Ijms 23 02906 1
Ijms 23 02906 1
Ijms 23 02906 1
Molecular Sciences
Article
Early Effects of Extracellular Vesicles Secreted by Adipose
Tissue Mesenchymal Cells in Renal Ischemia Followed by
Reperfusion: Mechanisms Rely on a Decrease in Mitochondrial
Anion Superoxide Production
Jarlene A. Lopes 1,2,† , Federica Collino 1,3,† , Clara Rodrigues-Ferreira 1,2 , Luzia da Silva Sampaio 1 ,
Glória Costa-Sarmento 1,4 , Camila H. C. Wendt 1 , Fernando P. Almeida 4 , Kildare R. Miranda 1,4,5 ,
Tais H. Kasai-Brunswick 2,4 , Rafael S. Lindoso 1,2,4, * and Adalberto Vieyra 1,2,4,6, *
1 Carlos Chagas Institute of Biophysics, Federal University of Rio de Janeiro, Rio de Janeiro 21941-902, Brazil;
jarlenelopes@biof.ufrj.br (J.A.L.); federica.collino@unimi.it (F.C.); clara_ferreira@biof.ufrj.br (C.R.-F.);
sampaio.lu@biof.ufrj.br (L.d.S.S.); sarmento@biof.ufrj.br (G.C.-S.); camilawendt@biof.ufrj.br (C.H.C.W.);
kmiranda@biof.ufrj.br (K.R.M.)
2 National Center of Science and Technology for Regenerative Medicine/REGENERA,
Federal University of Rio de Janeiro, Rio de Janeiro 21941-902, Brazil; tais@cenabio.ufrj.br
3 Laboratory of Translational Research in Pediatric Nephro-Urology, Department of Clinical Sciences and
Community Health, University of Milan, 20122 Milan, Italy
4 National Center of Structural Biology and Bioimaging/CENABIO, Federal University of Rio de Janeiro,
Citation: Lopes, J.A.; Collino, F.; Rio de Janeiro 21941-902, Brazil; fepealmeida@micro.ufrj.br
5 National Center of Science and Technology for Structural Biology and Bioimaging/INBEB,
Rodrigues-Ferreira, C.;
Federal University of Rio de Janeiro, Rio de Janeiro 21941-902, Brazil
Sampaio, L.d.S.; Costa-Sarmento, G.; 6 Graduate Program in Translational Biomedicine/BIOTRANS, Grande Rio University/UNIGRANRIO,
Wendt, C.H.C.; Almeida, F.P.;
Duque de Caxias 25071-202, Brazil
Miranda, K.R.; Kasai-Brunswick, T.H.; * Correspondence: lindoso@biof.ufrj.br (R.S.L.); avieyra@biof.ufrj.br (A.V.)
Lindoso, R.S.; et al. Early Effects of † These authors contributed equally to this work.
Extracellular Vesicles Secreted by
Adipose Tissue Mesenchymal Cells in
Abstract: Acute kidney injury (AKI) caused by ischemia followed by reperfusion (I/R) is charac-
Renal Ischemia Followed by
terized by intense anion superoxide (O2 •− ) production and oxidative damage. We investigated
Reperfusion: Mechanisms Rely on
whether extracellular vesicles secreted by adipose tissue mesenchymal cells (EVs) administered
a Decrease in Mitochondrial Anion
during reperfusion can suppress the exacerbated mitochondrial O2 •− formation after I/R. We used
Superoxide Production. Int. J. Mol.
Sci. 2022, 23, 2906. https://
Wistar rats subjected to bilateral renal arterial clamping (30 min) followed by 24 h of reperfusion.
doi.org/10.3390/ijms23062906 The animals received EVs (I/R + EVs group) or saline (I/R group) in the kidney subcapsular space.
The third group consisted of false-operated rats (SHAM). Mitochondria were isolated from proxi-
Academic Editor: Won Jong Rhee
mal tubule cells and used immediately. Amplex Red™ was used to measure mitochondrial O2 •−
Received: 1 February 2022 formation and MitoTracker™ Orange to evaluate inner mitochondrial membrane potential (∆ψ).
Accepted: 22 February 2022 In vitro studies were carried out on human renal proximal tubular cells (HK-2) co-cultured or not
Published: 8 March 2022 with EVs under hypoxic conditions. Administration of EVs restored O2 •− formation to SHAM levels
Publisher’s Note: MDPI stays neutral in all mitochondrial functional conditions. The gene expression of catalase and superoxide dismutase-1
with regard to jurisdictional claims in remained unmodified; transcription of heme oxygenase-1 (HO-1) was upregulated. The co-cultures of
published maps and institutional affil- HK-2 cells with EVs revealed an intense decrease in apoptosis. We conclude that the mechanisms by
iations. which EVs favor long-term recovery of renal structures and functions after I/R rely on a decrease
of mitochondrial O2 •− formation with the aid of the upregulated antioxidant HO-1/Nuclear factor
erythroid 2-related factor 2 system, thus opening new vistas for the treatment of AKI.
1. Introduction
Acute kidney injury (AKI) is one of the most severe systemic syndromes in internal
medicine, with significant mortality rates, especially in intensive-care units (ICUs), where
it accounts for more than 15% of the hospitalized patients [1] and 50% of those that are
critically ill [2]. The economic impact is also very high; in the United States, it is esti-
mated that it is greater than 20 billion dollars per year [3]. In the face of the controversy
regarding several non-specific treatments that are offered nowadays and the severity of
the outcomes [4,5], the search for therapeutic alternatives is growing worldwide. In the
last few decades, replacements started focusing on cell therapies to prevent or slow the
progression from AKI to chronic kidney disease (CKD). In the beginning, expectations were
centered on renal resident adult stem cells [6,7], but this hope was almost totally dissipated
when the existence of such cells was challenged [8,9]. Now, the use of progenitor cells is
intensely focused on mesenchymal stromal cells (MSC) and the vesicles they secrete to
the extracellular milieu (EVs). Recently, we demonstrated that EVs secreted by adipose
MSC block the progression of cellular and molecular lesions 3 days after AKI provoked by
ischemia followed by reperfusion (I/R) in rats [10].
The sudden temporary impairment of renal blood flow (ischemia) followed by restora-
tion of circulation (reperfusion) is a central event in AKI of different etiologies [11], and
intense production of anion superoxide (O2 •− ) occurs in the ischemic kidney followed by
reperfusion (I/R) [12]. The exacerbated production of reactive O2 species (ROS)—together
with an important inflammatory component—is a central process in the physiopatho-
genesis of AKI-associated lesions as a consequence of I/R, which initiates a cascade of
molecular events and aberrant signaling that culminates in tubular destruction [13,14],
severe impairment of renal function, and high mortality or frequent progress to CKD and
end-stage renal disease [15]. Increased Bax/Bcl2 ratios and increased lipid peroxidation
are key pathological molecular events resulting from the exacerbated formation of O2 •−
during the I/R-induced AKI [14] because they can lead to mitochondrial damage and
cellular necrosis.
The early moments of AKI onset and the response to treatments are crucial to define
AKI evolution and prognosis [16]. Therefore, knowledge regarding the molecular and
cellular events in these early stages can support the search for appropriate therapies and
their targets, especially the mechanisms altered after the burst and during ongoing ROS
formation. Considering that the effect of EVs secreted by adipose MSC, following subcap-
sular administration at the beginning of reperfusion, prevented or diminished tissular and
functional damage 3 days after I/R [10], the present study aimed to investigate the early
(24 h) EVs-induced molecular processes responsible for the late beneficial outcomes. We
previously demonstrated that EVs stained with the fluorescent probe Vybrant DiD diffuse
and are uniformly distributed in the kidneys 24 h after their injection [10]. We hypothesized
that they could modulate processes linked to preventing oxidative damage before sustained
transcriptional and translational renoprotective effects occur.
Specific objectives of this study were to investigate whether subcapsularly adminis-
tered EVs, i.e., an acellular therapeutic approach, could modulate: (i) renal ROS production
24 h after I/R (bilateral arterial clamping for 30 min followed by 24 h of reperfusion),
(ii) the O2 consumption in different respiratory states to dissect the influence of I/R and
EVs on electron fluxes and ATP synthesis, and (iii) the transcriptional status of injury
molecular markers, antioxidant enzymes, and pro-inflammatory cytokines. Measurements
of plasma levels of the lesional biomarkers’ urea and creatinine aimed to determine the
renal damage status. Finally, we investigated the effect of EVs on apoptosis in vitro and
on electrical potential difference across the inner mitochondrial membrane potential (∆ψ),
using cytometry and cultures of an established lineage of human renal proximal tubule
cells (HK-2) subjected to 24 h of hypoxia.
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 3 of 21
2. Results
2.1.2.Characterization
Results of Extracellular Vesicles Secreted by Adipose Tissue Mesenchymal Stromal
Cells
2.1. Characterization of Extracellular Vesicles Secreted by Adipose Tissue Mesenchymal
Stromal Cells
The mesenchymal stromal cells (MSC) of adipose origin (ADMSC) secreted the EVs
presented Theinmesenchymal
Figure 1A. They stromal cells a(MSC)
constitute of adipose
population origin (ADMSC)
of microvesicles secreted
(diameter abovethe 120EVs
nm)presented in Figure
and exosomes 1A. They
(diameter constitute
ranging 50–120 a population of microvesicles
nm), as demonstrated by the(diameter
transmissionabove
120 nm)
electron and exosomes
microscopy (TEM) (diameter rangingimages.
representative 50–120 The
nm),images
as demonstrated by the transmission
at higher magnification re-
veal a well-delimited membrane that encircles non-homogeneous content. The raw im- re-
electron microscopy (TEM) representative images. The images at higher magnification
veal
ages area presented
well-delimited membrane
in Figure S1A,B.that encircles
In Figure 1B,non-homogeneous content.
the detection of surface EV The raw images
markers [17]
are presented in Figure S1A,B. In Figure 1B, the detection of surface EV
confirms the nature of the vesicles seen in panel A, with enrichment of exosome markers markers [17] con-
suchfirms the nature ofand
as tetraspanins theendosomal-related
vesicles seen in panel A, with
proteins. Inenrichment of exosome
a previous study markers
[10], we demon- such
as tetraspanins
strated the presenceandofendosomal-related
the MSC markers proteins.
CD73, CD90,In a previous
and CD105study
(but[10],
not we demonstrated
CD146) in the
the presence of the MSC markers CD73,
EVs isolated from cultures of ADMSC (see Figure S2). CD90, and CD105 (but not CD146) in the EVs
isolated from cultures of ADMSC (see Figure S2).
Figure
Figure 1. Characterization
1. Characterization of extracellular
of extracellular vesicles
vesicles (EVs)(EVs) secreted
secreted by adipose
by adipose mesenchymal
mesenchymal cells.
cells. (A)
(A) Morphological characterization. Transmission electron microscopy (TEM) at the
Morphological characterization. Transmission electron microscopy (TEM) at the two indicated mag- two indicated
magnifications.
nifications. (B) Characterization
(B) Characterization by usingby using vesicular
vesicular surface antigens.
surface antigens. The immunodetections
The immunodetections show
thatshow
the EVs,
thatwhose images
the EVs, are images
whose presented
areinpresented
(A), are CD9 are CD9+ , CD63
+, CD63+, TSG101
in (A), + ,CD81
+, and + ,indicated.
+, as
TSG101 and CD81+ ,
as indicated.
2.2. Mitochondria Subjected to Hypoxic Damage Are Key Targets for the Extracellular Vesicles
2.2. Mitochondria
Secreted Subjected
by Mesenchymal Cells to Hypoxic Damage Are Key Targets for the Extracellular Vesicles
Secreted by Mesenchymal Cells
Processes that contribute to the maintenance of the electrical potential difference
Processes that contribute to the maintenance of the electrical potential difference across
across the inner mitochondrial membrane (Δψ) are key for the potential recovery of dam-
the inner mitochondrial membrane (∆ψ) are key for the potential recovery of damaged cells
aged cells with high metabolic demand and elevated rates of O2 consumption. This is the
with high metabolic demand and elevated rates of O2 consumption. This is the case for
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW
Int. J. Mol. Sci. 2022, 23, 2906 4 of 20
Figure 2. Evaluation of structural mitochondria damage after AKI and EVs treatment. (A) Trans-
mission electron Figure 2. Evaluation
microscopy images ofofmitochondria
structural mitochondria
from HK-2 cells damage after
in CTR, AKIand
HPX, andHPXEVs+treatment.
EVs (A)
mission electron
conditions, as indicated above the microscopy images of mitochondria
panels. Arrowhead in HPX points from
to HK-2 cellsmyelin
a typical in CTR,figure.
HPX, and HPX
conditions,
(B) Quantification as indicated areas.
of the mitochondrial above theBarspanels. Arrowhead
represent mean ±inSEM HPX(n points
= 34,to37,a typical
30 areas myelin figu
for CTR, HPX, and HPX + EVs groups, respectively). (C) Representative fluorescence images of30 areas fo
Quantification of the mitochondrial areas. Bars represent mean ± SEM (n = 34, 37,
HPX, and HPX + EVs groups, respectively). (C) Representative fluorescence images o
MitoTracker™ Orange (red areas) to evaluate mitochondrial ∆ψ in CTR, HPX, and HPX + EVs.
Tracker™ Orange (red areas) to evaluate mitochondrial Δψ in CTR, HPX, and HPX + EVs.
Nuclei are stained in blue (DAPI). Magnifications are indicated on the left side of the panels. The
are stained in blue (DAPI). Magnifications are indicated on the left side of the panels. The in
insets in the 100×
themagnification picturespictures
100× magnification are presented just below
are presented justthe panels.
below (D) The(D)
the panels. percentage of
The percentage of ev
events in cytometry analysesanalyses
cytometry (normalized to modaltovalue)
(normalized modal at value)
the arbitrary
at the fluorescence intensity units
arbitrary fluorescence intensity uni
indicated on thecated
abscissa. The
on the small colored
abscissa. The smallsquares indicate
colored theindicate
squares experimental conditions:conditions:
the experimental orange, orang
CTR; blue, HPX;blue,
red, HPX;
HPX red,
+ EVs.HPXThe+ EVs. The histograms
histograms of CTR, of CTR,and
HPX, HPX, and HPX+EVs
HPX+EVs overlap.overlap.
(E) The(E) The mit
drialfluorescence
mitochondrial mean mean fluorescence intensities
intensities (MFI) (MFI) of MitoTracker™
of MitoTracker™ Orange Orange were quantified
were quantified from from the
indicated
the groups indicated on theonabscissa.
the abscissa.
ScatterScatter
plots plots represent
represent determinations
determinations in which
in which median median
valuesvalues of f
cence were recorded. In (B,E), differences were assessed using
of fluorescence were recorded. In (B,E), differences were assessed using one-way ANOVA followed one-way ANOVA follow
Tukey’s test. (B,E) *** p < 0.001; ****p < 0.0001; NS: not significant.
by Tukey’s test. (B,E) *** p < 0.001; **** p < 0.0001; NS: not significant.
Int. J. Mol. Sci. 2022, 23, 2906 5 of 20
The bar graph in Figure 2B quantifies the mitochondrial area, showing its decrease in
hypoxia and the recovery of the CTR mean value when the renal cells were subsequently
cultured with EVs.
Figure 2C shows representative images of MitoTracker™ Orange-labeled (at three
different magnifications). The mitochondrial network around the nucleus is dense and
intertwined within HK-2 cells in CTR (a qualitative indication of preserved ∆ψ; on the left)
and rarified in the cells subjected to hypoxia for 24 h (in the middle). When HK-2 cells
previously exposed to 1% O2 for 24 h were subsequently co-cultured with 1% O2 plus EVs
for an equal period of time, the CTR mitochondrial morphology was partially recovered
(on the right). Figure 2D presents the distribution of the number of events normalized to
the modal value, which were recorded in flow-cytometry analysis of HK-2 cells also stained
with MitoTracker™ Orange. Mean fluorescence intensity (MFI), which was also analyzed
by flow cytometry, highlights the complete overlap in the intensity measured in CTR,
HPX, and HPX + EVs conditions, indicating that despite the mitochondrial morphological
alterations, ∆ψ is preserved under the hypoxia assay conditions. Figure 2E (mean ± SEM)
quantifies the values of mitochondrial fluorescence intensities in arbitrary units (AU). These
data suggest that organization and structure of renal mitochondria may be the target of
potential beneficial effects of EVs, in early stages after hypoxic injuries.
Figure 4. Quantification of H2O2 formation (energization with succinate) 24 h after I/R. Assays were
carried out in the different respiratory states indicated on the abscissae. (A) Phosphorylating (1 mM
ADP). (B) Non-phosphorylating (oligomycin). (C) Uncoupled (FCCP). (D) Residual (Antimycin A).
Experimental groups are also indicated on the abscissae. Bars indicate mean ± SEM of the number
of determinations indicated in the legend to Figure 3. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p <
0.0001; NS: not significant (one-way ANOVA followed by Tukey´s test).
An interesting feature was encountered when H+ leak, one of the most important
mechanisms of antioxidant defense in mitochondria [19], was investigated. Proton leak in
mitochondria (i.e., the return of H+ from the interspace to the matrix through pathways
different from the FoF1-ATPsynthase) can be estimated from the difference between the
Figure 4. Quantification of H2 O2 formation (energization with succinate) 24 h after I/R. Assays were
QO
Figure 4. Quantification2 in the presence of oligomycin and the residual QO2 after inhibition of Complex III by
ofout
H2O formation
carried in2the different(energization with
respiratory states succinate)
indicated 24abscissae.
on the h after I/R.
(A)Assays were
Phosphorylating (1 mM
Antimycin
carried out in the different A [20–22]. Figure 5 shows thatabscissae.
H+ leak was similar in the three groups and,
ADP). (B) Non-phosphorylating (oligomycin). (C) Uncoupled (FCCP). (D) ResidualmM
respiratory states indicated on the (A) Phosphorylating (1 (Antimycin A).
therefore, that(oligomycin).
ADP). (B) Non-phosphorylating the ischemic(C) episode followed
Uncoupled by reoxygenation
(FCCP). (D) indicate
Residual did not affect
(Antimycin the path-
Experimental groups are also indicated on the abscissae. Bars mean ± SEM ofA).the number of
Experimental groups ways through which
are also indicated H + flows back to the matrix through pathways different from the
oninthe
determinations indicated theabscissae. Bars indicate
legend to Figure mean
3. * p < 0.05; ** p±<SEM
0.01; of
*** the number
p < 0.001; **** p < 0.0001;
F oF1-ATPsynthase.
of determinations indicated in the legend to Figure 3. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p <
NS: not significant (one-way ANOVA followed by Tukey´s test).
0.0001; NS: not significant (one-way ANOVA followed by Tukey´s test).
An interesting feature was encountered when H+ leak, one of the most important
mechanisms of antioxidant defense in mitochondria [19], was investigated. Proton leak in
mitochondria (i.e., the return of H+ from the interspace to the matrix through pathways
different from the FoF1-ATPsynthase) can be estimated from the difference between the
QO2 in the presence of oligomycin and the residual QO2 after inhibition of Complex III by
Antimycin A [20–22]. Figure 5 shows that H+ leak was similar in the three groups and,
therefore, that the ischemic episode followed by reoxygenation did not affect the path-
ways through which H+ flows back to the matrix through pathways different from the
FoF1-ATPsynthase. Figure 5. Proton leak (QO2 measured in the presence of oligomycin). The reaction medium was
Figure 5. Proton leak (QO2 measured in the presence of oligomycin). The reaction medium was that
that to
used used to determine
determine the production
the production of reactive
of reactive O2 species
O2 species in3,Figure
in Figure without3, without
additionaddition of the
of the compo-
components required for the formation of H O
nents required for the formation of H2O2. The2bars . The bars correspond to mean ± SEM of
2 correspond to mean ± SEM of 6 (SHAM and I/R)6 (SHAM
and I/R) and 5 (I/R + EVs) determinations with different mitochondrial preparations. Groups are
those indicated on the abscissae. Not significant differences (NS) were found among the 3 groups
(one-way ANOVA followed by Tukey´s test).
2.4. Twenty-Four Hours after Ischemia Followed by Reperfusion, the Acute Renal Lesions
Still Persist
To see whether the early normalization of the redox status of renal cortical mito-
chondria was associated with amelioration of the acute lesions provoked by the ischemia
followed by reperfusion, we investigated the expression of two biomarkers of kidney
damage 24 h after the injury. They were Kidney Injury Molecule-1 (KIM-1) and Neutrophil
Figure 5. Proton leak (QO2 measured in the presence of oligomycin). The reaction medium was that
used to determine the production of reactive O2 species in Figure 3, without addition of the compo-
nents required for the formation of H2O2. The bars correspond to mean ± SEM of 6 (SHAM and I/R)
2.4. Twenty-Four Hours after Ischemia Followed by Reperfusion, the Acute Renal Lesions S
Persist
To see whether the early normalization of the redox status of renal cortical mito
dria was associated with amelioration of the acute lesions provoked by the ischem
Int. J. Mol. Sci. 2022, 23, 2906 lowed by reperfusion, we investigated the expression of two biomarkers 8 of 20of kidney
age 24 h after the injury. They were Kidney Injury Molecule-1 (KIM-1) and Neutrophil
nase-Associated Lipocalin (NGAL), which are considered sensitive and specific mark
proximal tubule lesions [23,24]. KIM-1 was barely detectable in SHAM conditions a
Gelatinase-Associated Lipocalin (NGAL), which are considered sensitive and specific markers
creased approximately 20-fold in the renal cortex corticis of I/R rats, a level that rem
of proximal tubule lesions [23,24]. KIM-1 was barely detectable in SHAM conditions and
unmodified in the group I/R + EVs (Figure 6A). As in the case of KIM-1, the express
increased approximately 20-fold in the renal cortex corticis of I/R rats, a level that remained
NGAL was very low in SHAM rats, increasing more than 15-fold after I/R without
unmodified in the group I/R + EVs (Figure 6A). As in the case of KIM-1, the expression of
NGAL was veryencelowof in EVs
SHAM treatment (Figure 6B).
rats, increasing moreThethanpersistent pathological
15-fold after I/R withoutdysfunction
influence of AKI i
firmed by the elevated levels of urea (87.8 ± 2.0 mg/dL vs. 57.8
of EVs treatment (Figure 6B). The persistent pathological dysfunction of AKI is confirmed ± 1.0 mg/dL in SHA
0.0017) and creatinine (0.47 ± 0.01 mg/dL vs. 0.28 mg/dL in SHAM;
by the elevated levels of urea (87.8 ± 2.0 mg/dL vs. 57.8 ± 1.0 mg/dL in SHAM; p = 0.0017) p = 0.0001) in
and creatinine which
(0.47 ±were
0.01 not modified
mg/dL by EVs
vs. 0.28 mg/dLadministration
in SHAM; pin = the 24 hin
0.0001) window
blood, of lesion (100.3
which
mg/dL for urea, NS with respect to I/R, p = 0.0001 vs. SHAM;
were not modified by EVs administration in the 24 h window of lesion (100.3 ± 10.4 mg/dL 0.52 ± 0.05 mg/dL for
for urea, NS with respect to I/R, p = 0.0001 vs. SHAM; 0.52 ± 0.05 mg/dL for creatinine, by Tu
nine, NS with respect to I/R, p < 0.0001 vs. SHAM) (one-way ANOVA, followed
NS with respecttest; n = 5–7).
to I/R, p < 0.0001 vs. SHAM) (one-way ANOVA, followed by Tukey’s test;
n = 5–7).
Figure 6. The expression (relative quantification) of the renal injury biomarkers 24 h after I/R are not
(A) KIM-1.
modified by EVs.Figure 6. The(B) NGAL. The
expression (relative quantification)
expression ofwas
of the genes the renal injury biomarkers
investigated 24 h after I/R
from total RNA
modified
extracted from cortex by EVs.
corticis. The (A)
barsKIM-1. (B) mean
represent NGAL. ± The
SEMexpression of the genes
that were compared wasone-way
using investigated from
ANOVA followed RNAby extracted fromThe
Tukey’s test. cortex corticis. The
experimental bars represent
groups meanon
are indicated ± SEM that were ncompared
the abscissae; =4 usin
way ANOVA followed by Tukey’s test. The experimental groups are indicated
(SHAM), n = 7 (I/R), n = 5 (I/R + EVs), for both biomarkers. **** p < 0.0001; NS: not significant. on the absciss
4 (SHAM), n = 7 (I/R), n = 5 (I/R + EVs), for both biomarkers. **** p < 0.0001; NS: not significa
Since hypoxia and exacerbated ROS formation can trigger and positively feed inflam-
matory processes inSince hypoxia
kidney tubuleand exacerbated
cells and their ROS formation
interstitial can trigger[13],
surroundings and the
positively
next feed in
matory
step was to study processes
the gene in kidney
expression tubule
of two cells and their interstitial
pro-inflammatory cytokines: surroundings
Interleukin-6 [13], th
step and
(IL-6) (Figure 7A) was Tumor
to study the gene
Necrosis expression
Factor-alpha of two(Figure
(TNF-α) pro-inflammatory cytokines: Interle
7B). Both cytokines
were remarkably (IL-6) (Figure 7A)
upregulated and
after Tumor followed
ischemia Necrosis Factor-alpha (TNF-α) (Figure
by 24 h of reperfusion to 700%7B).
andBoth cyto
100% higher levels, respectively, with respect to SHAM values. The effects of the EVs to 700
were remarkably upregulated after ischemia followed by 24 h of reperfusion
administration100%werehigher levels,
different respectively,
for each with
cytokine: IL-6respect to SHAM
dropped by halfvalues.
comparedThe effects
to I/R of the EV
and TNF-α remained unmodified
ministration in I/R +for
were different EVseach
rats,cytokine:
probablyIL-6
duedropped
to different influences
by half compared to I/
of redox environment alterations
TNF-α remained in the release
unmodified in I/Rof these
+ EVs cytokines.
rats, probablyThis
due point will be
to different influences
discussed below.dox environment alterations in the release of these cytokines. This point will be disc
below.
2.5. The Early Anti-Oxidative Responses after EVs Administration Co-Exist with Unmodified
Transcriptional Activation of Key Enzymes Involved in Redox Regulation
It is well known that enzyme-catalyzed antioxidant mechanisms control the balance
between cell death and survival in acute renal lesions [25]. Thus, we investigated the
gene expression: (i) of a master regulator of cellular redox homeostasis and mitochondrial
function [26,27], the heme oxygenase-1 (HO-1), and (ii) of two enzymes that catalyze the
sequential split of H2 O2 to H2 O and O2 after its formation by dismutation of O2 •− : catalase
(CAT) and superoxide dismutase (SOD), respectively. The expression of HO-1 in proximal
tubules increased by 300% after I/R compared to SHAM. The upregulated levels remained
unmodified by EVs injection (Figure 7C), evidence that I/R triggered an antioxidant mech-
anism of defense that could participate in the early restoration of the mitochondrial redox
status presented in Figures 3 and 4, without any influence of the EVs components. The
profile was the opposite for CAT (Figure 7D) and SOD (Figure 7E) transcription, which was
downregulated in I/R again without any EVs effects, indicating that I/R partially inhibited
and superoxide dismutase (SOD), respectively. The expression of HO-1 in proximal tubules
increased by 300% after I/R compared to SHAM. The upregulated levels remained un-
modified by EVs injection (Figure 7C), evidence that I/R triggered an antioxidant mecha-
nism of defense that could participate in the early restoration of the mitochondrial redox
status presented in Figures 3 and 4, without any influence of the EVs components. The
Int. J. Mol. Sci. 2022, 23, 2906
profile was the opposite for CAT (Figure 7D) and SOD (Figure 7E) transcription,9whichof 20
was downregulated in I/R again without any EVs effects, indicating that I/R partially in-
hibited transcriptional processes unable to be restored—in the early phase of the dam-
transcriptional processes
age—by the factors thatunable to be restored—in
the vesicles carry. the early phase of the damage—by the
factors that the vesicles carry.
8A,B,D).
the processThe co-culture
of early cell deathwith(Figure
EVs in 8C,D),
the reoxygenation
but not thatphase
of latesignificantly decreased
apoptosis (Figure 8C,E).the
When the number of total apoptotic cells (early and late stage) (Figure 8F) was considered,
the mean value of the group (HPX + EVs) (6.2%) was statistically similar to those of the
groups CTR (4.0%) and HYX (8.3%).
process of early cell death (Figure 8C,D), but not that of late apoptosis (Figure 8C,E). When
the number of total apoptotic cells (early and late stage) (Figure 8F) was considered, the
mean value of the group (HPX + EVs) (6.2%) was statistically similar to those of the groups
Int. J. Mol. Sci. 2022, 23, 2906 10 of 20
CTR (4.0%) and HYX (8.3%).
Figure 8. Co-culture with EVs decreases apoptosis of a lineage of proximal tubule cells (HK-2 line)
Figure 8. Co-culture
subjected towith EVs Representative
hypoxia. decreases apoptosis
cytometryof aanalysis
lineage of × 105 HK-2
of3proximal tubule
cells cells (HK-2inline)
cultivated 1.5 mL of
subjected DMEM
to hypoxia. Representative
without serum for 24cytometry analysis
h. (A) Cultures in normoxia 5 HK-2 cells
of 3 × 10 (CTR). cultivated
(B) Hypoxia (1%inO1.5
2 ) mL
(HPX)ofin the
DMEM without
absenceserum
of EVs.for(C)24HPX
h. (A) Cultures
in the in of
presence normoxia (CTR).
2 × 109 EVs (B) Hypoxia
(HPX+EVs). Then(1% O2) (HPX)
the cells in the for
were incubated
absence of24EVs. (C) HPX
h under 21% Oin2 inthethe
presence of 2 × 10
same medium.
9 EVs (HPX+EVs). Then the cells were incubated
(D–F) Quantification of cell death is expressed as a percent
for 24 h under
of total21% 2 in the same medium. (D–F) Quantification
cells.O(D) Early apoptosis, corresponding to ANX+ PI− cells. of cell
(E)death is expressed
Late apoptosis, as a
corresponding
percent oftototal cells. (D) Early apoptosis, corresponding to ANX +PI− cells. (E) Late apoptosis, corre-
−
ANX PI cells. (F) Sum of the cells that suffered early and late death: ANX PI cells + ANX+ PI+
+ + +
sponding to ANX+PI+ cells. (F) Sum of the cells that suffered early and late death: ANX+PI− cells +
cells. Bars represent mean ± SEM of different cultures in the conditions CTR (n = 16), HPX (n = 14),
ANX+PI+ cells. Bars represent mean ± SEM of different cultures in the conditions CTR (n = 16), HPX
and HPX+EVs (n = 9). * p < 0.05; ** p < 0.01; *** p < 0.001; NS: not significant (one-way ANOVA
(n = 14), and HPX+EVs (n = 9). * p < 0.05; ** p < 0.01; *** p < 0.001; NS: not significant (one-way
followed by Tukey´s test).
ANOVA followed by Tukey´s test).
3. Discussion
3. DiscussionThe main finding in this study was that subcapsular administration of MSC-derived
The EVs
mainatfinding in this
the moment ofstudy was that
reperfusion subcapsular
after administration
ischemia totally recovers the ofnormal
MSC-derived
ROS forma-
EVs at thetionmoment of reperfusion
by mitochondria afterproximal
from renal ischemiatubule totally recovers
cells the normal
in all functional ROS for-states.
respiratory
mation by Recovery of basal from
mitochondria and controlled production
renal proximal tubule of ROS
cellsisin
required for proper
all functional mitochondrial
respiratory
function, including ATP synthesis and energy delivery for
states. Recovery of basal and controlled production of ROS is required for proper mito- a varied ensemble of cell pro-
chondrial function, including ATP synthesis and energy delivery for a varied ensemblethe
cesses, especially ion transport [28], and this was achieved within 24 h after I/R by of EVs
that diffused from the renal subcapsular region to the entire parenchyma,
cell processes, especially ion transport [28], and this was achieved within 24 h after I/R by as we recently
demonstrated
the EVs that diffused fromby inthe
vivorenal
biofluorescence
subcapsularapproaches
region to the [10].entire parenchyma, as we
We found that electron leak, i.e., the premature transfer of electrons to O2 forming
recently demonstrated by in vivo biofluorescence approaches [10].
O2 •− [29], is the major early mitochondrial molecular event after non-septic AKI caused by
We found that electron leak, i.e., the premature transfer of electrons to O2 forming
I/R. The rate of O2 •− production rose by more than 50% after mitochondrial energization
O2•− [29],by
is the major early mitochondrial molecular event after non-septic AKI caused by
addition of succinate, the respiratory substrate of Complex II (Figures 3 and 4), even
I/R. The rate of O 2•− production rose by more than 50%•after
though this complex per se is not a source of O2 - formation mitochondrial energization
[30,31]. This substrate was
by addition of succinate,
chosen the respiratory
for the following reasons. substrate
First, duringof Complex
ischemia,IIthe (Figures 3 andof4),tubule
destruction even cells
though this complex per se is not a source of O •- formation [30,31]. This substrate was
releases fatty acids that are oxidized, forming FADH2 from FAD at the level of Complex
2
choosing succinate was that O2 •− formation at the level of Complex I resulted from reverse
transfer of electrons from FADH2 [33], thus activating a new site for the mitochondrial
generation of ROS. The importance of the EVs-induced total blockade of the uncontrolled
O2 •− production and tissue damage emerges from the observation that damage of cytosolic
structures is propagated to intact mitochondria, which amplifies the vicious circle of
mitochondrial destruction [34].
Of particular interest is the effect of I/R—and of EVs—when O2 •− formation is assayed
in phosphorylating conditions after the addition of 1 mM ADP (Figure 4A). The production
of O2 •− after I/R decreased to less than 15% when compared with the values obtained in the
presence of succinate alone (Figure 3D), as a consequence of the dissipation of the ∆eleq H+
during the simultaneous ATP synthesis [33,35]. The complete recovery of control rates of
O2 •− production points to the beneficial influence of EVs in maintaining ATP synthesis
and recovering the lower velocity of O2 •− formation, thus avoiding the amplified damage
of I/R through the impairment of ATP synthesis. The similarity between the profiles in
phosphorylating conditions and with FCCP (uncoupled) (Figure 4A,C) supports the view
that dissipation of ∆eleq H+ is the mechanism on which relies the decrease in the overall rate
of O2 •− formation. The 50% increase of O2 •− formation after I/R could be attributed to the
intensification of the pro-oxidant microenvironment and electron leak in the vicinity of the
Fe.S-containing 14 central subunits of Complex I [36], which alternate between successive
cycles of oxidation/reduction during the catalysis of electron transport [37]. Possibly, the
premature transfer of electrons to O2 occurs to a lesser extent in Complex III, conceivably
because it contains fewer Fe.S centers in its dimeric structure [38].
The view of selective oxidative damage of the electron transport system as a critical
early mechanism for mitochondrial dysfunction is reinforced by the observation that O2 •−
production increases by more than 80% in the I/R group in comparison with SHAM when
phosphorylation is blocked by oligomycin (Figure 4B), whereas H+ leak—which is estimated
by the QO2 in this condition and is considered a central antioxidant defense [19,22]—remains
unmodified (Figure 5). Since increased O2 •− enhances H+ leak, thus favoring uncoupling,
and uncoupling decreases O2 •− [39], it may be that the lack of effects of I/R observed in
Figure 5 results from protective feedback mutually involving the two processes.
The modest partial recovery of the rate of O2 •− formation in the group I/R + EVs
when compared to SHAM, as well as the high acceleration caused by I/R when the ETS
is blocked by Antimycin A at the level of Complex III (Figure 4D), are probably due to
the complexity of the pathways for the electron fluxes when this inhibition occurs. When
Complex III is blocked, the electrons flow from succinate toward Complex IV through the
alternative pathway that requires high spatial organization. It involves reverse transfer of
electrons to Complex I [33] that is part of the supercomplex I1 + III2 + IV1 [40–42], followed
by electron tunneling through the mobile pool of coenzyme Q towards Complex IV. It is
likely that under intense pro-oxidant activity and lipid peroxidation, this pool is easily
destructured, favoring electron leak, increasing further O2 •− formation and disrupting
repair mechanisms.
The recovery of the normal mitochondrial redox status by EVs seems to be a very early
process that is not accompanied by an overall improvement of the injuries caused by I/R.
Neither gene expression of KIM-1 nor that of NGAL, two key lesional biomarkers of acute
renal injury, was modified by EVs (Figure 6), thus confirming that intense tubular lesions
persist. Since 72 h after I/R, the expression of the tubular lesional biomarker KIM-1 was
strongly downregulated in rats given EVs [10], and this was accompanied by almost nor-
malization of the high Bax/Bcl2 ratio, an indicator of mitochondrial recovery [43], it may be
proposed that early preservation of a physiological redox mitochondrial microenvironment
during the first 24 h of reperfusion after ischemia helped to avoid elevated lipid peroxida-
tion and, therefore, activation of Bax-related proteins with later apoptosis. In addition, this
ensemble of events occurred in the middle of extensive tubular damage, as demonstrated
by the maintenance of I/R high levels of KIM-1 and NGAL after administration of EVs. In
the case of NGAL, an opposite view deserves consideration. Its upregulated expression
Int. J. Mol. Sci. 2022, 23, 2906 12 of 20
could be viewed as indicative of an antiapoptotic response that can help later recovery, as
proposed for an in vivo endotoxin-induced model of AKI in rats [44].
Tubular damage is accompanied by a persistent inflammatory response, as evidenced
by the elevated levels of the cytokines IL-6 and TNF-α (Figure 7), whose expression in-
creased in several models of AKI [45,46]. The elevated level of pro-inflammatory TNF-α,
which remained unmodified in rats receiving EVs, indicates immune infiltration [47] and is
probably responsible for the only partial decrease of IL-6 levels [48]. The amount remaining
after 24 h could contribute to reducing lipid peroxidation and oxidative damage [49]. Possi-
bly, the partial selective early decrease of the master regulator IL-6 [50] by EVs results from
the release of anti-inflammatory factors contained within the EVs that were demonstrated
in our previous proteomic studies [10].
The decrease in O2 •− promoted by EVs in all respiratory states in the first 24 h was
not due to transcriptional upregulation of the enzymes that, sequentially, catalyze the
formation of H2 O2 from O2 •− (SOD) and its conversion to H2 O and O2 (CAT), because
their levels remain the same as those encountered in I/R (Figure 7D,E). These enzymes
became downregulated as the ROS production increased in I/R [51–53], thus worsening
the prognosis of tubular damage. It may be that the sudden decrease in the pO2 during the
ischemia together with the formation of O2 •− during reperfusion resulted in the shutdown
of transcription promoters [54], as demonstrated for the CAT from normal and tumoral
cells from different origins, together with the destabilization of preexisting mRNA [25].
Of particular relevance is the upregulation of HO-1 by I/R, which was not modified
in I/R that received EVs (Figure 7C). The mRNA levels 24 h after I/R are similar to those
encountered after 72 h [10], when immunohistochemistry analysis revealed small areas
positively stained for HO-1. This correlation may indicate that the upregulation of this
antioxidant gene is an essential part of the early intrinsic response of kidney cells facing
the oxidative stress caused by I/R. This protective response is associated to a previous step
of activation of the Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and translocation to
the nucleus, which is ensured by rapid, numerous, and interacting pathways [55]. Due to
the role of HO-1 in the regulation of processes such as inflammation and apoptosis [27], its
early upregulation without further modification by EVs appears to be located at a crossroad
between apoptosis and survival, collaborating with the rapid EVs-mediated protective
antioxidant mechanisms in mitochondria discussed above. This view is supported by recent
observations demonstrating that administration of anti-ischemic drugs such as meldonium
increases the expression of Nrf2 with simultaneous decrease of lipid peroxidation and of
the Bax/Bcl2 ratios in a model of I/R in rats [14].
The images and the bar graph in Figure 8 revealed that EVs transferred to renal
cells—at least in part—the molecular machinery able to stimulate mechanisms of repair
previously characterized by proteomic studies [10]. It is clear, however, that the overall
benefit of EVs is partial, because the sum of cells in early and late apoptosis that were
cultured with EVs was not different from either the CTR group or the HPX group. The
antioxidant effects evidenced by the decrease in O2 •− formation and upregulation of the
HO-1 transcription, early protective mechanisms of EVs, resulted in in a partial decrease in
apoptosis in renal cells cultured with EVs after they were subjected to extreme anoxia. It is
worth mentioning that the upregulation of these mechanisms is related to cell survival and
proliferation [56,57]. One of the key factors shuttled by EVs secreted by MSC is catalase,
whose inactivation suppresses the beneficial effects of EVs [58]. Its release after diffusion
of EVs into renal parenchyma [10] may be responsible for suppressing the excess of O2 •−
formed during I/R.
ments for Manuscripts Submitted to Biomedical Journals. The animal study is reported in
accordance with ARRIVE guidelines [59].
ROS formation and O2 consumption, the mitochondria of the external portion of the cortex
(cortex corticis) were isolated as previously described [61] with slight modifications. In this
segment of the renal tissue, more than 90% of the cell population corresponds to proximal
tubules [62]. Briefly, the cortical fragments were washed twice using a solution containing
250 mM sucrose, 10 mM HEPES-Tris (pH 7.4), 2 mM Na2 EDTA, and 0.15 mg/mL trypsin
inhibitor (Sigma-Aldrich, St. Louis, MO, USA), which was used in the following steps.
After gentle manual homogenization using a glass Potter-Elvehjem homogenizer (Merck),
the total homogenates were centrifuged at 4 ◦ C. First, at 600× g for 5 min to sediment
intact cells, cell debris, and nuclei, recovering the supernatants that were immediately
centrifuged for 10 min at 12,000× g to obtain mitochondria-enriched sediments. These
sediments were resuspended in 5 mL of the above-described solution and centrifuged
again at 12,000× g to obtain a washed pellet containing mitochondria, finally resuspended
in 300 µL of the above solution and immediately used. For the experiments intended for
mRNA analysis and relative quantitative expression, the whole cortex region was processed
as recently described [10].
4.6. Analysis of Mitochondrial Morphology and Qualitative Evaluation of the Electrical Potential
Difference across the Inner Mitochondrial Membrane from Renal Cells in Co-Culture with
Extracellular Vesicles
HK-2 cells were fixed in 2.5% (v/v) glutaraldehyde with 4% (v/v) formaldehyde in
0.1 M cacodylate buffer (pH 7.2) for 24 h. Following a wash in cacodylate buffer 0.1 M, the
samples were post-fixed in 1% OsO4 (w/v) plus 0.8% (w/v) K4 (CN)6 Fe in 0.1 M cacodylate
buffer for 40 min, dehydrated in acetone series, and embedded in epoxide resin (Embed
812 Resin, EMS, Hatfield, PA, USA). Ultrathin sections (70 nm) were obtained using a Leica
EM UC7 ultramicrotome (Leica, Wetzlar, Germany), collected onto 200 mesh copper grids
Int. J. Mol. Sci. 2022, 23, 2906 15 of 20
(EMS), and stained for 20 min in 5% (w/v) uranyl acetate and 5 min in Reynolds’ lead citrate.
After, the samples were observed on a Tecnai-Spirit electron microscope (FEI Company,
Eindhoven, Netherlands) operating at 120 kV, equipped with a 2k CCD camera (Veleta,
Olympus). Profiles of mitochondria in randomly selected cells were evaluated with ImageJ
software (U.S. National Institutes of Health, Bethesda, MD, USA), and we compared the
average area among the different experimental groups. Due to the polymorphic shape of
the cells, we did not measure the volumetric density.
HK-2 cells were also used to qualitatively investigate the mitochondrial energetic
state—represented by the transmembrane potential ∆ψ—after hypoxia and the influence
of co-culture with EVs, as recently described [59]. HK-2 cells from the three experimental
groups described above were placed in plates of 24 wells, incubated with the fluorophore
MitoTracker™ Orange (Molecular Probes), and assayed as follows for immunofluorescence
visualization. Since the HK-2 cells do not adhere to glass, the coverslips at the bottom of
the plates were washed with 400 µL Attachment Factor Cascade Biologics™ AF (Thermo
Fisher Scientific, Waltham, MA, USA) and immediately dried at 37 ◦ C for 30 min. The cells
(8 × 104 per well, suspended in 500 µL DMEM without serum) were placed onto 13 mm
diameter coverslips deposited at the bottom of the wells, washed twice with PBS, and
supplied with 500 µL of the fluorophore diluted in a modified Krebs solution containing
120 mM NaCl, 4 mM KCl, 1.4 mM MgCl2 , 2.5 mM CaCl2 , 6 mM glucose, and 10 mM HEPES
(pH adjusted to 7.4 with Tris), and incubated for 20 min at 37 ◦ C. Then, the cells were
washed 3 times for 5 min with the same solution and fixed with paraformaldehyde 4% (w/v)
for 15 min at room temperature, sheltered from the light. After removal of the fixative,
the cells were rewashed 3 times for 5 min using the same solution. The coverslips were
carefully removed from the plate with the aid of a small forceps, supplied with 20 µL DAPI
(5 µg/mL in a PBS-glycerol 40% (v/v) solution at pH 7.4 adjusted with Tris). The coverslips
were mounted onto glass slides, sealed with colorless nail polish, and stored at −20 ◦ C for
24 h. The images were collected using AxioVision 4.8.2 software in an ApoTome microscope
(ApoTome Axion Imager.M2, Carl Zeiss Inc., Jena, Germany) at 554 nm (excitation) and
576 nm (emission).
4.8. Oxygen Consumption by Isolated Mitochondria from Kidney Proximal Tubule Cells
We measured oxygen consumption (QO2 ) by isolated mitochondria using a high-
resolution O2 electrode (Oxygraph-2K, OROBOROS Instruments, Innsbruck, Austria) at
37 ◦ C in the solution described above for mitochondrial O2 •− determination, except that
the components required to detect H2 O2 formation were omitted, and 0.06 mg/mL mito-
Int. J. Mol. Sci. 2022, 23, 2906 16 of 20
chondrial protein was used. The QO2 assays were run in parallel with H2 O2 assays. All
mitochondrial preparations were assayed to determine the respiratory control ratio (RCR)
and, therefore, to evaluate the coupling between electron fluxes and ATP synthesis. The
RCR was calculated from the ratio between the QO2 in the presence of 1 mM ADP and the
QO2 after the addition of oligomycin. Despite differences in the absolute values of QO2
(lower in I/R mitochondria), the RCR averaged 3.0 in all groups, with an interassay varia-
tion coefficient of ~10%. The QO2 after successive additions of oligomycin and Antimycin A
was used to estimate the H+ leak from the mitochondrial space back to the matrix [20–22].
4.9. RNA Isolation, Reverse Transcription and Real Time Quantitative Polymerase Chain Reaction
(qRT-PCR)
Small fragments of kidney cortex were suspended in 500 µL of Lysis/binding buffer
(miRNA isolation kit mirVana™, Thermo Fisher Scientific, Waltham, MA, USA) in RNAse-
free microtubes and homogenized using the dissociator TissueLyser LT provided with
a 5 mm diameter bead (Qiagen, Hilden, Germany). After 7 min of intense agitation, 400 µL
of the homogenate was mixed with 40 µL of miRNA homogenate additive (miRNA isolation
kit mirVana™), vigorously vortexed, and then placed on ice for 10 min. The suspensions
were then supplied with the same volume of chloroform, vortexed again at 12,000× g
for 5 min at room temperature, to recover supernatants of 1 mL that were mixed with
100% ethanol (1.25 mL ethanol:1 mL sample), gently homogenized with a micropipette
and centrifuged at 12,000× g for 15 s at room temperature using microtubes supplied with
the filter provided by the kit (miRNA isolation kit mirVana™). After removing the liquid,
the filters were first washed with 700 µL of the miRNA wash solution 1, centrifuged for
15 s at 12,000× g at room temperature, and then washed twice using 500 µL of the miRNA
wash solution 2/3 (both solutions from the kit mentioned above). Finally, the filters were
immersed in 100 µL of RNAse-free H2 O at 95 ◦ C, immediately centrifuged for 30 s at
13,000× g, and the liquids, after removal of the filters, were stored at −80 ◦ C.
The mRNAs were obtained using 10 µL of the High-Capacity cDNA Reverse Tran-
scription kit (Applied Biosystems™, Foster City, CA, USA)—with components freshly
mixed—and 10 µL samples containing 20 ng/µL mRNA. The RNA of these samples was
quantified using the NanoDrop™ ND-1000 (Thermo Fisher Scientific, Waltham, MA, USA),
as recently described [10]. The cDNAs were synthesized in the thermocycler PCR Thermal
Cycler (Applied Biosystems™), with cycles of 10 min at 25 ◦ C, 120 min at 37 ◦ C, 5 min
at 85 ◦ C, and 1 min at 4 ◦ C, before storage at −20 ◦ C. Negative controls without reverse
transcriptase were carried out in parallel with each run.
The reverse transcription followed by the real-time quantitative polymerase chain
reaction was performed in a single step using 10 µL of Power SYBR Green®PCR Master
Mix (Applied Biosystems™) and 10 µL of the cDNA-containing solution and the primers
(0.25 ng/µL and 100 nM, respectively). The sequence-specific oligonucleotides [10] were
from Eurofins Genomics (Ebersberg, Germany) (Table 1). Their amplifications were fol-
lowed using the ViiA™ 7 Real-Time System (Applied Biosystems™) after a stage of 10 min
to reach 95 ◦ C, followed by cycles of 15 min at 95 ◦ C, 60 min at 60 ◦ C, and 15 min at 95 ◦ C.
mRNA Sequence
Int. J. Mol. Sci. 2022, 23, 2906 rSOD1 F1 AAGAGAGGCATGTTGGAGACC17 of 20
rSOD1 R1 ACGGCCAATGATGGAATGCT
rCAT F1 CAGCTCCGCAATCCTACACC
rCAT R1
Table 1. List of the primers used in qRT-PCR analysis. GGACATCGGGTTTCTGAGGG
rIL6 F1 AAGCCAGAGTCATTCAGAGC
mRNA Sequence
rIL6 R1 GTCCTTAGCCACTCCTTCTG
rSOD1 F1 AAGAGAGGCATGTTGGAGACC
rTNFA F1 CTTCTCATTCCTGCTCGTGG
rSOD1 rTNFAR1 R1 ACGGCCAATGATGGAATGCT
TGATCTGAGTGTGAGGGTCTG
rCAT F1 F1
rKIM1 CAGCTCCGCAATCCTACACC
ACCTGATCAGACAGAGTGTGC
rCAT rKIM1
R1 R1 ATCTACAGAGCCTGGAAGAAGCA
GGACATCGGGTTTCTGAGGG
rIL6rHO-1
F1 F1 AGGTGCACATCCGTGCAGAG
AAGCCAGAGTCATTCAGAGC
rHO-1
rIL6 R1 R1 CTTCCAGGGCCGTATAGATATGGTA
GTCCTTAGCCACTCCTTCTG
rNGAL F1 GGGCTGTCCGATGAACTGAA
rTNFA F1 CTTCTCATTCCTGCTCGTGG
rNGAL R1 CATTGGTCGGTGGGAACAGA
rTNFA R1 TGATCTGAGTGTGAGGGTCTG
rGAPDH F1 GCCAAAAGGGTCATCATCTC
rKIM1 F1 ACCTGATCAGACAGAGTGTGC
rGAPDH R1 GGCCATCCACAGTCTTCT
rKIM1 R1 ATCTACAGAGCCTGGAAGAAGCA
4.10. StatisticalrHO-1
Analysis
F1 AGGTGCACATCCGTGCAGAG
The mean values
rHO-1 R1 of the different parameters investigated in the 3 experimental
CTTCCAGGGCCGTATAGATATGGTA
groups of ratsrNGAL
and inF1the 3 HK-2 cells assays were analyzed using one-way ANOVA fol-
GGGCTGTCCGATGAACTGAA
lowed by Tukey’s test. In the case of RQ data, the mean of each SHAM group was taken
rNGAL R1 CATTGGTCGGTGGGAACAGA
as 1.0, and the individual values from the 3 groups were expressed as a fraction or as a
rGAPDH
multiple of this valueF1 GCCAAAAGGGTCATCATCTC
[63–65]. This allowed the SEM of the unitary value of SHAM refer-
ence to be calculated.
rGAPDH R1 GGCCATCCACAGTCTTCT
5.
5.Conclusions
Conclusions
We
We demonstrated
demonstrated thatthat the
the early
early and
and central
central mechanism
mechanismby by which
which EVs
EVs protect
protect renal
renal
structure and function after I/R is the decrease of O2 production to controllevels
structure and function after I/R is the decrease of O 2 •−
•− production to control levelsand,
and,
therefore,
therefore, the
the normalization
normalization of of the
the mitochondrial
mitochondrial redox environment. The
redox environment. The antioxidant
antioxidant
components
componentsof of EVs
EVs are
are central
central inin the
the preservation
preservation mechanisms
mechanismsthat,that,with
withthe
the aid
aid of
of the
the
upregulated
upregulated antioxidant
antioxidant HO-1,
HO-1, depress
depress early
early processes
processes ofof mitochondrial
mitochondrial damage
damage and
and cell
cell
death
death after
after I/R.
I/R.The
Theproposed
proposedmolecular
molecularevents
eventselicited
elicitedbybyEVs
EVsare
aredepicted
depictedin
inFigure
Figure9.9.
Figure 9. Suppressing the excess of O2 •− : Proposed mechanisms for the rapid effects of EVs (24 h
of reperfusion after renal ischemia). Mesenchymal cells (MSCs) secrete EVs that, after subcapsular
administration and diffusion into the renal parenchyma [10], reach the tubular segments injured by
I/R. By releasing several factors, including the catalase they carry [58], they contribute to maintaining
the normal local redox state existing in the absence of injury. With mitochondrial and cytoplasmic
redox homeostasis restored, the mitochondrial processes required for ATP synthesis are preserved
and, therefore, the appropriate ATP supply is preserved for the transport demands and maintenance
of tubular structures.
Int. J. Mol. Sci. 2022, 23, 2906 18 of 20
References
1. Pieretti, J.C.; Junho, C.V.C.; Carneiro-Ramos, M.S.; Seabra, A.B. H2 S- and NO-releasing gasotransmitter platform: A crosstalk
signaling pathway in the treatment of acute kidney injury. Pharmacol. Res. 2020, 161, 105121. [CrossRef]
2. Neyra, J.A.; Leaf, D.E. Risk prediction models for acute kidney injury in critically Ill patients: Opus in progressu. Nephron 2018,
140, 99–104. [CrossRef] [PubMed]
3. Silver, S.A.; Chertow, G.M. The economic consequences of acute kidney injury. Nephron 2017, 137, 297–301. [CrossRef] [PubMed]
4. Wang, A.Y.; Bellomo, R. Renal replacement therapy in the ICU: Intermittent hemodialysis, sustained low-efficiency dialysis or
continuous renal replacement therapy? Curr. Opin. Crit. Care 2018, 24, 437–442. [CrossRef]
5. Iacovella, G.M.; Kumar, N. Controversies surrounding renal replacement therapy in the critically Ill patient. Semin. Respir. Crit.
Care Med. 2019, 40, 662–672. [CrossRef]
6. Oliver, J.A. Adult renal stem cells and renal repair. Curr. Opin. Nephrol. Hypertens. 2004, 13, 17–22. [CrossRef] [PubMed]
7. Bussolati, B.; Bruno, S.; Grange, C.; Buttiglieri, S.; Deregibus, M.C.; Cantino, D.; Camussi, G. Isolation of renal progenitor cells
from adult human kidney. Am. J. Pathol. 2005, 166, 545–555. [CrossRef]
8. Humphreys, B.D.; Valerius, M.T.; Kobayashi, A.; Mugford, J.W.; Soeung, S.; Duffield, J.S.; McMahon, A.P.; Bonventre, J.V. Intrinsic
epithelial cells repair the kidney after injury. Cell Stem Cell 2008, 2, 284–291. [CrossRef]
9. Kusaba, T.; Lalli, M.; Kramann, R.; Kobayashi, A.; Humphreys, B.D. Differentiated kidney epithelial cells repair injured proximal
tubule. Proc. Natl. Acad. Sci. USA 2014, 111, 1527–1532. [CrossRef]
10. Collino, F.; Lopes, J.A.; Corrêa, S.; Abdelhay, E.; Takiya, C.M.; Wendt, C.H.C.; de Miranda, K.R.; Vieyra, A.; Lindoso, R.S.
Adipose-derived mesenchymal stromal cells under hypoxia: Changes in extracellular vesicles secretion and improvement of
renal recovery after ischemic injury. Cell. Physiol. Biochem. 2019, 52, 1463–1483. [CrossRef]
11. Han, S.J.; Lee, H.T. Mechanisms and therapeutic targets of ischemic acute kidney injury. Kidney Res. Clin. Pract. 2019, 38, 427–440.
[CrossRef] [PubMed]
12. Baud, L.; Ardaillou, R. Involvement of reactive oxygen species in kidney damage. Br. Med. Bull. 1993, 49, 621–629. [CrossRef]
[PubMed]
13. Mulay, S.R.; Holderied, A.; Kumar, S.V.; Anders, H.J. Targeting inflammation in so-called acute kidney injury. Semin. Nephrol.
2016, 36, 17–30. [CrossRef] [PubMed]
Int. J. Mol. Sci. 2022, 23, 2906 19 of 20
14. Ðurašević, S.; Stojković, M.; Bogdanović, L.; Pavlović, S.; Borković-Mitić, S.; Grigorov, I.; Bogojević, D.; Jasnić, N.; Tosti, T.;
Ðurović, S.; et al. The effects of meldonium on the renal acute ischemia/reperfusion injury in rats. J. Mol. Sci. 2019, 20, 5747.
[CrossRef]
15. Fortrie, G.; de Geus, H.R.H.; Betjes, M.G.H. The aftermath of acute kidney injury: A narrative review of long-term mortality and
renal function. Crit. Care. 2019, 24, 24. [CrossRef]
16. Bhatraju, P.K.; Zelnick, L.R.; Chinchilli, V.M.; Moledina, D.G.; Coca, S.G.; Parikh, C.R.; Garg, A.X.; Hsu, C.Y.; Go, A.S.;
Liu, K.D.; et al. Association between early recovery of kidney function after acute kidney injury and long-term clinical out-
comes. JAMA Netw. Open 2020, 3, e202682. [CrossRef]
17. Willms, E.; Johansson, H.J.; Mäger, I.; Lee, Y.; Blomberg, K.E.; Sadik, M.; Alaarg, A.; Smith, C.I.; Lehtiö, J.; El Andaloussi, S.; et al.
Cells release subpopulations of exosomes with distinct molecular and biological properties. Sci. Rep. 2016, 6, 22519. [CrossRef]
18. Knox, F.G.; Fleming, J.S.; Rennie, D.W. Effects of osmotic diuresis on sodium reabsorption and oxygen consumption of kidney.
Am. J. Physiol. 1966, 210, 751–759. [CrossRef]
19. Nanayakkara, G.K.; Wang, H.; Yang, X. Proton leak regulates mitochondrial reactive oxygen species generation in endothelial cell
activation and inflammation—A novel concept. Arch. Biochem. Biophys. 2019, 662, 68–74. [CrossRef]
20. Nicholls, D.G. The influence of respiration and ATP hydrolysis on the proton-electrochemical gradient across the inner membrane
of rat-liver mitochondria as determined by ion distribution. Eur. J. Biochem. 1974, 50, 305–315. [CrossRef]
21. Nicholls, D.G. Mitochondrial membrane potential and aging. Aging Cell 2004, 3, 35–40. [CrossRef] [PubMed]
22. Brand, M.D.; Nicholls, D.G. Assessing mitochondrial dysfunction in cells. Biochem. J. 2011, 435, 297–312. [CrossRef] [PubMed]
23. Bonventre, J.V. Kidney Injury Molecule-1 (KIM-1): A specific and sensitive biomarker of kidney injury. Scand. J. Clin. Lab. Investig.
2008, 241, 78–83. [CrossRef] [PubMed]
24. Devarajan, P. Neutrophil gelatinase-associated lipocalin (NGAL): A new marker of kidney disease. Scand. J. Clin. Lab. Investig.
2008, 241, 89–94. [CrossRef]
25. Glorieux, C.; Zamocky, M.; Sandoval, J.M.; Verrax, J.; Calderon, P.B. Regulation of catalase expression in healthy and cancerous
cells. Free Radic. Biol. Med. 2015, 87, 84–97. [CrossRef]
26. Lever, J.M.; Boddu, R.; George, J.F.; Agarwal, A. Heme oxygenase-1 in kidney health and disease. Antioxid. Redox Signal. 2016,
25, 165–183. [CrossRef]
27. Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress
response and diseases: An evolutionarily conserved mechanism. Cell. Mol. Life Sci. 2016, 73, 3221–3247. [CrossRef]
28. Gonzalez-Vicente, A.; Hong, N.; Garvin, J.L. Effects of reactive oxygen species on renal tubular transport. Am. J. Physiol. Renal.
Physiol. 2019, 317, F444–F455. [CrossRef]
29. Jastroch, M.; Divakaruni, A.S.; Mookerjee, S.; Treberg, J.R.; Brand, M.D. Mitochondrial proton and electron leaks. Essays Biochem.
2010, 47, 53–67. [CrossRef]
30. Brand, M.D.; Buckingham, J.A.; Esteves, T.C.; Green, K.; Lambert, A.J.; Miwa, S.; Murphy, M.P.; Pakay, J.L.; Talbot, D.A.;
Echtay, K.S. Mitochondrial superoxide and aging: Uncoupling-protein activity and superoxide production. Biochem. Soc. Symp.
2004, 71203–71213. [CrossRef]
31. Murphy, M.P. How mitochondria produce reactive oxygen species. Biochem. J. 2009, 417, 1–13. [CrossRef]
32. Lustgarten, M.S.; Bhattacharya, A.; Muller, F.L.; Jang, Y.C.; Shimizu, T.; Shirasawa, T.; Richardson, A.; van Remmen, H. Complex
I generated, mitochondrial matrix-directed superoxide is released from the mitochondria through voltage dependent anion
channels. Biochem. Biophys. Res. Commun. 2012, 422, 515–521. [CrossRef] [PubMed]
33. Dröse, S. Differential effects of complex II on mitochondrial ROS production and their relation to cardioprotective pre- and
postconditioning. Biochim. Biophys. Acta 2013, 1827, 578–587. [CrossRef] [PubMed]
34. Hekimi, S.; Wang, Y.; Noë, A. Mitochondrial ROS and the effectors of the intrinsic apoptotic pathway in aging cells: The discerning
killers! Front. Genet. 2016, 7, 161. [CrossRef]
35. Robb, E.L.; Hall, A.R.; Prime, T.A.; Eaton, S.; Szibor, M.; Viscomi, C.; James, A.M.; Murphy, M.P. Control of mitochondrial
superoxide production by reverse electron transport at complex I. J. Biol. Chem. 2018, 293, 9869–9879. [CrossRef] [PubMed]
36. Zhu, J.; Vinothkumar, K.R.; Hirst, J. Structure of mammalian respiratory complex I. Nature 2016, 536, 354–358. [CrossRef]
37. Wirth, C.; Brandt, U.; Hunte, C.; Zickermann, V. Structure and function of mitochondrial complex I. Biochim. Biophys. Acta 2016,
1857, 902–914. [CrossRef]
38. Iwata, S.; Lee, J.W.; Okada, K.; Lee, J.K.; Iwata, M.; Rasmussen, B.; Link, T.A.; Ramaswamy, S.; Jap, B.K. Complete structure of the
11-subunit bovine mitochondrial cytochrome bc1 complex. Science 1998, 281, 64–71. [CrossRef]
39. Brookes, P.S.; Yoon, Y.; Robotham, J.L.; Anders, M.W.; Sheu, S.S. Calcium, ATP, and ROS: A mitochondrial love-hate triangle.
Am. J. Physiol. Physiol. Cell Physiol. 2004, 287, C817–C833. [CrossRef]
40. Lenaz, G.; Genova, M.L. Structure and organization of mitochondrial respiratory complexes: A new understanding of an old
subject. Antioxid. Redox Signal. 2010, 12, 961–1008. [CrossRef]
41. Lapuente-Brun, E.; Moreno-Loshuertos, R.; Acín-Pérez, R.; Latorre-Pellicer, A.; Colás, C.; Balsa, E.; Perales-Clemente, E.;
Quirós, P.M.; Calvo, E.; Rodríguez-Hernández, M.A.; et al. Supercomplex assembly determines electron flux in the mitochondrial
electron transport chain. Science 2013, 340, 1567–1570. [CrossRef] [PubMed]
42. Milenkovic, D.; Blaza, J.N.; Larsson, N.G.; Hirst, J. The enigma of the respiratory chain supercomplex. Cell Metab. 2017,
25, 765–776. [CrossRef] [PubMed]
Int. J. Mol. Sci. 2022, 23, 2906 20 of 20
43. Luo, X.; O’Neill, K.L.; Huang, K. The third model of Bax/Bak activation: A Bcl-2 family feud finally resolved? F1000Research 2020,
9, 935. [CrossRef] [PubMed]
44. Han, M.; Li, Y.; Wen, D.; Liu, M.; Ma, Y.; Cong, B. NGAL protects against endotoxin-induced renal tubular damage by suppressing
apoptosis. BMC Nephrol. 2018, 19, 168. [CrossRef]
45. Faubel, S.; Lewis, E.C.; Reznikov, L.; Ljubanovic, D.; Hoke, T.S.; Somerset, H.; Oh, D.J.; Lu, L.; Klein, C.L.; Dinarello, C.A.; et al.
Cisplatin-induced acute renal failure is associated with an increase in the cytokines interleukin (IL)-1beta, IL-18, IL-6, and
neutrophil infiltration in the kidney. J. Pharmacol. Exp. Ther. 2007, 322, 8–15. [CrossRef]
46. Zhang, M.Z.; Yao, B.; Yang, S.; Jiang, L.; Wang, S.; Fan, X.; Yin, H.; Wong, K.; Miyazawa, T.; Jianchun, C.; et al. CSF-1 signaling
mediates recovery from acute kidney injury. J. Clin. Investig. 2012, 122, 4519–4532. [CrossRef]
47. Ramseyer, V.D.; Garvin, J.L. Tumor necrosis factor-α: Regulation of renal function and blood pressure. Am. J. Physiol. Renal.
Physiol. 2013, 304, F1231–F1242. [CrossRef]
48. Shalaby, M.R.; Waage, A.; Espevik, T. Cytokine regulation of interleukin 6 production by human endothelial cells. Cell. Immunol.
1989, 121, 372–382. [CrossRef]
49. Nechemia-Arbely, Y.; Barkan, D.; Pizov, G.; Shriki, A.; Rose-John, S.; Galun, E.; Axelrod, J.H. IL-6/IL-6R axis plays a critical role in
acute kidney injury. J. Am. Soc. Nephrol. 2008, 19, 1106–1115. [CrossRef]
50. Su, H.; Lei, C.T.; Zhang, C. Interleukin-6 signaling pathway and its role in kidney disease: An update. Front. Immunol. 2017, 8, 405.
[CrossRef]
51. Paller, M.S.; Hoidal, J.R.; Ferris, T.F. Oxygen free radicals in ischemic acute renal failure in the rat. J. Clin. Investig. 1984, 74, 1156–1164.
[CrossRef] [PubMed]
52. Baliga, R.; Ueda, N.; Walker, P.D.; Shah, S.V. Oxidant mechanisms in toxic acute renal failure. Am. J. Kidney Dis. 1997, 29, 465–477.
[CrossRef]
53. Gyurászová, M.; Gurecká, R.; Bábíčková, J.; Tóthová, L’. Oxidative stress in the pathophysiology of kidney disease: Implications
for noninvasive monitoring and identification of biomarkers. Oxid. Med. Cell. Longev. 2020, 2020, 5478708. [CrossRef] [PubMed]
54. Cowan, D.B.; Weisel, R.D.; Williams, W.G.; Mickle, D.A. The regulation of glutathione peroxidase gene expression by oxygen
tension in cultured human cardiomyocytes. J. Mol. Cell. Cardiol. 1992, 24, 423–433. [CrossRef]
55. Bryan, H.K.; Olayanju, A.; Goldring, C.E.; Park, B.K. The Nrf2 cell defence pathway: Keap1-dependent and -independent
mechanisms of regulation. Biochem. Pharmacol. 2013, 85, 705–717. [CrossRef]
56. Wagner, E.F.; Nebreda, A.R. Signal integration by JNK and p38 MAPK pathways in cancer development. Nat. Rev. Cancer 2009,
9, 537–549. [CrossRef]
57. Vigolo, E.; Markó, L.; Hinze, C.; Müller, D.N.; Schmidt-Ullrich, R.; Schmidt-Ott, K.M. Canonical BMP signaling in tubular cells
mediates recovery after acute kidney injury. Kidney Int. 2019, 95, 108–122. [CrossRef]
58. De Godoy, M.A.; Saraiva, L.M.; de Carvalho, L.R.P.; Vasconcelos-Dos-Santos, A.; Beiral, H.J.V.; Ramos, A.B.; Silva, L.R.P.; Leal, R.B.;
Monteiro, V.H.S.; Braga, C.V.; et al. Mesenchymal stem cells and cell-derived extracellular vesicles protect hippocampal neurons
from oxidative stress and synapse damage induced by amyloid-β oligomers. J. Biol. Chem. 2018, 293, 1957–1975. [CrossRef]
59. Percie du Sert, N.; Hurst, V.; Ahluwalia, A.; Alam, S.; Avey, M.T.; Baker, M.; Browne, W.J.; Clark, A.; Cuthill, I.C.; Dirnagl, U.; et al.
The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. J. Physiol. 2020, 598, 3793–3801. [CrossRef]
60. Collino, F.; Lopes, J.A.; Tapparo, M.; Tortelote, G.G.; Kasai-Brunswick, T.H.; Lopes, G.M.C.; Almeida, D.B.; Skovronova, R.;
Wendt, C.H.C.; Miranda, K.R.; et al. Extracellular vesicles derived from induced pluripotent stem cells promote renoprotection in
acute kidney injury model. Cells 2020, 9, 453. [CrossRef]
61. Beiral, H.J.; Rodrigues-Ferreira, C.; Fernandes, A.M.; Gonsalez, S.R.; Mortari, N.C.; Takiya, C.M.; Sorenson, M.M.; Figueiredo-Freitas, C.;
Galina, A.; Vieyra, A. The impact of stem cells on electron fluxes, proton translocation, and ATP synthesis in kidney mitochondria after
ischemia/reperfusion. Cell Transplant. 2014, 23, 207–220. [CrossRef] [PubMed]
62. Whittembury, G.; Proverbio, F. Two modes of Na extrusion in cells from guinea pig kidney cortex slices. Pflugers Arch. 1970,
316, 1–25. [CrossRef]
63. Bianco, M.; Lopes, J.A.; Beiral, H.J.V.; Filho, J.D.D.; Frankenfeld, S.P.; Fortunato, R.S.; Gattass, C.R.; Vieyra, A.; Takiya, C.M. The
contralateral kidney presents with impaired mitochondrial functions and disrupted redox homeostasis after 14 days of unilateral
ureteral obstruction in mice. PLoS ONE 2019, 14, e0218986. [CrossRef] [PubMed]
64. Sahajpal, V.; Ashton, N. Increased glomerular angiotensin II binding in rats exposed to a maternal low protein diet in utero.
J. Physiol. 2005, 563, 193–201. [CrossRef] [PubMed]
65. Silva, P.A.; Muzi-Filho, H.; Pereira-Acácio, A.; Dias, J.; Martins, J.F.; Landim-Vieira, M.; Verdoorn, K.S.; Lara, L.S.; Vieira-Filho, L.D.;
Cabral, E.V.; et al. Altered signaling pathways linked to angiotensin II underpin the upregulation of renal Na+ -ATPase in chronically
undernourished rats. Biochim. Biophys. Acta 2014, 1842, 2357–2366. [CrossRef]