Acta Tropica 231 (2022) 106480

Contents lists available at ScienceDirect

Acta Tropica
journal homepage: www.elsevier.com/locate/actatropica

Hymenolepidid cestodes: Diversity, morphological and molecular

characterization of a new species, and phylogeny of parasitic species of
rodents from North and South America
Natalia Beatriz Guerreiro Martins a, *, Maria del Rosario Robles a, Graciela Teresa Navone a,
Callejón Rocío b
a
Centro de Estudios Parasitológicos y de Vectores (CEPAVE), CCT- CONICET- La Plata/Universidad Nacional de La Plata, Bv. 120 e/61 y 64, La Plata, Buenos Aires
1900, Argentina
b
Departamento de Microbiología y Parasitología, Facultad de Farmacia, Universidad de Sevilla, Sevilla, Spain

A R T I C L E I N F O A B S T R A C T

Keywords: Rodents are hosts of a wide diversity of cestodes. Fifteen genera included in the family Hymenolepididae
Argentina parasitize rodents, and only four of these genera have been recorded from the Neotropical region. The purpose of
Cestoda this paper is to update species of Hymenolepididae from rodents, describe a new species of Hymenolepis based on
Hymenolepididae
morphological and molecular characterization (ITS1 rDNA and cox1 mtDNA), comparing the features among the
Morphology
species from North and South American rodents, and provide phylogenetic inferences of Hymenolepididae from
Phylogenetic analysis
Rodentia rodents based on sequences available in the GenBank. Rodents were collected in the Parque Provincial Ernesto
Tornquist, Buenos Aires, Argentina. Hymenolepis ivanovae n. sp. differs from other Hymenolepis species registered
from North and South American rodents by body size, scolex, suckers, cirrus sac, cirrus, testes, and eggs, among
others. Comparative morphometric data for Hymenolepis species from North and South American rodents is
provided. Molecular analyses place H. ivanovae n. sp. within the genus Hymenolepis with strong support, and
show it close to species of zoonotic importance. The new species is the first species of Hymenolepis described from
Sigmodontinae rodents.

1. Introduccion least five families of Rodentia (Muridae, Geomyidae, Sciuridae, Crice­

tidae, and Spalacidae) (Gardner and Schmidt 1988; Makarikov and
The family Hymenolepididae Ariola, 1899 (Order Cyclophyllidea) is Tkach 2013; Gardner et al., 2014; Makarikov et al., 2015a).
the richest in number of species among the Cestoda, with about 850 Rodentolepis and Hymenolepis are the cosmopolitan genera of hyme­
species: 620 from birds and 230 from mammals. Also, the family con­ nolepidids with the highest species richness in rodents. Both genera have
tains over 130 genera, although many of them have been synonymized species of zoonotic importance (e.g. Martinez-Barbabosa et al., 2012;
(e.g. Czaplinski and Vaucher, 1994; Caira and Jensen, 2017). According Thompson, 2015; Di Yang et al., 2017), among these Rodentolepis nana
to Czaplinski and Vaucher (1994), the taxonomic identification of (Von Siebold, 1852) is a human parasite, although it can be found in
members of this family presents difficulties related to the great vari­ other mammals, and Hymenolepis diminuta (Rudolphi, 1819) a parasite
ability of morphological features and the lack of consensus about their of rats and mice, which is found occasionally in humans (Marti­
diagnostic value. These features include for example, uterine develop­ nez-Barbabosa et al., 2012).
ment, scolex morphology, and testes arrangement. Previous studies have used cytochrome c oxidase subunit 1 (cox1)
Fifteen genera are included in this family parasitizing rodents, six of partial gene of mitochondrial DNA (mtDNA); 12S and 18S small subunit
them have been recorded from North and South American rodents, and and internal transcribed spacer 2 (ITS2) regions of nuclear ribosomal
four from the Neotropical region (Hymenolepis Weinland, 1858;Gardner DNA (rDNA) rDNA to propose phylogenetic hypotheses among the
et al., 2020) Monogynolepis (Czaplinski and Vaucher, 1994; Spasskii, Cyclophyllidea (von Nickisch-Rosenegk et al., 1999; Foronda et al.,
1954). Moreover, these cestodes are globally distributed parasitizing at 2004; Tandon et al., 2011; Sharma et al., 2016a). In this context,

* Corresponding author.
E-mail address: natalia_gmartins@cepave.edu.ar (N.B. Guerreiro Martins).

https://doi.org/10.1016/j.actatropica.2022.106480
Received 14 May 2021; Received in revised form 11 March 2022; Accepted 17 April 2022
Available online 19 April 2022
0001-706X/© 2022 Elsevier B.V. All rights reserved.
N.B. Guerreiro Martins et al. Acta Tropica 231 (2022) 106480

morphological and molecular analyses have been provided for various Cestode specimens were collected from the small intestine, fixed in 10%
genera and species of Hymenolepididae (Hoberg et al., 2001; Olson formalin, and preserved in 70% ethanol. Some specimens were stained
et al., 2001; Georgiev et al., 2006; Haukisalmi et al., 2010). The with acidic carmine, dehydrated through an alcohol series, cleared in
monophyly of hymenolepidid was demonstrated by Mariaux (1998) on Eugenol, and mounted in natural Canada balsam. Specimens were
the basis of 18S rRNA sequences. The same analysis also strongly sug­ studied and photographed using a polarized light microscope (Olympus
gested the Anoplocephalidae as a sister group of Hymenolepididae. In BX51®). Drawings of specimens were made with the aid of a drawing
addition, phylogeny of mammalian hymenolepidids have been per­ tube. Measurements of specimens are given as follows: mean, standard
formed based on the partial 28S rDNA sequence (e.g. Mariaux, 1998; deviations, and range in parentheses. All measurements are given in
Haukisalmi et al., 2010). In this context, several studies on species of millimeters (mm) unless otherwise indicated. The ecological index
hymenolepidids as R. nana and H. diminuta have been provided (e.g. prevalence (P), and mean intensity (MI) were calculated for the species
Okamoto et al., 1997; Macnish et al., 2002; Sharma et al., 2016b). according to Bush et al. (1997).
Moreover, Haukisalmi et al. (2010) have proposed four multispecies Tables 1 and 2 show the Hymenolepididae species from rodents, and
clades of Hymenolepididae from rodents and shrews which show pro­ the morphometric comparison of Hymenolepis species from North and
nounced morphological variation and frequent colonizations among South American rodents, which were performed using specific bibliog­
unrelated hosts. Although rostellar morphology is obviously a key raphy and the digital repositories as Scielo, Redalyc, Scopus, Dialnet,
feature at specific and generic levels, at higher systematic levels it ap­ Pubmed, Google Academic, among others.
pears to be a rather poor indicator of phylogenetic affinity in Hymeno­ Nomenclatural acts have been registered in ZooBank, the online
lepididae cestodes. registration system for the ICZN. The type specimens were deposited in
To date, nine parasitic taxa of cestodes have been reported from the Helminthological Collection of Museo de La Plata, La Plata,
rodents in Argentina (Andrya octodonensis (Babero and Cattan, 1975), Argentina (MLP-He). La Plata, Buenos Aires and hosts in Mastozoo­
Hymenolepis diminuta, Rodentolepis nana, Hymenolepis sp., Rodentolepis logical Collection from Centro Nacional Patagónico (CNP), Puerto
cf. akodontis Rêgo (1967), Rodentolepis octocoronata (Von Linstow, Madryn, Chubut. CNP 3809, 4292, 4297, 4570, 4587. Other hosts with
1879), Rodentolepis srivastavai Rêgo (1970), Rodentolepis sp., and larvae collection number are in process, field numbers: ROB 7, 8, 9, 22, 23, 24,
of Hydatigera taeniaeformis (Batsch, 1786) [Strobilocercus fasciolaris]), all 25, 27, 48, 54, 55, 56, 57, 60, 65, 90, 91, 93, 98, 108, 123, 125, 126,
these records have been based on morphological studies (e.g. Rêgo, 131, 144, 153.
1970; Sutton, 1974; Navone et al., 2009; Haverkost and Gardner, 2010;
Martino et al., 2012; Miño et al., 2012; Guerreiro Martins et al., 2014; 2.4. Molecular analysis
Hancke and Suárez, 2016; Panisse et al., 2017; Fitte et al., 2017).
This paper aims to (1) update species of Hymenolepididae from ro­ 2.4.1. DNA extraction, amplification, and sequencing
dents, (2) describe a new species of Hymenolepis based on morphological Five adult specimens of cestodes from O. rufus of Buenos Aires
and molecular characterization (ITS1 rDNA and cox1 mtDNA), province were studied. The complete specimens previously identified
comparing the features among the species from North and South were stored in 96% ethanol until used for DNA extraction. Genomic DNA
American rodents, and (3) provide phylogenetic inferences of Hyme­ from proglottids was extracted and purified using a commercial DNA
nolepididae from rodents based on sequences available in the GenBank extraction kit (Wizard ® Genomic DNA Purification Kit, Promega,
(ITS1 rDNA and cox1 mtDNA genes). Madison, WI, USA) according to the manufacturer’s protocol for tissues.
Quality of extractions was assessed using 0.8% agarose gel electropho­
2. Materials and methods resis and ethidium bromide staining.
The ITS1 rDNA region was PCR-amplified using the following
2.1. Material examined primers and conditions (cited by Macnish et al., 2002): F3 (5’
GCGGAAGGATCATTACACGTTC 3’) and R3 (5’ GCTCGACTCTTCATC­
A total of 32 specimens of red hocicudo (Oxymycterus rufus [Crice­ GATCCACG 3’), 95◦ C for 15 min (initial denaturation), 35 amplification
tidae: Sigmodontinae]) were collected from Parque Provincial Ernesto cycles (95◦ C for 30 s, 57◦ C for 25 s, 72◦ C for 1 min), followed by final
Tornsquist (38◦ 04′ 44.55"S, 62◦ 00′ 19.04"W), Buenos Aires province, extension at 72◦ C for 7 min. The cox1 mtDNA partial gene region was
during field studies by several collaborators (see Acknowledgments). PCR-amplified the following primers and conditions (cited by Okamoto
et al., 1997): pr-a (5’ TGGTTTTTTGTGCATCCTGAGGTTTA 3’) and pr-b
2.2. Ethics statement (5’ AGAAAGAACGTAATGAAAATGAGCAAC 3’), 94◦ C for 3 min (initial
denaturation), 30 amplification cycles (94◦ C for 50 s, 42◦ C for 1 min 30
The research was conducted according to Argentine laws. Sample s, 72◦ C for 1 min 30 s), followed by final extension at 72◦ C for 7 min. The
collection was carried out during fieldwork under official permits PCR was performed in a Multigene Labnet Internation, Inc. thermocycler
granted by Organismo Provincial para el Desarrollo Sostenible (OPDS), and the products were checked on ethidium bromide-stained 1.5%
Province Buenos Aires, Disposicion 0132011, and Dirección de Fauna y Tris-Borate-EDTA (TBE) using 0.8% agarose gels electrophoresis and
Flora, Ministerio de Asuntos Agrarios, Province Buenos Aires, Dis­ examined by UV transillumination. All PCR products were purified and
posicion 141, in accordance with the recommendations in the Guide for sequenced in both directions using amplifying primers (Macrogen,
the Care and Use of Laboratory Animals of the National Institute of Seoul, Korea).
Health. Rodent specimens were collected, following the procedures and
protocols approved by national laws (Animal Protection National law 2.5. Sequence analysis
14.346 and references in the provincial permits), and ethical recom­
mendations for Research on Laboratory Animals, Farm and Obtained The sequences were registered in National Centre for Biotechnology
from Nature of National Council of Scientific and Technical Research Information (NCBI) GenBank database rDNA (ITS1) and mtDNA (cox1)
(CONICET), and subsequently aproved by the National Agency for the sequences were aligned using the MUSCLE alignment method included
Promotion of Science and Technology of Argentina (ANPCYT). No en­ in MEGA, version 7.0 (Kumar et al., 2016). Additional sequences from
dangered species were involved in this study. GenBank database were incorporated into the alignments (Table 3).
To assess the similarity among the marker sequences of specimens
2.3. Morphological analysis analyzed in the present study and other Hymenolepididae species, the
number of base differences per sequence with respect to the those under
Viscera were studied under a stereomicroscope (Olympus SZ61-TR). investigation was assessed using the number of differences method of

2
N.B. Guerreiro Martins et al. Acta Tropica 231 (2022) 106480

Table 1
Hymenolepididae species from rodents.
Parasite Type Host Type locality (by country) Refs.
Genus Specie Family Specie

Armadolepis A. dryomi Gliridae Dryomys nitedula Russia Makarikov et al. (2018)

A. genovi Gliridae Glis glis Bulgaria Makarikov and Georgiev (2020)
A. jeanbaeri Gliridae Eliomys quercinus Switzerland Makarikov (2017)
A. longisoma Gliridae Glis glis Russia Makarikov et al. (2018)
A. spasskii Gliridae Eliomys quercinus Slovakia Makarikov and Georgiev (2020)
A. tenorai Gliridae Dryomys nitedula Kazakhstan Makarikov (2017)
Arostrilepis A. beringiensis Cricetidae Lemmus trimucronatus Russia Makarikov and Kontrimavichus
(2011)
A. cooki Cricetidae Myodes gapperi Canada Makarikov et al. (2013b)
A. gulyaevi Cricetidae Myodes rufocanus Russia Makarikov et al. (2013b)
A. horrida Muridae Rattus norvegicus Germany Makarikov et al. (2011)
A. intermedia Cricetidae Myodes rufocanus Russia Makarikov and Kontrimavichus
(2011)
A. janickii Cricetidae Arvicola scherman Switzerland Makarikov and Kontrimavichus
(2011)
A. kontrimavichusi Cricetidae Myodes californicus United State Makarikov and Hoberg (2016)
A. macrocirrosa Cricetidae Myodes rutilus Russia Makarikov et al. (2011)
A. mariettavogeae Cricetidae Peromyscus californicus United State Makarikov et al. (2012)
A. microtis Cricetidae Microtus oeconomus Russia Gulyaev and Chechulin (1997)
A. rauschorum Cricetidae Microtus oeconomus Alaska Makarikov et al. (2013b)
A. schilleri Geomyidae Thomomys bulbivorus United State Makarikov et al. (2012)
A. tenuicirrosa Cricetidae Myodes rutilus Russia Makarikov et al. (2011)
Arvicolepis A. transfuga Cricetidae Arvicola terrestris Russia Makarikov et al. (2005)
Chitinolepis C. mjoebergi Muridae Leopoldamys sabanus Malaysia Baylis (1926)
Hobergia H. irazuensis Geomyidae Heterogeomys heterodus Costa Rica Gardner et al. (2020)
Hymenandrya H. aegyptica Muridae Psammomys obesus Egypt Mikhail and Fahmy (1968)
H. thomomyis Geomyidae Thomomys talpoides United State Smith (1954)
Hymenolepis H. alterna Muridae Rattus everetti Philippines Makarikov et al. (2015b)
H. apodemi Muridae Apodemus peninsulae Russia Makarikov and Tkach, 2013
H. bennetti Dipodidae, Napaeozapus insignis, Peromyscus maniculatus Canada Freeman (1960)
Cricetidae
H. bicauda Muridae Apomys microdon Philippines Makarikov et al. (2013a)
H. bilaterala Muridae Apomys datae Philippines Makarikov et al. (2015b)
H. citelli Sciuridae Spermophilus franklinii, S. richardsoni, S. Canada McLeod (1933)
tridecemlineatus
H. contracta Muridae Mus musculus Switzerland Janicki (1906)
H. cratogeomyos Geomyidae Cratogeomys planiceps Mexico Gardner et al. (2020)
H. diminuta Muridae Rattus rattus Brazil Rudolphi (1819)
H. folkertsi Cricetidae Peromyscus polionotus United State Makarikov et al. (2015a)
H. geomydis Geomyidae Geomys bursarius United State Gardner and Schmidt (1988)
H. haukisalmii Muridae Bullimus luzonicus Philippines Makarikov et al. (2013a)
H. hibernia Muridae Apodemus sylvaticus Ireland Montgomery et al. (1987)
H. mathevossianae Cricetidae Mesocricetus brandti Russia Akumyan (1948)
H. microcantha Muridae Gerbilliscus brantsii South Africa Collins (1972)
H. pitymi Cricetidae Microtus pinetorum United State Yarinsky (1952)
H. pseudodiminuta Muridae Apodemus speciosus, A. argenteus Japan Tenora et al. (1994)
H. relicta Muridae Rattus norvegicus France Blanchard (1891)
H. robertrauschi Cricetidae Onychomys leucogaster United State Gardner et al. (2014)
H. rymzhanovi Spalacidae Myospalax myospalax Kazakhstan Makarikov and Tkach (2013)
H. steatomidis Nesomyidae Steatomys spp. Republic of Côte d’Ivoire Hunkeler, 1974
H. suslica Sciuridae Spermophilus suslicus Russia Tinnin et al. (2011)
H. taterae Muridae Gerbilliscus brantsii South Africa Collins (1972)
H. tualatinensis Geomyidae Thomomys bulbivorus United State Gardner (1985)
H. uranomidis Muridae Uranomys ruddi Republic of Côte d’Ivoire Hunkeler, 1974
H. vogeae Muridae Mus booduga India Singh (1956)
H. weldensis Geomyidae Geomys bursarius United State Gardner and Schmidt (1988)
Lophurolepis L. petteri Muridae Lophuromys sikapusi Central African Republic Spassky (1973)
Monogynolepis M. taglei Chinchillidae Lagidium peruanum Chile Olsen (1966)
Nomadolepis N. ellobii Cricetidae Ellobius talpinus Siberia Makarikov et al. (2010)
N. fareasta Cricetidae Cricetulus barabensis Russia Makarikov et al. (2015c)
N. merionis Cricetidae Cricetulus migratorius Kazakhstan Makarikov et al. (2010)
N. shiloi Muridae Micromys minutus Russia Makarikov et al. (2015c)
Paraoligorchis P. taterae Muridae Tatera indica India Wason and Johnson (1977)
Pararodentolepis P. sinistra Muridae Rattus norvegicus Siberia Makarikov and Gulyaev (2009)
Pseudandrya P. straeleni Muridae Tatera sp. Democratic Republic of Baer and Fain (1955)
Congo
Relictolepis R. feodorovi Cricetidae Myodes rufocanus Russia Gulyaev and Makarikov (2007)
Rodentolepis R. akodontis Cricetidae Akodon cursor Brazil Rêgo (1967)
R. asymmetrica Cricetidae Chionomys nivalis Switzerland Baer (1932)
R. crassa Muridae Mus musculus Germany Spassky (1954)
R. criceti Cricetidae Cricetus cricetus ?Germany Spassky (1954)
R. evaginata Cricetidae Ondatra zibethicus United State Barker (1915)
R. fraterna Muridae, Gliridae France Dujardin (1845)
(continued on next page)

3
N.B. Guerreiro Martins et al. Acta Tropica 231 (2022) 106480

Table 1 (continued )
Parasite Type Host Type locality (by country) Refs.
Genus Specie Family Specie

Rattus norvegicus, Micromys minutus, Eliomys

quercinus
R. johnsoni Cricetidae Microtus pennsylvanicus Canada Schiller (1952)
R. microstoma Muridae Mus musculus France Dujardin (1845)
R. murisvariegati Muridae Arvicanthis niloticus ?Egypt Spassky (1954)
R. negevi Muridae Acomys cahirinus Israel Greenberg (1969)
R. ondatrae Cricetidae Ondatra zibethicus United State Rider and Macy (1947)
R. octocoronata Myocastoridae Myocastor coypus Argentina Sutton (1974)
R. oregonensis Cricetidae Ondatra zibethicus United State Neiland and Senger (1952)
R. peromysci Cricetidae Peromyscus boylii United State Tinkle (1972)
R. pearsei Muridae Hybomys univittatus Nigeria Joyeux and Baer (1930)
R. srivastavai Cricetidae Necromys lasiurus Brazil Rêgo (1970)
R. straminea Cricetidae Cricetus Cricetus France Bruguière (1791)
R. uncinispinosa Muridae Hybomys univittatus, Mastomys erythroleucus Nigeria Joyeux and Baer (1930)

Table 2
Morphological features and measures (mm) of Hymenolepis spp. from South and North American rodents.
Species H. citelli H. cratogeomyos H. diminuta H. folkertsi H. geomydis

Author McLeod (1933) Gardner et al. (2020) Rudolphi (1819) Makarikov (2015) Gardner and Schmidt
(1988)
Ref. McLeod (1933) Gardner et al. (2020) Wardle y McLeod (1952) Makarikov (2015a) Gardner and Schmidt
(1988)
References molecular - - Litvaitis and Rohde (1999) Hoberg et al. (2016) -
characterization
Host Spermophilus Cratogeomys planiceps Rattus rattus, Rattus norvegicus, Peromyscus polionotus Geomys bursarius
tridecemlineatus; Mus musculus
Spermophilus
richardsoni;
Spermophilus franklini
Country Canada Mexico Cosmopolitan United States United States
Infection site Stomach, intestine Small intestine Small intestine Small intestine Small intestine,
duodenum
Total length 150 88–129 200–300 99–116 72.26–168.41
Maximum width 28 2.72–3.41 3.00–4.00 1.71–1.85 1.98–3.30
Scolex L/W - 0.19–0.20 × 0.21–27 0.29–0.30 0.17 0.19–0.25 × 0.19–0.24
Sucker L/W 0.11 × 0.24 0.10–0.11 × 0.08–0.09 0.10–0.12 0.09–0.10 × 0.07–0.08 0.09–0.12 × 0.06–0.09
Testes L/W 0.14 × 0.11 0.14–0.19 × 0.09–0.12 - 0.07–0.11 × 0.04–0.06 0.08–0.18 × 0.05–0.18
Cirrus sac L/W 0.15–0.23 × 0.03–0.06 0.12–0.14 × 0.04–0.05 0.17–0.38 × 0.05–0.08 0.14–0.15 × 0.03–0.04 0.08–0.16 × 0.03–0.07
Eggs L/W 0.07–0.08 × 0.05–0.06 0.06–0.09 × 0.04–0.06 0.06–0.07 0.04–0.05 × 0.02–0.03 0.07–0.08 × 0.07–0.08
Species H. pitymi H. robertrauschi H. tualatinensis H. weldensis H. ivanovae n. sp.
Author Yarinsky (1952) Gardner et al. (2014) Gardner (1985) Gardner and Schmidt
(1988)
References Yarinsky (1952) Gardner et al. (2014) Gardner (1985) Gardner and Schmidt Present work
(1988)
References molecular - - - Haukisalmi et al. Present work
characterization (2010)
Host Microtus pinetorum Onychomys leucogaster Thomomys bulbivorus Geomys bursarius Oxymycterus rufus
Country United States United States United States United States Argentina
Infection site Small intestine Small intestine, Small intestine, duodenum Small intestine, Small intestine
duodenum duodenum
Total length 19.6 42.40 - 83.40 24–210 111.90–165.20 29.30–54.60
Maximum width - 284 - 454 1.75 1.87–2.29 0.78–2.62
Scolex L/W 0.13 × 0.15 0.19 - 0.26 0.09–0.17 0.14–0.25 × 0.12–0.28 0.12–0.40 × 0.13–0.57
Sucker L/W 0.08 x 0.04 0.12 - 0.16 × 0.08 - - - 0.07–0.22 × 0.05–0.16
0.09
Testes L/W 0.06 × 0.05 0.09–0.16 × 0.07–0.12 0.06–0.14 × 0.05–0.14 0.09–0.16 0.07–0.22 × 0.02–0.08
Cirrus sac L/W 0.07–0.08 × 0.02–0.03 0.15 - 0.23 × 0.03 - 0.05–0.15 × 0.02–0.05 0.15–0.19 × 0.03–0.05 0.05–0.12 × 0.02–0.04
0.06
Eggs L/W 0.04–0.06 × 0.02–0.04 0.06 - 0.07 × 0.04 - 0.06–0.09 × 0.04–0.07 0.07–0.08 × 0.06–0.07 0.04–0.06 × 0.02–0.04
0.06

L length, W width

MEGA 7 program version 7.0 (Kumar et al., 2016). Nevertheless, we propose a rooted tree for the mtDNA (cox1) dataset,
using Arostripelis horrida, Coronacanthus spp. and Staphylocystoides spp.
2.6. Phylogenetic analyses as outgroups (Table 3).
Phylogenetic analyses were performed by Maximum Likelihood (ML)
Since we were looking to measure the diversity and conservancy using the PHYML package from Guindon and Gascuel (2003) and
Bayesian inferences (BI) were generated using MrBayes, version 3.2.6
between a set of sequences, and considering that rDNA (ITS1) dataset
sequences present a substantial length variation which compromise in­ (Ronquist and Huelsenbeck, 2003). Each dataset was analyzed sepa­
rately, and both mitochondrial and ribosomal datasets were combined
ferences of positional homology, an unrooted tree is proposed.

4
N.B. Guerreiro Martins et al. Acta Tropica 231 (2022) 106480

Table 3
Sequences of Hymenolepididae species used for phylogenetic analyses (GenBank Accession numbers).
Species Host species / Geographical origin Code Gene / Region GenBank Accession numbers References

Hymenolepis ivanovae n. sp Oxymycterus rufus / Argentina Hsp1 ITS1 LR884484 This paper
Hsp2 LR884485 This paper
Hsp3 LR884486 This paper
Hsp4 LR884487 This paper
Hsp5 LR884488 This paper
Hymenolepis diminuta Rattus rattus / South Africa Hd1 MG322244 Julius et al. (2018)
Rattus norvergicus / South Africa Hd2 MG322245 Julius et al. (2018)
Lemur catta / China Hd3 KP317833 -
Rodentolepis nana Homo sapiens / Asia Rn1 MH629970 -
Homo sapiens / Asia Rn2 MH629973 -
Mus sp. /Japan Rn3 AF461124 -
Rattus rattus / Iran Rn4 KJ917784 -
Rodentolepis fraterna Rattus rattus / Spain Rf JN258041 Foronda et al. (2011)
Rodentolepis microstoma Homo sapiens / Australia Rm1 AY221156 Macnish et al. (2003)
Rm2 AY221158 Macnish et al. (2003)
Rm3 AY221160 Macnish et al. (2003)
Rm4 AY221161 Macnish et al. (2003)
Rm5 AY221162 Macnish et al. (2003)
Rm6 AY221163 Macnish et al. (2003)
Rm7 AY221164 Macnish et al. (2003)
Rm8 AY221167 Macnish et al. (2003)
Rm9 JN258040 Foronda et al. (2011)
Hymenolepis ivanovae n. sp Oxymycterus rufus / Argentina Hsp1 Cox1 LR884489 This paper
Hsp2 LR884490 This paper
Hsp3 LR884491 This paper
Hsp4 LR884492 This paper
Hsp5 LR884493 This paper
Hymenolepis diminuta Rattus sp. / United States Hd1 LC063183 Nkouawa et al. (2016)
Rattus sp. / United Kingdom Hd2 MH472979 Řežábková et al. (2019)
Rattus norvergicus / Spain Hd3 MH472980 Řežábková et al. (2019)
Homo sapiens / Poland Hd4 MH472981 Řežábková et al. (2019)
Rattus sp. / Czech Republic Hd5 MH472982 Řežábková et al. (2019)
Rattus norvergicus / Spain Hd6 MH472983 Řežábková et al. (2019)
Homo sapiens / Poland Hd7 MH472986 Řežábková et al. (2019)
Rattus norvergicus / Japan Hd8 KE689687 -
Rattus norvergicus Poland Hd9 LC063185 Nkouawa et al. (2016)
Tribolium castaneum / China Hd10 KF689686 -
KC990410 -
Hymenolepis hibernia Apodemus agrarius / South Korea Hh1 LC063179 Nkouawa et al. (2016)
Apodemus sylvaticus / Turkey Hh2 LC063181 Nkouawa et al. (2016)
Rodentolepis nana Mus musculus / Japan Rn1 AB494471 Okamoto et al. (1997)
Mesocricetus auratus / Uruguay Rn2 AB494472 Okamoto et al. (1997)
Homo sapiens / Mexico Rn3 HM447234 -
Homo sapiens / Mexico Rn4 HM447235 -
Mus sp. / Mexico Rn5 HM447238 -
Mus musculus / China Rn6 LC063187 Nkouawa et al. (2016)
Rattus rattus / India Rn7 KU821727 -
Rattus norvergicus / China Rn8 KY079336 -
Rattus sp. / Egypt Rn9 GU433102 -
Rattus sp. / Egypt Rn10 GU433103 -
Homo sapiens / Egypt Rn11 GU433104 -
Rodentolepis fraterna Rattus rattus, Mus musculus / Spain Rf JN258053 Foronda et al. (2011)
Rodentolepis microstoma Mus musculus / Peru Rm1 MG570384 Gomez-Puerta and Valdivia-Carrera (2018)
Mus musculus / China Rm2 LC063188 Nkouawa et al. (2016)
Mus musculus / Japan Rm3 AB494473 Okamoto et al. (1997)
Outrgousp
Arostripelis horrida Cletrhionomys gloereolus/ Lithuania Ah1 Cox1 DQ340976 -
Ah2 DQ340977 -
Coronacanthus magnihamatus Clethrionomys glareolus / Belarus Cm1 KJ710327 -
Coronacanthus vassilevi Neomys fodiens / Bulgary Cv KJ710328 -
Coronacathus integrus Ci KJ710329 -
Staphylocystoides gulyaevi Sg KC789837 Greiman et al. (2013)
Staphylocystoides parissima Sorex monticolus / United States Sp KC789840 Greiman et al. (2013)

into a total evidence dataset. jModeltest was employed to compute the included general time-reversible model with gamma-distributed rate
best partitioning scheme, as well as the best nucleotide substitution GTR + G (ITS1), general time reversible model with gamma-distributed
models for each partition (Posada, 2008). Models of evolution were rate variation and a proportion of invariable sites GTR + I + G (cox1
chosen for subsequent analysis according to the Akaike Information mtDNA) and general time-reversible model with gamma-distributed rate
Criterion (Posada and Buckley, 2004). GTR + G (concatenated markers). Support for the topology was exam­
For the study of the dataset containing the concatenation of two ined using bootstrapping (heuristic option) (Felsenstein, 1985) over
markers (ITS1 and cox1), analyses based on BI were partitioned by gene 1000 replications to assess the relative reliability of clades. The com­
and models for individual genes within partitions were those selected by mands used in MrBayes for BI were nst = 6 with gamma rates (ITS1),
jModelTest. For ML inference, best-fit nucleotide substitution models nst = 6 with invgamma rates (cox1) and nst = mixed (concatenated

5
N.B. Guerreiro Martins et al. Acta Tropica 231 (2022) 106480

phylogenetic trees). proglottids much broader than longer. Fully developed strobila 42.78 ±
Bayesian posterior probabilities (BPP) comprise the percentage 12.81 (29.30–54.60) mm long. Scolex 0.19 ± 0.10 (0.12–0.40) long by
converted for BI, the standard deviation of split frequencies was used to 0.25 ± 0.15 (0.13–0.57) wide (Fig. 1A). Suckers unarmed, oval, 0.12 ±
determine whether the number of generations completed was sufficient. 0.05 (0.07–0.22) long by 0.09 ± 0.04 (0.05–0.16) wide. Rostellum
Each analysis was run for 10 million generations, and the tree was present, unarmed. Apical organ not observed. Rostellar pouch 0.10 ±
sampled every 500 generation. Trees from the first million generations 0.02 (0.08–0.12) long by 0.06 ± 0.01 (0.04–0.07) wide. Mature pro­
were discarded based on an assessment of convergence. Burn-in was glottids 0.10 ± 0.03 (0.06–0.16) long by 1.71 ± 0.37 (1.44–2.42) wide
determined empirically by examination of the log likelihood values of (Fig. 1B). Genital pores unilateral. Testes subspherical, 0.08 ± 0.05
the chains. After eliminating the first million trees as ‘‘burn-in’’, we (0.07–0.22) long by 0.04 ± 0.02 (0.02–0.08) wide (Figs. 1B, 2B); poral
constructed a 50% majority-rule consensus tree, with nodal values testis separated from two antiporal testes by female gonads. Cirrus sac
representing the probability (posterior probability) that the recovered elongate, relatively short, does not touch the osmoregulatory canals,
clades exist, given the aligned sequence data. We accepted a clade in the 0.08 ± 0.03 (0.05–0.12) long by 0.03 ± 0.01 (0.02–0.04) wide. Smooth
Bayesian tree at around 70% posterior probability. and cylindrical cirrus, approximately 43 µm long and 7 µm wide. In­
ternal and external seminal vesicle present. Well-developed seminal
3. Results receptacle. Ovary lobate, 0.17 ± 0.05 (0.11–0.24) wide. Vitellarium
0.06 ± 0.02 (0.04–0.07) wide. Gravid proglottids, 0.23 ± 0.07
Each particular aim is listed with the corresponding results. (0.19–0.32) long by 1.83 ± 0.65 (0.78–2.62) wide. Uterus saccular and
lobed; fully developed occupying entire median field and extending
(1) This study provided an update of rodent hymenolepidid species in laterally beyond longitudinal osmoregulatory canals. Eggs subspherical
Table 1. A total of 55 records were found, which correspond to 79 54.90 ± 8.01 (45.66–65.86) µm long by 39.94 ± 8.04 (26.50–49.66) µm
Hymenolepididae species from 66 host species of 29 geographical wide (Figs. 1C, 2A); oncosphere 35.8 ± 6.01 (31–46) µm long by 25.8 ±
areas. 4.3 (22–33) µm wide. Measurements of embryonic hooks as follows:
(2) A morphological and molecular characterization (mitochondrial larger hooks of first and third pairs 13.12 ± 0.80 (11.35–14.21) µm
and ribosomal markers) is provided. length; smaller hooks of first and third pairs, 11.29 ± 0.45
(10.63–12.16) µm long; middle pair of hooks, 10.58 ± 0.58
Morphological and biometrical results (9.40–11.16) µm long.

3.1. Hymenolepis ivanovae n. sp. (Figs. 1 and 2, Table 2) 3.2. Taxonomic summary

Description (based on seven specimens): The characters observed in 3.2.1. Type host
the specimens agree with the genus Hymenolepis by strobila with Oxymycterus rufus (Fischer, 1814)
numerous proglottids and progressive maturation. Craspedote

Fig. 1. . Hymenolepis ivanovae n. sp. from Oxymycterus rufus (Holotype). (A) scolex. (B) mature proglottid. (C) egg.

6
N.B. Guerreiro Martins et al. Acta Tropica 231 (2022) 106480

Fig. 2. . Stained mounts of Hymenolepis ivanovae n sp from Oxymycterus rufus. (A) Holotype, egg. (B) Paratype, mature proglottids, showing ovary (o), testes (t) and
vitellarium (v).

3.2.2. Symbiotype respectively). The new species can be separated from H. cratogeomyos, H.
with collection number in process, field number: ROB 153 folkertsi, H. geomydis, H. robertrauschi, H. tualatinensis, and H. weldensi by
having a smooth cirrus. Hymenolepis ivanovae n. sp differs from H. citelli,
3.2.3. Type locality H. cratogeomyos, H. diminuta, H. folkertsi, H. geomydis, H. pitymi, H.
Parque Provincial Ernesto Tornquist, Buenos Aires province robertrauschi, H. tualatinensis and H. weldensi by having larger testes. In
(38◦ 04′ 44.55"S, 62◦ 00′ 19.04"W) addition, the new species differs from H. cratogeomyos, H. citelli, H.
diminuta, H. geomydis, H. robertrauschi and H. weldensis by the size of the
3.2.4. Site of infection eggs (0.05 × 0.03 vs. 0.06–0.09 × 0.04–0.06; 0.07–0.08 × 0.05–0.06;
Small intestine 0.06–0.07; 0.07–0.08; 0.06–0.07 × 0.04–0.06; 0.07–0.08 × 0.06–0.07,
respectively). Other metric differences of all Hymenolepis species of
3.2.5. Deposited specimens North and South American rodents can be observed in Table 2.
Holotype (no. 6805), and a total of five paratypes (no. 7720) were Hymenolepis horrida (von Linstow, 1901) (=Taenia horrida) recorded
deposited at MLP-He in Peromyscus californicus in the United States, was transferred to the
genus Arostrilepis by Mas-Coma and Tenora (1997), and for this reason
3.2.6. Host-parasite data its comparison was not considered.
P=81.2% (26/32), MI=4.2, and MA=3.4. Hymenolepis (sensu stricto) and Rodentolepis Spasskii 1954 are the
most species-rich hymenolepidid genera of rodents. The type species
3.2.7. Etymology H. diminuta and other species representing Hymenolepis (sensu stricto)
This species is named in honor of the outstanding Argentine parasi­ are characterized by a rudimentary, unarmed rostellum. However, the
tologist Dra. Verónica Ivanov, in recognition of her valuable contribu­ systematic relationships among species assigned to Rodentolepis (with
tions to the taxonomy and systematics of cestodes armed rostellum) are unclear, primarily reflecting the absence of
comprehensive phylogenetic studies (Haukisalmi et al., 2010). Although
3.2.8. Recorded in URN as urn some authors consider that Rodentolepis nana belongs to the genus
lsid:zoobank.org:act:AB69ED8E-9EEC-49FA-AF03-1168B43F5AFD Hymenolepis, both the presence of hooks and the evidence from recent
genetic studies indicate that this species, together with Rodentolepis
3.2.9. Remarks fraterna and Rodentolepis microstoma are part of the same clade (Macnish
Hymenolepis ivanovae n. sp. has morphological characters typical of et al., 2002; Haukisalmi et al., 2010) and support its exclusion from the
the genus, i.e. scolex with unarmed rostellum, ventral canals with comparative table (see Table 2).
transverse anastomoses, three testes separated into two groups by the
female gonads, multilobed ovary, short cirrus sac does not reach half the 3.3. Molecular data results
proglottids, labyrinthine uterus, oval eggs. However, morphological
comparison of H. ivanovae n. sp with species of Hymenolepis parasitic in Nucleotide sequence data of the ITS1 rDNA fragment and cox1 par­
North and South American rodents (Table 2) has revealed several fea­ tial sequences of mtDNA from Hymenolepis ivanovae n. sp. are reported
tures unique to the new species. and are available in GenBank (GenBank accession number) (Table 3).
The specimens here studied differ from H. citelli, H. cratogeomyos, H. The ITS1 rDNA region revealed five haplotypes (Hsp1-Hsp5): these
diminuta, H. folkertsi, H. geomydis and H. weldensi by a smaller body size sequences were 485 base pairs (bp) (exclusive of the primers) and their
(42.78 vs. 88–129; 150; 200–300; 99–116; 72.26–168.41; G+C content was 47.1–50.3% The multiple alignment of 22 ITS1 se­
111.90–165.20, respectively). Hymenolepis ivanovae n. sp. can be sepa­ quences (including sequences of species representing members of the
rated from H. pitymi and H. tualatinensis by the larger size of the scolex genus Hymenolepis from rodents and Lemur catta, and Rodentolepis from
(0.19 × 0.25 vs. 0.13 × 0.15; 0.09–0.17, respectively). Hymenolepis rodents and H. sapiens were available in GenBank, Table 3) shows a
ivanovae n. sp. has smaller suckers than H. citelli and H. robertrauschi dataset of 510 characters.
(0.09 × 0.12 vs. 0.11 × 0.24; 0.08–0.09 × 0.12–0.16, respectively). The The intra-specific similarity observed in ITS1 sequences of
cirrus sac of the new species is smaller than H. cratogeomyos, H. folkertsi H. ivanovae n. sp. from Argentina ranged 98.8–99.8%. Similar values of
and H. robertrauschi (0.08 vs. 0.12–0.14; 0.14–0.15; 0.15–0.23, intra-specificity are found among other species of hymenolepidids. A

7
N.B. Guerreiro Martins et al. Acta Tropica 231 (2022) 106480

wider range was observed in H. diminuta (98.4–100%) than in polytomy supported with high values (100% ML BV and 99% BPP,
H. ivanovae n. sp. (98.8–99.8%), and R. nana presented a higher intra- Fig. 4). Relationships within Clade 2 were the same respect to dataset
specific similarity (99.4–100%) respect to R. microstoma (98.8–99.9%) ITS1 (Fig. 3).
(Table 4). In contrast, the minimum values of inter-specific similarity The concatenated dataset of ribosomal (ITS1) and mitochondrial
was observed between different genera: H. diminuta and R. microstoma (cox1) gene sequences included 854 aligned sites and only 16 taxa
(56.7–58.2%) and the maximum values were observed within the same (outgroups not included for phylogenetics analysis). Phylogenetic ana­
genus: R. nana and R. microstoma (81.4–82.35%) (Table 4). lyses of this dataset yielded a tree with branches that were strongly
Cox1 mtDNA encoding gene revealed five haplotypes (Hsp1-Hsp5): supported (100% ML BV and 96–100%BPP). Phylogenetic inferences are
these sequences were 301 base pairs (bp) (exclusive of the primers) and in agreement with phylogenetic results based on separated markers.
their G+C content was 32.2–33.5%. The multiple alignment of 39 cox1 Thus, two main clades were observed: Clade 1 including Hymenolepis
partial sequences (including sequences of species representing members spp. (H. diminuta [subclade 1a] and H. ivanovae n. sp. [subclade 1b]) and
of the genus Hymenolepis from rodents, H. sapiens and Tribolium casta­ Clade 2 including Rodentolepis spp. (R. nana and R. fraterna [subclade
neum, and Rodentolepis from rodents and H. sapiens and outgroups 2a] and R. microstoma [subclade 2b]) with strong support of branches
available in GenBank, Table 3) yield a dataset of 301 characters. (100% ML bootstrap values BV and BPP) (Fig. 5).
The intra-specific similarity observed in cox1 sequences of
H. ivanovae n. sp. from Argentina ranged from 98.7–99.7%. The 4. Discussion
maximum value of intra-specific similarity was observed in H. diminuta
99.7–100% and the minimum value was 95.01% corresponding to Hymenolepis ivanovae n sp differs from other Hymenolepis species
H. hibernia (Table 5). For the genus Rodentolepis, the maximum and recorded from North and South American rodents, and from those
minimum values of intra-specific similarity was observed in R. nana available in the GenBank.
(98.3–100%) (Table 5). On the other hand, the minimum values of inter- Hymenolepidid tapeworms have been widely recorded in Cricetidae,
specific similarity was observed between different genus, H. ivanovae n. Muridae, Geomyidae, Dipodidae, and Sciuridae (Hoberg et al., 2016),
sp. and R. nana (79.1–82.4%) and the maximum values were observed in being most frequent in the Cricetidae and Muridae (see Table 1). We add
the same genus, H. ivanovae n. sp. and H. hibernia (84–86%) (Table 5). a new species, H. ivanovae, to the previous nine species of Hymenolepis
described from North and South American rodents. This new species is
(1) Phylogenetic inferences of Hymenolepididae from rodent based the first species of genus Hymenolepis reported from Sigmodontinae ro­
on sequences available in the genbank (ITS1 rDNA and cox1 dents. Currently, four hymenolepidid species are parasites of this rodent
mtDNA genes) subfamily, and of these, three were recorded in Argentina (R. cf. ako­
dontis, Rodentolepis sp. and H. ivanovae n. sp) (Navone et al., 2009;
Phylogenetic trees based on ITS1 rDNA provided robust phylogenetic Guerreiro Martins et al., 2014; Panisse et al., 2017). Many species of
resolution among Hymenolepididae taxa regardless of the inference Hymenolepis have been poorly described, generating a large number of
method (ML and BPP). The topology showed the existence of two main synonyms and other nomenclatural difficulties (Czaplinski and
clades: Clade 1 including Hymenolepis spp. (H. ivanovae n. sp. and Vaucher, 1994). The taxonomic status and systematics of Hymenolepis
H. diminuta) and Clade 2 including Rodentolepis spp. (R. nana, R. fraterna species are problematic, since cryptic species have been identified
and R. microstoma) with strong support of branches (100% ML bootstrap (Haukisalmi et al., 2010). Consequently, the genus Hymenolepis has been
values BV and Bayesian posterior probability BPP). Furthermore, within revised on several occasions, and the conformation and internal struc­
Clade 1, two subclades were observed: subclade 1a including H. diminuta ture remain controversial (Cunningham and Olson, 2010).
(100% ML BV and BPP) and subclade 1b including H. ivanovae n. sp. In the present study, a valuable update on the Hymenolepididae
from Buenos Aires from Argentina (96% BPP), and within Clade 2 two parasite species of rodents is provided. The listed of species include 15
subclades were observed: subclade 2a including R. nana and R. fraterna genera and 79 species of Hymenolepididae parasites of 43 genera and 66
with high support (94% ML BV and 100% BPP) and subclade 2b species of rodents recorded in each type locality from 29 countries. In
including R. microstoma (79% ML BV and 100% BPP) (Fig. 3). addition, the new species described here is compared with nine species
The analysis of the dataset based on cox1 mtDNA showed a partial of Hymenolepis spp. providing morphological data. The description of
congruence respect to the phylogenetic relationships between Hymeno­ H. ivanovae n. sp. was based on specimens of O. rufus from a locality in
lepis spp. based on dataset ITS1. Phylogenetic analysis provided robust the Buenos Aires province, that has an environment characterized by the
phylogenetic resolution among Hymenolepididae taxa regardless of the Pampean grassland. This species seems to be strongly associated with
inference method (ML and BPP). The topology showed the existence of the host and the environment, since other species of sigmodontine ro­
three main clades: Clade 1 including H. hibernia and H. ivanovae n. sp. dents distributed in the same locality were parasitized with a different
(93% ML BV and 96%BPP); Clade 1* including H. diminuta (96% ML BV species of hymenolepidid (unpublished data). Some ecological data of
and 99% BPP); Clade 2 including R. nana, R. fraterna and R. microstoma H. ivanovae n. sp. are given, indicating a high prevalence of the species in
(100% ML BV and BPP) (Fig. 4).These three clades were formed as a the sampled area.
In recent years, the Cyclophyllidea have been reviewed using
morphological and molecular approaches and a better understanding of
Table 4 phylogenetic relationships has been achieved (e.g. Okamoto et al., 1997;
Intra-specific and inter-specific similarity observed in ITS1 sequences in Hyme­ Mariaux, 1998; Hoberg et al., 1999; Littlewood and Bray, 2001; Macn­
nolepis and Rodentolepis species isolated from different host species. ish et al., 2002; Haukisalmi et al., 2010). In an approach to the contri­
Hymenolepis Hymenolepis Rodentolepis Rodentolepis bution of integrative taxonomy, the molecular characterization of the
ivanovae n. sp. diminuta nana microstoma new species is provided, contributing to the comprehensive knowledge
Hymenolepis 98.8–99.8% of the taxon and allowing its genetic comparison with other species of
ivanovae n. the family.
sp.
In addition, species of the genera Hymenolepis and Rodentolepis have
Hymenolepis 74.9–80.6% 98.4–100%
diminuta representatives of zoonotic importance which cause a disease called
Rodentolepis 59.7–60.1% 57.1–57.8% 99.4–100% hymenolepiasis. Although few species of Hymenolepididae family have
nana been recorded in the available genetic bases, the new species have little
Rodentolepis 60.4–60.8% 56.7–58.2% 81.4–82.35% 98.8–99.9% genetic distance from species recognized as zoonotic such as H. diminuta,
microstoma
R. nana and H. hibernia (e.g. Georgiev et al., 2006; Sargison et al., 2018),

8
N.B. Guerreiro Martins et al. Acta Tropica 231 (2022) 106480

Table 5
Intra-specific and inter-specific similarity observed in Cox1 partial sequences in Hymenolepis and Rodentolepis species isolated from different host species.
Hymenolepis ivanovae n. sp. Hymenolepis hibernia Hymenolepis diminuta Rodentolepis nana Rodentolepis microstoma

Hymenolepis ivanovae n. sp. 98.7–99.7%

Hymenolepis hibernia 84–86% 95.01%
Hymenolepis diminuta 82.1–83.4% 83.1–85.4% 99.7–100%
Rodentolepis nana 79.1–82.4% 81.39–83.3% 82.39–83.3% 98.3–100%
Rodentolepis microstoma 81.4–83.4% 82.7–83.4% 81.1–81.7% 84.7–85.3% 99.3–99.7%

Fig. 3. Phylogenetic tree of Hymenolepis spp. based on ITS1 ribosomal DNA. Phylogenetic tree inferred using Bayesian method. Maximum Likelihood bootstrap
values of clades are listed first, followed by Bayesian Posterior Probabilities respectively, for clade frequencies exceeding 65%.

Fig. 4. Phylogenetic tree of Hymenolepis spp. based on cox1 mitochondrial DNA. Phylogenetic tree inferred using Bayesian method. Maximum Likelihood bootstrap
values of clades are listed first, followed by Bayesian Posterior Probabilities respectively, for clade frequencies exceeding 65%.

9
N.B. Guerreiro Martins et al. Acta Tropica 231 (2022) 106480

Fig. 5. . Phylogenetic tree of Hymenolepis spp. based on concatenated cox1 mtDNA partial gene and ITS1 ribosomal DNA. Phylogenetic tree inferred using Bayesian
method. Maximum Likelihood bootstrap values of clades are listed first, followed by Bayesian Posterior Probabilities respectively, for clade frequencies
exceeding 65%.

and the potential of human infection should be tested. References

Akumyan, K.S., 1948. Hymenolepis mathevossianae sp. nova from the Mesocricetus brandti.
CRediT authorship contribution statement Dokl. Akad. Nauk Armyan. 183–188.
Baer, J.G., 1932. Contribution à la faune helminthologique de Suisse. Rev. Suisse Zool.
Natalia Beatriz Guerreiro Martins: Investigation, Data curation, 39, 1–56.
Baer, J.G., Fain, A., 1955. Cestodes. Exploration du Pare National de l’Upemba, Mission
Conceptualization, Methodology, Visualization, Formal analysis, G.F. de Witte.
Writing – original draft, Writing – review & editing. Maria del Rosario Barker, F.D., 1915. Parasites of the American muskrat (Fiber zibethicus). J Parasitol. 1 (4),
Robles: Investigation, Data curation, Conceptualization, Methodology, 184–197. https://doi.org/10.2307/3270807.
Baylis, H.A., 1926. Some parasitic worms from Sarawak. Sarawak Mus. J. 10, 303–322.
Visualization, Formal analysis, Writing – original draft, Writing – review Collins, H.M., 1972. Cestodes from rodents in the Republic of South Africa.
& editing. Graciela Teresa Navone: Investigation, Data curation, Onderstepoort J. Vet. Res. 39 (1), 25–50.
Methodology, Writing – original draft, Writing – review & editing. Blanchard, R., 1891. Histoire zoologique et médicale des Téniadés du genre
‘Hymenolepis” Weinland.. Société D’Éditions Scientifiques, Paris.
Callejón Rocío: Methodology, Formal analysis, Writing – original draft,
Bruguière, J.G., 1791. Tableau encyclopédique et méthodique des trois règnes de la
Writing – review & editing. Nature, contenant l’Helminthologie, ou les Vers infusoires, les Vers intestins, les Vers
mollusques, &c. 7ème livraison. Panckoucke, Paris.
Bush, A.O., Lafferty, K.D., Lotz, J.M., Shostak, A.W., 1997. Parasitology meets ecology on
its own terms: Margolis et al. revisited. J. Parasitol. 83, 575–583.
Declaration of Competing Interest Caira, J.N., Jensen, K., 2017. Planetary Biodiversity Inventory (2008–2017): Tapeworms
from Vertebrate Bowels of the Earth. University of Kansas. Natural History Museum
The authors declare there are no conflicts of interes. Special Publication No. 25.
Cunningham, L.J., Olson, P.D., 2010. Description of Hymenolepis microstoma (Nottingham
strain): a classical tapeworm model for research in the genomic era. Parasites
Vectors 3 (1), 1–9. https://doi.org/10.1186/1756-3305-3-123.
Acknowledgements Czaplinski, B., Vaucher, C., 1994. Family Hymenolepididae Ariola, 189. In: Khalil, L.F.,
Jones, A., Bray, R.A. (Eds.), Keys to the Cestode Parasites of Vertebrates. CAB
International, University Press, Cambridg, pp. 595–663.
We thank Carlos Galliari, Ulyses Pardiñas, Agustin Abba, Pablo Teta, Di Yang, W.Z., Zhang, Y., Liu, A., 2017. Prevalence of Hymenolepis nana and H. diminuta
and Marcela Lareschi for their cooperation in host collections; to Carlos from brown rats (Rattus norvegicus) in Heilongjiang Province, China. Korean J.
Parasitol. 55 (3), 351–355. https://doi.org/10.3347/kjp.2017.55.3.351.
Galliari and Ulyses Pardiñas for the identification of the hosts; to Daniel
Dujardin, M.F., 1845. Histoire Naturelle des Helminthes ou Vers Intestinaux. Librairie
Novoa, Raquel Stefanici (OPDS), Monica Casciaro (Direccion de Flora y Encyclopédique de Roret, Paris. https://doi.org/10.5962/bhl.title.10123.
Fauna, Province Buenos Aires), and the rangers from Cerro Bahia Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap.
Blanca, Sierra de la Ventana, for their help; and to Mike Kinsella for the Evolution 39 (4), 783–791. https://doi.org/10.1111/j.1558-5646.1985.tb00420.x.
Fitte, B., Robles, M.d.R., Dellarupe, A., Unzaga, J.M., Navone, G.T., 2017. Hymenolepis
valuable critical reading of the manuscript and for the revision of the diminuta and Rodentolepis nana (Hymenolepididae: Cyclophyllidea) in urban rodents
English version. of Gran La Plata: association with socio-environmental conditions. J. Helminthol. 92
(5), 549–553.
Foronda, P., Casanova, J.C., Valladares, B., Martinez, E., Feliu, C., 2004. Molecular
systematics of several cyclophyllid families (Cestoda) based on the analysis of 18S
Funding ribosomal DNA gene sequences. Parasitol. Res. 93, 279–282. https://doi.org/
10.1007/s00436-004-1130-8.
Foronda, P., López-González, M., Hernández, M., Haukisalmi, V., Feliu, C, 2011.
This study was funded by Agencia Nacional de Promocion Cientıfica Distribution and genetic variation of hymenolepidid cestodes in murid rodents on
y Tecnologica (PICT 0924- Director GN and PICT 0547-Director UP). the Canary Islands (Spain). Parasites vectors 4 (1), 1–9. https://doi.org/10.1186/
NGM, MRR and GN are members of CONICET. 1756-3305-4-185.

10
N.B. Guerreiro Martins et al. Acta Tropica 231 (2022) 106480

Freeman, R.S., 1960. Another hymenolepid with great morphological variation, Macnish, M.G., Ryan, U.M., Behnke, J.M., Thompson, R.C.A., 2003. Detection of the
Hymenolepis bennetti n. sp. (Cestoda) from Napaeozapus insignis algonquinensis Prince. rodent tapeworm Rodentolepis (= Hymenolepis) microstoma in humans. A new
Can. J. Zool. 38 (4), 737–743. https://doi.org/10.1139/z60-076. zoonosis? Int. J. Parasitol. 33 (10), 1079–1085. https://doi.org/10.1016/s0020-
Gardner, S.L., 1985. Helminth parasites of Thomomys bulbivorus (Richardson) (Rodentia: 7519(03)00137-1.
Geomyidae), with the description of a new species of Hymenolepis (Cestoda). Can. J. Makarikov, A.A., 2017. A taxonomic review of hymenolepidids (Eucestoda,
Zool. 63, 1463–1469. https://doi.org/10.1139/z85-219. Hymenolepididae) from dormice (Rodentia, Gliridae), with descriptions of two new
Gardner, S.L., Dursahinhan, A.T., Campbell, M., Rácz, S.E., 2020. A new genus and two species. Acta Parasitol. 62 (1), 1–21. https://doi.org/10.1515/ap-2017-0001.
new species of unarmed hymenolepidid cestodes (Cestoda: Hymenolepididae) from Makarikov, A.A., Gardner, S.L., Hoberg, E.P., 2012. New species of Arostrilepis
geomyid rodents in Mexico and Costa Rica. Zootaxa 4766 (2), 358–376. https://doi. (Eucestoda: Hymenolepididae) in members of Cricetidae and Geomyidae (Rodentia)
org/10.11646/zootaxa.4766.2.5. from the Western Nearctic. J. Parasitol. 98, 617–626. https://doi.org/10.1645/GE-
Gardner, S.L., Luedders, B.A., Duszynski, D.W., 2014. Hymenolepis robertrauschi n. sp. 2943.1.
from grasshopper mice Onychomys spp. in New Mexico and Nebraska, U.S.A. Occas Makarikov, A.A., Georgiev, B.B., 2020. Review of records of hymenolepidids (Eucestoda:
Pap Mus Texas Tech Univ. 322, 1–10. Hymenolepididae) from dormice (Rodentia: Gliridae) in Europe, with a redescription
Gardner, S.L., Schmidt, G.D., 1988. Cestodes of the genus Hymenolepis Weinland, 1858 of Armadolepis spasskyi Tenora and Baruš, 1958 and the description of A. genovi n. sp.
sensu stricto from pocket gophers Geomys and Thomomys spp. (Rodentia: Syst. Parasitol. 97 (1), 83–98. https://doi.org/10.1007/s11230-019-09891-7.
Geomyidae) in Colorado and Oregon, with a discriminant analysis of four species of Makarikov, A.A., Guliaev, V.D., 2009. Pararodentolepis gen. n., a new genus of cestodes
Hymenolepis. Can. J. Zool. 66, 896–903. https://doi.org/10.1139/z88-132. from rodents, with the description of P. sinistra sp. n. (Cyclophyllidea:
Georgiev, B.B., Bray, R.A., Timothy, D., Littlewood, J., Morand, S., Krasnov, B.R., Hymenolepididae). Parazitologiia 43 (6), 454–459.
Poulin, R., 2006. Cestodes of small mammals: taxonomy and life cycles. Makarikov, A.A., Gulyaev, V.D., Chechulin, A.I., 2005. Arvicolepis gen. n., a new cestode
Micromammals and Macroparasites. Springer, Tokyo, pp. 29–62. genus from rodents and redescription of Arvicolepis transfuga (Spassky et
Gomez-Puerta, L.A., Valdivia-Carrera, C.A., 2018. Hymenolepis microstoma (Cestoda: Merkusheva, 1967) comb. nov. (Cyclophyllidea, Hymenolepididae). Problemy
Hymenolepididae) en ratones caseros (Mus musculus) de Lima, Perú. Rev. Peru. Biol. tsestodologii [Problems of cestodology]. Russian Acad Sci, Zool Inst, St. Petersburg.
25 (3), 311–314. Russian Acad. Sci., Zool. Inst., St. Petersburg 178–186.
Greenberg, Z., 1969. Helminths of mammals and birds of Israel I. Helminths of Acomys Makarikov, A.A., Gulyaev, V.D., Krivopalov, A.V., 2010. Nomadolepis (Cyclophyllidea,
spp. (Rodentia, Murinae). Isr. J. Ecol. Evol. 18 (1), 25–38. https://doi.org/10.1080/ Hymenolepididae), a new genus of cestodes from rodents. Zool. Zhurnal 89 (8),
00212210.1969.10688272. 948–955.
Greiman, S.E., Tkach, V.V., Cook, J.A., 2013. Description and molecular differentiation Makarikov, A.A., Gulyaev, V.D., Kontrimavichus, V.L., 2011. A redescription of
of a new Staphylocystoides (Cyclophyllidea: Hymenolepididae) from the dusky shrew Arostrilepis horrida (Linstow, 1901) and descriptions of two new species from
Sorex monticolus in Southeast Alaska. J. Parasitol. 99 (6), 1045–1049. https://doi. Palaearctic microtine rodents, Arostrilepis macrocirrosa sp. n. and A. tenuicirrosa sp. n.
org/10.1645/13-302.1. (Cestoda: Hymenolepididae). Folia Parasitol. 58 (2), 108–120. https://doi.org/
Guerreiro Martins, N.B., Robles, M.d.R., Kinsella, J.M., Navone, G.T., 2014. Distribución 10.14411/fp.2011.011.
geográfica de cestodes Hymenolepididae de Oxymycterus rufus (Rodentia-Cricetidae) Makarikov, A.A., Hoberg, E.P., 2016. Broadening diversity in the Arostrilepis horrida
en Argentina. Rev. Arg. Parasitol. 2, 14–22. complex: Arostrilepis kontrimavichusi n. sp.(Cyclophyllidea: Hymenolepididae) in the
Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large western red-backed vole Myodes californicus (Merriam)(Cricetidae: Arvicolinae) from
phylogenies by maximum likelihood. Syst. Biol. 52 (5), 696–704. https://doi.org/ temperate latitudes of the Pacific Northwest, North America. Syst. Parasitol. 93 (5),
10.1080/10635150390235520. 467–477. https://doi.org/10.1007/s11230-016-9640-1.
Guliaev, V., Makarikov, A., 2007. Relictolepis gen. n. - a new cestode genus Makarikov, A.A., Stakheev, V.V., Tkach, V.V., 2018. Phylogenetic relationships of the
(Cyclophyllidea: Hymenolepididae) from rodents of the Russian Far East and the genus Armadolepis Spassky, 1954 (Eucestoda, Hymenolepididae), with descriptions
description of R. feodorovi sp. n. Parazitologiia 41, 399–405. of two new species from Palaearctic dormice (Rodentia, Gliridae). Syst. Parasitol. 95
Gulyaev, V.D., Chechuli, A., 1997. Arostrilepis microtis n. sp. (cyclophyllidea: (1), 65–79. https://doi.org/10.1007/s11230-017-9765-x.
hymenolepididae), a new cestode species from siberian rodents. Res. Rev. Parasit. 57 Makarikov, A.A., Tkach, V.V, 2013. Two new species of Hymenolepis (Cestoda:
(2), 103–107. Hymenolepididae) from Spalacidae and Muridae (Rodentia) from eastern Palearctic.
Hancke, D., Suárez, O.V., 2016. Infection levels of the cestode Hymenolepis diminuta in rat Acta Parasitol. 58, 37–49. https://doi.org/10.2478/s11686-013-0115-0.
populations from Buenos Aires, Argentina. J. Helminthol. 90, 199–205. Makarikov, A.A., Tkach, V.V., Bush, S.E., 2013a. Two new species of Hymenolepis
Haukisalmi, V., Hardman, L.M., Foronda, P., Feliu, C., Laakkonen, J., Niemimaa, J., (Cestoda: Hymenolepididae) from murid rodents (Rodentia: Muridae) in the
Lehtonen, J.T., Henttonen, H., 2010. Systematic relationships of hymenolepidid Philippines. J Parasitol. 99, 847–855. https://doi.org/10.1645/12-173.1.
cestodes of rodents and shrews inferred from sequences of 28S ribosomal RNA. Zool. Makarikov, A.A., Galbreath, K.E., Hoberg, E.P., 2013b. Parasite diversity at the Holarctic
Scr. 39 (6), 631–641. https://doi.org/10.1111/j.1463-6409.2010.00444.x. nexus: species of Arostrilepis (Eucestoda: Hymenolepididae) in voles and lemmings
Haverkost, T.R., Gardner, S.L., 2010. New species in the genus Monoecocestus (Cestoda: (Cricetidae: Arvicolinae) from greater Beringia. Zootaxa 3608, 401–439. https://doi.
Anoplocephalidae) from neotropical rodents (Caviidae and Sigmodontidae). org/10.11646/zootaxa.3608.6.1.
J. Parasitol. 96 (3), 580–595. Makarikov, A.A., Nims, T.N., Galbreath, K.E., Hoberg, E.P., 2015a. Hymenolepis folkertsi
Hoberg, E., Jones, A., Bray, R.A., 1999. Phylogenetic analysis among the families of the n. sp. (Eucestoda: Hymenolepididae) in the oldfield mouse Peromyscus polionotus
Cyclophyllidea (Eucestoda) based on comparative morphology, with new hypotheses (Wagner) (Rodentia: Cricetidae: Neotominae) from the southeastern Nearctic with
for co-evolution in vertebrates. Syst. Parasitol. 42, 51–73. https://doi.org/10.1023/ comments on tapeworm faunal diversity among deer mice. Parasitol. Res. 114,
A:1006100629059. 2107–2117. https://doi.org/10.1007/s00436-015-4399-x.
Hoberg, E.P., Makarikov, A.A., Tkach, V.V., Meagher, S., Nims, T.N., Eckerlin, R.P., Makarikov, A.A., Tkach, V.V., Villa, S.M., Bush, S.E., 2015b. Description of two new
Galbreath, K.E., 2016. Insights on the host associations and geographic distribution species of Hymenolepis Weinland, 1858 (Cestoda: Hymenolepididae) from rodents on
of Hymenolepis folkertsi (Cestoda: Hymenolepididae) among rodents across temperate Luzon Island, Philippines. Syst. Parasitol. 90, 27–37. https://doi.org/10.1007/
latitudes of North America. Parasitol. Res. 115 (12), 4627–4638. https://doi.org/ s11230-014-9528-x.
10.1007/s00436-016-5255-3. Makarikov, A.A., Melnikova, Y.A., Tkach, V.V., 2015c. Description and phylogenetic
Hoberg, E.P., Mariaux, J., Brooks, D.R., Littlewood, D.T.J., Bray, R.A., 2001. Pylogeny affinities of two new species of Nomadolepis (Eucestoda, Hymenolepididae) from
among the orders of the Eucestoda (Cercomeromorphae): integrating morphology, Eastern Palearctic. Parasitol. Int. 64 (5), 453–463. https://doi.org/10.1016/j.
molecules and total evidence. Interrelationships of the Platyhelminthes. Taylor & parint.2015.06.009.
Francis, London, pp. 112–126. Mariaux, J., 1998. A molecular phylogeny of the Eucestoda. J Parasitol. 84, 114–124.
Hunkeler, P., 1974. Les Cestodes parasites des petits mammifères (Rongeurs et https://doi.org/10.2307/3284540.
Insectivores) de Côte-d’Ivoire et de Haute-Volta. Rev. Suisse Zool. 80, 809–930. Martínez-Barbabosa, I., Gutiérrez-Cárdenas, M.E., Aguilar-Venegas, J.M., Shea, M.,
Janicki, C., 1906. Studien an Saugetiercestoden. Z. Wiss. Zool. 81, 505–597. Gutiérrez-Quiroz, M., Ruíz-González, L.A., 2012. Infección por Hymenolepis diminuta
Joyeux, C., Baer, J.G., 1930. On a collection of cestodes from Nigeria. J. Helminthol. 8 en una estudiante universitaria. Rev. Biomed. 23, 61–64.
(1), 59–64. https://doi.org/10.1017/S0022149X00002522. Martino, P.E., Radman, N., Parrado, E., Bautista, E., Cisterna, C., Silvestrini, M.P.,
Julius, R.S., Schwan, E.V., Chimimba, C.T., 2018. Molecular characterization of Corba, S., 2012. Note on the occurrence of parasites of the wild nutria (Myocastor
cosmopolitan and potentially co-invasive helminths of commensal, murid rodents in coypus, Molina, 1782). Helminthologia 49 (3), 164–168.
Gauteng Province, South Africa. Parasitol. Res. 117 (6), 1729–1736. https://doi.org/ Mas-Coma, S., Tenora, F., 1997. Proposal of Arostrilepis n. gen.(Cestoda:
10.1007/s00436-018-5852-4. Hymenolepididae). Res. Rev. Parasit. 57, 93–101.
Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary genetics McLeod, J.A., 1933. A parasitological survey of the genus Citellus in Manitoba. Can. J.
analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. https://doi. Res. 9 (2), 108–127. https://doi.org/10.1139/cjr33-072.
org/10.1093/molbev/msw054. Mikhail, J.W., Fahmy, M.A.M., 1968. A new species of the genus Hymenandrya with a
Littlewood, D.T.J., Bray, R.A., 2001. Interrelationships of Platyhelminthes. Taylor & short review of the family Anoplocephalidae. Zool. Anz. 180 (5/6), 436–441.
Francis, London. Miño, M.H., Rojas Herrera, E.J., Notarnicola, J., Robles, M.d.R., Navone, G.T., 2012.
Litvaitis, M.K., Rohde, K., 1999. A molecular test of platyhelminth phylogeny: inferences Diversity of the helminth community of the Pampean grassland mouse (Akodon
from partial 28S rDNA sequences. Invertebr. Biol. 42–56. https://doi.org/10.2307/ azarae) on poultry farms in central Argentina. J. Helminthol. 86 (1), 46–53.
3226911. Montgomery, S.S.J., Montgomery, W.I., Dunn, T.S., 1987. Biochemical, physiological
Macnish, M., Morgan-Ryan, U.M., Monis, P.T., Behnke, J.M., Thompson, R.C.A., 2002. and morphological variation in unarmed hymenolepids (Eucestoda: Cyclophyllidae).
A molecular phylogeny of nuclear and mitochondrial sequences in Hymenolepis nana Zool. J. Linn. Soc. 91 (4), 293–324. https://doi.org/10.1111/j.1096-3642.1987.
(Cestoda) supports the existence of a cryptic species. Parasitology 125 (6), 567–575. tb01417.x.
https://doi.org/10.1017/S0031182002002366.

11
N.B. Guerreiro Martins et al. Acta Tropica 231 (2022) 106480

Navone, G.T., Notarnicola, J., Nava, S., Robles, M.d.R., Galliari, C., Lareschi, M., 2009. Schiller, E.L., 1952. Hymenolepis johnsoni n. sp. a cestode from the vole Microtus
Arthropods and helminths assemblage in sigmodontine rodents from wetlands of the pennsylvanicus drumondii. J. Wash. Acad. Sci. 42, 53–55.
Rio de la Plata, Argentina. Mastozool. Neotrop. 16 (1), 121–133. Sharma, S., Lyngdoh, D., Roy, B., Tandon, V., 2016a. Molecular phylogeny of
Neiland, K.A., Senger, C.M., 1952. Helminths of northwestern mammals. Part I. Two new Cyclophyllidea (Cestoda: Eucestoda): an in-silico analysis based on mtCOI gene.
species of Hymenolepis. J Parasitol. 38 (5), 409–414. https://doi.org/10.2307/ Parasitol. Res. 115 (9), 3329–3335. https://doi.org/10.1007/s00436-016-5092-4.
3273921. Sharma, S., Lyngdoh, D., Roy, B., Tandon, V., 2016b. Differential diagnosis and
Nkouawa, A., Haukisalmi, V., Li, T., Nakao, M., Lavikainen, A., Chen, X., Henttonen, H., molecular characterization of Hymenolepis nana and Hymenolepis diminuta (Cestoda:
Ito, A., 2016. Cryptic diversity in hymenolepidid tapeworms infecting humans. Cyclophyllidea: Hymenolepididae) based on nuclear rDNA ITS2 gene marker.
Parasitol. Int. 65 (2), 83–86. https://doi.org/10.1016/j.parint.2015.10.009. Parasitol. Res. 115 (11), 4293–4298. https://doi.org/10.1007/s00436-016-5210-3.
Okamoto, M., Agatsuma, T., Kurosawa, T., Ito, A., 1997. Phylogenetic relationships of Singh, K.S., 1956. Hymenolepis vogeae n. sp., from an Indian field mouse, Mus buduga
three hymenolepidid species inferred from nuclear ribosomal and mitochondrial Thomas, 1881. Trans. Am. Microsc. Soc. 75 (2), 252–255. https://doi.org/10.2307/
DNA sequences. Parasitology 115, 661–666. https://doi.org/10.1017/ 3224018.
S0031182097001741. Smith, C.F., 1954. Four new species of cestodes of rodents from the high plains, central
Olsen, O.W., 1966. Diplophallus laglei n. sp. (Cestoda: Cyctophyllidea) from the viccacha, and southern Rockies and notes on Catenotaenia dendritica. J. Parasitol. 40 (3),
Lagidium peruanum Meyer, 1832 (Chinchillidae) from the Chilean Andes. Proc. 245–254. https://doi.org/10.2307/3273736.
Helminthol. Soc. Wash. 33 (1), 49–53. Spassky, A.A., 1954. Classification of hymenolepididae from mammals. Trudy
Olson, P.D., Littlewood, D.T.J., Bray, R.A., Mariaux, J., 2001. Interrelationships and Gel’mintologicheskoi Laboratorii. Akad. Nauk. SSSR 7, 120–167.
evolution of the tapeworms (Platyhelminthes: Cestoda). Mol. Phyl. Evol. 19, Spassky, A.A., 1973. New genera of cyclophyllidean cestodes. Parasites of Animals and
443–467. https://doi.org/10.1006/mpev.2001.0930. Plants, Kishinev 9, 38–48.
Panisse, G., Robles, M.d.R., Digiani, M.C., Notarnicola, J., Galliari, C., Navone, G.T., Sutton, C.A., 1974. Contribución al conocimiento de la fauna parasitológica Argentina,
2017. Description of the helminth communities of sympatric rodents (Muroidea: Rodentolepis octocoronata (von Linstow, 1879). Neotrópica 20, 145–148.
Cricetidae) from the Atlantic Forest in northeastern Argentina. Zootaxa 4337 (2), Tandon, V., Biswal, D.K., Prasad, P.K., Malsawmtluangi, C., Fred, A., Filipe, J.,
243–262. Gamboa, H., 2011. Reconstructing the phylogenetic relationships of the
Posada, D., 2008. jModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25, cyclophyllidean cestodes: a case study using ITS2 rDNA and sequence structure
1253–1256. https://doi.org/10.1093/molbev/msn083. alignment. In: Biomedical Engineering Systems and Technologies, 127. Springer,
Posada, D., Buckley, T.R., 2004. Model selection and model averaging in phylogenetics: Berlin, pp. 309–321. BIOSTEC 2010, CCIS.
advantages of Akaike information criterion and Bayesian approaches over likelihood Tenora, F., Asakawa, M., Kamiya, M., 1994. Hymenolepis pseudodiminuta sp. n. (Cestoda:
ratio tests. Syst. Biol. 53, 793–808. https://doi.org/10.1080/10635150490522304. Hymenolepididae) from Apodemus spp. (Rodentia: Muridae) in Japan.
Rêgo, A.A., 1967. Sobre alguns cestódeos parasitos de roedores do Brasil. Mem. Inst. Helminthologia 31, 185–189.
Oswaldo Cruz 65, 1–18. Thompson, R.C.A., 2015. Neglected zoonotic helminths: Hymenolepis nana, Echinococcus
Rêgo, A.A., 1970. Uma nova especie de Rodentolepis parasita de roedor (Cestoda, canadensis and Ancylostoma ceylanicum. Clin. Microbiol. Infect. 21 (5), 426–432.
Hymenolepididae). H. D. Srivastava Commen. 251–254. https://doi.org/10.1016/j.cmi.2015.01.004.
Řežábková, L., Brabec, J., Jirků, M., Dellerba, M., Kuchta, R., Modrý, D., Parker, W., Jirků Tinkle, D.P., 1972. Description and natural intermediate hosts of Hymenolepis peromysci
Pomajbíková, K., 2019. Genetic diversity of the potentially therapeutic tapeworm n. sp., a new cestode from deer mice (Peromyscus). Trans. Am. Microsc. Soc. 91 (1),
Hymenolepis diminuta (Cestoda: Cyclophyllidea). Parasitol. Int. 71, 121–125. https:// 66–69. https://doi.org/10.2307/3224860.
doi.org/10.1016/j.parint.2019.04.009. Tinnin, D.S., Ganzorig, S., Gardner, S.L., 2011. Helminths of squirrels (Sciuridae) from
Rider, C.L., Macy, R.W., 1947. Preliminary survey of the helminth parasites of muskrats Mongolia. Occasional Papers, 303. Museum of Texas Tech University, pp. 1–9.
in northwestern Oregon, with description of Hymenolepis ondatrae n. sp. Trans. Am. von Nickisch-Rosenegk, M., Lucius, R., Loss-Frank, B., 1999. Contributions to the
Microsc. Soc. 66 (2), 176. https://doi.org/10.2307/3223248. phylogeny of the Cyclophyllidea (Cestoda) inferred from mitochondial 12S rDNA.
Ronquist, F., Huelsenbeck, J.P., 2003. MrBAYES 3: bayesian phylogenetic inference J. Mol. Evol. 48, 586–596.
under mixed models. Bioinformatics 19, 1572–1574. https://doi.org/10.1093/ Wardle, M.A., McLeod, J.A., 1952. The Zoology of Tapeworms. University of Minnesota
bioinformatics/btg180. Press, Minneapolis.
Rudolphi, C., Ruhm, W., 1819. Entozoorum synopsis cui accedunt mantissaduplex et Wason, A., Johnson, S., 1977. A new genus of hymenolepid cestode from the Indian
indices locupletissimi. Sumptibus Augusti Rücker, Berlin, Germany. gerbil, Tatera indica. J. Helminthol. 51 (4), 309–312. https://doi.org/10.1017/
Sargison, N., Herman, J., Pilkington, J., Buckland, P., Watt, K., Chambers, A., S0022149X00007641.
Chaudhry, U., 2018. Molecular confirmation of Hymenolepis hibernia in field mice Yarinsky, A., 1952. Hymenolepis pitymi n. sp., a hymenolepidid cestode from the pine
(Apodemus sylvaticus) from St Kilda has potential to resolve a host-parasite mouse. J. Tenn. Acad. Sci. 27 (2), 150–152.
relationship. Int. J. Parasitol.: Parasites Wildl. 7 (3), 364–368.

12