human CD20, clone 2H7 BioLegend Cat# 302302; RRID: AB_314250)
Mouse anti-human Tbet, clone 4B10 Standard BioTools Cat# 3160010B; RRID: AB_2810251
Mouse anti-human CD152/CTLA-4, clone 14D3 Standard BioTools Cat# 3161004B; RRID: AB_2687649
Mouse anti-human CD25, clone M-A251 Biolegend Cat# 356102; RRID: AB_2561751
Mouse anti-human CD272/BTLA, clone MIH26 Standard BioTools Cat# 3163009B; RRID: AB_2910546
Mouse anti-human CD39, clone A1 BioLegend Cat# 328221; RRID: AB_2563747
Mouse anti-human CD223/LAG-3, clone 874501 Standard BioTools Cat# 3165028B; RRID: AB_2687859
Mouse anti-human CD160, clone BY55 BioLegend Cat# 341202; RRID: AB_2074411
Mouse anti-human CD197/CCR7, clone G043H7 Standard BioTools Cat# 3167009A; RRID: AB_2858236
Mouse anti-human CD127/IL-7Ra, clone A019D5 Standard BioTools Cat# 3168017B; RRID: AB_2756425
Mouse anti-human CD366/Tim-3, clone F38-2E2 Standard BioTools Cat# 3169028B; RRID: AB_2905650
Mouse anti-human CD45RA, clone HI100 Standard BioTools Cat# 3170010B; RRID: AB_2938862
Mouse anti-human Ki-67, clone Ki-67 BioLegend Cat# 350502; RRID: AB_1066238
Cancer Cell 42, 1–17.e1–e8, January 8, 2024 e2

ll
Article
Continued
Mouse anti-human C122/IL-2Rbeta, clone TU27 BioLegend Cat# 339015; RRID: AB_2563712
Mouse anti-human CD95/Fas, clone DX29 BioLegend Cat# 305631; RRID: AB_2563766
Hamster anti-human Helios, clone 22F6 BioLegend Cat# 137202; RRID: AB_1090063
Mouse anti-human Eomes, clone WD1928 Thermo Fisher Scientific Cat# 14-4877-82; RRID: AB_2572882
Mouse anti-human 279/PD-1, clone EH12.2H7 Standard BioTools Cat# 3174020B; RRID: AB_2868402
Mouse anti-human CD16, clone 3G8 Standard BioTools Cat# 3209002B; RRID: AB_2756431
Biological samples
Patient apheresis, peripheral blood and GD2-CAR This paper NCT02107963
product samples from phase I trial
Critical commercial assays
Human Luminex XL Cytokine 45-Plex RND Systems LKTM014
Human IFN-gamma DuoSet ELISA RND Systems DY285B
Deposited data
Bulk RNA-seq This paper dbGaP: phs003455.v1.p1
Bulk ATAC-seq This paper dbGaP: phs003455.v1.p1
Experimental models: Cell lines
Human: THP-1 cells ATCC TIB-202
Human: 143B cells ATCC CRL-8303
Recombinant DNA
iC9-2A-14G2A.CD28.OX40Z vector Heczey et al.11 N/A
CXCR3-A Custom Vector Twist Biosciences NCBI Reference Sequence: NM_001504.2
Software and algorithms
ChrAccR Fabian Mueller, https://doi.org/ https://github.com/GreenleafLab/ChrAccR,
10.5281/zenodo.6091218 https://zenodo.org/record/6091218
DESeq2 Love et al.,75 https://bioconductor.org/packages/release/
http://refhub.elsevier.com/ bioc/html/DESeq2.html
S2667-2375(22)00043-1/sref35
SAMtools SAMtools http://samtools.sourceforge.net/
Macs2 Zhang et al., 2008 https://pypi.org/project/MACS2/
http://refhub.elsevier.com/
S1097-2765(21)00753-X/sref43
ChIPseeker Yu et al., 2015 https://bioconductor.org/packages/release/
https://doi.org/10.1093/ bioc/html/ChIPseeker.html
bioinformatics/btv145
ChromVAR Schep et al., 2017 https://bioconductor.org/packages/release/
https://www.nature.com/ bioc/html/chromVAR.html
articles/nmeth.4401
Seurat Stuart et al., 2019 https://github.com/satijalab/seurat/
http://refhub.elsevier.com/
S1097-2765(21)00753-X/sref38
CATALYST Crowell et al., 2023 https://www.bioconductor.org/packages/
https://github.com/HelenaLC/ release/bioc/html/CATALYST.html
CATALYST
SingleCellExperiment Amezquita et al., 2020 https://bioconductor.org/packages/release/
https://www.nature.com/ bioc/html/SingleCellExperiment.html
articles/s41592-019-0654-x
flowCORE Ellis et al., 2023 https://bioconductor.org/packages/release/
bioc/html/flowCore.html
caret Kuhn et al., 2023 https://cran.r-project.org/web/packages/
https://github.com/topepo/ caret/index.html
caret/

ll
Article
Continued
randomForest Liaw et al., 2002 https://cran.r-project.org/web/packages/
https://CRAN.R-project.org/ randomForest/index.html
doc/Rnews/
Bead-based Normalizer Finck et al.,64 https://med.virginia.edu/flow-cytometry-
facility/wp-content/uploads/sites/170/2015/
10/3_Finck-Rachel_CUGM_May2013.pdf
Single-Cell-Debarcoder Fread et., 2017 https://github.com/zunderlab/single-cell-
debarcoder
cydar Lun et al.,65 https://www.bioconductor.org/packages/
release/bioc/html/cydar.html
Lme4 Bates et al., 2015 https://cran.r-project.org/web/packages/
lme4/index.html
Destiny Angerer et al.,69 https://bioconductor.org/packages/release/
bioc/html/destiny.html
RIMA Liu et al., 2022 https://liulab-dfci.github.io/RIMA/
STAR Dobin at al.,72 https://hbctraining.github.io/Intro-to-rnaseq-
hpc-O2/lessons/03_alignment.html
RSeQC Wang et al.,73 https://rseqc.sourceforge.net/
Salmon Patro et al.,74 https://combine-lab.github.io/salmon/
ClusterProfile Wu et al., 2021 https://github.com/YuLab-SMU/clusterProfiler
CIBERSORT Chen et al.,78 https://cibersortx.stanford.edu/
Immunedeconv Sturm et al.,79 https://github.com/omnideconv/immunedeconv
RESOURCE AVAILABILITY
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by lead contact, Rosandra
Kaplan(kaplanrn@mail.nih.gov).
Materials availability
This study did not generate new unique reagents.
Data and code availability

d RNA-seq and ATAC-seq data have been deposited in dbGAP and are available via controlled access as of the date of publi-
cation. Accession numbers are listed in the key resources table.
d This paper does not report any original code.
d Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon
request.
EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS
Trial design
This is a Phase I open labeled, single institution dose escalation trial of GD2 CAR-Ts in children and young adults with GD2+ solid
tumors carried out in the Pediatric Oncology Branch of the National Cancer Institute (NCT02107963). The trial used a 3+3 design
with four dose levels with administration of 1 x 105, 1 x 106, 3 x 106, and 1 x 107 transduced GD2 CAR-Ts/kg. The primary ob-
jectives were to determine the feasibility of producing GD2 CAR-Ts meeting the established release criteria and to assess the
safety of administering escalating doses of GD2 CAR-Ts in children and young adults with neuroblastoma and osteosarcoma
(eligibility criteria in Table S1), following cyclophosphamide-based lymphodepletion (Days -3 to -2: 1800 mg/m2/day over 2 hours
daily for 2 days), as well as determine the recommended Phase II dose and evaluate clinical kinetics of GD2 CAR-Ts. Secondary
objectives included determining if administration of GD2 CAR-Ts mediated antitumor effects, and measuring correlates of CAR-T
activity, including CAR expansion and persistence. The GD2 CAR construct also included an iC9, which could be activated by a
bioinert small molecule dimerizing agent, AP1903, to mediate clearance of GD2 CAR-Ts. Secondary objectives included potential
administering AP1903 for severe CAR-T toxicity and assessing toxicity of AP1903 if administered. Dose escalation decisions were
made based on clinically significant dose-limiting toxicity (DLT) events possibly associated with CAR-T. DLTs were determined

ll
Article
during the first 28-days after CAR-T administration and defined as a treatment-emergent adverse event (TEAE) not reasonably
attributed to the patient’s underlying disease, other medical conditions, or concomitant medications or procedures. The maximum
tolerated dose was defined as the highest dose level at which less than two of six evaluable patients experienced a DLT. Patients
were eligible for enrollment if they had a confirmed diagnosis of osteosarcoma or neuroblastoma, two tumors which have ubiq-
uitous expression of GD2.19 All patients provided written informed consent before study entry. The study was approved by the
relevant institutional review boards and/or independent ethics committees and was conducted according to the International
Conference on Harmonization Good Clinical Practice guidelines and the Declaration of Helsinki. This study is registered with
ClinicalTrials.gov.
METHOD DETAILS
CAR-T Cell manufacturing

Patients underwent apheresis to obtain autologous peripheral blood mononuclear cells (PBMCs). These cells were then
selected using either bead selection or elutriation and ACK lysis, activated using CD3/CD28 beads, transduced with a bicis-
tronic retroviral vector including an iC9 domain and a GD2.CD28.OX40.z CAR (Figure 1A), and then expanded for 7-9 days
with IL-2.23
Cytokine assay
Cryopreserved plasma samples were analyzed for the presence of cytokines in a multiplex format according to the manufacturer’s
instructions (Human Luminex XL Cytokine 45-Plex R&D Systems.
qPCR assay
GD2 CAR-T expansion was measured by qPCR of peripheral blood-isolated PBMCs using TaqMan chemistry on the StepOnePlus
Real-Time PCR System according to the manufacturer’s instructions.
Target Primer/Probe Name Sequence (5’-3’)

CDKN1A Sense primer GAAAGCTGACTGCCCCTATTTG
Antisense primer GAGAGGAAGTGCTGGGAACAAT
Probe CTCCCCAGTCTCTTT
OX40Z Sense primer CGCCCACTCCACCCT
Antisense primer GTTCTGGCCCTGCTGGTA
Probe CAAGATCAGAGTGAAGTTC
Mass cytometry, cytometry by time of flight (CyTOF), assay and analysis

Pre-treatment (apheresis), GD2 CAR-T product, and post-treatment (apheresis or whole blood) samples were analyzed by mass cy-
tometry (CyTOF) with 2 different panels as previously described.62,63
CyTOF assays
Upon thawing, cells were washed twice with RPMI supplemented with penicillin-streptomycin and L-glutamine (Hyclone), 10% FBS
(Hyclone), 20 U/mL of sodium heparin (Millipore Sigma) and benzonase 25 U/mL (Pierce, ThermoFisher). Cell counts were obtained
using a Vi-Cell XR cell viability analyzer (Beckman Coulter), and cells were split to proceed with antibody staining with a range of 1 to 2
million cells per test. Reconstituted lyophilized Veri-Cells tagged with 181Ta (custom order from BioLegend) were added directly to
each sample to a ratio of 1:10.
For the T cell Phenotype Panel, cells were washed twice in PBS (Rockland) and then were stained for live-dead discrimination with
Cell-ID Cisplatin 5 mM (Fluidigm) for 5 min. After 2 washes with the Cell Staining Media (CSM, PBS 1X supplemented with 0.5%
BSA and 0.02% sodium azide), cells were resuspended in 1X Maxpar Fix I Buffer (Fluidigm) and fixed for 10 min at room temper-
ature. Cells were washed twice with Maxpar 10X Barcode Perm Buffer (Fluidigm) and stained for barcoding with the Cell-ID 20-Plex
Pd Barcoding Kit (Fluidigm) for 30 min at room temperature. Then, cells were washed twice with CSM prior to being pooled in a unique
5 mL FACS tube. The composite sample was stained with a surface antibody cocktail containing the Fc receptor-blocking solution
Human TruStain FcX (BioLegend) for 30 min at room temperature. After 2 washes with CSM, cells were fixed in CSM + PFA 2%
(Alfa-Aesar) for 10 min at room temperature and washed again in CSM. Then cells were fixed again with ice-cold methanol for
10 min on ice in the dark. After 2 washes with CSM, we proceeded to intracellular staining (Table S6) for 45 min at room temperature.
Finally, after 2 washes in CSM, cells were stained with the Cell-ID Ir-Intercalator in 1X PBS (Rockland) + PFA 2% overnight at 4 C.
Prior to acquisition on the next day, the sample was washed twice with CSM and 3 times with milli-Q water and resuspended with EQ
Four Element Calibration Beads (Fluidigm) 1:10 in milli-Q water. Data were acquired on a Helios mass cytometer (Fluidigm). A mixture
of unstimulated and PMA/ionomycin stimulated, tantalum-labeled lyophilized PBMCs (Vericells, Biolegend) were added to all sam-
ples as a spike-in control.

ll
Article
For Myeloid Panel, pre-treatment patient samples, post-treatment patient samples, and healthy human PBMC samples were
thawed into RPMI media (Gibco) supplemented with 5% FBS (Omega Scientific). Samples were then washed twice with PBS (Corn-
ing) supplemented with 2% FBS. Cell counts were obtained using a Moxi V cell viability analyzer (Orflo). 10 million cells per sample
were taken into viability staining with Cell-ID Cisplatin 5 mM (Fluidigm) in PBS. Cells were then washed with 1x CyPBS (Rockland)
and blocked with Human Blocking Solution (1x CyPBS, 1mM EDTA, 1% Human AB Serum, 0.1% NaN3 in 1x CyPBS) for 10 min. Cells
were then barcoded using triplet combinations of anti-human CD45 Cadmium metals (Fluidigm) in CyFACS (2mM EDTA, 0.1% BSA,
0.05% NaN3 in 1x CyPBS) for 30 minutes at 4 C. Cells were then washed twice with CyFACS and pooled into one tube. A total of 5
patient samples and 1 healthy PBMC technical control were barcoded and ran together for each CyTOF acquisition. Post-washes,
cells were stained with an established Myeloid Panel in CyFACS for 30 min at 4 C. Cells were washed twice with CyFACS and re-
suspended in 2% PFA (Thermo Scientific) overnight at 4 C. Fixed cells were permeabilized with 1x Permeabilization Buffer
(eBioscience) for 30 minutes at 4 C. Cells were then resuspended in Cell-ID Intercalator 500 mM (Fluidigm) in 1x Permeabilization
Buffer for 30 min at room temperature. Cells were washed once with CyFACS and once with Cell Acquisition Buffer (Fluidigm), re-
suspended in 1:10 EQ Four Element Calibration Beads (Fluidigm) in Cell Acquisition Buffer, and CyTOF acquisitions were run.
RNA-sequencing assay and analysis

cDNA library construction
Total RNA was quantified using the Quant-iT RiboGreen RNA Assay Kit and normalized to 5ng/ul. An aliquot of 200ng for each
sample was transferred into library preparation which was an automated variant of the Illumina TruSeq Stranded mRNA Sample
Preparation Kit. This method preserves the strand orientation of the RNA transcript and uses oligo dT beads to select mRNA from
the total RNA sample. It is followed by heat fragmentation and cDNA synthesis from the RNA template. The resultant 500bp
cDNA then goes through library preparation (end repair, base ‘A’ addition, adapter ligation, and enrichment) using Broad Insti-
tute-designed indexed adapters substituted in for multiplexing. After enrichment, the libraries were quantified with qPCR using
the KAPA Library Quantification Kit for Illumina Sequencing Platforms and then pooled equimolarly. The entire process was per-
formed in a 96-well format and all pipetting was done by either Agilent Bravo or Hamilton Starlet.
Illumina sequencing
Pooled libraries were normalized to 2nM and denatured using 0.1 N NaOH prior to sequencing. Flowcell cluster amplification and
sequencing were performed according to the manufacturer’s protocols using either the HiSeq 2000 or HiSeq 2500 machine. Each
run was performed with 101bp paired-end reads, including an eight-base index barcode. Data were analyzed using the Broad Insti-
tute Picard Pipeline which includes de-multiplexing and data aggregation.
ATAC-seq assay and analysis

ATAC-seq assay
Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) was conducted as previously described80
with minor modifications specified below. Apheresis and Product samples were counted, and 150,000 cells were split into 3 replicates
containing 50,000 cells each. Cells were pre-treated with 200 units/ml Dnase I (Worthington Biochemical, LS006343) in PBS for 30 min
at 37 C. Post-incubation, samples were washed twice with ATAC resuspension buffer (ATAC-RSB; containing 1M Tris-HCl pH 7.5, 5M
NaCl, 1M MgCl2 in sterile water), plus 0.1% Tween-20, with centrifugation at 500g for 5 minutes at 4 C. Cells were then lysed for 3 mi-
nutes on ice with 50 ml cold ATAC-RSB plus 0.1% NP40, 0.1% Tween-20 and 0.01% Digitonin. After lysis, nuclei were washed with 1 ml
ATAC-RSB containing 0.1% Tween-20 and were pelleted at 500g for 10 minutes at 4 C. Nuclei were transposed with Illumina Tn5
transposase (Illumina, 20034198), and reactions were cleaned up with the Qiagen MinElute PCR Purification Kit (Qiagen 28006).
ATAC libraries were PCR amplified with New England Biosystems’ 1X PCR Master Mix (NEB, M0541L) and custom Nextera PCR
primers at 1.25 mM each for 11 or 12 total cycles. Amplified libraries were purified with AMPure XP beads (Beckman Coulter
A63880), and the KAPA library quantification kit (Kapa Biosystems, KK4854) was used to quantify library concentrations. Libraries
were pooled with equimolar concentrations and sequenced by Novogene on a Novaseq S4 with 2x150bp paired-end reads.
Primary monocyte assays

Healthy donor monocytes were isolated from healthy donor apheresis by counterflow elutriation and acquired from the NIH Clinical
Center Department of Transfusion Medicine and cryopreserved. Monocytes were thawed and treated with varying concentrations of
recombinant human IFN a or IFN g and cultured at 37 C/5%CO2 for 24 hours. CXCR3 expression was analyzed by flow cytometry
gated on single, live, CD45+ CD33+ cells.
Cell lines
THP-1 monocyte cells were acquired from ATCC and cultured in ATCC-formulated RPMI-1640 medium with 10% FBS, 100 units/mL
penicillin-streptomycin, and 0.05 mM 2-mercaptoethanol. A CXCR3-overexpressing THP-1 cell line (CXCR3 THP-1) was generated
by lentiviral transduction. Briefly, a plasmid containing human CXCR3-A (GenBank: NM_001504.2) was synthesized (Twist Biosci-
ences) and lentivirus was produced as previously described.21 THP1 cells were centrifuged in the presence of lentivirus and
8 mg/mL polybrene at 931 xg for 2 hours at 30C. Lentivirus was washed off the following day and CXCR3 expression was confirmed
by flow cytometry (Figure S6E). 143B osteosarcoma tumor cells were acquired from ATCC and cultured in RPMI-1640 medium with
10% FBS, 100 units/mL penicillin-streptomycin. GD2-CAR T cells from healthy donors were manufactured as previously described22

ll
Article
by the Biopharmaceutical Development Program, Frederick National Laboratory. GD2-CAR T cells were thawed and cultured over-
night in T cell expansion media (TCEM; AIM-V media supplemented with 5% FBS, 2mM GlutaMAX, 14 mM HEPES) with 100 units/mL
human recombinant IL-2.
Co-culture assays
Parental untransduced THP-1 (UTD THP-1), CXCR3 THP-1, 143B, and GD2CAR- T cells were harvested and resuspended in TCEM.
Cell were cultured at indicated ratios for approximately 24 hours, at which point supernatant was collected and the cells were stained
for flow cytometry. Human interferon gamma was analyzed by ELISA (R&D Systems).
Disease burden assessments

Disease burden score
There is no standard assessment method to describe the overall tumor burden of patients with relapsed or refractory disease. The
tumor burden of patients enrolled on this trial ranged widely between newly relapsed patients with relatively small tumors and those
with advanced, multiply relapsed, and refractory disease. With the goal of better characterizing this heterogeneous group of patients,
we developed a preliminary radiographical disease burden score that considers the size of the largest tumor lesion, the number of
metastatic lesions greater than or equal to one centimeter in size, and the number of sites involved. Our scoring system is included in
Table 2. For the sake of comparison, patients who were assigned a total score less than or equal to 2 were classified as having small
disease burden. In contrast, patients with a score of 3 or above were classified as having large disease burden.
Assay for quantification of metabolically active tumor burden
Standardized Uptake Values (SUVs) were calculated as the ratio of measured activity to injected dose per body weight (kilogram). All
lesions identified by nuclear medicine physicians during standard read-out and reviewed per protocol analysis were considered for
quantitative analysis. Semi-automated analysis was performed using commercial software (MIM, Cleveland, OH, USA). Briefly, a re-
gion-growing technique available within MIM software was utilized starting from seed point using bookmarks provided from clinical
imaging reports. Briefly, region-growing iteratively adds image voxels to the contour if they meet a uniformity criterion and values
derived from existing voxels contained within the contour.28 This algorithm was optimized based on anatomical region by varying
the minimum uptake bound for which contour stops searching (range 1-2 SUV). In any cases of algorithm failure, threshold-based
segmentation from minimum 2 SUV is accepted. For all lesions, SUV metrics were extracted, including: SUVmax, SUVmean, Total
Lesion Glycolysis (TLG), and lesion volume. Additionally, metrics from all lesions were aggregated for patient-level analysis,
including: SUVmax, defined as maximum uptake value of all lesion SUVmax values, TLG, defined as sum of all lesion TLG values,
and volume, defined as the sum of all lesion volumes.
QUANTIFICATION AND STATISTICAL ANALYSIS
CyTOF analysis
For the T cell Phenotype Panel, after CyTOF acquisition, the data collected were normalized using the Nolan Lab normalizer (https://
github.com/nolanlab/bead-normalization/releases). Samples from the T cell Phenotype Panel were deconvoluted with the Zunder
Lab Single Cell Debarcoder (https://github.com/zunderlab/single-cell-debarcoder).
For the Myeloid Panel, during data acquisition, a CD45-barcoding method was used to add healthy PBMCs as a technical control
to the samples. After bead-based normalization using the Normalizer,64 only live and singlet cells were included in the analysis. Data
were batch corrected with a quantile function constructed for the pooled distribution of each batch (a pair of sample and spike-in
control) using the cydar package.65
Analyses of the T cell Phenotype Panel data and the Myeloid Panel data followed the same pipeline. Data were arcsinh transformed
(cofactor=5) and The CATALYST package66 was used to apply the FlowSOM method67 to cluster the cells and project the cells on the
UMAP. Cell types were identified using lineage markers (Tables S6 and S7). Most clusters were present in each patient. The Gener-
alized Linear Mixed Model (GLMM), through the lme4 package,68 was used to identify significant differential cell population abun-
dances. Correlations between cell type frequencies and peak GD2 CAR-T expansion (GD2 CAR copy numbers per 100ng of detected
DNA) and tumor volume were performed using Spearman rank correlation tests. For the myeloid analysis, diffusion map pseudo-time
was performed for trajectory analysis using the destiny package.69 We conducted two separate trajectory analyses to differentiate
between good and poor CAR-T expanders.
In the analyses of both CyTOF panel datasets, a machine learning (ML) strategy was implemented to discover the genes that can
effectively discriminate between different conditions. To accomplish this goal, the importance scores of the genes were determined
by training a random forest (RF) model using the normalized gene expression from the same number of randomly selected cells from
each condition using the Caret and Random Forest R packages.70,71 This procedure was repeated for 30 iterations and the impor-
tance scores of the genes in each iteration were scaled to the 0-100 range for a better comparison. When classifying the groups, a
higher score is regarded as having more classification power.
RNA-seq analysis
Paired-end transcriptome reads were processed with a standardized RNA-seq Immune Analysis pipeline called RIMA (https://liulab-
dfci.github.io/RIMA). RIMA is an automated Snakemake pipeline to streamline the processing of RNA-seq data. Read alignments

ll
Article
were performed with STAR72 against the hg38 reference genome from the NCI Genomic Data Commons (GDC). RNA-seq quality
control was performed on the aligned BAM files using RSeQC.73 With the uniquely mapped reads, transcriptome per million
(TPM) metrics were quantified using SALMON74 on the BAM files. Differentially expressed genes were identified using DESeq2.75
Gene set enrichment was performed using ClusterProfile76 against Hallmark and ImmuneSigDB gene sets from the Molecular Signa-
ture Database (MsigDB).77 Immune infiltration analysis was performed using CIBERSORT absolute78 from the Immunedeconv79 R
package. Gene expression was first normalized by subtracting the average expression across samples, and the gene signature score
was then calculated as the average normalized expression of gene sets. Wilcoxon rank-sum test was then applied to the gene signa-
ture scores.
The Exhaustion Score was derived by analyzing data from a previously described CAR-T model of exhaustion.29 Differential anal-
ysis was performed on RNA-seq data from HA and CD19 CAR T cells cultured at the latest timepoint, when activation markers
normalize (Day 14). Overlapping genes were selected that were differentially expressed (False Discovery Rate (FDR) p-value < 0.05).
These genes defined the Exhaustion Score, comprising 553 genes. The Exhaustion Score was derived as a z-score of the geometric
mean of expression values from this gene signature. The Activation Score was derived as a z-score of the geometric mean of expres-
sion values from the gene signature of T cell activation from the Panther Pathways dataset (Gene Ontology: GO_0042110).
Expression analysis on publicly available datasets

The results published here are in part based upon data generated by the Therapeutically Applicable Research to Generate Effective
Treatments (TARGET) initiative, phs000218, managed by the NCI. The data used for this analysis are available at dbGaP accession
phs000468.v21.p8. Information about TARGET can be found at http://ocg.cancer.gov/programs/target. Survival data and mRNA
expression levels for CXCR3 and its ligands were downloaded from the TARGET Osteosarcoma cohort on the UCSC Xena browser.52
High, middle, and low CXCR3 level groups were divided into similar-sized groups, and the proportional hazards ratio assumption
required for Kaplan-Meier analyses was met and representative of the correct p-value assessment. Kaplan-Meier curves for high,
medium, and low transcript levels were generated for analysis of overall survival of 85 patients for whom data were available. Sta-
tistical analysis on group survival differences was performed utilizing the log-rank test, and log-log plot confirmed that proportional
hazards assumption was met (Figure S6C). Further, Cox proportional hazards model analysis demonstrated that low-level CXCR3
has an HR coefficient of 1.4755 compared to high-level CXCR3 (p=0.011) (Figure S6D).
ATAC-seq analysis
Raw fastq data from Novogene were processed with the pepATAC pipeline with standard parameters.81 Quality control (QC) metrics
such as Transcription Start Site (TSS) scores were calculated based on transcription start sites of protein-coding genes as indicated
in hg38 gencode. Peaks were called using MACS2 with the following parameters on Tn5 insertion sites: –shift, -75, –extsize, 150,
–nomodel, –call-summits, –nolambda’’, -p, 0.01. Downstream analysis with the ChrAccR R package was carried out on the dedupli-
cated bam files and MACS2 peak-called bed files output from pepATAC. The consensus peakset across technical and biological
replicates was calculated using the getPeakSet.snakeATAC function in the ChrAccR R package where peaks had to be consistently
absent or present with a cutoff of 0.75 (75%) across replicates to be retained. The count matrix was calculated as insertion counts
across samples at consensus peakset regions using the ChrAccR region Aggregation function (Figure S4). DESeq275 was used to
calculate differentially accessible peaks and independent hypothesis weighting82 was used to correct for multiple testing. The ggma-
plot package was used to visualize the MA plot. Differentially accessible peaks for samples classified as good or poor expanders
were used to calculate motif enrichment using the getMotifEnrichment function in the ChrAccR R package based on the CIS-BP
TF motif database (from chromVARmotifs package).83 Adjusted p values (q values) were converted to -log(q value) and top enriched
motifs were plotted by -log(q value) and odds ratio.
ADDITIONAL RESOURCES
Clinical trial information: https://clinicaltrials.gov/study/NCT02107963.

Immune determinants of CAR-T cell expansion in solid tumor patients receiving GD2 CAR-T cell therapy (科研通-ablesci.com)

Uploaded by

Copyright:

Available Formats

Immune determinants of CAR-T cell expansion in solid tumor patients receiving GD2 CAR-T cell therapy (科研通-ablesci.com)

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Immune determinants of CAR-T cell expansion in solid tumor patients receiving GD2 CAR-T cell therapy (科研通-ablesci.com)

Uploaded by

Copyright:

Available Formats

Article

Immune determinants of CAR-T cell expansion in

d Multi-omic analyses identify immune contributors to CAR-T

d Good expanders had increased naive T cells and CXCR3+

d Poor expanders had more CXCR3– monocytes at baseline

Kaczanowska et al., 2024, Cancer Cell 42, 1–17

*Correspondence: ramakrs@stanford.edu (S.R.), rosie.kaplan@nih.gov (R.N.K.)

INTRODUCTION neuroblastoma has seen improvement in overall survival for

Table 1. Patient Demographics and Baseline Characteristics

2 Cancer Cell 42, 1–17, January 8, 2024

Figure 1. GD2 CAR-T administration results in varying levels of CAR-T expansion

4 Cancer Cell 42, 1–17, January 8, 2024

Cancer Cell 42, 1–17, January 8, 2024 5

Figure 2. CAR-T product samples display features of T cell exhaustion

(legend continued on next page)

Cancer Cell 42, 1–17, January 8, 2024 7

monocyte populations that shifted from a favorable pre-treat- DISCUSSION

Cancer Cell 42, 1–17, January 8, 2024 9

Cancer Cell 42, 1–17, January 8, 2024 11

Figure 5. Apheresis CXCR3 expression on monocytes is a marker of good CAR-T expansion

12 Cancer Cell 42, 1–17, January 8, 2024

Figure 6. Myeloid populations shift in response to CAR-T treatment

Cancer Cell 42, 1–17, January 8, 2024 13

14 Cancer Cell 42, 1–17, January 8, 2024

Cancer Cell 42, 1–17, January 8, 2024 15

16 Cancer Cell 42, 1–17, January 8, 2024

Cancer Cell 42, 1–17, January 8, 2024 17

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

e1 Cancer Cell 42, 1–17.e1–e8, January 8, 2024

Cancer Cell 42, 1–17.e1–e8, January 8, 2024 e2

e3 Cancer Cell 42, 1–17.e1–e8, January 8, 2024

Data and code availability

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Cancer Cell 42, 1–17.e1–e8, January 8, 2024 e4

CAR-T Cell manufacturing

Target Primer/Probe Name Sequence (5’-3’)

Mass cytometry, cytometry by time of flight (CyTOF), assay and analysis

e5 Cancer Cell 42, 1–17.e1–e8, January 8, 2024

RNA-sequencing assay and analysis

ATAC-seq assay and analysis

Primary monocyte assays

Cancer Cell 42, 1–17.e1–e8, January 8, 2024 e6

Disease burden assessments

QUANTIFICATION AND STATISTICAL ANALYSIS

e7 Cancer Cell 42, 1–17.e1–e8, January 8, 2024

Expression analysis on publicly available datasets

Clinical trial information: https://clinicaltrials.gov/study/NCT02107963.

Cancer Cell 42, 1–17.e1–e8, January 8, 2024 e8

You might also like