© 2000 Oxford University Press Nucleic Acids Research, 2000, Vol. 28, No.

17 3361–3369

Requirements for double-strand cleavage by chimeric

restriction enzymes with zinc finger DNA-recognition
domains
Jeff Smith1,2, Marina Bibikova3, Frank G. Whitby3, A. R. Reddy1,4, Srinivasan Chandrasegaran1
and Dana Carroll3,*
1Department of Environmental Health Sciences, The Johns Hopkins University School of Hygiene and Public Health,
615 North Wolfe Street, Baltimore, MD 21205, USA, 2Department of Biophysics and Biophysical Chemistry,
The Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA, 3Department of Biochemistry,
University of Utah School of Medicine, 50 North Medical Drive, Salt Lake City, UT 84132, USA and
4Department of Biological Sciences, Pondicherry University, Pondicherry 605014, India

Received April 12, 2000; Revised June 20, 2000; Accepted July 3, 2000

ABSTRACT their diversity, these endonucleases have limited utility

because their recognition sites are rather short (8 bp or less)
This study concerns chimeric restriction enzymes
and their specificity is not easily altered. The class of homing
that are hybrids between a zinc finger DNA-binding nucleases or meganucleases (2) recognizes longer sequences
domain and the non-specific DNA-cleavage domain (∼20 bp), but shares the limitation of having rigid sequence
from the natural restriction enzyme FokI. Because of requirements. For some applications it would be desirable to
the flexibility of DNA recognition by zinc fingers, have enzymes that recognize specific sequences with good
these enzymes are potential tools for cleaving DNA at discrimination, but also have the ability to be manipulated to
arbitrarily selected sequences. Efficient double- bind new, arbitrarily selected sequences.
strand cleavage by the chimeric nucleases requires We have developed a class of chimeric nucleases based on
two binding sites in close proximity. When cuts were the linkage of a zinc finger DNA-binding domain to the DNA-
mapped on the DNA strands, it was found that they cleavage domain (FN) from the Type IIs restriction enzyme
occur in pairs separated by ∼4 bp with a 5′ overhang, FokI (3–6). Similar hybrids combine DNA-binding domains
as for native FokI. Furthermore, amino acid changes from natural and synthetic transcription factors to this or other
in the dimer interface of the cleavage domain abolished non-specific cleavage domains (7–10). In these constructs,
activity. These results reflect a requirement for DNA cleavage is directed to sites recognized by the binding
dimerization of the cleavage domain. The dependence domains, thus proving the feasibility of manipulating the target
specificity.
of cleavage efficiency on the distance between two
The Cys2His2 zinc fingers are of particular interest in this
inverted binding sites was determined and both
regard. Each individual finger contacts primarily three consecutive
upper and lower limits were defined. Two different
base pairs of DNA in a modular fashion (11,12; Fig. 1). By
zinc finger combinations binding to non-identical manipulating the number of fingers and the nature of critical
sites also supported specific cleavage. Molecular amino acid residues that contact DNA directly, binding
modeling was employed to gain insight into the domains with novel specificities can be evolved and selected
precise location of the cut sites. These results define (13–21). In principle, a very broad range of DNA sequences
requirements for effective targets of chimeric nucleases can serve as specific recognition targets for zinc finger
and will guide the design of novel specificities for proteins. Chimeric nucleases with several different specificities
directed DNA cleavage in vitro and in vivo. based on zinc finger recognition have already been constructed
and characterized (3,6,8,9).
In the present work, we examine in more detail the requirements
INTRODUCTION for efficient DNA cleavage by two of these zinc finger–FN
Site-specific endonucleases are powerful tools for the mani- chimeras. Both Zif-QQR-FN (QQR) (22) and Zif-∆QNK-FN
pulation of DNA sequences. Naturally occurring restriction (QNK) (6) have the general structure diagrammed in Figure 1, with
enzymes have played a central role in the cloning and mapping the three finger DNA-binding domain at the N-terminus connected
of genes since their original isolation roughly three decades by a peptide linker to the nuclease domain at the C-terminus.
ago. Type II enzymes able to specifically cleave more than Because of differences in several key residues in the middle
140 different sites are now available commercially (1). Despite finger, they recognize related, but distinct, sites: 5′-GGG GAA

*To whom correspondence should be addressed. Tel: +1 801 581 5977; Fax: +1 801 581 7959; Email: carroll@medschool.med.utah.edu
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors
3362 Nucleic Acids Research, 2000, Vol. 28, No. 17

head-to-head inverted repeats 10 bp apart; pQD10 carries

direct repeats separated by 10 bp.
Enzymes
Zif-QQR-FN and Zif-∆QNK-FN were prepared as previously
described (6). Briefly, the coding sequence for the chimeric
nuclease was cloned into pET15b, so that it carries a His6 tag at
its N-terminus, and was propagated in BL21 (DE3) cells that
overproduce E.coli DNA ligase from a pACYC184 derivative.
Expression of the nuclease was initiated by addition of IPTG to
0.7 mM to cells growing at 22°C in LB medium plus ampicillin,
Figure 1. Schematic diagram of the chimeric nuclease. The three zinc fingers tetracycline and 100 µM ZnCl2. Harvested cells were disrupted
are shown in ribbon representation (12). The residues that provide the primary by sonication or by passage twice through a French press and
specificity-determining interactions with the DNA bases, at positions –1, 3 the clarified extract was passed over a His-bind column. The
and 6 relative to the start of the α-helix of each finger, are indicated next to the enzyme was eluted with 0.4 M imidazole and purified further
bases they contact. The FokI endonuclease domain is C-terminal to the zinc
fingers and separated from them by a 15 amino acid linker [(G4S)3; G, glycine, on a heparin–Sepharose, then a gel filtration column (S-100
S, serine]. The specific sequences illustrated are for QQR (22,23). HR or Superdex-75). It was stored at –80°C in 40% glycerol (10%
glycerol in some cases), 20 mM Tris, pH 7.9, 10 mM β-mercapto-
ethanol, 100 µM ZnCl2. In vitro reactions were typically
GAA for QQR (22,23) and 5′-GGG GCG GAA for QNK performed in 20 µl containing 10 mM Tris, pH 8.5, 50 mM
(6,24). Studies of these two chimeric nucleases were pursued NaCl, 1 mM DTT, 100 µM ZnCl2, 50 µg/ml BSA, 100 µg/ml
in parallel, using similar, but not identical, procedures and tRNA. QQR reactions used 50 ng of substrate DNA that had
substrates. been linearized by PvuII digestion; QNK substrates were line-
Both enzymes require two copies of the recognition site in arized with ScaI (Fig. 6) or with SspI (Figs 3a and 7) and used
close proximity to effect efficient double-strand cleavage, at 100 ng/reaction. Enzyme was added, followed by preincubation
for 30 min at room temperature. MgCl2 was added to a final
reflecting a requirement for dimerization of the cleavage
concentration of 10 mM and incubation was continued for 1 h
domain. While natural FokI (25) must also dimerize, the need
at room temperature. Cleavage was monitored by electro-
for neighboring paired binding sites is unique to the chimeric
phoresis in 1% agarose gels.
nucleases. A consequence of this requirement is that the
Dimer interface mutants of QNK were constructed by PCR
chimeric enzymes have very high target specificity, since two with primers that incorporate the desired mutations. For
designated 9 bp sequences must be bound. The results D483A, the forward primer was d(CAATTGGCCAAGCAGC-
presented here will guide the future design of chimeric nucleases TGAAATGCAACGATATGTCGAAGAAAATCAAACACG);
directed to specific targets. One potential application of these the corresponding primer for R485D was d(CAATTGGC-
enzymes is site-specific cleavage of DNA in vivo with the goal CAAGCAGATGAAATGCAAGATTATGTCGAAGAAAA-
of evaluating double-strand break repair or stimulating TCAAACACG). Each was used with the reverse primer
targeted recombination. The latter prospect is addressed in a d(TAGGATCCTCATTAAAAGTTTATCTCGCCGTTATT)
separate study (Bibikova et al., manuscript in preparation). from the C-terminus of the FN coding sequence. The resulting
PCR products were cleaved with MscI, gel purified and used as
MATERIALS AND METHODS reverse primers in a second round of PCR that included
d(GAAGATCTTCGATCCCGCGAAATTAA), from the vector
DNA substrates N-terminal to the QNK coding sequence, as the forward
primer. The final PCR products were digested with NdeI and
For most QNK substrates, double-stranded oligodeoxyribo- BamHI, gel purified and cloned into pET15b. Identities of
nucleotides having the recognition site 5′-GGG GCG GAA individual clones were confirmed by DNA sequencing and the
were cloned into the BamHI site of pUC18. The parent plasmid proteins were expressed and purified as described above.
for QQR substrates was pRW4 (26) and oligodeoxyribonucleo-
tides containing the recognition site 5′-GGG GAA GAA were Mapping cut sites
inserted into the unique XhoI site. QNK plasmids were trans- To label one strand of the QNK substrates, plasmids were cut
formed into Escherichia coli DH5α, QQR plasmids into E.coli at one end of the pUC18 polylinker with EcoRI. The DNA was
XL-1 Blue and DNAs from individual colonies were characterized treated with calf intestinal alkaline phosphatase (New England
by DNA sequence analysis. The exact sequences of the inserts BioLabs, Beverly, MA) and then with T4 polynucleotide
are given in Figure 5. Plasmid DNAs were purified using kinase (Boehringer Mannheim, Indianapolis, IN) and [γ-32P]ATP
Qiagen columns (Qiagen, Valencia, CA). (Amersham Life Sciences, Arlington Heights, IL). After heat
The names of the plasmids reflect the structure of the inserts. inactivation of the kinase, the DNA was digested with HindIII,
pKS has a single QNK site, while pKT8 has two sites 8 bp which cuts at the other end of the polylinker. The resulting
apart in tail-to-tail inverted orientation, i.e. the G ends of the small fragment was purified from a 3% low melting point
recognition site face each other. Similarly, pKT14, pKT28 and agarose gel. To label the other strand, the order of HindIII and
pKT48 carry inverted sites with the indicated separations. EcoRI digests was reversed. One quarter of the labeled sample
pQS carries a single copy of the QQR site; the pQTn series has was subjected to each of the Maxam–Gilbert G and G+A reactions
tail-to-tail inverted sites with n bp between them; pQH10 has (27) and the remaining two quarters were used in reactions with
 Nucleic Acids Research, 2000, Vol. 28, No. 17 3363

or without QNK. After phenol/chloroform extraction and

ethanol precipitation, the products were separated by electro-
phoresis in a 10% polyacrylamide sequencing gel.
For QQR reactions, a DNA fragment of ∼400 bp was ampli-
fied by PCR from each of the plasmid substrates. The primers,
d(CAGGTAGATGACGACCATCAGG) and d(GGAATGG-
ACGATATCCCGCAAG), correspond to sequences in pRW4
flanking the insertion site. This fragment was gel purified with
a Qiaex II gel extraction kit (Qiagen) and used as a template for
a second PCR, using the internal primers d(GGTTGGCAT-
GGATTGTAGGCG) and d(TGTTAGATTTCATACACGG-
TGCC), to generate a fragment of ∼200 bp. To label each
strand separately, one of the latter primers was treated with T4
polynucleotide kinase and [γ-32P]ATP. The PCR products were
purified with a QIAquick PCR purification kit (Qiagen), then
treated with QQR. Denatured reaction products were separated
by electrophoresis in 6% polyacrylamide sequencing gels.
Dideoxy sequencing reactions were performed for each
Figure 2. Substrate specificity of QQR. (a) Substrates with various binding
substrate using a dsDNA cycle sequencing kit (Gibco BRL, site dispositions. pQS has a single copy of the canonical recognition site,
Gaithersburg, MD) and the same labeled primers as for PCR. indicated by the arrow. The remaining DNAs have two sites in tail-to-tail
These were run on the same gels in lanes immediately adjacent inverted (pQT10), head-to-head inverted (pQH10) and direct repeat (pQD10)
to the nuclease cleavage products. orientations. The vector is pRW4 without an insert. Samples of DNA (0.7 nM,
corresponding to 1.4 nM recognition sites in the cases with paired sites) were
Molecular modeling incubated without enzyme (–) or with QQR at 1.0 (a), 1.5 (b) or 3.0 nM (c).
The locations of the 5.6 kb linear substrate DNAs and the 3.6 and 2.0 kb
Coordinates for the zinc fingers were taken from the co-crystal fragments expected from cleavage at the target site are indicated to the right of
structure of the DNA-binding domain of QNK bound to DNA the figure. (b) Cleavage at higher enzyme concentrations. The substrates were
PCR fragments from a single site plasmid (QS) and one with two inverted sites
(Protein Database accession no. 1MEY) (24). Coordinates for (QT16); DNA concentration ∼20 nM. QQR concentrations were 0 (–), 3.5 (1),
the FokI cleavage domain dimer include residues 387–579 7 (2), 17.5 (3), 35 (4) and 50 nM (5). The locations of the substrate (S) and
from the structure of the protein alone (Protein Database acces- expected product (P) bands are indicated to the right. Faster migrating
sion no. 2FOK) (28). The cleavage domain dimer was docked fragments are from cleavage at secondary sites. The Stds lane in each panel
contains linear size standards.
to B-form DNA by eye, using the published model (28) as a
guide. The zinc finger domains were placed at various posi-
tions along the DNA by aligning backbone phosphates from
consecutive residues in the co-crystal structure (24) with corre- (pQD10) were effectively cut, while head-to-head inverted
sponding phosphates on B-form DNA. All alignments were repeats (pQH10) were cleaved much less efficiently. Observed
performed with the graphics program O and figures were double-strand breaks mapped to the expected sites (Fig. 2a and
prepared from these data using MolScript. data not shown).
At substantially higher enzyme:substrate ratios, both QQR
and QNK made targeted cuts in DNAs that carried a single
RESULTS copy of the recognition site. In the comparison shown in
Figure 2b, QS carries a single site, while QT16 has two in tail-
Binding site requirements for double-strand cleavage
to-tail orientation 16 bp apart. The DNAs were PCR fragments
Previous work with several zinc finger chimeric nucleases, of ∼200 bp, identical to those used for mapping reactions (see
including QQR, showed that they make cuts primarily to the below). QT16 was cleaved at all QQR concentrations tested
left side of their recognition sequences, as depicted in Figure 1 and cleavage was essentially complete at an approximately 1:1
(22). This was the expected location, given the orientation of ratio of enzyme to sites (lane 4). In contrast, QS required ∼10-fold
the zinc fingers on the DNA and the structure of the chimeric more enzyme to achieve comparable levels of cleavage (QS in
protein. Some cleavage occurred on both strands, but the lane 4 versus QT16 in lane 1), and this corresponds to a 20-fold
mapping of the sites was performed on denatured DNA and the higher ratio of enzyme to recognition sites. At the highest
efficiency of double-strand cleavage was not determined (22). enzyme concentration used (lane 5), other sites began to be
Therefore, we focused our attention on the production of cleaved, perhaps reflecting binding of QQR to more distantly
double-strand breaks. related sequences.
We constructed and analyzed a collection of specifically
designed plasmid substrates with variable numbers and orien- Influence of target site separation on cleavage efficiency
tations of the canonical recognition site for QQR. These were Paired inverted sites in the tail-to-tail orientation showed
linearized and treated with QQR. At enzyme:substrate ratios efficient double-strand cleavage when the sites were 10 or 16 bp
close to 1, in order to achieve double-strand cleavage it was apart (Fig. 2). To determine the upper and lower limits on
necessary to have at least two copies of the target oligonucleo- distances that would allow cleavage, we examined a series of
tide (Fig. 2a). A single copy of the recognition sequence (pQS) substrates for each chimeric nuclease in which variable
did not support cleavage. With 10 bp between paired sites, both amounts of essentially random DNA sequence were inserted
tail-to-tail inverted repeats (pQT10) and direct repeats between the recognition sites. For QNK, separations of 8, 14,
3364 Nucleic Acids Research, 2000, Vol. 28, No. 17

strands. Natural FokI dimerizes to cleave DNA (25) and it is

reasonable to suspect that the cleavage domains in the context
of the chimeric nuclease would do the same. In this case, the
upper limit on effective site separation would reflect the
maximum extension achievable by the peptide linker between
the binding and cleavage domains.
We distinguished these possibilities by mapping the cut sites
for QNK and QQR on a wide range of substrates at single
nucleotide resolution. Model (i) predicts that single-strand cuts
will be produced in fixed positions relative to each recognition
site and that their locations will move apart as the distance
between the sites is increased. Model (ii) predicts that cuts in
the two strands will always be paired and, like FokI, they
should produce a 5′ overhang of 4 bp.
To map the cuts made by QNK, a fragment carrying the
paired sites, the intervening sequence and ∼50 bp of pUC18
was labeled on either end with 32P as described in Materials
and Methods. After digestion with the enzyme, products were
compared to G and G+A sequencing reactions of the same
fragment (Fig. 4a). Maxam–Gilbert chemistry removes the
designated base and leaves the preceding 3′-phosphate, while
the chimeric nuclease leaves a 3′-hydroxyl. Both these proper-
ties increase the mobility of the Maxam–Gilbert fragments, so
the alignment with the QNK products was adjusted by about
1.5 bands to identify the exact site of cleavage.
Figure 3. Dependence of cleavage on separation between inverted sites. (a) QNK With 8 bp between QNK sites (KT8), strong cuts were seen
substrates with a single copy of the recognition site (pKS) or with 8, 14, 28 and on both strands between the sites: a single cut on one strand, a
48 bp separations between tail-to-tail inverted sites, as indicated. Reactions strong and a secondary cut on the other strand (Fig. 4a). When
contained 2.5 nM DNA and 10 nM enzyme. (b) QQR substrates with the mapped on the DNA sequence, the major cuts are 4 bp apart
separations indicated between inverted sites. Reactions and designations as in
Figure 2a, with 0.7 nM DNA and either no enzyme (–) or QQR at 1.0 (a), 1.6
and result in a 5′ overhang (Fig. 5a). With KT14, five or six
(b) or 5.0 nM (d). The band between 5.6 and 3.6 kb in the samples labeled 4 is relatively strong cuts were made on each strand (Figs 4a and
an artifact of this particular plasmid preparation. 5a). When mapped they overlap considerably, but may be
interpreted as three clusters of paired cuts staggered by ∼4 bp,
one near the middle of the intervening sequence and one near
28 and 48 bp were tested (Fig. 3a). Under conditions that did each end. With KT28, again a single strong cleavage site was
not support cleavage at a single site (pKS), the 8, 14 and 28 bp seen on both strands near the middle of the space between
separations allowed double-strand cleavage, while the 48 bp binding sites with a 4 bp 5′ stagger. Minor bands were visible
separation did not. in all cases, indicating that the cut locations were not rigidly
determined.
For QQR, we tested a larger collection of different separations,
as shown in Figure 3b. When the paired sites were 4 bp apart, Cuts were also mapped on a DNA carrying a single recogni-
tion site for QNK (KS), using a high concentration of enzyme
very little double-strand cleavage was observed and that only
(Fig. 4a). Two groups of cuts were seen on each strand, similar
at the highest enzyme input. A separation of 6 bp led to good
to results obtained previously with other zinc finger chimeras
cleavage with QQR and this remained true for all distances
(9). These cuts assemble on the DNA sequence into two clusters
tested up to 35 bp. The substrate with a separation of 40 bp,
centered ∼4 and 13 bp from the 5′-end of the binding site
however, was essentially not cleaved. Thus, the upper limit for (Fig. 5a). There is a general 5′ stagger in each cluster, although
effective site separations is between 35 and 40 bp, in agree- the distances between the cuts are not restricted to 4 bp. Similar
ment with the observations for QNK. locations were seen with KT48 at high QNK concentrations
Mapping cut sites on DNA strands (Fig. 5a).
Also shown in Figure 5a are mapped cuts in two QNK
In principle, the requirement for two binding sites to achieve substrates that were determined independently by the procedure
double-strand cleavage could reflect either of two underlying described for QQR below. The major cuts in KT8′ are farther
phenomena. (i) Each individual bound chimeric molecule apart than seen in KT8, perhaps due to sequence preference of
might make an independent single-strand cut close to its the FokI cleavage domain (see Discussion). KT12 showed
binding site and two such cuts in proximity would be necessary paired, centered, strong cuts separated by a 4 bp 5′ stagger,
to produce a double-strand break. In this view the upper limit plus one minor cut reflecting a 3 bp stagger.
on the distance between effective paired sites would be deter- To map cuts on QQR substrates, a PCR fragment of ∼200 bp
mined by the stability of the DNA duplex between nicks on the from each plasmid was labeled on either end and reaction
two strands. (ii) The cleavage domain of the chimeric nuclease products were analyzed in parallel with dideoxy sequencing
might have to dimerize in order to act as an effective nuclease reactions on the same DNAs, using the same primers. At
and when it does concerted breaks would be made in the two moderate QQR concentration essentially no nicks were
 Nucleic Acids Research, 2000, Vol. 28, No. 17 3365

Figure 4. Mapping cut sites on DNA strands. (a) QNK substrates. Lanes G and G+A contain Maxam–Gilbert sequencing reaction products of the end-labeled
DNAs. Adjacent lanes have the same fragments (∼40 nM) treated without enzyme (–) or with QNK at 10 (+) or 100 nM (++). (b) QQR substrates. In each set,
samples of a DNA fragment, labeled on one strand and treated with the nuclease, were run beside dideoxy sequencing reactions (GATC) initiated from a primer
labeled at exactly the same position. DNAs (4 nM) were incubated without enzyme (–) or with QQR at 1.0 (a) or 3.0 nM (c). In both panels arrows indicate the
positions and orientations of the 9 bp recognition sites.

produced in the vicinity of a single copy of the recognition site sequence, but close to either end, as described for QT16 above.
(not shown). At the same concentration single strong cuts were While the major cuts were staggered by 4 bp in most cases,
made in both strands between sites separated by 12 bp (QT12). minor cut sites were also seen. In QT26, QT30 and QT35, the
When mapped onto the DNA sequence, these strong cuts were cut locations returned to the center of the interval, although
precisely 4 bp apart with a 5′ stagger (Fig. 5b). With QT16, weak cuts near the ends were seen with QT26. When the site
cuts were made near one end or the other of the intervening separation reached 40 bp, no prominent nicks were seen, just as
sequence and the most prominent cuts occurred in pairs with a for the single site substrate.
4 bp 5′ stagger. QT30 provided the only case in which the These results support Model (ii), i.e. dimerization of the
strongest cuts were clearly separated by <4 bp. These paired cleavage domain in the space between the binding sites.
cuts staggered by 3 bp were located at the center of the spacer.
Examining the full range of QQR substrates in Figure 5b, we Cleavage of paired non-identical sites
see that paired nicks were always located between the binding
To achieve cleavage of an arbitrarily selected target, paired
sites and related by a 5′ stagger of ∼4 bp. With QT6, prominent
cuts were made at the center of the interval with a 4 bp stagger. zinc finger binding sites would be chosen that would usually
For QT8, the strongest cuts were centered and showed 5 or not be identical. To demonstrate that such a configuration also
6 bp staggers. QT10 showed alternative 4 bp staggers offset leads to effective dimerization and cleavage, we constructed a
slightly from the center of the symmetrical intervening substrate having one site each for QNK and QQR 14 bp apart
sequence and QT12 showed the centered 4 bp stagger and in tail-to-tail inverted orientation (pQK14). This DNA was
described earlier. There were minor bands in each of these not cleaved by either enzyme alone at moderate enzyme
cases corresponding to slightly shorter or slightly longer 5′ concentration, but was cleaved by a mixture of the two (Fig. 6).
staggers. With QT14, QT18 and QT20 the paired cuts on the The level of cleavage was comparable to that of pQT14 using
two strands occurred not in the center of the intervening the corresponding QQR enzyme alone. Thus, paired non-identical
3366 Nucleic Acids Research, 2000, Vol. 28, No. 17

Figure 5. Maps of the cuts made on all substrates. (a) QNK substrates. (b) QQR substrates. The sequences of both strands are given in the region around the 9 bp
recognition sites, which are indicated with a line between the strands. Cut sites corresponding to strong bands are indicated with an arrowhead, cuts of moderate
intensity with a vertical line and weaker cuts with a dot.
 Nucleic Acids Research, 2000, Vol. 28, No. 17 3367

cleavage (25). In addition to the need for an intact dimer inter-

face, we showed that cleavage by the chimeric nucleases
requires two copies of the binding site in close proximity and
that paired cuts with a conserved stagger are made in the two
strands, regardless of the disposition of the binding sites.
The structure of the FokI cleavage domain dimer resembles
the active form of other restriction enzymes (28). It is highly
plausible that nuclease activity depends on the structure
Figure 6. Cleavage of a hybrid site. pQT14′ has paired sites for QQR 14 bp achieved by dimerization and that single molecules are
apart, while pQK14 has one site each for QQR and QNK separated by 14 bp. inactive. Both in the case of FokI (25) and our chimeric
DNA concentration, 2.5 nM; enzyme concentration, 10 nM each. Labels as in enzymes (J.Smith and S.Chandrasegaran, data not shown),
Figure 3a.
results with dimerization mutants indicate that even targeted
single-strand cleavage depends on dimerization.
The requirement for paired binding sites in close proximity
distinguishes the chimeric nucleases from FokI. In the latter
case, it appears that dimerization occurs between monomers
bound to quite distant sites on the DNA (25). The fact that the
chimeric nucleases and FokI exist as monomers in solution
further differentiates them from several other Type II restric-
tion endonucleases that must bind to two recognition sites to
achieve full activity (31–34). In these cases the enzyme is natu-
rally dimeric or tetrameric and association with the second site
activates cleavage at one or both sites.
When a single recognition site supports cleavage at high
Figure 7. Dimerization mutants of QNK. Linear pKT8 was incubated with no concentrations of chimeric nuclease, we cannot distinguish
enzyme (–), with QNK or with the D483A and R487D mutants, as indicated.
All reactions were performed with 20 nM DNA and 40 nM protein. Labels as among several possible explanations. Dimerization could
in Figure 3a. occur between one DNA-bound and one unbound enzyme
molecule, between two molecules bound to canonical sites on
sites are effective cleavage targets when enzymes with both separate DNAs or between one enzyme bound to the canonical
specificities are provided. site and another that is weakly associated with nearby duplex
through non-sequence-specific interactions. In the latter case,
Dimerization mutants marginal energy contributions from zinc finger–DNA binding
The crystal structure of FokI reveals a dimer interface, where and the dimerization interface could combine to produce the
Asp483 of each cleavage domain monomer makes bidentate necessary affinity and permit cleavage.
hydrogen bonds with Arg487 of the other (28). Simultaneous The dimer interface in the chimeric nucleases may be some-
conversion of these two residues to Ala dramatically reduced what flexible, since cuts staggered by distances other than 4 bp
the cleavage efficiency of the restriction endonuclease (25). In were sometimes produced. Another manifestation of this
order to confirm the requirement for dimerization of the chimeric flexibility may be a slight preference for cutting 3′ of a T (see
nucleases, we mutated each of these residues individually in Fig. 5). Native FokI cuts 9 and 13 bp from 5′-GGATG without
QNK: Asp483 to Ala (D483A) and Arg487 to Asp (R487D). apparent sequence preference (35,36).
The corresponding proteins were purified and used to treat Molecular modeling
pKT8, which was readily cleaved by QNK. Both mutant
enzymes were incapable of producing double-strand breaks In order to gain further insight into the requirements for recog-
(Fig. 7). Thus, dimerization is critical for the activity of the nition and cleavage by the chimeric nucleases, we constructed
chimeric nucleases, just as for native FokI. hypothetical molecular models using published coordinates for
the separate domains (24,28). As envisioned by Wah et al.
(28), the cleavage domain dimer sits like a saddle across the
DISCUSSION DNA duplex making close contacts in the major groove
(Fig. 8). The N-termini of the monomers (A and B), which
Double-strand cleavage requirements must be connected to the zinc finger domains through the
The data presented here on in vitro cleavage by two chimeric flexible linker, are located on either side of the DNA at the
nucleases demonstrate that the cleavage domain of the enzyme base of the saddle, essentially in the positions of the stirrups.
must dimerize to effect efficient double-strand incision of The two connecting points lie almost in a plane perpendicular
DNA. These results complement findings for natural FokI, to the DNA axis in our model, although the dimer may be
which recognizes its binding site as a monomer (29,30), but angled into or across the major groove in reality.
requires dimerization to cleave DNA (25). In that case, the The zinc finger domains (I and II in Fig. 8) were placed in the
crystal structure of the enzyme showed a credible dimer major groove on either side of the cleavage dimer at separations
interface (28); cleavage efficiency showed an exponential and orientations corresponding to the experimental substrates.
dependence on enzyme concentration; a separate cleavage The distances that must be traversed by the peptide linker in
domain could complement sub-optimal concentrations of the order to join the binding and cleavage domains were estimated.
intact molecule; mutations in the dimer interface abolished Sometimes the connections could be made directly through
3368 Nucleic Acids Research, 2000, Vol. 28, No. 17

of the DNA upon zinc finger binding or association with the

cleavage domain dimer. Nonetheless, a number of conclusions
could be drawn.
The modeling showed that with only 4 bp between inverted
recognition sites, steric clash would occur between the binding
and cleavage domains. This accounts for the observation that
double-strand cleavage was very inefficient with QT4
(Fig. 3b). With a 6 bp separation, the C-termini of the zinc
fingers project into the major groove in the area under the
cleavage domain saddle and the binding and cleavage domains
all have unobstructed access to the DNA (Fig. 8a). In practice,
the QT6 substrate was readily cleaved by the nuclease.
With a separation of 16 bp, the observed cuts lay not in the
center of the interval, but closer to either side, and this is
rationalized by the modeling (Fig. 8b and c). If the cleavage
domain dimer were centered between the binding sites, the
termini of the domains that must be connected would lie on
opposite sides of the DNA helix (Fig. 8b). When the domains
are moved to the observed location of the cuts, centered 3 bp
from one binding site and 13 bp from the other, the termini are
all on the same side of the DNA (Fig. 8c) and the distances to
be traversed by the linker are considerably shortened. Cuts ∼3
or 13 bp from the recognition sites were seen with a number of
substrates (Fig. 5). In addition to placing the linker entirely on
one side of the DNA, it is possible that the linker has two
preferred conformations, one particularly compatible with
extending each of the observed distances.
The modeling does not explain some of the limits to
cleavage. For example, it is not clear why QT35 was cleaved,
but QT40 was not, since the estimated distances are not much
different for the two cases. The extension required for the
linker in the case of direct repeats (QD10) is well within the
range of those traversed for inverted repeats. From similar
Figure 8. Molecular modeling. The DNA is represented as a space filling
model and colored by atom type, from light gray to black. The cleavage
considerations, it is not clear why the head-to-head inverted
domain dimer (aqua) is shown as a ribbon diagram; the N-termini of the two repeat is cleaved inefficiently, since one pair of connections
monomers are labeled A and B. The two zinc finger domains are also shown would, in principle, require the two linkers to stretch only
as ribbon diagrams, colored magenta (I) and purple (II), and the positions of 40 Å. There may be some features of the actual structure that
their N- and C-termini are indicated. (a) Model of QT6, with binding domains our simplified model does not reflect.
3 bp on either side of the center of the cleavage domain dimer. The cleavage
domain dimer sits in the major groove largely behind the double helix as In summary, the modeling has shown that, while the
pictured, while the zinc finger domains wind through the major groove on chimeric nucleases cleave DNAs with a wide range of separa-
either side. The distances between the closest pairs of connectable termini tions between recognition sites, they prefer to cleave at specific
(I→B:II→A) are ∼20 Å. (b) Model of QT16 with the cleavage domain dimer positions that allow the linker between the DNA-binding and
centered between the binding sites, i.e. 8 bp on either side. The connecting
points for both zinc finger domains are on the opposite side of the helix from
DNA-cleavage domains to remain entirely on one side of the
the ends of the cleavage domains. (c) Model of QT16 with the cleavage dimer DNA duplex. Although the linker is, in principle, sufficiently
off-center, 3 bp from one binding site and 13 bp from the other. Now all the long to make the traverse around the duplex, this configuration
connecting points are on the same side of the duplex. is apparently disfavored. The situation is reminiscent of that
for native FokI, which makes cuts approximately one helical
turn away from its binding site, thus placing the binding and
space and in other cases a diversion was necessary to avoid cleavage domains on the same side of the duplex. In this case
clashing with the DNA. Both possible sets of connections were the linker is thought to be an α-helix that is limited in its exten-
assessed: I→A:II→B and I→B:II→A. sibility (30).
There are 24 amino acids in the chimeric nuclease sequence Applications of chimeric restriction enzymes
between positions defined in the component crystal structures:
It was demonstrated previously that zinc finger chimeras can
three disordered at the end of the zinc finger domain, 15 in the
cut DNA in the vicinity of their specific recognition sites and
intentional (Gly4Ser)3 linker, three as a result of cloning the their potential utility as highly specific cleavage reagents was
linker and three disordered at the N-terminus of the cleavage noted (3–5,8). The current finding that paired binding sites are
domain. At full extension this segment could theoretically required for efficient dimerization and cleavage shows
reach as far as 80–90 Å. The modeling has its limitations, since precisely what type of target will be susceptible to these
the positioning of the cleavage domain dimer on the DNA is enzymes. In order to cleave at an arbitrarily determined location,
hypothetical and no attempt was made to incorporate distortions two 9 bp DNA sequences in inverted orientation and separated by
 Nucleic Acids Research, 2000, Vol. 28, No. 17 3369

6–35 bp should be selected. Zinc finger combinations that bind REFERENCES

these sequences specifically would then be derived by design 1. Roberts,R.J. and Macelis,D. (1999) Nucleic Acids Res., 27, 312–313.
or selection and linked to the FokI cleavage domain. Expression 2. Belfort,M. and Roberts,R.J. (1997) Nucleic Acids Res., 25, 3379–3388.
and purification of the two resulting chimeric nucleases would 3. Kim,Y.-G., Cha,J. and Chandrasegaran,S. (1996) Proc. Natl Acad. Sci.
provide the desired site-specific cleavage reagent. USA, 93, 1156–1160.
4. Kim,Y.-G., Kim,P.S., Herbert,A. and Rich,A. (1997) Proc. Natl Acad.
The feasibility of this approach is demonstrated by our Sci. USA, 94, 12875–12879.
studies with hybrid sites for QQR and QNK (Fig. 6). These 5. Chandrasegaran,S. and Smith,J. (1999) Biol. Chem., 380, 841–848.
particular enzymes are not ideal reagents in this regard, since 6. Smith,J., Berg,J.M. and Chandrasegaran,S. (1999) Nucleic Acids Res., 27,
both zinc finger domains, especially QNK (6,24), show affinity 674–681.
for DNA sequences other than their canonical recognition 7. Kim,Y.-G. and Chandrasegaran,S. (1994) Proc. Natl Acad. Sci. USA, 91,
883–887.
sites. Better discrimination has been achieved in several 8. Huang,B., Schaeffer,C.J., Li,Q. and Tsai,M.-D. (1996) J. Protein Chem.,
instances by selecting against binding to related sites during 15, 481–489.
the evolution of novel specificities (19,21). Another possibility 9. Kim,Y.-G., Smith,J., Durgesha,M. and Chandrasegaran,S. (1998) Biol.
for improving selectivity is to include additional zinc fingers in Chem., 379, 489–495.
the constructs that would bind additional DNA triplets (37,38). 10. Nahon,E. and Raveh,D. (1998) Nucleic Acids Res., 26, 1233–1239.
11. Pavletich,N.P. and Pabo,C.O. (1991) Science, 252, 809–817.
Efficient double-strand cleavage with two chimeric nucleases 12. Berg,J.M. and Shi,Y. (1996) Science, 271, 1081–1085.
with three zinc fingers involves the recognition of 18 bp of 13. Desjarlais,J.R. and Berg,J.M. (1992) Proc. Natl Acad. Sci. USA, 89, 7345–7349.
DNA. This provides a remarkable degree of specificity, since 14. Desjarlais,J.R. and Berg,J.M. (1993) Proc. Natl Acad. Sci. USA, 90,
any particular 18 bp sequence is predicted to occur approxi- 2256–2260.
15. Choo,Y. and Klug,A. (1994) Proc. Natl Acad. Sci. USA, 91, 11163–11167.
mately once in 6.9 × 1010 (= 418) bp. This is ample specificity 16. Jamieson,A.C., Kim,S.-H. and Wells,J.A. (1994) Biochemistry, 33,
for locating a unique sequence in a mammalian genome (3 × 5689–5695.
109 bp), assuming that each zinc finger domain discriminates 17. Rebar,E.J. and Pabo,C.O. (1994) Science, 263, 671–673.
well against related sites. A very promising application of 18. Wu,H., Yang,W.-P. and Barbas,C.F. III (1995) Proc. Natl Acad. Sci. USA,
these enzymes is the in vivo production of chromosomal breaks 92, 344–348.
19. Greisman,H.A. and Pabo,C.O. (1997) Science, 275, 657–661.
that could stimulate targeted homologous recombination. In a 20. Isalan,M., Klug,A. and Choo,Y. (1998) Biochemistry, 37, 12026–12033.
separate study (Bibikova et al., manuscript in preparation), we 21. Segal,D.J., Dreier,B., Beerli,R.R. and Barbas,C.F. III (1999) Proc. Natl
demonstrate that QQR and QNK are both capable of binding Acad. Sci. USA, 96, 2758–2763.
and cleaving their recognition sites in vivo, even when those 22. Kim,Y.-G., Shi,Y., Berg,J.M. and Chandrasegaran,S. (1997) Gene, 203,
sites are incorporated in chromatin. In appropriately constructed 43–49.
23. Shi,Y. and Berg,J.M. (1995) Science, 268, 282–284.
substrates, this cleavage leads to efficient homologous recom- 24. Kim,C.A. and Berg,J.M. (1996) Nature Struct. Biol., 3, 940–945.
bination. 25. Bitinaite,J., Wah,D.A., Aggarwal,A.K. and Schildkraut,I. (1998)
Proc. Natl Acad. Sci. USA, 95, 10570–10575.
26. Maryon,E. and Carroll,D. (1989) Mol. Cell. Biol., 9, 4862–4871.
ACKNOWLEDGEMENTS 27. Maxam,A.M. and Gilbert,W. (1977) Proc. Natl Acad. Sci. USA, 74, 560–564.
28. Wah,D.A., Bitinaite,J., Schildkraut,I. and Aggarwal,A.K. (1998)
We are grateful to Dr David Segal for his participation in the Proc. Natl Acad. Sci. USA, 95, 10564–10569.
early phases of this project and to Jonathan Trautman for 29. Skowron,P., Kaczorowski,T., Tucholski,J. and Podhajska,A. (1993)
technical assistance. We thank Dr Jeremy Berg for advice on Gene, 125, 1–10.
zinc finger recognition and Dr H.O. Smith for continuing 30. Wah,D.A., Hirsch,J.A., Dorner,L.F., Schildkraut,I. and Aggarwal,A.K.
(1997) Nature, 388, 97–100.
interest in this project, which is an equal collaboration between 31. Kruger,D.H., Barcak,G.J., Reuter,M. and Smith,H.O. (1988)
the Chandrasegaran and Carroll laboratories. This work was Nucleic Acids Res., 16, 3997–4008.
supported in part by grants from the National Institutes of 32. Conrad,M. and Topal,M.D. (1989) Proc. Natl Acad. Sci. USA, 86,
Health (GM53923) and the National Science Foundation 9707–9711.
(MCB 9415861) to S.C. and by grants from the National 33. Oller,A.R., Vanden Broek,W., Conrad,M. and Topal,M.D. (1991)
Biochemistry, 30, 2543–2549.
Institutes of Health (GM50739 and GM58504) and the Univer- 34. Wentzell,L.M., Nobbs,T.J. and Halford,S.E. (1995) J. Mol. Biol., 248,
sity of Utah to D.C. Assistance was also provided by the 581–595.
Markey Center for Protein Biophysics and the Huntsman 35. Sugisaki,H. and Kanazawa,S. (1981) Gene, 16, 73–78.
Cancer Institute at the University of Utah and by the Environ- 36. Kim,S.C., Skowron,P.M. and Szybalski,W. (1996) J. Mol. Biol., 258,
638–649.
mental Health Sciences Core Facility at Johns Hopkins Univer- 37. Liu,Q., Segal,D.J., Ghiara,J.B. and Barbas,C.F. III (1997) Proc. Natl
sity (supported by NIH grant ES03819). S.C. is a member of the Acad. Sci. USA, 94, 5525–5530.
Scientific Advisory Board of Sangamo Biosciences Inc. 38. Kim,J.-S. and Pabo,C.O. (1998) Proc. Natl Acad. Sci. USA, 95, 2812–2817.