Interactions between environmental copper, microbial community structure and histamine levels in edible crustaceans

Thesis 2011-06 of the Department of Ecological Science, VU University Amsterdam. ISBN-13: 978-94-6191-069-1 Cover photograph by Budi Widianarko and Adi Santosa, showing a traditional Javanese tambak in the northern coast of Central Java, with pak Yatin showing a live shrimp. 2

VRIJE UNIVERSITEIT

Interactions between environmental copper, microbial community structure and histamine levels in edible crustaceans

ACADEMISCH PROEFSCHRIFT
ter verkrijging van de graad Doctor aan de Vrije Universiteit Amsterdam, op gezag van de rector magnificus prof.dr. L.M. Bouter, in het openbaar te verdedigen ten overstaan van de promotiecommissie van de faculteit der Aard- en Levenswetenschappen op vrijdag 2 december 2011 om 13.45 uur in de aula van de universiteit, De Boelelaan 1105

door

Bernadeta Soedarini geboren te Yogyakarta, Indonesi

promotoren:

prof.dr. N.M. van Straalen prof.dr.ir. B. Widianarko

copromotoren:

dr.ir. C.A.M. van Gestel dr. W.F.M. Rling

Contents
Summary Samenvatting Ringkasan Chapter 1. Chapter 2. Chapter 3. General introduction Copper contamination in coastal pond sediments of Semarang Indonesia Copper toxicokinetics in marbled crayfish (Procambarus sp.): implications for food quality and safety Effect of copper exposure on histamine concentrations in the marbled crayfish (Procambarus sp.) Interactions between accumulated copper, bacterial community structure and histamine formation in stored crayfish meat after copper exposure General discussion 9 15 23 31 47 65

Chapter 4.

81

Chapter 5.

93

Chapter 6. References Acknowledgements

113 125 151

The Irish inspiring prayer God, give me the serenity to accept what I cant change; the courage to change what I can; and the wisdom to know the different.

Summary

Interactions between environmental copper, microbial community structure and histamine levels in edible crustaceans
Water pollution, particularly metal and microbial, is a global problem. When the pollution occurs in aquacultural areas, it may negatively impact the edible species and eventually threaten food quality and safety. Indonesia, one of the top ten aquaculture producers in the world, also experiences severe water pollution. Aquaculture is economically importance throughout Indonesia, like for Semarang a major city on the Northern coast of Central Java known as one of aquaculture producers. One of the most important aquaculture activities in Semarang is shrimp culture. Many ponds used for shrimp and fish culture are situated along the coast line and are influenced by metal pollution from a variety of sources and microbial pollution from city drainage. For that reason, we studied the influence of metal pollution and microbial contamination in an edible crustacean species. The main aim was to determine the interaction between copper and microorganisms in the aquatic environment and their impact on crustaceans. To deal with the problem, several approaches were selected, i.e. metal bioaccumulation, histamine formation in the animal triggered by metals exposure, bacterial community structure under the influence of metal contamination and histamine accumulation in the crustaceans edible tissue during storage. The metal of interest in this study was copper, referring to the situation found in shrimp ponds along the Semarang coast line (Chapter 2). In three sampling sites, copper concentrations were significantly higher than those of the other sampling sites, up to twice the local background concentration,

10

which is approximately 40 g/g dry sediment. Cadmium concentrations in sediment samples taken from different aquacultural ponds in the Semarang coastal area were below the detection limit (0.03 g/g dry weight), while zinc, nickel and iron concentrations varied among locations but were generally also low. Sediments taken from two shrimp ponds located close to the intercity highway of Semarang had lead (Pb) concentrations that were significantly higher than at the other locations. In addition to copper and lead, at some sites nickel and chromium also showed elevated sediment concentrations. According to the Sediment Quality Guidelines (SQGs) applied in several countries, the Semarang coastal pond sediments can be classified as mid-range (medium range) contaminated. The contamination may partly be attributed to anthropogenic inputs, such as intensification of agricultural and aquacultural practices, and metal-contaminated waste from industrial and household activities. The interaction between copper, microbial community structure and histamine level was studied by performing a set of experiments. Because of its accessibility for biological experiments, i.e. ease of culturing and producing high numbers of genetically identical offspring, the freshwater marbled crayfish (Procambarus sp.) was chosen as a model of edible crustacean species (Chapters 3, 4 and 5). Our study on copper toxicokinetics in marbled crayfish (Procambarus sp.) showed there was no clear uptake in animals exposed to 0.031 mg Cu/L, suggesting that the animals at low copper exposure levels are able to regulate copper concentrations in their body to a fairly constant level. However, at higher exposure levels (0.38 mg Cu/L) the internal copper concentration was not regulated at the same level, at least not in all organs. The exoskeleton, gills and muscle tissues accumulated copper relatively fast and reached equilibrium within 10 days of

11

exposure. Copper accumulation was highest in the hepatopancreas as uptake in this storage organ steadily increased with time and did not reach equilibrium within the 14-day exposure period (Chapter 3). The copper accumulation levels in the marbled crayfish found in this study were hepatopancreas > gills > exoskeleton > muscle. In terms of food safety, the highest copper concentrations measured in the marbled crayfish muscles (meat) were 40 g/g dry weight (~10 g/g wet weight). This level does not exceed the recommendations set by the Australian National Health and Medical Research Council (ANHMRC) for seafood, which is 10 g/g wet weight. In Chapter 4, we observed that metal accumulation in marbled crayfish organs affected the concentrations of histamine, an important indicator of food spoilage used in food safety research. The higher the copper exposure concentrations, the higher the histamine levels were in the hepatopancreas. A rapid built-up of histamine in the hepatopancreas started right from the beginning of the copper exposure of the crayfish. Copper exposure to average concentrations of 0.031 and 0.38 mg Cu/L did not affect histamine concentrations in the crayfish muscle. In contrast, histamine concentrations in the hepatopancreas of crayfish exposed to 0.38 mg Cu/L was significantly higher than in crayfish exposed to 0.031 mg Cu/L and reached approximately 10 mg histamine/kg fresh weight. Histamine is a well-known neuromodulator (besides dopamine) in the animal nervous system. Histamine is specifically associated with modulation of muscle action in intestinal tissues. Why histamine levels in the crayfish would increase with copper accumulation is unknown. This is an interesting phenomenon but so far has not been reported in the literature. Two proposed mechanisms are (1) a stress response of the animal, or (2) up-regulation of histidine production followed

12

by decarboxylation reactions. Histamine concentrations in the muscle in all cases never exceeded 2 mg histamine/kg fresh weight, which is much lower than the maximum level of histamine in seafood of 50 mg histamine/kg fresh weight set by the United States Food and Drug Administration (US FDA). Our experiment on histamine formation in the marbled crayfish triggered by copper exposure therefore indicated that in terms of the meat, copper exposure itself did not pose any threat for seafood safety. In Chapter 5, the bacterial community structures under the influence of copper contamination and their effect on the histamine accumulation in the marbled crayfish meat during storage are described. Cluster analysis of 16S rRNA gene-based microbial community fingerprints revealed copper toxicity to the freshwater bacterial community. Further, we observed a relation between bacteria in the water and bacteria playing role in deteriorative process in crayfish meat during storage. Histamine concentrations in the meat of the marbled crayfish exposed to 0.5 mg Cu/L upon storage were significantly lower and did not increase as rapidly compared to those in the control marbled crayfish. After 10 days of storage, meat from crayfish exposed to 0.5 mg Cu/L contained approximately 7.5 mg histamine/kg fresh weight, significantly less than the meat of animals incubated in copper-free water, which approximated 22 mg/kg fresh weight. We suggest that copper exposure can slow down histamine accumulation in crayfish meat during storage through affecting the composition of bacterial communities and the associated histamine production. According to our findings on the copper accumulation in the marbled crayfish and by extrapolating of these results to other crustaceans (Chapter 3), it is recommended to consume only muscle tissue (meat) rather than the

13

whole body of crustaceans. Consuming small size edible crustaceans, where it is hard to avoid eating the gills and hepatopancreas, which usually contain the highest metal concentrations, indeed may pose a hazard for food safety. Histamine levels induced by copper exposure, however, generally are much lower than the threshold level for food safety. Furthermore, copper concentrations in the water up to 0.5 mg Cu/L have been shown to have a large impact on the microbial community structure in both the culturing water and in the stored marbled crayfish meat. Copper exposure can decrease histamine levels in crayfish meat during storage through affecting the bacterial community-associated histamine production (Chapter 5). In spite of these findings and recommendations, still several uncertainties remain. Future research therefore might focus e.g. on (1) the mechanism(s) of histamine formation triggered by copper exposure, (2) copper uptake and internal distribution in different species of crustaceans, especially species living in brackish water, (3) determination of sources of bacterial contamination from the aquatic environment or from seafood handling that play a major role in histamine accumulation, (4) impact of other chemicals of concern for the coastal areas of Java, such as Semarang on microbial communities in crustaceans, especially on the histamineproducing microorganisms.

14

Samenvatting

15

Interaktie tussen koper in oppervlaktewater, de structuur van microbile levensgemeenschappen en histamine concentraties in eetbare kreeftachtigen

Vervuiling van oppervlaktewater, vooral met metalen en microorganismen, is een algemeen probleem. Wanneer de vervuiling plaatsvindt in gebieden waarin op commercile schaal waterorganismen voor consumptie worden geproduceerd (zogenaamde aquacultuur), kan dit leiden tot een belasting van deze organismen en zo de kwaliteit en veiligheid van het voedsel bedreigen. Ook in Indonesi, dat behoort tot de top-tien van landen met aquacultuur, is sprake van vervuiling van oppervlaktewateren. Aquacultuur is van groot economisch in heel Indonesi. Dit geldt ook voor Semarang, een stad langs de noordkust van Centraal Java. Een van de belangrijkste activiteiten op het gebied van aquacultuur in Semarang betreft de kweek van kreeftachtigen, met name van garnalen. Om die reden is in dit onderzoek de invloed van de belasting met metalen en microbile contaminatie in een eetbare kreeftachtige onderzocht. Het voornaamste doel van dit onderzoek was de interactie te bepalen tussen koper en microorganismen in oppervlaktewater en hun invloed op kreeftachtigen. Voor dit onderzoek zijn verschillende aspecten onderzocht, zoals de bioaccumulatie van metalen, de vorming van histamine in de dieren onder invloed van metaalvervuiling, en de invloed van metaalvervuiling op structuur van de bacterile levensgemeenschap en de accumulatie van histamine in de eetbare delen van de kreeft gedurende opslag.

16

Met het oog op de situatie die werd gevonden in aquacultuur vijvers langs de kust bij Semarang (Hoofdstuk 2), werd koper als metaal voor dit onderzoek gekozen. Cadmium concentraties in sediment monsters van verschillende garnalenkweekvijvers in dit gebied lagen beneden de detectiegrens (0,03 g/g drooggewicht), terwijl de concentraties aan zink, nikkel en ijzer varieerden maar over het algemeen laag waren. Sediment van twee garnalenkweekvijvers dicht bij de snelweg van Semarang bevatte hoge gehalten aan lood (Pb), die significant hoger waren dan op de andere locaties. Op drie lokaties waren de kopergehalten in het sediment significant hoger dan in de andere vijvers, tot tweemaal de locale achtergrondconcentratie van 40 g/g droog sediment. Naast koper en lood werden op sommige locaties ook verhoogde concentraties nikkel en chroom in het sediment aangetroffen. Volgens de Sedimentkwaliteitscriteria (SQGs) die in verschillende landen worden gehanteerd zijn de garnalenkweekvijvers langs de kust bij Semarang matig vervuild. De vervuiling kan deels worden toegeschreven aan menselijke invloeden, zoals intensieve landbouw en aquacultuur en de lozing van metaalvervuild afval van industrile en huishoudelijke activiteiten. De interactie tussen koper, structuur van de microbile levengemeenschap en histamine gehalten werden onderzocht door middel van een serie experimenten. Vanwege de geschiktheid voor biologische experimenten, zoals goede kweekbaarheid en de productie van grote aantallen genetische identieke nakomelingen, werd de zoetwater marmerkreeft (Procambarus sp.) gekozen als model voor eetbare kreeftachtigen (Hoofdstukken 3, 4 en 5). Het onderzoek naar de toxicokinetiek van koper in de marmerkreeft (Procambarus sp.) liet zien er nauwelijks sprake is van koperopname in de dieren bij blootstelling aan 0,031 mg Cu/L. Dit suggereert dat de dieren bij lage blootstellingsconcentraties in staat zijn het kopergehalte in hun lichaam

17

op een vrij constant niveau te houden (regulatie). Bij een hogere blootstellingsconcentratie (0,38 mg Cu/L) kon het interne kopergehalte niet meer worden gereguleerd, tenminste niet in alle organen. Het exoskelet, de kieuwen en het spierweefsel vertoonden een snelle accumulatie van koper, waarbij binnen ongeveer 10 dagen een evenwicht werd bereikt. De koperaccumulatie was het hoogst in de hepatopancreas, en het kopergehalt in dit opslagorgaan bleef toenemen met de tijd; ook na 14 dagen blootstelling was geen evenwicht bereikt (Hoofdstuk 3). De kopergehalten in de verschillende organen van de marmerkreeft namen af in de volgorde hepatopancreas > kieuwen > exoskelet > spierweefsel. Het hoogste kopergehalte dat werd gemeten in het spierweefsel (vlees) van de marmerkreeft bedroeg 40 g/g drooggewicht (~10 g/g versgewicht). Met het oog op voedselveiligheid kan dus worden geconcludeerd dat de kopergehalten in het vlees van de marmerkreeft onder de grens bleven, die wordt aanbevolen door de Australian National Health and Medical Research Council (ANHMRC) voor visproducten, die 10 g/g versgewicht bedraagt. In Hoofdstuk 4 werd onderzocht hoe de metaalaccumulatie in de organen van de marmerkreeft de vorming van histamine benvloeden. Histamine is in de monitoring van voedselveiligheid een belangrijke indicator voor bederf van voedsel. Hoe hoger de blootstellingconcentraties aan koper, des te hoger waren de histaminegehalten in de hepatopancreas. Een snelle toename van histamine werd waargenomen in de hepatopancreas kort na het begin van de koperblootstelling. Blootstelling aan gemiddelde concentraties van 0,031 en 0,38 mg Cu/L had geen invloed op de histaminegehalten in het spierweefsel van marmerkreeft. In de hepatopancreas van kreeften blootgesteld aan 0,38 mg Cu/L waren de histaminegehalten significant hoger dan in dieren blootgesteld aan 0,031 mg Cu/L, met waarden van ongeveer 10 mg

18

histamine/kg

versgewicht.

Histamine

is

een

van

de

belangrijkste

modulatoren van het zenuwstelsel (naast dopamine). Histamine wordt specifiek geassocieerd met modulatie van de werking van spieren in het maagdarmkanaal. Het is echter onbekend waarom koperopname leidt tot een toename van de histaminegehalten in kreeften. Dit fenomeen is voor zover bekend niet eerder beschreven in de literatuur. De mechanismen die dit fenomeen zouden kunnen verklaren zijn (1) een stress reactie van het dier, of (2) een stimulering van de histidineproductie gevolgd door decarboxyleringsreacties. Histaminegehalten in het spierweefsel van de marmerkreeften waren nooit hoger dan 2 mg histamine/kg versgewicht, wat veel lager is dan het maximale gehalte van 50 mg histamine/kg versgewicht in visproducten dat is vastgesteld door de United States Food and Drug Administration (US FDA). Het onderzoek naar de histaminevorming in marmerkreeften laat dus zien dat de blootstelling aan koper geen invloed heeft in termen van voedselveiligheid. In Hoofdstuk 5 wordt het effect van koperbelasting op de structuur van de bacterile levensgemeenschap in het water en de marmerkreeft beschreven, en het effect hiervan op de accumulatie van histamine in het vlees van de marmerkreeft tijdens bewaren. Clusteranalyse van 16S rRNA-gebaseerde fingerprints toonde aan dat koper een effect had op de samenstelling van de bacterile levensgemeenschap in het water waarin de kreeften werden gehouden. Ook werd een relatie gevonden tussen de bacterin in het water en de bacterin die een rol spelen in de afbraakprocessen die leiden tot bederf van het vlees van de kreeften tijdens opslag. Histaminegehalten in marmerkreeften blootgesteld aan 0,5 mg Cu/L bleven tijdens bewaren significant lager en namen veel minder snel toe dan in kreeften die niet aan koper waren blootgesteld. Na 10 dagen bewaren bevatte het vlees van kreeften

19

blootgesteld aan 0,5 mg Cu/L ongeveer 7,5 mg histamine/kg versgewicht, hetgeen significant lager is dan dat in vlees van dieren gehouden in kopervrij water (ongeveer 22 mg/kg versgewicht). Deze resultaten suggereren dat blootstelling aan koper de histamine-accumulatie in het vlees van de kreeften tijdens bewaren kan vertragen doordat het een effect heeft op de bacterile levensgemeenschap die verantwoordelijk is voor de histamineproductie. Op grond van onze bevindingen met betrekking tot de accumulatie van koper in de marmerkreeft (Hoofdstuk 3) wordt aanbevolen om alleen het spierweefsel (vlees) te consumeren in plaats van de hele kreeft. Consumptie van kleine kreeftachtigen, waarbij het moeilijk is het eten van kieuwen en hepatopancreas-weefsel, kan wel leiden tot een risico voor voedselveiligheid omdat deze organen de hoogste gehalten aan metalen bevatten. Histaminegehalten genduceerd door koperblootstelling blijven over het algemeen ruim beneden de grenzen voor voedselveiligheid. Kopergehalten tot 0,5 mg Cu/L blijken een grote invloed te hebben op de microbile levensgemeenschap, zowel in het kweekwater als in de het opgeslagen vlees van de marmerkreeft. Blootstelling aan koper kan de histaminegehalten in het vlees van de kreeften verlagen, doordat het de microbile gemeenschappen beinvloedt die verantwoordelijk zijn voor de vorming van histamine (Hoofdstuk 5). Ondanks deze bevindingen blijven nog vele onzekerheden bestaan. Verder onderzoek is nodig naar (1) de mechanisme(n) van de vorming van histamine onder invloed van koperbelasting, (2) de opname en interne verdeling van koper in verschillende soorten kreeftachtigen, met name ook in soorten die in brak water leven, (3) bepaling van de bron van bacterile contaminatie vanuit het aquatische milieu of tijdens het verwerken van de kreeften en garnalen

20

die een belangrijke rol spelen in de vorming en accumulatie van histamine, (4) de invloed van andere potentieel gevaarlijke stoffen in het kustgebied van Semarang op de microbile levensgemeenschap in kreeftachtigen, en de daarmee samenhangende histamineproductie.

21

22

Ringkasan

23

Interaksi antara paparan tembaga, struktur komunitas mikroba dan kadar histamin dalam udang
Pencemaran air, khususnya logam dan mikroba, merupakan permasalahan global. Apabila pencemaran tersebut terjadi di area budidaya perikanan, dampak negatif terhadap spesies yang dibudidayakan, yang mengancam kualitas dan keamanan pangan hasil perikanan yang dihasilkan, kemungkinan besar terjadi. Budidaya perikanan memiliki peranan yang penting dalam perekonomian Indonesia, termasuk juga bagi Semarang kota utama di pesisir utara Jawa Tengah yang dikenal sebagai salah satu sentra perikanan. Udang dipilih sebagai obyek dalam studi ini karena udang merupakan salah satu produk budidaya perikanan yang terpenting di Semarang. Tujuan utama studi ini adalah untuk menelaah interaksi antara cemaran logam dan mikroba yang ada dalam air serta dampaknya terhadap udang, ditinjau dari kualitas dan keamanan pangan. Pendekatan ilmiah yang dipilih dalam studi ini antara lain meliputi bioakumulasi logam, pembentukan histamin dalam tubuh udang akibat paparan logam, serta pengaruh pencemaran logam terhadap stuktur komunitas bakteri dalam daging udang serta pengaruhnya terhadap tingkat akumulasi histamin selama penyimpanan. Tembaga (Cu) dipilih sebagai fokus dalam studi ini berdasarkan hasil analisis logam yang terkandung dalam sedimen-sedimen yang diambil dari tambak-tambak udang di sepanjang pantai Semarang (Bab 2). Sedimen di tiga lokasi pengambilan sampel menunjukkan cemaran tembaga yang jauh lebih tinggi dibandingkan lokasi-lokasi lain, yang mencapai hampir dua kali

24

lipat dari kadar tembaga normal untuk lingkungan Semarang (the local background concentration ) yaitu berkisar 40 g/g sediment kering. Konsentrasi cadmium dalam semua sampel sedimen sangat rendah, lebih rendah dari tingkat kepekaan alat analisis logam yang digunakan (0,03 g/g sampel kering), sedangkan konsentrasi seng, nikel dan besi bervariasi antar lokasi, meskipun secara umum kadarnya rendah. Berbeda dengan tambak di lokasi-lokasi lain, sedimen yang diambil dari dua tambak yang terletak di dekat Jalan Arteri Utara Semarang menunjukkan adanya cemaran logam timbal. Selain tembaga dan timbal, beberapa lokasi tercemar nikel dan krom pada kadar yang cukup tinggi. Mengacu pada pedoman-pedoman penilaian kualitas sedimen (sediment quality guidelines ) yang berlaku di beberapa negara, sedimen tambak di perairan Semarang dapat diklasifikasikan cukup tercemar. Pencemaran tersebut mengindikasikan adanya pembuangan limbah dari berbagai sumber yang mengandung logam, sebagai akibat dari intensifikasi pertanian dan perikanan serta pembuangan limbah pabrik maupun limbah rumah tangga ke badan-badan air. Dalam studi ini, serangkaian percobaan telah dilakukan. Udang-karang air tawar (Procambarus sp.) dipilih sebagai hewan model dengan pertimbangan antara lain kemudahannya untuk dikembang-biakkan serta kemampuannya menghasilkan keturunan yang identik secara genetik serta dalam jumlah yang besar (Bab 3, 4 dan 5). Studi toksiko-kinetika logam tembaga dalam udang-karang air tawar (Procambarus sp.) menunjukkan tidak adanya pola penyerapan yang jelas ketika udang mendapat paparan tembaga pada konsentrasi 0,031 mg Cu/L. Hal tersebut dapat diartikan bahwa pada kadar paparan relatif rendah, hewan masih mampu mengatur stabilitas kadar tembaga dalam tubuhnya. Namun demikian, pada tingkat paparan yang lebih tinggi, kadar tembaga dalam tubuh hewan meningkat, meskipun penyerapan

25

tidak terjadi pada tingkat yang sama di setiap organ tubuhnya. Cangkang luar, insang, daging dan telur relatif menyerap tembaga dengan cepat, dan segera mencapai titik keseimbangan (stabil) kurang dari 10 hari dari durasi paparan. Akumulasi tembaga tertinggi terjadi di jaringan hati dan pankreas (hepatopancreas), hal tersebut tampak dari penyerapan yang terjadi terusmenerus hingga hari ke-14 masa paparan, serta belum tercapainya titik keseimbangan pada akhir masa paparan tersebut (Bab 3). Studi ini menunjukkan tingkat akumulasi tembaga dalam tubuh udang-karang dari mulai dari yang tertinggi hingga terendah adalah hepatopancreas > insang > cangkang luar > daging. Ditinjau dari aspek keamanan pangan, kadar tembaga tertinggi dalam jaringan daging udang-karang rerata berkisar 40 g/g berat kering (~10 g/g berat basah). Kadar tersebut tidak melampaui kadar tembaga maksimum yang direkomendasikan oleh Dewan Nasional Penelitian Kesehatan dan Medis Australia (ANHMRC) untuk makanan hasil laut, yaitu 10 g/g berat basah. Di Bab 4 dibahas mengenai peningkatan kadar histamin dalam udang-karang air tawar akibat paparan tembaga. Histamin merupakan salah satu indikator kerusakan bahan pangan yang umum digunakan sebagai acuan keamanan pangan. Kadar histamin dalam hewan meningkat seiring dengan peningkatan kadar tembaga, dan peningkatan tertinggi terjadi di hepatopancreas. Histamin terbentuk dengan segera setelah hewan mendapat paparan tembaga. Paparan tembaga pada konsentrasi 0,031 dan 0,38 mg Cu/L tidak secara signifikan berpengaruh terhadap peningkatan histamin dalam jaringan daging udang. Rerata kadar histamin dalam hepatopancreas udang-karang setelah mendapat paparan tembaga 0,38 mg Cu/L adalah 10 mg histamin/kg berat basah. Histamin dikenal sebagai neuromodulator utama (selain dopamin) yang berperanan dalam sistem saraf hewan. Histamin terutama berperan

26

dalam perangsangan kerja otot jaringan usus. Fenomena peningkatan kadar histamin seiring dengan peningkatan akumulasi tembaga ini merupakan fenomena baru yang menarik, dan belum pernah dipublikasikan sebelumnya. Mekanisme yang terjadi dibalik fenomena tersebut kemungkinan adalah (1) hewan mengalami stress and peningkatan kadar histamine merupakan respon fisiologis dari stress tersebut, (2) terjadi perubahan pengaturan produksi asam amino histidin yang diikuti dengan reaksi dekarboksilasi sehingga menghasilkan peningkatan kadar histamin. Kadar histamin yang terukur dalam sampel jaringan daging tidak pernah lebih dari 2 mg histamin/kg berat basah, jauh lebih rendah dibandingkan standar histamin maksimum yang diijinkan ada dalam makanan hasil laut seperti yang ditetapkan oleh Food and Drug Administration Amerika Serikat (US FDA) tahun 2011. Di Bab 5 dijelaskan mengenai pengaruh cemaran tembaga terhadap struktur komunitas bakteri serta akibat-lanjutnya terhadap akumulasi histamin dalam daging udang selama penyimpanan. Analisis klaster terhadap komunitas bakteri yang didasarkan pada 16S r-RNA gene (teknik molekuler) menunjukkan adanya toksisitas tembaga terhadap komunitas bakteri air tawar. Selain itu, nampak bahwa bakteri dalam air memiliki keterkaitan dengan bakteri penyebab pembusukan daging udang selama penyimpanan. Kadar histamin dalam daging udang yang sebelumnya mendapat paparan 0,5 mg Cu/L tidak hanya lebih rendah tetapi juga meningkat secara lambat dibandingkan daging udang kontrol. Setelah penyimpanan 10 hari, kandungan histamin dalam daging udang yang ketika masih hidup mendapat paparan tembaga 0,5 mg Cu/L hanya berkisar 7,5 mg histamin/kg berat basah, jauh lebih rendah daripada daging udang yang ketika masih hidup diinkubasi dalam air bebas tembaga yang mencapai sekitar 22 mg histamin/kg berat basah. Mempertimbangkan bahwa paparan tembaga

27

terhadap udang hidup ternyata memperlambat akumulasi histamin dalam daging udang selama penyimpanan, nampaknya peningkatan histamin dalam daging udang sangat tergantung pada komunitas bakteri yang berada di dalam air tempat hidup udang tersebut. Mengacu pada fakta hasil penelitian mengenai akumulasi tembaga dalam tubuh udang-karang air tawar (Bab 3), disarankan konsumsi udang sebaiknya dibatasi hanya pada bagian dagingnya saja. Konsumsi udang berukuran kecil, akan memunculkan kerumitan untuk memisahkan bagian insang dan hepatopancreas dari bagian dagingnya, tentu memberikan risiko keamanan pangan yang lebih tinggi. Peningkatan kandungan histamin yang diakibatkan paparan tembaga, bagaimanapun jauh lebih rendah dari batasan terendah (threshold) untuk keamanan pangan (Bab 4). Lebih lanjut, kadar tembaga dalam air yang mencapai 0,5 mg Cu/L memberikan pengaruh nyata terhadap struktur komunitas mikroba baik mikroba dalam air aquarium maupun mikroba dalam daging udangnya. Paparan tembaga dapat menekan kadar histamin dalam daging udang selama masa penyimpanan karena tembaga mempengaruhi komunitas bakteri, khususnya bakteri penghasil histamin (Bab 5). Meskipun dalam studi ini beberapa penemuan, fenomena baru dan rekomendasi telah berhasil diungkapkan, masih terdapat beberapa pertanyaan ilmiah yang dapat diteliti lebih lanjut. Beberapa topik penelitian yang dapat dikembangkan di masa mendatang antara lain (1) mekanisme pembentukan histamin yang dipicu oleh paparan tembaga, (2) penyerapan tembaga dan distribusinya dalam beberapa spesies crustacea, khususnya yang hidup di air payau, (3) penentuan sumber kontaminasi utama apakah dari lingkungan air ataukah dari penanganan pasca panen yang memainkan peran utama dalam

28

akumulasi histamin, serta (4) pengaruh cemaran-cemaran lain yang terdapat di perairan pantai utara Pulau Jawa, seperti halnya Semarang terhadap komunitas mikroba dalam crustacea, khususnya mikroba penghasil histamin.

29

30

Chapter 1 General introduction

31

Food security is a global issue of continuous concern. The Food and Agriculture Organization of the United Nations (FAO, 2010) has defined food security as an existence when all people, at all times, have physical, social and economic access to sufficient, safe and nutritious food that meets their dietary needs and food preferences for an active and healthy life. This definition covers three main aspects of the food security concept: (1) food sufficiency, (2) food safety and (3) nutritional value. These three aspects of concern are sometimes arranged in order of importance, but the fundamental message is that in terms of global food security, all three aspects should be taken into account. Providing food for the global population in a sufficient amount is not only a matter of optimal performance of the food production sector, but also a concern because of the still growing global human population. In the 20th century, the world population increased 3.7-fold to reach 6.3 billion people in 2003 and currently is expected to grow to 8.9 billion by 2050 (Cohen, 2003). The ever increasing number of people definitely is a challenge to agriculture and aquaculture two main food production sectors besides wildfishery and terrestrial wildlife hunting. The green revolution, which took place between 1950 and 1970, has greatly reduced food shortage through increasing crop yields as well as livestock production, using high-yielding plant and animal varieties, synthetic fertilizers and biocides (Evenson and Gollin, 2003). In addition, the rapidly growing aquaculture sector has applied intensification methods to boost production. Especially between 1987 and 1997, aquacultural production increased more than twofold in weight and value of its products (Naylor et al., 2000). The so-called rapid-aquaculture by means of semi-intensive and intensive practices was highly needed

32

because of the declining worldwide fishery stocks that became clear since 1985 (Naylor et al., 2000).

Year
Figure 1. The average number of undernourished people in the world over the period 19691971 to 2010, based on the Food and Agriculture Organization (FAO, 2010). The X-axis represents the year and the Y-axis represents the number of undernourished people (in millions). Data for 2009 and 2010 are presented in dashed lines as they are estimated by FAO with input from the United States Department of Agriculture, Economic Research Service.

FAO (2006) stated that global aquaculture has grown tremendously during the last 50 years, from a production level of less than a million tonnes in the early 1950s to 59.4 million tonnes by 2004. Due to the growth of aquaculture production, its products now contribute to at least 15% of the global average animal-protein consumption (Smith et al., 2010).

33

The three main reasons for the global hunger problem are the low productivity of agriculture (especially in tropical Africa and remote parts of Asia as well as Latin America), poverty, and unemployment (especially in South and East Asia, Latin America, Central Asia, and the Middle East). From an economical point of view, hunger decreases labour productivity leading to losses of 6 to 10% of the Gross National Product (Sachs et al ., 2004 in Sanchez and Swaminathan, 2005). Considering that small-scale agriculture and aquaculture farming families represent about half of the hungry population worldwide, increasing the productivity of their crops, livestock, fish, and trees is a major way to fight the global hunger problem. Actions to restore soil fertility and to increase agricultural productivity might include, among others, the use of appropriate combinations of mineral and organic fertilizers, leguminous green manures, agro-forestry fertilizer trees and returning crop residues to the soil as well as improving water management. In terms of aquaculture, culturing of fast-growing species is a progressive strategy to produce more seafood in less time (Brummett and Williams, 2000). Considering that malnutrition weakens immunity, making humans more susceptible to diseases (Kadiyala and Gillespie, 2003), fighting global malnutrition is very important to improve human health and the quality of life. Providing adequate nutrition in the diet via food fortification, clean drinking water, protein-rich foods (beans and seafood) and micronutrient-rich foods (vegetables and fruits) are major elements of the program of the Millennium Development Goals targeted by the United Nations for 2015 (Sanchez and Swaminathan, 2005). Since 2003 the World Health Organization (WHO) issued a recommendation for most countries to regularly consume seafood (Sioen et a l., 2007). Indeed, seafood contains high levels of protein and omega-3 polyunsaturated fatty acids that are essential for brain development and beneficial for human health in

34

comparison to meat which has a high content of saturated fatty acids (Nettleton, 1991). Furthermore, compared to cheese, eggs, beef, chicken or any legumes, seafood has a balanced content of proteins with all 20 amino acids being present (Sosulski and Imafidon, 1990). The favourable nutritious profile of food is unfortunately often counteracted by factors that may have adverse health effects. Legumes, especially peanuts, frequently cause allergy, sometimes with laryngeal oedema and asthma reactions that can be fatal (Ewan, 1996). Besides, peanuts also may contain aflatoxins produced by the fungus Aspergillus flavus that may cause liver damage (Timbrell, 1989). The wild mushrooms Cortinarius specio sissimus and C. orellanus, which have the characteristic orange gills and thick stipe, were first recognized to cause renal failure in 1972 in Finland (Short et al., 1980). Orelline and orellanine, the toxic compounds of C. orellanus , are highly resistant to heat, freezing, and drying. Ohlson and Anjou (1979) observed that rapeseed and mustard (Brassica napus , B. campestris and B. juneea), although containing 40-45% oil and 25% high nutritive quality proteins, also contain 4% glucosinolates compounds that cause the thyroid to increase in weight (goitrogenic effect). Three classes of disease are associated with seafood consumption, i.e. intoxication, infection and allergy (Eastaugh and Shepherd, 1986). There are several examples of natural toxins in seafood, among others phycotoxins (Van Egmond, 2004) and tetrodotoxin (Watters, 1995; Daly, 2004). Phycotoxins are produced by dinoflagellate algae that are accumulated by planktivorous marine animals, especially shellfish. The most important marine phycotoxins are the shellfish-poisons that accumulate in mussels, oysters and clams, and the ciguatera toxins that accumulate in finned fish.

35

Two types of shellfish poisoning are known: diarrhetic shellfish poisoning (DSP), which involves severe gut convulsions and diarrhea due to effects of okadaic acid on intestinal cells, and paralytic shellfish poisoning (PSP), which is due to saxitoxin and involves confusion, lack of coordination and can be fatal in immunocompromised individuals. Tetrodotoxin is considered as the most lethal seafood toxin and is especially found in the puffer fish (Spheroides rubripes ) and the marine goby fish (Yongeichthys criniger ) (Daly, 2004). The approximate LD50 value of tetrodotoxin for human beings is 0.1 mg/kg body weight, a thousand times more toxic than, for instance, the organochlorine insecticide DDT (Timbrell, 1989). Tetradotoxin poisoning is especially known in Eastern Asia. Fugu is a delicacy puffer fish in the Japanese kitchen, which can only be prepared in restaurants where the cook has a special licence to remove the highly toxic liver and ovary. Most accidents related to puffer fish consumption happen due to lack of knowledge and reckless behaviour of consumers. Ciguatera is a symptom of seafood poisoning due to food-chain accumulation of ciguatoxin. This very persistent compound, produced by dinoflagellate algae, accumulates in fish and may reach high concentrations in predatory fish such as barracuda and grouper. Ciguatera is especially known from the Caribean. Seafood is also known as the vehicle for a variety of pathogens (Klaassen and Watkins III, 2010; Wallace et al., 1999). Butt et al. (2004) distinguished three groups of infectious agents, i.e. viruses, bacteria and other parasites that may cause seafood-related illnesses. Several outbreaks of viral gastroenteritis associated with clam and oyster consumption have been reported by Morse et al . (1986). The existence of infectious human caliciviruses and hepatitis A virus in seafood is a result of poor hygiene and sanitation, either in aquaculture production or during seafood handling. The

36

existence of infectious bacteria in seafood, such as Vibrio parahaemolyticus, Listeria monocytogenes , Aeromonas hydrophila and Campylobacter jejuni , is also of concern. Seafood consumption is estimated to cause an average 1019% of the 76 million food-borne illnesses reported in the United States every year (Butt et al ., 2004). Bacterial pathogens implicated in seafoodborne diseases may be indigenous to the marine or estuarine environment or may involve enteric bacteria due to faecal contamination, or contamination during seafood handling and processing (Feldhusen, 2000). A special aspect of bacterial contamination in seafood is the accumulation of histamine, especially in crustaceans (shrimp, prawn, crab and crayfish). Histamine is a derivative of the amino acid histidine (Sobel and Painter, 2005). A group of so-called histamine-producing bacteria possess histidine decarboxylase, an enzyme that transforms the free amino acid histidine into histamine (Niven et al ., 1981; see Figure 2). Seafood containing levels higher than 50 mg histamine/kg may cause histamine poisoning with allergic-like symptoms such as nausea, vomiting, diarrhea, hives, itching, red rash, and hypotension (Taylor et al ., 1989). Several histamine poisoning outbreaks (known as scombrotoxism or scombroid poisoning) via seafood consumption have been documented in the United States (Feldhusen, 2000), South Africa (Auerswald et al., 2006) and Denmark (Emborg et al., 2005). Especially in crustaceans, high concentrations of histamine may not only be caused by bacteria, but may also be naturally present in the animal as histamine acts as a neurotransmitter or neuromodulator (Cebada and Garcia, 2007). Histamine is often used as an indicator of food spoilage in studies aiming to determine the safe consumption of stored seafood products. With prolonged storage, even under cooled conditions, shrimps and prawns will gradually degrade until consumption becomes hazardous. One of the first

37

indicators of health risk is a rise of the histamine concentration. Therefore histamine is often measured routinely in shelf-life studies.

Figure 2. Conversion of histidine to histamine by (http://en.wikipedia.org/wiki/File:Histidine_decarboxylase.svg).

histidine

decarboxylase

In addition to the risk of poisoning, infection and allergy caused by natural agents, consuming seafood is also endangered by chemical pollutants. Availability of safe food is a basic human right as it improves human health and contributes to the productivity of daily activities (WHO, 2002). But ensuring the availability of safe food requires a continuous effort due to the environmental quality degradation occurring in many areas of the world. Although the green revolution and the rapid-aquaculture contributed significantly to the world food supply, they also may have negative impacts on the environment (Tilman et al ., 2001; Badgley et al ., 2006). Contamination of surface and groundwater by pesticides, biocides and other chemicals derived from intensified agricultural practices is taking place globally. Moreover, the ever increasing industrial activity and the application of a great variety of chemicals in industrial sectors definitely cause an extra load of potentially toxic compounds to the environment. Also, chemicals used in personal care products, pharmaceutical products and marine antifouling agents are expected to contribute to environmental quality degradation. Many aquatic species are able to accumulate pollutants in their bodies (Rainbow, 2002). The accumulation capacity is well-known for mussels, 38

which may contain environmental pollutants in concentrations several orders of magnitude higher than in the water. Also crustaceans may accumulate pollutants, which are retained in the hepatopancreas. The high concentrations of pollutants in some representatives of the marine coastal environment may form a basis for biomonitoring programmes which aim to document temporal or geographic trends (Van Straalen, 2008). For example, in the 1980s a mussel watch programme was set-up to monitor pollution along the West coast of the US (Farrington et al., 1983). Environmental pollution has increased worldwide due to industrial activity but also due to intensification of agricultural and aquaculture practices. The increased global population also produces an increasing amount of waste that is released into the environment via wastewater, waste incineration processes and controlled or uncontrolled dumping of solid wastes. Many toxic pollutants present in the water may end up in animal organs through bioaccumulation. Several researchers reported that persistent organochlorine compounds, such as polychlorinated biphenyls (PCBs), dioxin-like compounds and toxic metals like mercury and cadmium are found in seafood (Smith and Gangolli, 2002; Bayen et al., 2005; Moon and Ok, 2006; Storelli, 2008). Depending on how aquatic animals are exposed to the pollutants, the route of uptake in the animal body may be different. A distinction is made between passive diffusion, facilitated transport, active transport and endocytosis (Simkiss and Taylor, 1995 in Veltman et al., 2008). In general, seafood that is cultured in polluted areas is contaminated by the same pollutants that exist in water and sediment. Ahmed (1991) stated that seafood quality always reflects the quality of the water from which it is captured. The Minamata disease in the Minamata bay Japan is an example of

39

dramatic tragedies caused by the consumption of metal-contaminated seafood (Takeuchi et al ., 1962). The Minamata disease is a toxic encephalopathia without a primary inflammation as a result of consumption of large amounts of fish and shellfish that were contaminated with methylmercury. The Minamata bay was contaminated by mercury originating from the effluent of a chemical factory producing artificial fertilizers, vinyl chloride, acetaldehyde and its derivatives. In the production of especially acetaldehyde, mercuric chloride and sulphate were used as catalysts. The mercury was eventually bioaccumulated in shellfish and fish growing in the bay, after being methylated by sediment-living microorganisms. Although less dramatic, various reports dealing with metal contamination in seafood are available worldwide including among others coppercontaminated seafood in Taiwan (Han et al ., 1994), mussels contaminated with cadmium, copper, lead and zinc in the Philippines (Dumalangan et al., 2010), mercury-contaminated edible fish species in Malaysia (Hajeb et al ., 2009), trace metals in edible tissues of several aquatic animals in Australia (Fabris et al., 2006), edible fish species contaminated with lead and cadmium in Finland (Tahvonen and Kumpulainen, 1996), fish contaminated by mercury and methyl-mercury in Brazil (Malm et al., 1995), intake of arsenic, cadmium, mercury and lead through metal-contaminated seafood in Spain (Falco et al ., 2006) and mercury-contaminated seafood in Indonesia (Soegianto et al., 2010). The health benefits and risks of consuming seafood to some extent cause a conflict between the dietary recommendation to eat seafood regularly and the seafood safety problem. Sioen et al. (2008) even mentioned that debating the health benefits versus the risks of seafood consumption has reached a

40

scientific and social interest. In addition, pathogen contamination of seafood may interact with environmental pollutant accumulation, as these types of contamination often co-occur. Several aspects of this complex problem of seafood safety are studied in this thesis, focused on seafood production in Central Java, Indonesia. Indonesia is one of the top ten aquaculture producers in the world (FAO, 2006). With regard to the international trading as well as local food supply, assuring seafood quality and safety is therefore crucial. Among the coastal cities of Indonesia, Semarang, Java Island, is known to have good resources for aquaculture. Around 42% of the Semarang coast line is utilized for aquaculture with milk-fish (Chanos chanos ) and tiger prawn (Penaeus monodon) being the favourite seafood commodities cultured in the coastal ponds (tambaks). From an ecological prespective, aquaculture in the estuarine environments tends to be problematic, because of the tendency of these areas to trap and accumulate particle-bound pollutants such as metals (Fernandes et al ., 1994). Previous studies on metal concentrations in the sediment of streams along the Northern coast of Central Java, including Semarang, have shown that several spots contained especially high concentrations of copper and lead (Widianarko et al., 2000a; Widianarko et al., 2000b; Takarina et al., 2004). Java is the most densely populated island in Indonesia (Whitten et al ., 1996), and even in the World (Gillespie and Clague, 2009). The fact that typhoid fever ranked fourth among the ten commonest diseases in Semarang (Gasem et al., 2001) most likely also links to the poor food hygiene (in addition to bad housing sanitation). In fact, typhoid fever spreads through faecal contamination of water and food (Egoz et al ., 1988; King et a l., 1989). Typhoid fever is caused by Salmonella enterica and the outbreak spreads up easily via typhoid fever patients or

41

carriers of Salmonella-contaminated feces. In practice, shrimp obtained from Java Island appeared to be contaminated with human bacterial pathogens (Dewanti-Hariyadi et al., 2005). This underlines the seriousness of bacterial contamination in the water but also in the food. It adds to the complexity of environmental problems in the estuarine area of Semarang via poor hygiene and sanitation. Considering the complex pollution in the Semarang coastal area there is a serious concern about quality and safety of seafood cultured in the productive coastal area. Seafood may not only be contaminated with e.g. metals and microbial agents, both actors may also have an effect on indigenous agents like histamine that is produced by the organisms themselves or may result from microbial activity upon storage of seafood. By nature, the interaction between metals and (micro)organisms is very complex. Some metals are essential to animals, plants or microorganisms and therefore selectively retained from the food and often regulated in the body. Others are non-essential but may still circulate through animal bodies. Both essential and non-essential metals may be toxic at low concentrations. This asks for a comprehensive study on the interaction between metal contamination and microbial-related effects on seafood quality. This study therefore focuses on the interaction between metal pollution of aquaculture ponds, microbial community structure and histamine production in related seafood species. A conceptual model that links the three factors (metals, microorganisms and seafood) is shown in Figure 3. According to this model, metals in the aquatic environment will not only affect the community structure in the water but may also affect the seafood directly through metal bioaccumulation. Metal

42

accumulation may also lead to toxic effects on the organisms cultured, with histamine production being one element of concern in case of crustacean seafood items like shrimp and crayfish. Histamine may be produced in response to stress (Cebada and Garcia, 2007). Changes in the microbial community structure due to metal exposure may not only occur in the water but also in the seafood. As a consequence of these changes, the population of histamine-producing bacteria in the seafood items may change, both in size and activity. This may possibly affect seafood quality and safety, by increasing histamine production. All these factors have to be studied as they may affect food quality and safety individually as well as in combination. In this study, we focused on crustaceans, which are the most economically valuable seafood commodity after cyprinid fish (FAO, 2006). Edible crustaceans, especially shrimp and prawn, are also cultivated world-wide making that the study will have a broader impact. Crustaceans are known to accumulate more metals than fish (Rainbow, 1992). Also, crustaceans naturally produce histamine, a human allergenic substance (Mietz and Karmas, 1978). The most common edible species of crustacean cultured in Indonesia is the tiger prawn, Peneaus monodon. In European restaurants the tiger prawn is commonly known as gamba. Live tiger prawns however, are not available in The Netherlands and most likely also not obtainable in any European laboratory. Therefore we chose a crustacean species that is more accessible to biological experiments. The freshwater marbled crayfish (Procambarus sp.; Malacostraca, Decapoda, Astacida) was chosen as a model in this study, due to the ease of culturing and production of high numbers of genetically identical offspring (Martin et al., 2007).

43

Figure 3. Conceptual model of the interactions between metals and microorganisms in the aquatic environment and their impact on crustaceans. Shown are several processes of concern for seafood quality and safety: (1) metal bioaccumulation in crustaceans, (2) histamine formation in the animal triggered by metal exposure, (3) bacterial community structure and functioning in the animals affected by metal contamination and its consequences for histamine accumulation in the edible tissues during storage.

Objectives of the thesis

The main purpose of this study is to determine the interaction between metals and microorganisms in the aquatic environment and their impact upon crustaceans. The study especially focused on food quality and safety aspects related to metal and microbial contamination. Several approaches were chosen in this study, i.e. metal bioaccumulation, histamine formation in the animal triggered by metals, bacterial community structure as affected by metal contamination and histamine accumulation in the crayfish edible tissue during storage. 44

Outline of the thesis

In Chapter 2 , the profile of metal pollution in coastal shrimp pond sediments along the Semarang coast line was investigated. It was concluded that metal contamination in Semarang coastal pond sediments most likely is due to anthropogenic input. Among the metals, copper was generally found and at several sites the concentrations were up to twice the local background concentration. In Chapter 3 , copper uptake and elimination kinetics in the organs of marbled crayfish (Procambarus sp.) were determined at two exposure levels in the water. Copper showed fast uptake kinetics with in most organs equilibrium was reached within 10 days of exposure. Copper accumulation was highest in the hepatopancreas, which acts as a storage organ. Copper concentrations in muscle (edible tissue) showed fast kinetics, even at 0.38 mg Cu/L in the water and as a result concentrations remained fairly low and therefore do not pose any risk to food safety. In Chapter 4 , the effect of copper exposure levels on triggering histamine production in the hepatopancreas and the muscle of marbled crayfish was examined. Histamine levels showed a significant increase under the influence of increased copper exposure levels. Histamine production may be linked to a stress response of the animal or could arise because of upregulation of histidine production (to scavenge excess copper) followed by transformation to histamine. In Chapter 5 , interactions between accumulated copper, bacterial community structure and histamine formation in crayfish meat were studied during storage of the meat at 5oC. Exposure of the crayfish to an aqueous copper concentration of 0.5 mg Cu/L changed the bacterial community structure in the water and significantly reduced the histamine accumulation levels in crayfish meat during 10 days of storage.

45

Chapter 6 provides a general discussion of the thesis. Results and findings from the field investigation as well as the scientific knowledge obtained from the laboratory experiments are discussed and general conclusions with respect to improvement of seafood quality and safety are drawn.

46

Chapter 2 Metal contamination in coastal pond sediments of Semarang Indonesia

47

Abstract
Semarang is one of the largest coastal cities in Indonesia with a long tradition of aquaculture and seafood consumption. The rapid residential growth, industrial expansion and agricultural intensification have contributed to increasing metal pollution in the Semarang rivers and coastal areas. In this study, we examined the metal concentrations of aquaculture pond sediments along the Semarang coast line. Sediment samples were taken from ten aquaculture ponds in spring 2009. Copper concentrations at several sites were found to be up to twice the local background concentration, which is approximately 40 g/g dry weight. Some sites close to the intercity highway and the Semarang harbor were polluted by lead. According to Sediment Quality Guidelines (SQGs) applied in Australia and New Zealand, Hong Kong and the Netherlands, Semarang coastal pond sediments can be classified as mid-range (medium range) contaminated. Natural erosion of Mount Ungaran as well as the use of copper-based chemicals in manufacturing industries, agriculture, fisheries and household wastes are possible sources of copper. Lead most likely originates from automobile exhaust. Considering that concentrations of other trace metals (Cr and Ni) were also increased in some of the sediments, the ecological risk and possible consequences for aquaculture should be assessed further.

48

Introduction
Increasing industrial activities, large population density and agricultural intensification may lead to increased levels of anthropogenic pollutants in the environment. Coastal areas could be the most affected places among potentially polluted sites as pollutants in any water will end up in the coastal areas and the sea. Since coastal areas are also used for culturing several edible species, pollution may affect these organisms. The effects of pollution may not only include reduction of the productivity but the bioaccumulation of pollutants in animal organs, especially in the edible parts, will also have consequences for food quality and food safety. Metals are naturally occurring elements whose concentrations and bioavailability have been greatly influenced by human activities. Metals cause bioaccumulation problems in many organisms (Luoma and Rainbow, 2008) which may lead to many health effects. The itai-itai disease, which occurred in the Toyama Prefecture in Japan in the 1950, is an example of dramatic metal (cadmium) poisoning that also involved metal-contaminated food consumption (Inaba et al ., 2005). Another example is the Minamata disease caused by mercury-contaminated fish eaten by Japanese fishermen and their families around the Minamata bay in 1950s (Takeuchi et al., 1962). There are many more, less dramatic, examples of metal bioaccumulation in seafood (Pourang, 1995; Malm et al., 1995; Madany et al., 1995) that exceed the legal safety limits defined by FAO (Nauen, 1983) and ANHMRC (Maher, 1985). Aquaculture plays an important role for the economy of Indonesia. Referring to the state of aquaculture summarized by FAO (2006), Indonesia takes the 49

sixth position among the top ten aquaculture producers in the world. Indonesian aquaculture products are essential not only for the local food supply but also for export. Considering that aquaculture products are traded as a food commodity, therefore quality and safety are important considerations. Not only pathogenic microorganisms but also chemical contaminants, such as persistent organic pollutants and potentially toxic metals, are major concerns for seafood safety in that they may pose a risk to consumer health. Semarang is one of the coastal cities of Indonesia which has good resources for aquaculture. About 42% of the Semarang coast line is utilized for aquaculture. Milk fish (Chanos chanos) and tiger prawn (Penaeus monodon) are the two favorite seafood commodities cultured in the coastal ponds. With the citys increasing economic development, metal pollution is also increasing as was already found in the rivers of Semarang urban area some 10 years ago (Widianarko et al., 2000a; Widianarko et al., 2000b; Takarina et al., 2004). Metal contamination in the aquaculture ponds of the Semarang coast line is therefore of concern, but so far there are no data available on metal concentrations in these ponds. The objectives of the present study were (1) to determine physical characteristics and metal concentrations in the Semarang coastal pond sediments, (2) to compare the metal concentrations found in the sediments with the local background concentration and internationally accepted Sediment Quality Guidelines, and (3) to provide information on the possible sources of the metals and their potential risk for food quality and safety.

50

Material and methods

Study Area Semarang, the capital city of the province of Central Java, is the fifth largest city of Indonesia. It is located at South Latitude 6o5608 to 7o0657 and East Longitude 110o1617 to 110o3031 (Marfai and King, 2008). The city has a typical coastal geography, consisting of a hilly area in the South and a coastal lowland area in the North. In the South, Semarang is bordered by Mount Ungaran (2050 m), an eroded stratovolcano. The Semarang municipality covers an area of about 373.7 km2 in which the northern parts are adjacent to the Java coast line (Lubis et al ., 2011). Semarang has a tropical climate with alternating rainy and dry seasons. The annual rainfall is about 20652460 mm with maximum rainfall in December and January (Marfai and King, 2008). The climate generally is hot with temperatures between 24C and 30C, and an average annual temperature of 28.4C. Two canalized rivers from Mount Ungaran run through the city, one on the east side (East Canal) and one through the west side (West Canal). The Semarang coastal area was originally fringed with mangrove forests, but is now highly developed for multi-use purposes, including major industrial facilities, fisheries, and a harbor. The land use pattern and physical environment in Semarang are uncontrolled and changing rapidly neglecting the environmental carrying capacity both in the upland and in the lowland area. The average population density of Semarang has reached 1,010 people per square kilometer. Agriculture is intensifying as well as industrial activities. The number of industrial enterprises has reached 4,678 units in Central Java (Central Java Province Statistical Central Bureau, 2009). A map of Semarang is shown in Figure 1. A map of Semarang - Indonesia is shown

51

in Figure 1. The map of Indonesia was created using the Ocean Data View packages, http://odv.awi.de (Schlitzer, 2008), and the map of Semarang was manually re-drawn from a map provided by Google Maps, http://maps.google.com.

Figure 1. Semarang, Central Java Indonesia. The numbers indicate the aquaculture ponds sampled for this study. The sampling sites include: 1. Beringin River 6. Siangker River-1 2. Kyai Gilang River-1 7. Siangker River-2 3. Kyai Gilang River-2 8. West Canal 4. Tapak River-1 9. East Canal-1 5. Tapak River-2 10. East Canal-2

52

Sampling schedule The sampling locations, marked with black dots in Figure 1, are aquaculture areas along the Semarang coast line. The sampling sites fall under the influence of different rivers and canals, with different levels of human interference and a variable degree of exposure to metal contamination. Surface sediment (5-10 cm) samples were collected using a plastic grab sampler at ten locations during the late rainy season, February through March 2009. The water level in the ponds varied from 50 to 150 cm at the time of sampling. In each pond three samples were taken, each consisting of about 2 kg of wet sediment. The wet material was stored in 5-L plastic bags, sieved in the laboratory and the fraction passing through a diameter size of 5 mm was dried at 105oC for 48 hours. Before extraction, the dried material was grounded using a porcelain mortar and again sieved through a plastic sieve with diameter size of 0.5 mm. The fine dried sediments were stored in a plastic bag under dry conditions until chemical analysis. Metal analysis Dried homogenized sediment samples of 100 mg were digested in 2.0 ml of a mixture of HNO3 (Sigma-Aldrich, 65%) and HCl (Riedel-de-Han, 37%) in a ratio of 4:1, in closed teflon pots placed in an oven with a constant temperature of 140oC for 7 hours. The digests were diluted with milli-Q water to a volume of 10 ml and analyzed for seven different metals (Cd, Cr, Cu, Fe, Ni, Pb and Zn) by flame atomic absorption spectrophotometer (Perkin-Elmer AAnalyst 100). Quality control of the analyses was maintained by digesting certified reference material ISE 989. The recoveries of the different metals in the reference material were 103-108% of the certified reference values.

53

Sediment characterization To determine pH, 5.0 g dry weight sediment was shaken with 25 mL 0.01 M CaCl2 for 2 hours at 200 rpm. The pH was then measured using a Consort P907 pH meter. Organic matter content was determined as Loss on Ignition (%LoI) upon burning samples for 6 hours at 500 oC in an oven. The Cation Exchange Capacity (CEC) was determined using the silver thiourea method (Dohrmann, 2006) with some modifications. Principally, all positive ions bound to negatively charged colloid surfaces, mineral and organic, are replaced by the strong affinity monovalent silver thiourea complex (AgTU) cation. The dried sediment was constantly mixed with a 0.01 M AgTU solution in Milli-Q water under end-over-end shaking for 4 hours, followed by centrifugation (MSE Falcon 6/300, UK) for 15 minutes at 3000 rpm. The supernatants of samples and blanks were diluted 100 times and the concentration of silver was measured by flame atomic absorption spectrophotometry (Perkin-Elmer AAnalyst 100). Quality control of the analysis was maintained by determining CEC of the LUFA 2.2 standard soil (Speyer, Germany). The CEC measured in Lufa 2.2 soil was 70-77% of the certified value. Statistical analysis All computations were done using the statistical software package SPSS 16.00. Comparisons between metal concentrations in the sediments from different sites were done by analysis of variance (one way ANOVA) followed by Tukeys post-hoc test (p < 0.05). The possible association between different metals was pair-wise assessed by determining Pearson correlation.

54

Results and discussion

Physicochemical characteristics of sediments The pH, organic matter content and CEC of the ten sampling sites are shown in Table 1. All sediments were slightly basic with pH-CaCl2 ranging from 7.4 to 8.1. Such characteristics are typical, as normal pH of surface water (including seawater) is neutral to basic. In addition, the alkaline pH may be partly due to lime application. In ponds constructed in mangrove areas, oxidation of pyrite causes release of acid sulfate, and liming is applied to neutralize the acid (Grslund and Bengtsson, 2001). All sediments contained relatively high organic matter contents (> 4%), which are considered normal as the sampling sites were located in estuarine areas with prior mangrove vegetation. Sediments had fairly high CEC levels, which were similar to values of soils along the Semarang coast line. CEC often is correlated with organic matter, clay and silt contents (Asadu et al., 1997). Metal concentrations Metal concentrations found in the aquaculture pond sediments are presented in Table 2 and Figure 2. Concentrations of cadmium in all samples were below the detection limit (0.03 g/g). Zinc, nickel and iron concentrations varied among locations but were generally low. Widianarko et al . (2000a) proposed local background concentrations of Cu, Pb and Zn for Semarang coastal area of 40.7 g/g, 25.6 g/g and 132 g/g, respectively. Only copper levels in all samples exceeded the local background concentration. In three sampling sites located close to Beringin River, East Canal-1 and Siangker River, copper concentrations were 1.7 to 1.8 times the local background concentration, suggesting pollution due to anthropogenic activities. Lead concentrations in sediments taken from East Canal-1 (112 14.7 g/g) and

55

Table 1. Sampling locations and physicochemical characteristics of sediments collected from ten aquaculture ponds along the Semarang coastal line in Indonesia.

Location Beringin River East Canal-1 East Canal-2 Gilang River-1 Gilang River-2 Siangker River-1 Siangker River-2 Tapak River-1 Tapak River-2 West Canal
o

GPS 06 57.405S ; 110o19.214E 06o57.224S ; 110o27.060E 06o57.366S ; 110o27.194E 06o57.065S ; 110o18.765E 06o56.901S ; 110o18.758E 06o58.060S ; 110o23.142E 06o58.083S ; 110o22.912E 06o58.036S ; 110o21.126E 06o58.045S ; 110o21.168E 06o57.016S ; 110o24.300E

pH CaCl2 8.1 7.4 7.8 7.8 7.9 7.8 7.9 7.6 7.9 7.8

LoI (%) 6.10.08 11.20.05 8.20.06 9.70.04 7.70.14 7.20.06 8.50.06 8.80.06 7.80.06 4.70.13

CEC (cmol/kg) d.w. 30.90.47 29.60.94 28.91.86 31.10.21 31.60.09 29.50.75 30.40.70 30.70.86 30.90.77 30.90.36

GPS = location indicated with Global Positioning System LoI = Loss on Ignition (= organic matter content) CEC = Cation Exchange Capacity d.w. is dry weight Name of location refers to the closest river or canal All values for LoI and CEC are mean standard deviation (n=3). Sample size was 3, each with 2 replications of laboratory analysis.

56

120 100 80 60 40 20 0

80

70

Cu (g/g DW) Cu (g/g DW)

50

Pb (g/g DW)

60

BR EC1 EC2 GR1 GR2 SR1 SR2 TR1 TR2 WC

BR EC1 EC2 GR1 GR2 SR1 SR2 TR1 TR2 WC

35 70

22

30 18

20 60

25 16

Cr (g/g DW)

Ni (g/g DW)

20 14

Fe (mg/g DW)
50 40 30

15 12

BR EC1 EC2 GR1 GR2 SR1 SR2 TR1 TR2 WC

BR EC1 EC2 GR1 GR2 SR1 SR2 TR1 TR2 WC

BR EC1 EC2 GR1 GR2 SR1 SR2 TR1 R2 WC

Figure 2. Box-Whisker plots showing the variation in copper, lead, chromium, nickel and iron concentrations in g/g dry weight (meanSE, n=6) in sediment from ten different aquaculture ponds along the Semarang coast line. See Table 1 and Figure 1 for further information on the sampling sites, and Table 2 for mean metal concentrations. BR = Beringin River; EC = East Canal; SR = Siangker River; GR = Kyai Gilang River; TR = Tapak River; WC = West Canal.

57

Tabel 2. Metal concentrations found in sediments collected from ten aquaculture ponds along the Semarang (Indonesia) coast line in the period of February March 2009.

Cu (g/g d.w.) 72.63.2b,c 20.10.1a

c

Pb (g/g d.w.) 21.00.7a,b 31.01.0e 28.04.2d,e 26.00.3b,c,d,e 22.50.8b,c 17.21.5a 25.41.9b,c,d 24.72.6b,c,d 27.50.6c,d,e 21.22.4a,b 16.30.2b,c 13.20.8a 17.10.9b 18.51.5c,d 19.01.0c,d 15.71.6a,b 15.50.3a,b 19.11.4d 19.70.4d 44.24.6a 45.02.8a 50.75.9a,b 57.22.9b,c 47.30.9a 49.20.9a,b 50.43.1a,b 51.02.5a,b 52.50.7a,b 15.70.1a,b 64.03.3c (g/g d.w.) (g/g d.w.) (mg/g d.w.)

Cr

Ni

Fe

Zn (g/g d.w.) 1489.7b,c 19424.9d 1075.7a,b 92.51.8a 1040.9a,b 12121.9a,b,c 11032.2a,b 1626.0c,d 1255.3a,b,c 1083.7a,b

Location

Beringin River 72.311.7b,c 11214.7 81.330.2b 19.40.4a 21.80.4a 14.40.5a 19.22.7a 22.51.4a 21.21.2a 18.71.4a

East Canal-1

East Canal-2 51.40.9a 64.51.3a,b,c 73.75.1c 52.75.5a,b 47.30.3a 49.41.0a

60.813.4a,b,c

Gilang River-1

Gilang River-2

Siangker River-1

Siangker River-2

Tapak River-1

57.210.5a,b,c

Tapak River-2

West Canal

Name of location refers to the closest river or canal; see Table 1 and Figure 1. d.w. is dry weight All values are mean standard deviation (n=3). Sample size was 3, each with 2 replications of laboratory analysis. Different superscripts show significant differences between locations (p<0.01), based on Tukeys post-hoc test. The values printed in bold exceed the Sediment Quality Guidelines (see Table 4)

58

East Canal-2 (81.3 30.2 g/g) were significantly higher than at the other locations (Tukeys post-hoc test; p < 0.05). Lead most likely originated from automobile exhausts since both sites are located less than 50 meters away from the intercity highway (Jalan Arteri Utara) and around 2 km from the Semarang harbour. Pearson correlations between metal concentrations found in the ten sampling sites are shown in Table 3. When metals are found in high levels at the same site, this may suggest a similar source of pollution. Chromium and nickel concentrations were significantly correlated (p<0.01). In geochemistry research, the Cr/Ni ratio is commonly used as a preindication of volcanic rock and stone (Garver et al., 1996). The existence of chromium together with nickel found at two locations (East Canal-1 and East Canal-2) is indicative of natural erosion from Mount Ungaran. The significant correlations between lead, nickel and chromium concentrations, however, may also suggest an anthropogenic source of nickel and chromium pollution. These metals often are used together in electroplating industries (United State Patent, 1995). The significant correlation between copper and zinc (p < 0.05) might indicate the anthropogenic origin of these metals from their use in fungicides (complex of copper and zinc with sulphuric acid; Nan, 1995). Possible sources of copper in pond sediments Metal contamination of aquaculture ponds can be unintentional and sometimes even unavoidable due to water quality problems (Grslund and Bengtsson, 2001). Boyd (1990) cited by Yang et al. (2007) stated that copper pollution often results from copper sulphate. Copper sulphate is the most commonly used algicide, normally applied in the aquatic farming of fish, mollusks, crustaceans and aquatic plants. Copper sulphate application is the only algal control method for shrimp ponds recommended by FAO

59

(GESAMP, 1997). CuSO4.5H2O is known as an effective, relatively inexpensive algicide, which is also useful as an anti-parasitic agent (Watson and Yanong, 2006). Considering that waters along the north coast of Central Java normally are turbid and eutrophic (Takarina et al., 2004), fish farmers in Semarang coastal ponds may be expected to use the copper-based algicides to control water quality and to combat parasites. Copper is an essential mineral for animals and plants, so it is commonly used for fortification in the food and feed manufacturing industry. Copper contaminated waste water may be produced by food factories in Semarang including among others for the production of noodles, biscuits and bakery products, dairy products, candy and frying oil. Also these processes may contribute to the increasing anthropogenic copper pollution of rivers and canals. Copper is also known as antifouling agent for boats (Warnken et al., 2004) and often used as wood-preservative (Freeman and McIntyre, 2008) in plywood and furniture. Semarang harbour (Tanjung Mas) is a trade port where many ferries and boats often lie at anchor for several days. Given that the local government did not ban copper-based antifouling yet, relatively high copper concentrations may be found in the port area. Furthermore, a large plywood factory is operating in Semarang together with many smallscale furniture producers, which also use copper-based wood preservatives. These activities may also contribute the increasing anthropogenic copper levels. Application of copper-based dyes in Semarang textile and porcelain industries can be another source of anthropogenic copper pollution. In developing countries, including Indonesia, 70% of the industrial waste is discharged untreated into surface water bodies (WWAP, 2000). As any effluent discharged into the environment eventually finds its way to a river, pond or sea, aquatic animals may be most vulnerable to the toxic effects

60

Tabel 3. Pearson correlations between metal concentrations found in ten aquaculture ponds along the Semarang coast line.

Log_Pb (g/g d.w.) 1.000 0.277 0.073 0.478** -0.101 -0.296 -0.395* 0.168 0.375* 1.000 1.000 0.867** 1.000 -0.234 -0.387* 1.000 1.000

Log_Cu (g/g d.w.)

Log_Fe (mg/g d.w.)

Log_Zn (g/g d.w.)

Log_Ni (g/g d.w.)

Log_Cr (g/g d.w.)

-0.486** 0.392*

0.653**

Log_Pb (g/g d.w.) Log_Cu (g/g d.w.) Log_Fe (mg/g d.w.) Log_Zn (g/g d.w.) Log_Ni (g/g d.w.) Log_Cr (g/g d.w.)

0.640**

For this analysis, data were log-transformed d.w. is dry weight **. Correlation is significant at the 0.01 level (2-tailed). *. Correlation is significant at the 0.05 level (2-tailed).

61

Table 4. Cu and Pb concentrations of Semarang coastal pond sediments compared to different Sediment Quality Guidelines

Source of data 47.3 73.7 18.7 112 50a; 75c; 85b 218c; 220a; 530b The present study 34a; 36b; 65c 190b; 270a,c

Cu (g/g) d.w.

Pb (g/g) d.w.

Reference

Semarang pond sediments

Sediment Quality Guideline (SQG): Low

High

a. ANZECC-ISQG for Australia and New Zealand (Simpson et al., 2006) b. SQO for the Netherlands (Crommentuijn et al., 2000) c. ISQV for Hong Kong (Chapman et al., 1999)

d.w. is dry weight ANZECC-SQG, Australian and New Zealand Environment Conservation Council Interim Sediment Quality Guideline SQO, Sediment Quality Objective ISQV, Interim Sediment Quality Value

62

of pollutants. Considering that some aquatic animals are consumed and traded as food, pollution in the aquaculture ponds may eventually also pose a risk to human health. Seafood quality and safety risk Metal concentrations found in sediment are not necessarily available for organisms. Physical and chemical characteristics of the sediments, like organic matter content, chelating agents, humic substances, ligands, pH and metal interactions may all influence the bioavailability of metals (Simpson et al., 2004; Luoma & Rainbow, 2008). Metal bioavailability can affect living organisms via bioaccumulation processes. Elevating awareness on seafood safety in the global society is quite logical as seafood consumption per capita has increased remarkably over the last two decades (Einarsson & Emerson, 2009). Evidence of copper-contaminated seafood products sold in the local markets has been reported by several authors from various countries (Maher, 1985; Han, et al ., 1994; Hashmi et al., 2002; Canli and Atli, 2003; Pourang et al ., 2005; Mishra et al ., 2007; Sivaperumal et al ., 2007). The European Copper Institute proposed a legal limit of copper in foodstuff of 5 g/g wet basis (Van Lysebetten et al., 2010). The World Health Organization (WHO) and the Food and Agricultural Administration (FAA) suggest the intake of copper should not exceed 12 mg/day for adult males and 10 mg/day for adult females. Some clinical features of copper toxicity include among others, fatigue, depression, headaches, cold extremities, lack of concentration and poor memory (Nolan, 1983).

63

Although there is evidence that copper may accumulate in seafood products, it still is uncertain whether the increased concentrations found in Semarang coastal pond sediments indeed pose a risk for seafood quality and safety. The fact that also other metals, like Cr and Ni, show increased sediment concentrations asks for further research to assess the risk for seafood consumers and therefore for human health.

Conclusions
Compared to the SQG values for copper and lead, Semarang coastal ponds sediments are categorized as mid-range contaminated. In addition to copper and lead, also nickel and chromium at some sites show elevated sediment concentrations. Metal pollution in Semarang coastal pond sediments can at least partly be attributed to anthropogenic input. The pond sediments along the Semarang coast line are slightly basic, relatively high in organic matter contents, and have fairly high CEC values. As a consequence, metal bioavailability may be reduced. Nevertheless, copper and lead contamination in Semarang coastal ponds may threaten local aquaculture practices and may pose a risk for the quality and safety of seafood products.

64

Chapter 3 Copper toxicokinetics in marbled crayfish (Procambarus sp.): implications for food quality and safety

65

Abstract
Metal pollution in coastal areas may threaten seafood quality through metal bioaccumulation in edible organs. Although copper is an essential trace metal, it is a common pollutant in sediments. The aim of this study was to investigate the effect of copper exposure concentration on copper bioaccumulation in marbled crayfish (Procambarus sp.) by determining uptake and elimination kinetics. Crayfish were exposed to average sub-lethal copper concentrations of 0.031 and 0.38 mg Cu/L for 14 days and transferred to copper-free water for another 14 days. At different time points during the uptake and elimination phases copper concentrations were measured in five organs (exoskeleton, gills, muscle, ovaries and hepatopancreas). At 0.031 mg Cu/L, copper levels in the crayfish organs were not significantly increased compared to the control animals, suggesting effective regulation. Exposure to 0.38 mg Cu/L did lead to slightly, but not significantly increased copper levels in muscles and ovaries, while the gills and exoskeleton, which are in direct contact with the water, showed significantly increased copper concentrations. In these four organs, copper showed fast uptake kinetics with equilibrium being reached within 10 days of exposure. Copper accumulation was highest in the hepatopancreas; uptake in this storage organ steadily increased with time and did not reach equilibrium within the 14-day exposure period. The maximum copper concentration reached in edible parts (muscle) of the crayfish did not exceed the Australian National Health and Medical Research Council recommended standard value for edible crustaceans, suggesting that the risk for food quality and safety is limited at the exposure concentration of 0.38 mg Cu/L.

66

Introduction
One of the major groups of environmental pollutants are metals. Industrial and municipal discharges, including metal processing and acid mine drainage (Powell, 1988), smelter emissions (Nriagu and Rao, 1987), wastewater discharge by manufacturing industries (Camusso and Tartari, 1991; Oyewo and Don-Pedro, 2003) and domestic sludge disposal (Thongra-ar et al., 2008) can lead to elevated metal concentrations in the environment. Among the metal pollutants, copper is commonly found in the Earth's crust and water bodies (Nriagu, 1979). But elevated copper concentrations in surface waters are mostly caused by human activities. According to Graedel et al . (2004) the average anthropogenic copper discharge to surface waters was estimated at 499 550 Gg per year. As a consequence aquatic animals might habitually be exposed to copper in various concentrations. Bossuyt and Janssen (2003) stated that environmentally relevant copper concentrations in freshwater bodies are 0.5 100 g Cu/L. Among the aquatic organisms, crustaceans are important and possibly the most susceptible group. For example, Daphniidae, as a representative of crustaceans are known to be quite sensitive to pollutants (including metals) in aquatic ecosystems (Zhou et al ., 2008). From an ecological and food quality point of view, research on larger crustacean species is also highly relevant. In the freshwater food web, larger crustaceans take a position as predators, which may enhance the effect of bioaccumulation along the food chain. The advantage of using larger species as animal model in toxicological research is the possibility to determine the internal distribution of the compound of interest. Copper is an essential trace metal for all living organisms but is also highly toxic when the concentration exceeds species-specific thresholds (Pea et al., 67

1999; US-EPA, 2007). In earlier studies, 15 g Cu/L caused 50% mortality of rainbow trout juveniles after 35 days of exposure (McKim et al ., 1978). Further, Bini and Chelazzi (2006) reported that high internal copper concentrations caused red swamp crayfish (Procambarus clarkii ) to loose muscular control and eventually die. For an essential metal such as copper, the range between essential and toxic concentration levels can be rather narrow (Mastin and Rodgers, 2000). Understanding of the distribution of metals in certain tissues of organisms is vital, especially to identify specific organs particularly selective and sensitive to metal bioaccumulation (Szefer et al., 1990). There are several mechanisms that might be relevant for the uptake of metals in animals, including passive diffusion, facilitated transport, active transport and endocytosis (Simkiss and Taylor, 1995 in Veltman et al., 2008). In the case of an essential metal such as copper, the uptake is normally via membrane transport proteins (Veltman et al., 2008). But metal uptake does not always result in metal bioaccumulation. Bioaccumulation is a complex mechanism including uptake and elimination processes. Luoma and Rainbow (2005) mentioned that the bioaccumulation kinetics of metal in animals significantly varies, depending on the metal, with species and ecosystem investigated. The parthenogenetic marbled crayfish (Procambarus sp.) is a freshwater crustacean with unknown geographic origin and taxonomic identity (Scholtz et al., 2003) that has been reported as an invasive species in Europe and Madagaskar (Marzano et al ., 2009; Jimenez and Faulkes, 2010). Studies on marbled crayfish so far have focused on morphological and molecular analysis (Schiewek et al ., 2007), life stage (Seitz et al ., 2005) and reproductive components (Vogt et al ., 2004), development of the central nervous system

68

(Vilpoux et al., 2006), production of genetically uniform offspring (Martin et al., 2007) and also embryonic development of the histaminergic system (Rieger and Harszch, 2008). This makes it a suitable species also for toxicity tests. However, currently no research on metal kinetics in marbled crayfish has been reported. As a model-species of edible crustaceans and with regard to food quality and safety assessment, organ-specific accumulation data, especially for the muscles of crayfish, are highly required. The objectives of the present study were (1) to investigate the effect of exposure concentration on copper bioaccumulation in marbled crayfish organs by determining copper uptake and elimination kinetics, and (2) to evaluate the possible consequences of copper bioaccumulation in edible parts of marbled crayfish from a food quality and safety point of view.

Materials and methods

Animals Marbled crayfish (Procambarus sp.; Marmokrebs; Malacostraca, Decapoda, Astacida), used as a model of edible crustacean, were provided by Alterra, part of Wageningen University and Research Centre - the Netherlands. The animals measured 3.5-7.2 cm and weighed 1.3-7.4 g (fresh weight). The animals were acclimated in continuously aerated filtered copper-free water (pH 7.3 0.1; hardness 24 mmol CaCO3/L) for one week prior to exposure, under constant laboratory conditions (temperature 20 1 C; day/night cycle of 12 hours light and 12 hours dark). Copper-free tap water was obtained from a special piping system without copper linings available at VU University. Animals were fed commercial crayfish food pellets three times a week. 69

Copper exposure The copper concentrations used in this study were based on Bini and Chelazzi (2006) who showed that a concentration of 0.05 mg Cu/L caused no effects while at 0.5 mg Cu/L a (non-lethal) reduction was observed in both heart and gill chamber ventilation rates of red swamp crayfish (Procambarus clarkii ). Test concentrations of 0.05 mg Cu/L and 0.5 mg Cu/L were prepared by dissolving CuSO4.5H2O (Merck, p.a.) in copper-free water. The test animals were randomly divided in three groups and exposed individually in 800 mL glass jars at 20 1 C. The first two groups, each having 31 animals, were exposed to the two different levels of copper (0.05 and 0.5 mg Cu/L). The third group, containing 7 animals, was the control and was kept in copper-free water. The animals were incubated in a climate-controlled room under the same conditions as during acclimatization. They were fed three times a week with commercial crayfish food pellets, shortly before renewing the exposure solution. The wet weight of all test animals was measured at the start of the test and upon sampling. The exposure took 14 days after which all remaining animals were transferred to copper-free water. At different time points during the copper uptake (1, 2, 4, 8 and 14 days) and elimination phases (15, 16, 18, 22 and 28 days) three animals from each treatment, in the inter-moult stage, were sampled and killed by cutting off the head using a lancet. Control animals were sampled only after 14 and 28 days. The animals were dissected to collect the gills, hepatopancreas, ovaries, muscle and exoskeleton. The organs were placed in plastic tubes with lid, frozen in liquid nitrogen, weighted and kept in a freezer (-20 C) until analysis. Copper concentration in animal organs and exposure solutions All tissue samples were freeze-dried for 48 hours and then powdered using a pestle and mortar. The dried homogenized samples were digested by two

70

different methods, depending on the amount of sample available. For samples < 50 mg, a micro-digestion was done using 600 l of a mixture of HNO3 (JT. Baker, Ultrex II ultra pure) and HClO4 (JT. Baker, Ultrex ultra pure) in the ratio of 7:1 in small glass tubes placed in a heater block with a gradual temperature increase (85 C for 60 min; 130 C for 60 min and 160 C for 60 min). Samples weighing > 50 mg were digested in 2.0 ml of a mixture of HNO3 (Sigma-Aldrich, 65%) and HCl (Riedel-de-Han, 37%) in a ratio of 4:1 in closed teflon pots placed in an oven with a constant temperature of 140 C for 7 hours. The digests in the glass tubes and teflon pots were diluted with 0.1 M HNO3 to volumes of 3.0 and 10 ml, respectively. For animals exposed to 0.5 mg Cu/L, organs were analyzed using flame atomic absorption spectrophotometry (AAS, Perkin-Elmer AAnalyst 100), while the organs of control and 0.05 mg Cu/L exposed animals were measured by graphite furnace AAS (Perkin-Elmer 5100). Also copper concentrations in the exposure solution were measured by flame or graphite furnace AAS. Quality control of the analysis was maintained by digesting certified reference material Dolt-2 (CNRC, Ontario, Canada). The recoveries of copper in the reference material averaged 57% (small glass tube digestion) and 108% (teflon pots digestion) of the certified reference value, respectively. Considering the large deviations for the micro-digestion method, all data were corrected for copper recovery in the certified reference material. Data analysis The copper uptake and elimination kinetics in each crayfish organ were analyzed using a one-compartment first-order kinetics model described by Janssen et al . (1991). The model considers each organ as an independent compartment with specific uptake and elimination rates. From the first 14-day

71

copper exposure period (the uptake phase), the copper concentration in the organs was described as: Qt = C0 + Cw(k1/k2)(1 e- k2t)

After 14 days, when the animals were transferred to copper-free water (the elimination phase), the copper concentration in the organs was described as: Qt = C0 + Cw(k1/k2)(1 e- k2t) Cw(k1/k2) (1 e k2(t-tc))

where Qt = copper concentration in crayfish organ (g Cu/g dry weight) at given time; C0 = copper concentration in the crayfish organ at t = 0 (g Cu/g dry weight), Cw = copper concentration in the water during the uptake phase (mg Cu/L), k1 = uptake rate (L water/kg organ dry weight per day), k2= elimination rate (per day), t = time (day), tc = time at which animals were transferred to copper-free water (day 14). Both equations were used simultaneously to estimate the parameters C0, k 1 and k2 using all data from the uptake and elimination phases for each copper treatment level. The model was applied to each organ separately, so it is assumed that all organs take up copper from a central compartment.

To calculate Cu kinetics in the whole crayfish, these equations were also applied to average total body concentrations estimated from the weighted sum of the concentrations in the different organs. In the latter calculation only, the average animal growth rate was taken into account to check to what extent elimination rate (k2) might be affected by growth dilution. The effect of copper concentration in the exposure solution and exposure time on the copper

72

concentration in each organ was analyzed using 2-way analysis of variance (ANOVA). All calculations and statistical analyses were performed with the statistics software SPSS, version 17.0 (SPSS Inc. Chicago, Illinois, USA).

Results
Of the 69 animals used, 64 (92.8 %) survived until the last day of the experiment. The fresh weight of the animals at the start of the experiment was comparable between treatments, with an average SD of 3.55 0.018 g (n=69). The average weight of the test animals increased with time reaching 3.97 1.60 (mean SD; n=39) g after 14 days but did not significantly differ from the starting weight (ANOVA, p > 0.05). Animal weights also did not differ between copper exposure levels (ANOVA, p > 0.05). The growth rate was estimated to be 0.006 and 0.007 g dry weight /day for the 0.05 and 0.5 mg Cu/L exposure groups, respectively. The average copper concentrations in the exposure solutions were 0.042 0.004 mg Cu/L and 0.446 0.018 mg Cu/L, respectively. Upon renewal of the water after 2-3 days, the copper concentrations were considerably lower with 0.020 0.007 mg Cu/L and 0.316 0.057 mg Cu/L, respectively. The decreased concentration was taken into account to calculate the average exposure level. The average copper concentrations over the entire exposure period used to calculate the uptake and elimination kinetics were 0.031 mg Cu/L and 0.38 mg Cu/L, respectively.

73

Exoskeleton

Hepatopancreas

Whole animal

Gills

Muscle

Figure 1. Uptake and elimination of copper in marbled crayfish (Procambarus sp.) exoskeleton, gills, hepatopancreas, muscle and the whole body. Crayfish were exposed for 14 days (uptake) to an average measured concentration of 0.38 mg Cu/L, after which they were transferred to copper-free water (elimination). Each data point represents a measurement of an individual animal. Lines represent the fit of a one-compartment first-order kinetics model to the data.

74

Copper concentrations in the marbled crayfish and in their exoskeleton, gills, muscles, and hepatopancreas exposed to an average measured concentration of 0.38 mg Cu/L are shown in Figure 1. Except for the ovaries, a good fit of the one-compartment model was obtained. In the ovaries, copper concentrations showed quite some variation and did not show a consistent change with copper exposure level and time. Copper levels in the ovaries ranged between 12 and 534 mg/kg dry weight. Copper kinetics in the whole animals was not affected by crayfish growth, suggesting there was no significant effect of growth dilution. For that reason no further attempts were made to extend the model with animal growth rate when assessing copper kinetics in the different tissues. Estimated uptake and elimination rates at an average measured concentration of 0.38 mg Cu/L are summarized in Table 1. This table also includes bioconcentration factors (BCF) calculated as the ratio of the uptake and elimination rate constants. BCF was highest for the hepatopancreas and lowest for the muscles and exoskeleton. Average BCF for copper accumulation in the whole animal was approximately 1214 L/kg. At an average measured concentration of 0.031 mg Cu/L, copper concentrations did not significantly increase with time, nor did they differ from the concentrations measured in the control animals (data not shown). As a consequence, the one-compartment model could not be fit to the data. Table 2 shows the results of the two-way ANOVA applied to the copper concentrations in the different crayfish organs. Copper concentrations in the exoskeleton, the gills and the hepatopancreas of animals exposed to the average measured concentration of 0.38 mg Cu/L were significantly higher than levels in the animals exposed to the average measured value of 0.031 mg Cu/L (ANOVA, p < 0.05). The effect of exposure concentration on copper concentrations in the ovaries and muscles was not significant (ANOVA, p >

75

Table 1. Copper uptake and elimination rates (k1 and k 2) and initial concentrations (C0) with corresponding standard error in different organs of the marbled crayfish (Procambarus sp.) exposed to an average measured concentration of 0.38 mg Cu/L estimated using a one-compartment firstorder kinetics model. Also given are bioconcentration factors (BCF) calculated as the ratio of k1 and k2 values.

Crayfish 41.3 17.6 20.1 10.1 257 139 13.5 7.25 223 114 0.034 0.033 0.253 0.120 0.269 0.136 0.223 0.114 0.008 0.032 184 31.9 50.4 6.01 490 78.4 24.1 4.88 797 274

k1 (L water/kg organ d.w./day)

k2 (day-1)

C0 (mg Cu/kg organ d.w.)

BCF (L/kg) 1214 79.4 955 60.5 27875

Animal Exoskeleton Gills Muscle Hepatopancreas

d.w. is dry weight

Table 2. Two-way ANOVA measures for the effect of copper exposure concentration and time on the copper accumulation levels in different organs of marbled crayfish (Procambarus sp.). The animals were exposed to average measured concentration of 0.031 mg Cu/L or 0.38 mg Cu/L, respectively for 14 days, after which they were transferred to copper free water until day 28.

Dependent variable Cu in exoskeleton Cu in gills Cu in ovaries Cu in muscle Cu in hepatopancreas

Copper exposure <0.001* 0.045* 0.213 0.199 <0.001*

Time 0.166 0.022* 0.238 0.285 0.006*

Interaction 0.108 0.378 0.298 0.612 0.108

*Significant at 0.05

76

0.05). Time had a significant effect on copper concentrations in the hepatopancreas and the gills, but not in the exoskeleton, the muscle or the ovaries. The interaction between copper exposure and time was not significant for any of the organs.

Discussion
Copper concentrations in the marbled crayfish organs at the highest exposure concentration could well be described by the one-compartment first-order kinetics model. Copper exposure to aquatic animals showed a large variety of sub lethal effects, which seem to be species-specific (Vasloo et al., 2002; van Heerden et al ., 2004; Li et a l., 2007). Osunde et a l. (2004) showed that survival of the juvenile freshwater prawn Macrobrachium rosenbergii was significantly reduced compared to the control when exposed to 0.2 and 0.4 mg Cu/L. In addition, exposure to 0.6 mg Cu/L showed a dramatic decrease of the survival. Bini and Chelazzi (2006), exposing the crayfish Procambarus clarkii to different copper concentrations in the water, found that 0.5 mg Cu/L caused a (non-lethal) reduction in both heart and gill chamber ventilation rates. In this study, marbled crayfish exposed for 14 days to average measured copper concentrations of 0.38 mg Cu/L did not show any significant effects on survival or growth. The nominal copper concentrations of 0.05 mg Cu/L and 0.5 mg Cu/L chosen for this study therefore did not have sublethal effects on the marbled crayfish. Copper was present in all crayfish organs, also without exposure to Cu-treated water (see the C0 values in Table 1). Copper is an essential metal in most organisms, but plays an important role especially in crustaceans. In these organisms, copper binds oxygen in hemocyanin, the respiratory protein in the blood (hemolymph) (Anderson et al., 1997). Uglow

77

(1969) in Donker et al . (1990) reported that hemocyanin constitutes approximately 90% of the haemolymph protein. Each hemocyanin molecule contains two copper atoms (Senkbeil and Wriston, 1981). Copper is also required for normal biological functioning of many proteins, including enzymes necessary for the moulting in blue crabs (Engel, 1987) and for the immune response in grass shrimp juveniles (Lee and Shiau, 2002). Animals exposed to an average measured concentration of 0.031 mg Cu/L showed no clear uptake suggesting that marbled crayfish are able to regulate copper in their bodies to a fairly constant level under low copper exposure. Animals exposed to an average measured concentration of 0.38 mg Cu/L showed increased uptake of copper, especially in the hepatopancreas. In this organ, copper levels showed a continuous increase with time until transfer to copper-free water. After the transfer, elimination of copper from the hepatopancreas occurred very slowly. The hepatopancreas has an important role in the copper homeostasis of several species (Donker et al., 1990; Lyon et al., 1983; Chaves-Crooker et al., 2003) and contains metal-binding proteins, so metals can be stored in this organ. It regulates the copper level in the crayfish body to avoid toxicity but also deficiencies. Copper kinetics in the whole body of marbled crayfish is very similar to that in the hepatopancreas, suggesting the hepatopancreas is the organ that regulates copper level in crayfish. The exoskeleton is a bio-mineral composite that serves as structural support (Sugawara et al ., 2006), so it will mainly take up copper from the water by adsorption. Gills, the respiratory organs of crayfish showed to be sensitive to changing copper concentrations in the water. In crayfish, gills are the primary entry points of copper in the body (Bryan, 1968 in Zia and Alikhan, 1979). Through respiration, copper in the water binds to hemocyanin (the oxygencarrier protein in the hemolymph) and further circulates to all organs in the

78

crustacean body. Copper kinetics in the muscle and ovaries therefore result from the hemocyanin circulating via the hemolymph. The copper accumulation pattern in the marbled crayfish found in this study, with hepatopancreas > gills > exoskeleton > muscle, is similar to the pattern reported for another crayfish species Astacus leptodactylus (Guner, 2007) as well as for the freshwater prawn Macrobachium rosenbergii (Li et al., 2005). The bioconcentration factor (BCF) is a quantitative measure that indicates the potential toxicological impact of substances (Feijtel et al., 1997). To produce adverse effects, metals must first bioaccumulate at a specific site (McGeer et al., 2003). But for an essential metal such as copper, the homeostatic control and active regulation in animals might affect the bioaccumulation process, thus also the BCF. Rainbow and White (1989) comparing three taxa of crustaceans (decapod, amphipod and barnacle), showed active regulation of the copper body concentration only in Palaemon elegans - a decapod. The BCF in marbled crayfish of this study was 1214, lower than in Daphnia magna exposed to 7.5 g Cu/L (Winner, 1985) as well as in the Antarctic gammarid Paramorsa walkeri after exposure to 30 g Cu/L (Duquesne et al ., 2000), which were ~ 2000 and 2080 respectively. It is suggested that the BCF may be lower in bigger animals, because their relative surface is smaller, while BCF also is known to decrease with increasing exposure concentration (McGeer et al., 2003; DeForest et a l., 2007). No other BCF values for copper uptake in larger crustacean species were available, however, hampering proper conclusions about the possible relationship of the BCF with e.g. water exposure concentration or body size. The advantage of using marbled crayfish as test animal in this study is due to the ease of culturing and production of high numbers of genetically identical

79

offspring (Martin et al . 2007). The marbled crayfish is useful in epigenetics and epigenomics (Vogt, 2008) but may also be suitable as a (eco)toxicological test species. This study supports the usefulness of this species for (eco)toxicological tests. Copper is an essential element also for humans, but excess copper in foodintake may have negative effects on human health. Clinical features of copper toxicity in humans include, among others, fatigue, depression, headaches, cold extremities, lack of concentration and poor memory (Nolan, 1983). The Australian National Health and Medical Research Council (ANHMRC) recommends a maximum copper level in crustaceans of 10 g/g wet weight (Maher, 1985). Considering that marbled crayfish contains on average approximately 72% water, the maximum copper concentrations measured in marbled crayfish muscles (meat) in this study of 40 g/g dry weight (~ 10 g/g wet weight) does not exceed the recommended level. Exposure of crayfish to a measured concentration of 0.38 mg Cu/L therefore does not pose a threat to food quality and safety.

Conclusions
Exposure to sub-lethal copper levels up to 0.38 mg Cu/L for 14 days did not affect survival and body weight development of marbled crayfish. At the lowest exposure level, copper was not significantly accumulated in the crayfish, suggesting an effective regulation of body concentrations. At 0.38 mg Cu/L, copper was rapidly accumulated in most crayfish organs, but also rapidly eliminated. Copper was mainly stored in the hepatopancreas and uptake and elimination kinetics in this organ were much slower.

80

Chapter 4 Effect of copper exposure on histamine concentrations in the marbled crayfish (Procambarus sp.)

81

Abstract
Crustaceans can store excess copper in the hepatopancreas, an organ playing a role in digestive activity as well as in neurosecretory control. Here, we studied the effect of copper exposure on the level of histamine, an indicator of food spoilage in edible crustaceans. Histamine is also a neuromodulator in the intestinal nervous system of crustaceans, and a human allergen. Marbled crayfish (Procambarus sp.) were exposed to average measured values 0.031 mg Cu/L and 0.38 mg Cu/L, respectively for 14 days and then transferred to copper-free water for another 14 days. Concentrations of copper and histamine in the hepatopancreas and muscle were evaluated at different time points. Histamine levels were significantly higher in hepatopancreas and muscle tissues at the highest exposure level, but only after transfer of the animals to copper-free water. The increased histamine concentration following copper exposure may be explained from a (delayed) stress response, and from upregulated histidine synthesis induced by copper, followed by decarboxylation to histamine. Histamine concentrations in the crayfish muscle the edible part did not exceed the United State Food and Drug Administration recommended limit for seafood safety.

82

Introduction
Metal bioaccumulation in aquatic animals is an important phenomenon in ecotoxicology and well documented for many years (Spehar et a l., 1978; Calabrese et al ., 1984; Khan et al ., 1989; Baden et al ., 1999; Canivet et al ., 2001; Luoma and Rainbow, 2005; Veltman et al., 2008; Martins et al., 2011). Among the metal pollutants in water bodies and sediments, copper is interesting, because it is both essential and toxic depending on its available concentration. Especially in crustaceans, copper binds oxygen in hemocyanin, the respiratory protein in the crustacean blood (hemolymph) (Anderson et al., 1997). In aquatic crustaceans exposure to excess copper causes physiological disturbances, due to bioaccumulation. For instance, Bini and Chelazzi (2006) reported that upon exposure to 0.5 mg Cu/L, Procambarus clarkii showed and alteration in the cardiac and ventilatory rates. Several researchers reported variability of the physiological status in crustaceans caused by copper, including among others reduced osmoregulatory capacity (Haris and Santos, 2000) and changed moulting cycle (Engel and Brouwer, 1993). Furthermore, physiological effects are preceded by or coincide with changes in biochemistry of the animals. Li et al. (2007) reported copper effects on the structure of gills and hepatopancreas in juvenile giant freshwater prawns coinciding with an impact on the content of metallothionein. In a previous study (Soedarini et al ., submitted; chapter 3 of this thesis), marbled crayfish showed accumulation of copper in different tissues at increased exposure concentrations in the water with excess copper especially being stored in the hepatopancreas. The pattern of copper bioaccumulation in crayfish is similar to that in other aquatic crustaceans, such as the penaeid shrimp Metapenaeus dobsoni (Manisseri and Menon, 1995), the blue crab 83

Callinectes spp. (Sastre et al., 1999) and the freshwater prawn Macrobrachium rosenbergii (Reddy et al., 2006). In crustaceans, the hepatopancreas is playing an important role in digestive activity as well as in neurosecretory control. Several studies have shown that histamine, a biogenic amine, plays a role as neurotransmitter or neuromodulator in the stomatogastric nervous system of crustaceans (Pulver et al., 2003; Cebada and Garcia, 2007). Histamine is also an indicator of food spoilage in shelf-life studies with edible crustaceans. Spoilage usually coincides with a marked increase of histamine due to growth of histamine-producing bacteria. Considering that histamine may cause poisoning with allergy-like symptoms in human, such as nausea, vomiting, diarrhea, hives, itching, red rash, and hypotension (Taylor et al ., 1989), the United States Food and Drug Administration (US FDA, 2011) has set a maximum level of histamine in seafood at 50 mg histamine/kg (fresh weight). In this study we ask the question whether copper accumulation interacts with the histamine content of crayfish. Currently there are no studies on effects of pollution on the histamine level in aquatic crustaceans. This study therefore is unique in linking ecotoxicology with food safety aspects. We assess histamine concentrations in marbled crayfish tissues under the influence of different copper exposure levels.

Materials and methods

Test animals Marbled crayfish (Procambarus sp.; Malacostraca, Decapoda, Astacida) were obtained from Alterra, part of Wageningen University and Research Centre, The Netherlands. Marbled crayfish itself is not a common edible species, but, 84

being a freshwater and parthenogenetic species, it is more easily cultured and used in experiments than salt water species. The animals used measured 3.5 to 7.2 cm body length and weighed 1.3 to 7.4 g, and were acclimated in an aquarium filled with aerated, filtered copper-free water (pH 7.3 0.1; CaCO3 hardness 24 mmol/L) for one week prior to exposure. The crayfish were incubated in a climate-controlled room at 20 1 C; day/night cycle of 12 hours light and 12 hours dark and fed with commercial crayfish food pellets (Tetra Wafer Mix) three times a week. Copper exposure Aqueous copper concentration of 0.05 mg Cu/L and 0.5 mg Cu/L were prepared by dissolving CuSO4.5H2O (Merck, p.a.) in copper-free tap water (pH 7.3 0.1; hardness 24 mmol CaCO3/L). Copper-free tap water was obtained from a special piping system without copper linings available at VU University. The test animals were randomly divided in three groups and exposed individually in 800 ml glass jars at 20 1 C. The first two groups, each having 31 animals, were exposed to the two different levels of copper (0.05 and 0.5 mg Cu/L). The third group, containing seven animals, was the control and kept in copper-free water. The animals were incubated in a climate-controlled room under the same conditions as during acclimatization. They were fed three times a week with commercial crayfish food pellets, shortly before renewing the exposure solution. The exposure took 14 days after which all remaining animals were transferred to copper-free water. At different time points during the copper uptake (1, 2, 4, 8 and 14 days) and elimination phases (15, 16, 18, 22 and 28 days) three animals from each treatment, in the inter-moult stage, were sampled and killed by decapitation using a lancet. Control animals were sampled only at 0 and 28 days. The animals were dissected to collect the gills, hepatopancreas, ovaries, muscle and

85

exoskeleton. The organs were placed in plastic tubes with lid, frozen in liquid nitrogen, weighed and kept in a freezer (-20 C) until analysis. Histamine analysis Histamine was extracted from the wet tissue samples (hepatopancreas and muscle). Sample at a precise weight between 0.1 0.2 g F.W. were placed in 15 ml plastic tubes and 10 ml 0.1 M ethylenediaminetetraacetic acid (EDTA)2Na solution (pH 8.0) was added. The samples were boiled for 20 minutes and then cooled on ice. The samples were subsequently filtered through a membrane filter (0.2 m cellulose acetate syringe filter WHAT10462701, Whatman, UK) (Sato et al ., 2005). To determine the amount of histamine in the filtrate, the histamine EIA Kit was used (Oxford Biomedical Research), which is a competitive direct enzyme-linked immunosorbent assay (ELISA) in a micro-well format that allows users to obtain histamine concentrations in ng/ml range. A series of standard solutions containing pre-defined amounts of histamine (0 50 ng/ml) was used. Absorbance was read at 650 nm using a Versamax 340 750 nm plate reader (MTX Lab systems, Inc.) Data analysis All calculations were run using Excel (Window Microsoft Office 2007). The effect of the copper concentration in the water and time of exposure on the histamine concentrations in the crayfish organs were analyzed using two-way analysis of variance (two-way ANOVA). Effects of copper on histamine concentrations in the hepatopancreas and the muscle were determined by Tukeys test. Statistical analysis were run in the statistics software SPSS, version 17.0 (SPSS Inc. Chicago, Illinois, USA).

86

Results
Data on measured copper concentrations in the water, crayfish growth and copper uptake and elimination kinetics have been reported previously (Soedarini et al., submitted; chapter 3 of this thesis). Average measured copper concentrations in the water during the first 14-day test period were 0.031 mg Cu/L and 0.38 mg Cu/L, respectively. Development with time of the histamine concentrations in the hepatopancreas and the muscle of marbled crayfish are shown in Figure 1. Results of the corresponding statistical analysis are presented in Table 1. Overall, histamine levels in the animals were significantly higher than the control at the highest exposure level (p < 0.05), but this seemed mainly due to the levels in the second part of the test when the animals were no longer exposed to copper (Figure 1). Time did not affect histamine levels in the animals, except for histamine in the hepatopancreas during the first 14-day test period, which was significantly affected by time (p=0.040). A closer look to the data shows that this is mainly caused by the relatively low histamine levels at the start and after 1 day (Figure 1); this suggests a rapid built-up of histamine in the hepatopancreas in the beginning of the experiment, unrelated to copper exposure. To better visualize effects of copper exposure concentration, histamine concentrations averaged over all exposure times are shown in Figure 2. Copper exposure concentrations did not affect histamine concentrations in the muscle but showed a clear effect on the histamine levels in the hepatopancreas. Averaged histamine concentrations in the muscle of animals exposed to copper-free water, 0.031 mg Cu/L and 0.38 mg Cu/L were 1.28 0.31, 1.28 0.38 and 1.62 0.51 mg histamine/kg fresh weight (mean SD), respectively. 87

Average histamine concentrations in the hepatopancreas of crayfish exposed to 0.031 mg Cu/L did not differ from the control, with values of 4.67 1.37 and 5.95 2.89 mg histamine/kg fresh weight (mean SD), respectively. In contrast, histamine concentrations in the hepatopancreas of crayfish exposed to 0.38 mg Cu/L were significantly higher, reaching an average value of 9.41 4.72 mg/kg (mean SD).
Table 1. Probability (p) values of F-tests in a two-way ANOVA for the effects of exposure time and copper concentration on the histamine concentrations in muscle and hepatopancreas of marbled crayfish (Procambarus sp.), separated for the uptake phase (day 1-14) where the animals were exposed to concentrations of 0.031 and 0.38 Cu mg/L and the elimination phase (day 15-28) where all animals were exposed to copper-free water.

Figure 1. Histamine concentrations in the hepatopancreas and the muscle of marbled crayfish (Procambarus sp.) measured at different exposure times to two different Cu concentrations for 14 days and after transfer to copper-free water for another 14 days. Each data point represents the averaged measured concentration in three test animals.

88

Figure 2. Average histamine concentrations in the hepatopancreas and the muscle tissue of marbled crayfish (Procambarus sp.) exposed for 14 days to different copper concentration levels and transferred to copper-free water for another 14 days. Error bars represent the standard deviations (n = 6, 27 and 29 for copper-free water, 0.05 mg Cu/L and 0.5 mg Cu/L, respectively). Different letters indicate significantly different histamine levels between treatments (ANOVA, Tukeys post-hoc test).

Figure 3. Histamine concentrations in the hepatopancreas and the muscle of marbled crayfish (Procambarus sp.) expressed as a function of copper concentrations in these tissues. Animals were exposed for 14 days to different copper exposure levels and then transferred to copperfree water for another 14 days. Each data point represents an individual measurement. The r represents Pearson correlation coefficient; p represents degree of linear relationship between the two variables and ** indicates strong correlation between copper concentration and histamine concentration in the hepatopancreas of marbled crayfish (SPSS, Pearson correlation test).

89

Figure 3 relates histamine concentrations to the copper levels in the analyzed tissues. Histamine levels did significantly correlate with copper concentrations in the hepatopancreas (p < 0.01), but not in the muscle of marbled crayfish (Procambarus sp).

Discussion
Histamine is a well-known neuromodulator of the intestinal nervous system, with a local (paracrine) action on motor neurons. In the lobster Homarus americanus, histamine reduces the firing of neurons associated of the stomatogastric system (Pulver et al. , 2003). The increase of histamine levels under the influence of copper, observed in our experiments, may be linked to a stress response of the animal by which it attempts to slow down pyloric activity to prevent further uptake of copper. Alternatively, histamine could arise because of an increase of the concentration of histidine, followed by decarboxylation to histamine. Histidine has an important role in the coppercontaining, oxygen carrying molecule of crustaceans. Each hemocyanin molecule contains two copper ions and each copper ion is coordinated by three histidine residues. A highly up-regulated synthesis of histidine could be part of a mechanism by which the animal attempts to scavenge and store copper in the hepatopancreas. Any excess of histidine produced could be metabolized to histamine. Which of these possibilities is true is difficult to say. They are both speculative. However, since we observed an increase of histamine concentrations only in the hepatopacreas, and since this was also the only organ in which copper was selectively retained, a causal link between histamine increase and copper accumulation is very likely. Both explanations may also be valid when trying to explain the reason why histamine levels

90

showed a kind of delayed response, with higher levels arising especially in the second part of the test when the animals were transferred to copper-free water. In all cases, histamine concentrations in the muscle were significantly lower than in the hepatopancreas. Histamine levels in muscle tissue of marbled crayfish never exceeded 2 mg histamine/kg fresh weight. These concentrations are lower than the maximum level of histamine in seafood of 50 mg histamine/kg fresh weight set by the United States Food and Drug Administration (US FDA, 2011). Ingestion of food containing histamine can cause histamine poisoning with allergy-like symptoms such as nausea, vomiting, diarrhea, hives, itching, red rash, and hypotension (Taylor et al ., 1989). But considering that none of the muscle samples in our experiment exceeded the threshold of histamine set by the US-FDA, exposure of crayfish to a copper concentration of 0.38 mg Cu/L does not seem to pose a threat to food quality and safety, despite the fact that there was a significant increase of histamine in the hepatopancreas.

Conclusions
Histamine levels in the hepatopancreas but not in the muscle of marbled crayfish (Procambarus sp.) increased with increasing copper concentrations and time of exposure. Histamine levels in the hepatopancreas significantly correlated with accumulated copper levels in this organ. Possible reasons for the link between increased histamine and copper accumulation are (1) animal stress, and (2) up-regulated histidine production associated with copper scavenging.

91

 At an exposure concentration of 0.38 mg Cu/L, histamine concentration in the crayfish edible tissue (muscle) did not exceed the US-FDA limit level for fresh seafood.

92

Chapter 5 Interactions between accumulated copper, bacterial community structure and histamine formation in stored crayfish meat after copper exposure

93

Abstract
Copper is toxic to microorganisms, but it is not clear whether copper accumulated from the environment impacts deteriorative processes in stored seafood, through affecting contaminating microbial communities associated with histamine production. Crayfish (Procambarus sp.) were exposed to 0.50 mg Cu/L and the effect on microbial community structure in water and stored meat samples, and on histamine levels were determined and compared to those of crayfish cultured in copper-free water. Exposure to aqueous copper for 14 days increased the copper concentration by 17% in crustacean meat, but copper remained within a range acceptable for human consumption. Cluster analysis of 16S rRNA-based microbial community fingerprints revealed copper toxicity to the freshwater bacterial community. Histamine in crayfish was easily measured and an increase with storage was observed over 10 days. Histamine concentrations in crayfish exposed to copper were significantly lower and did not increase as rapidly, compared to those in control crayfish. Thus, exposure to environmental copper appears to reduce histamine accumulation in crayfish, by affecting the community of environmental (and possibly intestinal) bacteria, while having only a minor effect on copper accumulation in the meat itself. The data suggest a relation between bacteria in the water and bacteria playing a role in deteriorative processes in crayfish meat.

94

Introduction
World aquaculture has grown tremendously in quantity, but the quality and safety aspects of aquaculture products (seafood) are still a concern due to the risk of food-borne illnesses (Feldhusen, 2000). Among seafood, crustaceans such as shrimp and prawn are important since they are the second most valuable seafood commodity (FAO, 2006). Although they have high economical value, crustaceans are considered as perishable food. The relatively high moisture and free amino acids content (Simpson et al ., 1998) make crustacean meat quite susceptible to deteriorative bacteria. Ahmed (1991) stated that microorganisms, histamine and heavy metals are the major concerns for seafood safety. Here, we investigated the interaction between these three components. The microbial status of seafood after catch is closely related to environmental conditions and microbiological quality of the water (Feldhusen, 2000). During storage, especially at inadequate temperatures, microbial growth can hardly be avoided and leads to decay. Further, the presence and activity of histamineproducing bacteria is often associated with deteriorative processes in seafood (Kim et al ., 1999). Histamine-producing bacteria possess histidine decarboxylase, an enzyme which transforms the free amino acid histidine into histamine (Niven et al ., 1981). Ingestion of food containing histamine can cause histamine poisoning with allergic-like symptoms such as nausea, vomiting, diarrhea, hives, itching, red rash, and hypotension (Taylor et al ., 1989). In crustaceans, histamine may not only be produced by bacteria, but is also naturally present and acts as neurotransmitter or neuromodulator (Cebada and Garcia, 2007). The United State Food and Drug Administration (US FDA,

95

2011) has set the maximum level of histamine in seafood at 50 mg histamine/kg (fresh weight). Crustaceans are generally cultured in ponds in estuarine environments, which are often exposed, through wastewater discharge, to metals including copper. Elevated copper concentrations in estuarine environments occur world-wide (Correa et al., 1999; Kirby et al., 2001; Matthiessen et al., 1999; Schiff et al., 2007; Thongra-ar et al., 2008). Exposure to copper increases its concentration in crustaceans, with the accumulation depending on the organ (hepatopancreas > gills > exoskeleton > muscle; Guner, 2007; Soedarini et al ., submitted; chapter 3 of this thesis). With regard to food safety assurance, the Australian National Health and Medical Research Council (ANHMRC) recommends a maximum copper level of 10 g/g wet weight in crustaceans (Maher, 1985). Copper can have an inhibitory effect on the growth of bacteria (Zevenhuizen et al., 1979; Cabrero et al., 1998). Bacteria do not respond equally to copper, e.g. Pseudomonas putida and P. syrin gae strains revealed resistance to copper (Cooksey and Azad, 1992). By its nature, the interaction between metals and microorganisms is a very complex phenomenon. Some metals are essential to certain microorganisms and therefore required, whereas others are toxic even at low concentrations. In a mixture with other metals, copper reduced the microbial diversity in the digestive tracts of crayfish (Micknien and yvokien, 1999). It is not yet clear if and how copper present in water will affect deteriorative processes in stored meat - by affecting the occurrence and growth of deteriorative bacteria and histamine producing bacteria. Here, we investigated the interaction between aqueous copper, bacterial community in culture water and stored meat as well as histamine accumulation in crustacean meat during

96

storage. Marbled crayfish (Procambarus sp.) was chosen as a model of edible crustacean species due to its genetic uniformity (Martin et al ., 2007) and availability.

Materials and methods

Source of animals Marbled crayfish (Procambarus sp.; Malacostraca, Decapoda, Astacida) were used as a model of freshwater edible crustaceans and were provided by Alterra, part of Wageningen University and Research Centre, the Netherlands. The animals measured 3.7-5.8 cm and weighed 1.6-4.7 g. Copper exposure and sample preparations Prior to copper exposure, crayfish were acclimated in copper-free tap water (pH 7.3 0.1; hardness 24 mmol CaCO3/L) for one week. Copper-free water was obtained from a system involving Amsterdam tap water delivered by plastic rather than metal pipings on the universitys premises. An exposure solution of 0.5 mg Cu/L was prepared from CuSO4.5H2O (Merck, p.a.) dissolved in copper-free water. Seventy animals were randomly divided into two groups and exposed to 0.5 mg Cu/L and copper-free water, respectively, for 14 days. The exposure took place in ten 3 L plastic aerated-aquaria with seven animals in each. Throughout the experiment, the animals were incubated in a climate-controlled room at 20 1C with day/night cycle of 12 hours light and 12 hours dark. They were fed three times a week with commercial crayfish food pellets (Tetra Wafer Mix, one pellet per crayfish per feeding) three hours before renewing the exposure solution. To collect microorganisms, 500 mL of the culture water was vacuum-filtered over 45-mm-diameter, 0.2-m pore-size 97

filter (Millipore). After 14 days of exposure, all crayfish were killed by decapitation using a sterile scissor and the headless specimens (edible parts; crayfish meat and tail) were individually placed in a sterile petridish and stored in a refrigerator (5 1C). At different times of storage (0, 2, 4, 5, 6, 7 and 10 days) five specimens from each treatment were collected. All samples (filter and specimen) were kept in a freezer (-20 C) until analysis. Copper concentration analysis All crayfish samples (weighing around 0.25 g fresh weight) were freeze-dried for 48 hours and digested in 2.0 mL of a mixture of HNO3 (Sigma-Aldrich, 65%) and HCl (Riedel-de-Han, 37%) in a ratio of 4:1 in a closed teflon pot at 140 C for 7 hours. The digests were then diluted with 0.1 M HNO3 to 10 mL and the copper concentration was analyzed using flame atomic absorption spectrophotometry (Perkin-Elmer AAnalyst 100). The copper concentrations in the culture water were directly measured before and after renewing the water. Quality control of the analysis was maintained by digesting certified reference material Dolt-2 (CNRC, Ontario, Canada). The recoveries of copper in the reference material averaged 113% of the certified reference value. Considering that the deviations were slightly greater than 10%, all data were corrected for copper recovery in the certified reference material. Microbial community structure analysis Microbial DNA isolation Microbial DNA in the crayfish meat and tail was isolated using PowerFoodTM Microbial DNA isolation kit (MO BIO Laboratories, Inc., Solana Beach, CA, USA). A frozen sample of 0.25 g was placed in a bead beater tube, one piece of glass bead (4.0 mm diameter) and 1000 L of sterilized PBS buffer were added. A FastPrep Instrument (MP Biomedicals, Santa Ana, CA) was then

98

used for 40 seconds at speed level of 4 m/s. After 5 minutes of natural sedimentation, 250 L of supernatant was collected and centrifuged at 13.000 x g for 3 minutes. The residual liquid was removed and the microbial pellet at the bottom of the tube was resuspended in 450 L of PF1 solution from the PowerFoodTM Microbial DNA isolation kit and further processed following the manufacturers protocol. The microbial DNA from the Millipore filters containing microorganisms in the culture water was isolated using FastDNA spin kit for soil (MP Biomedicals, Solon, OH). The filter was aseptically cut in small pieces and further processed following the manufacturers protocol. Bacterial DNA amplification PCR amplification was performed with universal bacterial primers targeting the 16S rRNA gene, F357GC and R518 (Muyzer et al., 1993). Table 1 shows the sequence of the primers and the amplification conditions that we used prior to DGGE. A total volume of 25 L was used in each PCR reaction, containing 1 L of 10 M forward primer; 1 L of 10 M reverse primer; 1 L of 10 mg/mL bovine serum albumin (BSA; New England BioLabs, Leusden, The Netherlands); 12.5 L GoTaq Colorless Master Mix 2 x (Promega, Madison, WI); 8.5 L DNase-RNasefree water (MP Biomedicals, Solon, OH) and 1 L microbial DNA template. Amplified DNA was verified by electrophoresis using 1.0% agarose in 1 x TAE buffer. The size of the product of PCR amplification was ~220 bp.

99

Table 1. Primer sequences and conditions for amplifying bacterial 16S rRNA genes and histidine decarboxylase hdc genes of Gram-negative and Gram-positive bacteria.
primer concentration 0.4 M 94C; 5 94C; 30 54C; 30 72C; 30 72C; 5 initial denaturation denaturation annealing elongation final elongation Reference

Primer

Sequence (5

3)

F357GC

R518 0.2 M 94C; 5 94C; 1 58C; 1 72C; 1

16S rRNA genes CGCCCGCCGCGCGCGGCGGGCGGG GCGGGGGCACGGGGGGCCTACGGG AGGCAGCAG ATTACCGCGGCTGCTGG

Muyzer et al. (1993)

hdc-f hdc-r 0.2 M 94C; 5 95C; 45 48C; 1

Gram-negative hdc genes TCHATYARYAACTGYGGTGACTGGRG CCCACAKCATBARWGGDGTRTGRCC

72 C; 5

Takahashi et al. (2003) 72C; 1 72 C; 5 Coton and Coton (2005)

HDC-3 HDC-4

Gram-positive hdc genes GATGGTATWGTTTCKTATGA CCAAASWCCDGCATCTTC

100

Denaturing Gradient Gel Electrophoresis (DGGE) DGGE was performed using the Bio-Rad D Code (Bio-Rad, Hercules, CA, USA). PCR products were loaded in 8% (wt/vol) polyacrylamide gel with a denaturing gradient of 30% - 55% (100% denaturant was defined as 7 M urea and 40% (vol/vol) formamide). The gels were electrophoresed in 1 x TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM Na-EDTA; pH 8.0) at 200 V and 60C for 4 h. A mixture of 12 different bacterial 16S rRNA gene fragments was used as the marker. The gels were stained in 1 x TAE buffer containing 1 g of ethidium bromide ml-1 and were recorded with a chargecoupled device camera system. Gel images were converted, normalized and analyzed with Gel Compar II software package (Applied Maths, Belgium). Similarity values between fingerprints were calculated using Pearson correlation, and subjected to UPGMA cluster analysis (Van Verseveld and Rling, 2004). Sequencing of DGGE bands The four most intense DGGE bands were cut out with a sterile scalpel blade and each diluted in 50 L water. One microliter of the diluted DNA of each DGGE band was re-amplified using universal primers F357 and R518 and run with the PCR program as described above. PCR products that revealed a correctly sized band on agarose gel were cut out and purified using the Wizard SV gel and PCR clean up system (Promega, Madison, WI) according to the manufacturers instructions. Sequencing was performed using Big Dye v1.1 chemistry (Applied Biosystems) on an ABI 3100 Genetic Analyzer. To determine the closest known relatives of the partial 16S rRNA gene sequences obtained, BLAST searching was performed (Altschult et al., 1990).

101

Detection of hdc genes Table 1 shows primer sequences and amplification conditions used to detect histidine decarboxylase (hdc) genes. Primers for the amplification of the hdc gene in Gram-negative bacteria were hdc-f and hdc-r, which amplify a DNA fragment of 709 bp (Takahashi et al., 2003). Primers for the amplification of the hdc gene in Gram-positive bacteria were HDC-3 and HDC-4 which amplify a DNA fragment of 435 bp (Coton and Coton, 2005). DNA isolated from Photobacterium damselae subsp. damselae (LMG 7892, BCCM, Gent, Belgium) and Lactobacillus parabuchnerii (DSM 5987, DSMZ, Germany) served as positive controls of Gram-negative and Gram-positive histamineproducing bacteria, respectively. Histamine analysis A precise weight (between 0.10 and 0.25 g fresh weight) of crayfish sample was crushed to homogeneity, 8 x diluted with water, and centrifuged (10,000 g; 5 minutes). Twenty L of the collected supernatant was added in 180 L acylation buffer of the histamarine enzyme Immunoassay kit IM2369 (Immunotech SAS, Marseille, France). The principle analysis is a competitive direct enzyme-linked immunosorbent assay (ELISA) in a micro-well format. A series of standard solutions containing pre-defined amounts of histamine (1 500 mg/kg) was used. Absorbance was read at 410 nm using a Versamax 340 750 nm plate reader (MTX Lab systems, Inc.). Data analysis The effect of copper concentration in the exposure solution on the copper concentration in crayfish meat was analyzed using one-way analysis of variance (ANOVA). All calculations and statistical analysis were performed

102

with the statistics software SPSS, version 17.0 (SPSS Inc. Chicago, Illinois, USA).

Results
Copper exposure clearly affected the copper concentrations in the crayfish. Copper concentrations in crayfish meat of the animals exposed to averaged measured concentration of 0.43 mg/L copper were higher (N= 10; ANOVA, p < 0.05) than in the control (copper-free water); they averaged 32.2 5.61 g/g D.W. and 26.6 5.93 g/g D.W. (mean SD), respectively (Table 2).

Bacterial communities in the culture waters and in crayfish meat were profiled by cultivation-independent DGGE analysis of amplified 16S rRNA gene fragments, to reveal the impact of copper exposure during crayfish culturing and subsequent storage of meat (Figure 1). The fingerprints of the marker of 12 different bacterial 16S rRNA gene fragments of the DGGEs were well reproducible at > 85% (profiles are not shown). 103

Figure 1. Cluster analysis of DGGE profiles of bacteria (30 to 55% denaturant gradient) present in the water and marbled crayfish meat samples after Pearson correlation. The codes next to the profiles designate the copper treatment (+ and 0.5 mg Cu/L), duration of storage (0 and 10 days) and test replication (a, b and c).

Cluster analysis (Figure 1) revealed clear differences between bacterial community structure in copper-free water and in aqueous copper (0.5 mg Cu/L), with a similarity of 33.5% 19.1% (mean S.D). The DGGE profiles revealed fewer bands (averaging 5.3) for water samples exposed to copper than for samples from the control, copper-free water (averaging 13.3). The similarity between replicates of DGGE fingerprints of microbial communities in copper-free water was 66.5% 8.06%. More variation between replicates was observed for samples that were exposed to 0.43 mg Cu/L, with a similarity among replicates of 46.1% 36.9%. Bacterial community structures in the crayfish meats (0-day stored) harvested from both treatments were clearly different from those in the corresponding culture water. DGGE profiles of meat from crayfish incubated in copper-free water showed only a single band. This band was not visible in the DGGE profiles from the incubation water, 104

which contained on average 12.3 bands. A similar observation was made for meat from crayfish exposed to the aqueous copper, containing on average only 3.3 bands compared to 5.3 in the corresponding water samples. During storage of the meat over a period of 10 days, a few more new bands occurred, both for crayfish exposed to aqueous copper or copper-free water. The similarity between 0 day and 10 days stored meat samples fell at 57.5% 10.6% (crayfish exposed to aqueous copper) and 52.2% 3.5% (crayfish incubated in copper-free water). Between the two copper treatments, the similarity of bacterial community structure in crayfish meat after 10 days stored was 55.5% 6.4%. This was slightly lower than the correspondence between the microbial communities in the meats from the two treatments at the start of the storage, when the similarity was 60.0% 1.4%. Thus, differences in bacterial community structure in relation to copper exposure were already visible at the start of meat storage. Also, in both treatments, bacterial community structure in the crayfish meat and the crayfish tail after ten days of storage showed very similar profiles of DGGE fingerprints (the similarity fell at 78.5% 6.4%; data not shown). One common band was present in all DGGE profiles from crayfish meat samples, irrespective of copper treatment or the duration of storage. This band was removed and sequenced. Based on BLAST searching, the sequence (162 nucleotides) was 99% identical to Pseudomonas sp. Histidine decarboxylase encoding genes of neither Gram-negative nor Grampositive bacteria could not be detected in any of the water or crayfish meat samples. However, the histamine concentration in the crayfish meat samples increased during refrigerated storage, for both control and copper exposed crayfish (Figure 2). The strongest increase of histamine concentrations was observed for the meat obtained from crayfish grown in copper-free water. After five days of storage, histamine concentrations between the two

105

treatments were significantly different (t-test, p < 0.05). After 10 days of storage, crayfish meat from animals exposed to 0.5 mg Cu/L contained less histamine than the meat of animals incubated in copper-free water, reaching 7.28 2.58 and 21.6 6.63 mg/kg fresh weight, respectively. The histamine accumulation pattern appeared to correlate with the differences and changes in bacterial communities over time. Crayfish meat of animals exposed to 0.5 mg Cu/L after 10 days of storage revealed fewer DGGE bands and contained a lower histamine concentrations.

Histamine in crayfish meat (mg/kg f.w.)

R2 = 0.891

R2 = 0.940

Time (days)
Figure 2. Histamine accumulation in crayfish meat samples during refrigerated storage for 10 days, including the trend lines based on polynomial regression (linear for the 0.5 mg Cu/L samples, quadratic for the copper-free samples). Each data point represents the average value of histamine concentration (N = 5) with the standard error bars measured in meat of crayfish exposed to 0.5 mg Cu/L () and animals incubated in copper-free water (). Coefficients of determination (R2) of the regressions are indicated in the graph. Histamine concentration is expressed in mg histamine / kg sample fresh weight.

106

Discussion
This study contributes knowledge that links animal toxicology and food microbiology. Copper is known to have anti-microbial activity (Flemming and Trevors, 1989), but how copper in aqua-culturing will affect the histamine accumulation in crustacean meat during storage, especially by changing the microbial community structure, is not clear yet. Copper and copper-containing compounds are widely used as bactericide (Cooksey, 1990), algicides and fungicides (Foye, 1977 in Cervantes and Gutierrez-Corona, 1994). On the other hand, copper in general is an essential element for (micro)organisms (Cervantes and Gutierrez-Corona, 1994) and not harmful at low concentrations (1 10 M). Copper especially plays an important role in crustaceans, where it binds oxygen in hemocyanin, the respiratory protein in the crustacean haemolymph (Anderson et al., 1997). We observed that while copper exposure had a minor, acceptable effect on copper concentrations in crayfish meat, it had a large impact on both the microbial community structure in the culturing water and stored meat, and in fact also resulted in decreased histamine production in stored meat. This suggests that copper contamination may have a positive effect on the shelf life of crustacean meat. Copper exposure, copper accumulation and safety limits A high copper concentrations in culturing water generally lead to elevated copper concentrations in the organs or tissues of crustaceans (Rainbow and White, 1989; Paganini and Bianchini, 2009), as also observed in this study (Table 2). In crustaceans, excess copper is mostly accumulated in the hepatopancreas and is also present in high concentration in the gills the

107

respiratory organ but not in the muscle (Guner, 2007; Li et a l., 2008; Soedarini et al., submitted; chapter 3 of this thesis). The copper concentration in crayfish meat was increased by 17.4 %, to 32.2 g/g dry weight, upon exposure to 0.5 mg/L copper. The Australian National Health and Medical Research Council recommends a maximum copper level in crustaceans of 10 g/g wet weight (Maher, 1985). Considering that crayfish meat contains 78% water (data not shown), the copper concentration measured in this study does not exceed the recommended value and does not threaten human health. Interactions between copper, microbial communities and histamine levels. Despite the fact that copper concentrations in meat remained within food safety limits, clear effects of copper exposure were observed on microbial communities and histamine accumulation in stored crayfish meat. The histamine accumulation pattern appeared to correlate with the differences and changes in bacterial communities over time. Meat of crayfish exposed to 0.5 mg Cu/L and stored for 10 days revealed fewer microbial species and contained lower histamine concentrations. We observed a correlation between microbial communities in water and in meat. Different communities in water and in meat, as the result of copper exposure were observed. Micknien and yvokien (1999) also found that copper exposure - in a mixture with other metals - reduced microbial diversity and changed the microbial community structure in the digestive tracts of crayfish. The crayfish intestinal tract, running on the dorsal side of the animal (Figure 3) contains high numbers of bacteria (DePaola et al ., 1994), including putative deteriorative bacteria. As the edible, and stored, portion (consisting of the posterior of the animal) usually still contains the intestine, contamination of meat by intestinal material after harvesting and cutting the crayfish will be a

108

major source for deterioration during storage. In the present study the crayfish was killed with a sterilized scissor and further treated under aseptic conditions, therefore the risk of bacterial contamination from other sources during sample handling was minimal.

Figure 3. Digestive system of crayfish (Barnes, 1987). The edible portion consists of the hind part of the animal (abdomen and part of the thorax), including the intestinal tract. During storage, the bacterial community in the intestines may grow and migrate into the muscle tissue.

It is likely that aquatic microbial communities determine the composition of the intestinal communities and that deteriorative bacteria during decay derive from the culture water, via intestinal communities. This can be concluded from the following four arguments: (1) aqueous copper changed the bacterial community structure in the culturing-water, (2) copper concentrations in muscle tissue were only insignificantly affected by copper exposure and thus likely had a minor direct influence on intestinal communities, (3) yet communities in muscle tissue were different from communities in the water and (4) histamine levels in the crayfish meat during storage were different between the treatments. The copper concentration in the meat itself most likely

109

is not the major determinant of the histamine accumulation pattern in crayfish meat during storage. In general, copper toxicity for microbes and its effect on microbial community structure in aquatic samples depends on a number of factors, among others the exposure concentration (Timbrell, 1989), the chemical forms of the toxic substance (Beswick et al ., 1976; Jonas, 1989; Tubbing et al ., 1994), with especially the free ionic form (Cu2+) being toxic (Domek et al., 1984), and the difference between microorganisms in the intolerance for copper (Reteuna et al., 1989). Many species of bacteria show resistance to copper, among others Pseudomonas syringae pv. tomato (Bender and Cooksey, 1986), Xanthomonas campestris pv. juglandis (Stall et a l., 1986) and Escherichia coli strains that carry the pco determinant (Brown et al ., 1992). Depending on the species, copper resistance genes can be located either on transferable plasmids or on chromosomal DNA (Cooksey et al., 1990; Brown et al., 1995). Furthermore, the toxic effect of the cupric ions to aquatic microorganisms is also influenced by dissolved organic material such as humic substances (Santos et al., 2008), aerobic anaerobic conditions (Beswick et al., 1976) and salinity (Fleming and Trevors, 1989), which may all vary depending on the geographical region and aquaculture practises. Thus, while a positive effect of copper exposure on the quality of stored crayfish was observed in this study, it may well be that under other environmental conditions other microbial communities might be selected with different effects on histamine accumulation in stored meat. Pseudomonas sp. occurred in all crayfish meat samples, from both treatments and throughout storage. Previously, Pseudomonas strains isolated from water and sediment revealed copper resistance (Binder and Cooksey, 1987; Cooksey

110

and Azad, 1992). Furthermore, Ryser et al. (1984) found that some species of Pseudomonas (P. fluor escens, P. putida and non-fluorescent Pseudomonas spp.) showed the ability to produce low concentrations of histamine. Application of molecular tools to deteriorative processes. Cultivation-independent DNA-based fingerprinting of bacterial communities, followed by clustering analysis, is a reproducible, rapid and relatively unbiased technique to describe the dynamics in bacterial communities and their responses to experimental treatments. Isolation and analysis of DNA directly from food samples (without cultivation of microorganisms) has an advantage over prior cultivation and analysis of the cultivated bacteria. Amman et al. (1995) mentioned that only a minor fraction of microorganisms is cultivable under laboratory conditions, even when using enriched or selective media. By using specific primers, also genes encoding special functional characteristics can be determined relatively easily. However, considering that histamine production was observed, but hdc genes were not detected in our study, likely microbes harbouring hdc genes that deviate from common hdc genes, were present. Thus, there is the need to attempt to culture these species or use other culturing-independent approaches, such as metagenomics, to gain insight in which of their genes are involved in histamine production, so these genes can be targeted in the future using PCR amplification approaches. Indeed the primers currently available for detecting hdc genes are specific for bacteria with an ability to produce high concentrations of histamine, such as Photobacterium damselae subsp. damselae or Lactobacillus parabuchnerii - the positive controls of Gramnegative and Gram-positive histamine-producing bacteria used in this study, respectively.

111

112

Chapter 6 General discussion

113

Food safety appears to be a greater problem with aquaculture products compared to marine wild-captured products. The risk of contamination by chemical and biological agents is greater in freshwater as well as in coastal ecosystems than in open sea (Reilly and Kferstein, 1999). The quality and safety of aquaculture products in general varies from region to region, depending on the production methods and management practices (Hopkins et al., 1993) and also on the environmental quality of the region (Moullac and Haffner, 2000). Considering water pollution is a global problem (Schwarzenbach et al ., 2010), a comprehensive study on the interaction between pollutants, particularly metal and microbial, and their impact on edible aquatic animals as described in this thesis may contribute knowledge in eco(toxicology), microbiology and food safety. It may also be useful for policy makers working on aquaculture development programmes. In this study, freshwater marbled crayfish (Procambarus sp.) was chosen as a model of edible crustacean species. Marbled crayfish is accessible to biological experiment due to ease of culturing and production of large numbers of genetically identical offspring (Martin et al ., 2007). From an ecological point of view, crustaceans tend to accumulate more metals than fish (Rainbow, 1992). Crustaceans are also known to produce histamine, a human allergenic substance (Mietz and Karmas, 1978). In terms of seafood trading, crustaceans are known as economically valuable seafood and cultured world wide. This thesis is dealing with the interaction between metals in the aquatic environment, microbial community structure and histamine production in a surrogate seafood species. The conceptual model, introduced in the Introduction, which links the three factors (metals, microorganisms and seafood) is shown in Figure 1. Metals in the aquatic environment will affect

114

the microbial community in the water but also result in metal bioaccumulation. Both factors will affect the safety status of the seafood. Metal accumulation in animal organs may also lead to toxic effects on the organisms cultured, with increased histamine level as one of the toxic effect indicators. Changes in the microbial community structure due to metal exposure may not only occur in the water but also in the seafood. As a consequence of these changes, the population of histamine-producing bacteria in the seafood items may change, both in size and activity. This may possibly affect seafood shelf-life and quality, by increasing histamine production. In this thesis, all these factors have been studied and their effect on food quality and safety will be discussed here. Copper was selected as the metal of interest referring to the situation found in shrimp ponds along the Semarang coast line (Chapter 2). We observed that cadmium concentrations in all sediment samples were below the detection limit (0.03 g/g d.w.), while zinc, nickel and iron concentrations varied among locations but were generally also low. Sediments taken from two shrimp ponds located close to the intercity highway had lead concentrations that were significantly higher than at the other locations. In three sampling sites, copper concentrations were significantly higher than at the other sites, up to twice the local background concentration, which is approximately 40 g/g dry sediment. In addition to copper and lead, nickel and chromium at some sites also showed elevated sediment concentrations. According to the Sediment Quality Guidelines (SQGs) applied in several countries, the Semarang coastal pond sediments can be classified as mid-range (medium range) contaminated. The contamination may partly be attributed to anthropogenic inputs. contamination in coastal areas is occurring Copper

115

Figure 1. A model of the interactions between copper and microorganisms in the aquatic environment and their impact on marbled crayfish as a model of edible crustaceans species, with special concern for food quality and safety. Copper bioaccumulation in crayfish meat and histamine formation in the crustacean triggered by copper exposure has only minor effects on seafood safety. Copper exposure changes bacterial community structure both in the culture water and in the crayfish, and also decreases histamine accumulation in the edible tissues during storage.

worldwide, among others in the Atlantic (Chou et al., 2002; Dean et al., 2007), Aegean (Kucuksezgin et al ., 2010), Northern Adriatic (Munari and Mistri, 2007), Far East (Alagarsamy, 2006) and Southeast Asia (Nicholson and Lam, 2005). In the case of aquaculture ponds, there are at least two major ways for copper entering the water system, i.e. intentional and accidental. Application of chemicals intended to clear the water and suppress excessive growth of 116

algae likely contributes to copper contamination. Copper is the active compound of several algicides, e.g. copper sulphate, and algicides containing copper are still used worldwide (Song et al., 2010; Jacinthe et al., 2010). The use of algicides in aquaculture practices sometimes is hard to avoid because of its benefits: (1) to avoid oxygen depletion in the water that leads to sudden mass mortality in fish and crayfish, especially at night due to excessive growth of algae stimulated by fertilizer application (Diana et al ., 1991) and (2) to avoid off-flavour in aquaculture products due to accumulation of blue-green algae (Gibson, 1972; Tucker, 2000). Copper may also enter aquaculture ponds by the intake of copper-contaminated water from rivers or estuaries used for maintaining the water level of the ponds. Several sources of anthropogenic copper in water bodies have been reported, including among others a wide range of industrial waste (Graedel et al ., 2002; Widmer et al ., 2005), antifouling paints (Srinivasan and Swain, 2007), and domestic waste water (Isaac at al., 1997). The higher the population density and the industrial activity present in a coastal area, the higher the input of anthropogenic copper in water bodies may be. The fact that tributyltin (TBT) was banned as an antifouling agent on small boats in 1990, may also lead to an increased use of copper-containing paints (Helland and Bakke, 2002) and this further increases the risk of copper contamination in coastal areas. Considering the fact that Semarang is a densely populated industrial city with an active harbour, there are many possible sources of copper, however, the main ones are probably derived from (1) algicides, (2) industrial waste, (3) domestic waste, and (4) copper-based antifouling agents. Our study on copper toxicokinetics in marbled crayfish (Procambarus sp.) showed there was no clear uptake in animals exposed to 0.031 mg Cu/L, suggesting that animals are able to regulate low copper concentrations in their

117

body at a fairly constant level. This is seen in many animals because copper is an essential trace metal playing an important role in e.g. hemocyanin and antioxidant enzymes such as superoxide dismutase. However, at higher exposure levels, the internal copper concentration is not regulated at the same level, at least not in all organs. Copper concentrations in the exoskeleton, the gills and the hepatopancreas of marbled crayfish exposed to 0.38 mg Cu/L were significantly higher than levels in the animals exposed to 0.031 mg Cu/L. The exoskeleton, gills, muscle and ovaries accumulated copper relatively fast and reached equilibrium within 10 days of exposure. Copper accumulation was highest in the hepatopancreas as uptake in this storage organ steadily increased with time and did not reach equilibrium within the 14-day exposure period (Chapter 3). The copper accumulation levels in the marbled crayfish found in this study were hepatopancreas > gills > exoskeleton > muscle. The tendency of marbled crayfish to accumulate copper especially in hepatopancreas is typical for crustaceans (Icely and Not, 1980; Ahsanullah et al., 1981; Bagato and Alikhan, 1987; Vogt and Quinitio, 1994; Anderson et al., 1997; ChavezCrooker et al., 2003; Guner, 2007). All species that have hemocyanin in their blood system (haemolymph) store an excess of copper in the hepatopancreas. In terms of food safety, the maximum copper concentrations measured in the marbled crayfish muscles (meat) were 40 g/g dry weight (~10 g/g wet weight). This level does not exceed the recommendations set by the Australian National Health and Medical Research Council (ANHMRC) for seafood, which is 10 g/g wet weight (Maher, 1985). Metal accumulation in marbled crayfish organs affected the concentrations of histamine, an important indicator of food spoilage used in food safety research. Histamine levels showed that the higher the copper exposure concentrations, the higher the histamine levels were in the hepatopancreas. A rapid built-up of

118

histamine in the hepatopancreas was started right from the beginning of the copper exposure. Copper exposure concentrations did not affect histamine concentrations in the crayfish muscle. Histamine concentrations in the hepatopancreas of crayfish exposed to 0.38 mg Cu/L approximated 10 mg histamine/kg fresh weight (Chapter 4). In animal biochemistry, physiology and neurobiology, histamine is known as one of the major neuromodulators (besides dopamine) that plays a role in the animal nervous system (Pulver et al., 2003; Cebada and Garcia, 2007). Histamine is specifically associated with modulation of muscle action in intestinal tissues. Why histamine would increase with copper accumulation is unknown. The phenomenon we observed is interesting but so far has not been reported in the literature. The proposed mechanisms in explaining this phenomenon are (1) a stress response of the animal or (2) upregulation of histidine production followed by decarboxylation reactions. The amino acid histidine is an important chelator of metals. Copper is bound to histidine residues in hemocyanin. In this hypothesis, copper would induce the production of histidine, of which part is decarboxylated to produce histamine. Testing these hypotheses poses an interesting subject for further research. Histamine concentrations in the muscle in all cases never exceeded 2 mg histamine/kg fresh weight, which is much lower than the maximum level of histamine in seafood of 50 mg histamine/kg fresh weight set by the United States Food and Drug Administration (US FDA, 2011) thus the experiment indicated that copper exposure itself did not affect seafood safety. Histamine has a negative impact on seafood quality and safety. The level of histamine is an accepted index of seafood deterioration due to the growth of histamine-producing bacteria (Russel and Maretic, 1986). In our study, we observed that 0.50 mg Cu/L significantly changed the bacterial community in the freshwater. Upon storage, histamine concentrations in meat of crayfish

119

exposed to 0.50 mg Cu/L were significantly lower and did not increase as rapidly compared to those in control crayfish. After 10 days of storage, meat from crayfish exposed to 0.50 mg Cu/L contained approximately 7.5 mg histamine/kg fresh weight, significantly less than the meat of animals incubated in copper-free water, which approximated 22 mg/kg fresh weight. Considering that copper can slow down histamine accumulation during storage by changing the bacterial community structure in the culture water, we suggest that the increased histamine level during storage is derived from the bacteria present in the water (Chapter 5). Aquatic bacteria will also be present in the gut, and these might be the source of bacterial growth in the animal after it died. Consequently, when copper affects the bacterial community in the water, there will also be an effect on the bacterial community growing in the animal during storage. In this study aseptic conditions were employed during processing the crayfish meat, because several studies on histamine in seafood observed that poor sanitation and mishandling during processing are the cause of the increased histamine levels (Lpez-Sabater et a l., 1994; Tsai et al ., 2004). Elevated levels of histamine in seafood can have severe implications for human beings because histamine induces physical responses like seafood allergy with burning sensation in the mouth and asthma (Bucca et al., 1991), besides nausea, vomiting, diarrhea, hives, itching, red rash, and hypotension (Taylor et al ., 1989). In international seafood trade, the seafood quality standard criteria set by the United States Food and Drug Administration, including the criteria for histamine (maximum 50 mg histamine/kg fresh weight), are used as the guidelines (Ababouch et al., 2005). According to our study, the histamine concentrations found in the crayfish meat from both treatments were lower than the standard and not causing concern regarding seafood safety. But considering that in real aquaculture ponds more diverse bacterial communities may exist including histamine-producing bacteria

120

higher concentrations of histamine during storage may be produced potentially leading to food-safety risks. Also, contamination during handling and processing of the seafood has to be taken into account since it may also lead to similar effects on histamine accumulation during storage. Determining which source of bacterial contaminations from the aquatic environment or from seafood handling will play a major role in histamine accumulation is also an interesting subject for future research. According to the copper accumulation pattern and histamine levels in marbled crayfish in our studies (Chapter 3 and Chapter 4, respectively), high copper concentrations and high levels of histamine especially occur in the hepatopancreas. This seems irrelevant to seafood safety considering that the hepatopancreas is non-edible. But in terms of small size edible crustaceans, such as Euphausia pacifica Hansen, Euphausia superba Dana and Sergia lucens Hansen (Kubota and Kobayashi, 1988), where the whole body is considered as the edible portion, information of copper concentration in each organ as well as in the whole body and histamine concentration in the hepatopancreas becomes important. Consuming the whole body of crustaceans, including the gills and hepatopancreas organs with high concentrations of copper indeed may pose a hazard for food safety. In terms of food safety assessment, the major consideration is dietary exposure. Two factors are needed for defining the dietary exposure, i.e. data on food consumption and data on the concentration of chemicals in food (Nesreddine and Parent-Massin, 2002). A further step is comparing the estimated dietary exposure to the toxicological reference value of the chemical of concern. In the food safety risk assessment, the concept of acceptable daily intake (ADI) is commonly applied. ADI is the level of daily intake of specific

121

substances by humans, on a body weight basis, which would not cause an appreciable risk. The ADI concept has been developed and established by FAO/WHO together with the International Program on Chemical Safety (WHO, 1987). The ADI concept has been developed to deal with food containing specific substances that are considered toxic or cause adverse health effects under an assumption that exposure levels below the threshold are safe. The ADI concept allows people to consume certain amounts of food with caution without any worry for their health, as long as the concentrations are below the threshold and amounts of food taken do not exceed recommended values. The threshold level is based on the no observed adverse effect level (NOAEL), which in most cases is determined, based in laboratory toxicity studies with test animals. The ADI concept is therefore derived from the NOAEL with a safety factor of 100 (Kuiper et al., 2001). The provisional guidelines determined by the World Health Organization of the United Nations (WHO, 1998) determined the upper limit of copper intake at 2 -3 mg/kg body weight per day. Intake copper from any source food and drink under those dosages should not give any adverse health effects, even in case of long-term exposure. Several foods, such as liver and meat, seafood, nuts, and seeds (NAS, 1989) and drinking water (US EPA, 1991) are considered as high copper diet materials. In the human body, copper is essential and thus required for the proper functioning of many enzyme systems, such as superoxide dismutase, cytochrome oxidase, tyrosinase, monoamine oxidase and phenylalanine hydroxylase (Linder and Hazegh-Azam, 1996). But Olivares et al. (2001) mentioned that acute exposure to high copper concentrations can cause food-poisoning symptoms including as nausea, vomiting, diarrhea, and abdominal pain. Furthermore, several studies with mice showed that although copper is not known for its carcinogenicity (Toyokuni & Sagripanti, 1994) it has a tendency to be mutagenic (BRL, 1968 in WHO, 1998). When

122

considering our data, in case of a person with 60 kg body weight consuming 100 g of a marbled crayfish exposed to 0.5 mg Cu/L (containing 185 mg Cu/kg dry weight or ~ 46 mg Cu/kg fresh weight), the exposure will be 0.08 mg/kg body weight. Referring to the WHO standard limit of copper intake of 2-3 mg/kg body weight per day, consuming the whole body of marbled crayfish does not pose any risk. According to our findings, exposure to copper at nominal concentrations up to 0.5 mg/L had a minor effect on histamine levels of live crayfish and did not lead to unacceptable copper levels in crayfish meat. It did, however, have a large impact on both the microbial community structure in the culturing water and in the stored meat. In Figure 1, the arrow that connects histamine levels in live animals to food safety and the arrow connecting copper accumulation to food safety are printed in white as these interactions are considered to have minor effects on food safety. In contrast, the arrow that connects histamine accumulation in the meat during storage is printed in grey colour as it is considered to represent a serious impact. Copper exposure decreased histamine production in stored meat. This suggests that copper contamination may have a positive effect on the shelf life of crustacean meat. This effect of copper is indirect, by impacting the microbial community structure. Effect of copper application during seafood handling on seafood quality and safety poses an interesting subject for future research. Also, whether the copper toxicity on microorganisms also occurs with other metals or organic pollutants needs further research. Comparing the copper behaviour in different species of crustaceans, especially those living in freshwater and brackish water may also be an interesting subject of future research.

123

A unique feature of this study is the comprehensive link between environmental quality and food safety. The effect of copper in the aquatic environment on edible crustacean model species, both alive (i.e. copper accumulation and histamine levels) and during storage (i.e. microbial community structure and histamine accumulation) was studied. Several scientific approaches were involved in this study: toxicology, microbiology and food safety. In terms of toxicology, copper uptake and elimination kinetics in each organ of the marbled crayfish was described (Chapter 3). Also, a new insight was gained on increasing histamine levels in the crayfish, especially in the hepatopancreas, triggered by copper (Chapter 4). In both chapters, the relevancy of the interaction between copper accumulation and histamine levels for food safety was elucidated. Further copper exposure changed the bacterial community structures both in culture water and crayfish meat, which eventually affected the histamine accumulation during storage (Chapter 5). The (molecular)-microbiology and food safety approaches were comprehensively utilized for explaining the phenomenon. Our finding on microbial contamination in the aquatic environment affecting seafood quality supports the statement of Ahmed (1991) that the quality of seafood reflects the quality of the water from which the seafood is taken. Aquaculture production under poor hygiene and poor sanitation will result in faster deterioration of seafood, and also in higher levels of accumulated histamine during storage. Moderate copper contamination in the aquatic environment does not pose a risk to food safety in terms of metal bioaccumulation and even leads to the growth inhibition of the deteriorative bacteria in seafood during storage.

124

References

125

Ababouch, L., Gandini, G., Rayder, J., 2005. Causes of detentions and rejections in international fish trade. FAO Fisheries Technical Paper 473, Food and Agricultural Organization of the United Nations, Rome. Ahmed, F.E., 1991. Seafood safety. National Academy Press. Washington, D.C. Ahsanullah, M., Negilski, D.S., Mobley, M.C., 1981. Toxicity of zinc, cadmium and copper to the shrimp Callianassa australien sis. III. Accumulation of metals. Marine Biology 64, 311-316. Alagarsamy, R., 2006. Distribution and seasonal variation of trace metals in surface sediments of the Mandovi estuary, west coast of India. Estuarine, Coastal and Shelf Science 67, 333-339. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. Journal of Molecular Biology 215, 403-410. Amman, R.I., Ludwig, W., Schleifer, K.H., 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiological Reviews 59, 143-169. Anderson, M.B., Reddy, P., Preslan, J.E., Fingerman, M., Bollinger, J., Jolibois, L., Maheshwarudu, G., George, W.J., 1997. Metal accumulation in crayfish, Procambarus clarkii, exposed to a petroleum-contaminated Bayou in Louisiana, Ecotoxicolgy and Environmental Safety 37, 267-272. Asadu, C.L.A., Diels, J., Vanlauwe, B., 1997. A comparison of contributions of clay, silt, and organic matter to the effective CEC of soils of Subsaharan Africa. Soil Science 162, 785-794. Auerswald, L., Morren, C., Lopata, A.L., 2006. Histamine levels in seventeen species of fresh and processed South African seafood. Food Chemistry 98, 231-239. Baden, S.P., Eriksson, S.P., Gerhardt, L., 1999. Accumulation and elimination kinetics of manganese from different tissues of the Norway lobster, Nephrops norvegicus (L.). Aquatic Toxicology 46, 127-137. Badgley, C., Moghtader, J., Quintero, E., Zakem, E., Chappell M.J., AvilesVazquez, K., Samulon, A., Perfecto, I., 2006. Organic agriculture and the global food supply. Renewable Agriculture and Food Systems 22, 86-108. 126

Bagato, G., Alikhan, M.A., 1987. Copper, cadmium, and nickel accumulation in crayfish populations near copper-nickel smelters at Sudbury, Ontario, Canada. Bulletin Environmental Contamination and Toxicology 38, 540-545. Barnes, R. D., 1987. Invertebrate Zoology, 5th Ed. W. B. Saunders Company, Philadelphia. Bayen, S., Koroleva, E., Lee, H.K., Obbard, J.P., 2005. Persistent organic pollutants and heavy metals in typical seafoods consumed in Singapore. Journal of Toxicology and Environmental Health 68, 151-66 Bender, C.L., Cooksey, D.A., 1986. Indigenous plasmids in Pseudomonas syringae pv. tomato: conjugative transfer and role in copper resistance. Journal of Bacteriology 165, 534-541. Bender, C.L., Cooksey, D.A., 1987. Molecular cloning of copper resistance genes from Pseudomonas syringae pv. tomato. Journal of Bacteriology 169, 470-474. Beswick, P.H., Hall, G.H., Hook, A.J., Little, K., McBrien, D.C.H., Lott, K.A.K., 1976. Copper toxicity: evidence for the conversion of cupric to cuprous copper in vivo under anaerobic condition. Chemico-Biological Interactions 14, 367-356. Bini, G., Chelazzi, G., 2006. Acclimatable cardiac and ventilatory responses to copper in the fresh water crayfish Procambarus clarkii . Comparative Biochemistry and Physiology 144C, 235-241. Bossuyt, B.T.A., Janssen, C.R., 2003. Acclimation of Daphnia magna to environmentally realistic copper concentrations. Comparative Biochemistry and Physiology136C, 253-264. Brown, N.L., Barrett, S.R., Camakaris, J., Lee, B.T.O., Rouch, D.A., 1995. Molecular genetics and transport analysis of the copper-resistance determinant (pco) from Escherichia coli plasmid pRJ1004. Molecular Microbiology 17, 1153-1166. Brown, N.L., Rouch, D.A., Lee, B.T.O., 1992. Copper resistance determinants in bacteria. Plasmid 27, 41-51. Brummett, R.E., Williams, M.J., 2000. The evolution of aquaculture in African rural and economic development. Ecological Economics 33, 193-203. 127

Bucca, C., Rolla, G., Scappaticci, E., Baldi, S., Caria, E., Oliva, A., 1991. Histamine hyperresponsiveness of the extrathoracic airway in patients with asthmatic symptoms. Allergy 46, 147-153. Butt, A.A., Aldridge, K.E., Sanders, C.V., 2004. Infections related to the ingestion of seafood. Part I: viral and bacterial infections. The Lancet Infectious Disease 4, 201-212. Cabrero, A., Fernandez, S., Mirada, F., Garcia, J., 1998. Effects of copper and zinc on the activated sludge bacteria growth kinetics. Water Research 32, 1355-1362. Calabrese, A., MacInnes, J.R., Nelson, D.A., Greig, R.A., Yevich, P.P., 1984. Effect of long-term exposure to silver or copper on growth, bioaccumulation and histopathology in blue mussel Mytilus edulis . Marine Environmental Research 11, 253-274. Camusso, M., Tartari, G., 1991. Measurement and prediction of copper ion activity in Lake Orta, Italy. Environmental Science and Technology 25, 678683. Canli, M., Atli, G., 2003. The relationships between heavy metal (Cd, Cr, Cu, Fe, Pb, Zn) levels and the size of six Mediterranean fish species. Environmental Pollution 121, 129-136. Canivet, V., Chambon, P., Gibert, J., 2001. Toxicity and bioaccumulation of arsenic and chromium in epigean and hypogean freshwater macroinvertebrates. Archieves of Environmental Contamination and Toxicology 40, 345-354. Cebada, J., Garcia, U., 2007. Histamine operated Cl -gated channels in crayfish neurosecretory cells. Journal of Experimental Biology 210, 39623969. Central Java Province Statistical Central Bureau, 2009. http://jateng.bps.go.id/2006/index06.html. (accessed 1 March 2011; in Indonesian language). Cervantes, C., Gutierrez-Corona, F., 1994. Copper resistance mechanisms in bacteria and fungi. Federation of European Microbiological Societies (FEMS) Microbiology Reviews 14, 121-138.
-

128

Chapman, P.M., Allard, P.J., Vigers, G.A., 1999. Development of sediment quality values for Hong Kong administrative region: a possible model for other jurisdictions. Marine Pollution Bulletin 38, 161-169. Chavez-Crooker, P., Garrido, N., Pozo, P., Ahearn, G.A., 2003. Copper transport by lobster (Homarus americanus ) hepatopancreatic lysosomes. Comparative Biochemistry and Physiology 135C, 107-118. Chou, C.L., Paon, L.A., Moffatt, J.D., 2002. Cadmium, copper, manganese, silver, and zinc in rock crab (Cancer irr oratus) from highly copper contaminated sites in the Inner Bay of Fundy, Atlantic Canada. Bulletin Environmental Contamination and Toxicology 68, 885892. Cohen, J.E., 2003. Human population: the next half century. Science 302, 1172-1175. Cooksey, D.A., 1990. Genetic of bactericide resistance in plant pathogenic bacteria. Annual Review of Phytopathology 28, 201-219. Cooksey, D.A., Azad, H.R., Cha, J.S., Lim, C.K., 1990. Copper resistance gene homologs in pathogenic and saprophytic bacterial species from tomato. Applied and Environmental Microbiology 56, 431-435. Cooksey, D.A., Azad, H.R., 1992. Accumulation of copper and other metals by copper-resistant plant-pathogenic and saprophytic Pseudomonas. Applied and Environmental Microbiology 58, 274-278. Correa, J.A., Castilla, J.A., Ramirez, M., Varas, M., Lagos, N., Vergara, S., Moenne, A., Romn, D., Brown, M.T., 1999. Copper, copper mine tailings and their effect on marine algae in Northern Chile. Journal of Applied Phycology 11, 57-67. Coton, E., Coton, M., 2005. Multiplex PCR for colony direct detection of Gram-positive histamine- and tyramine-producing bacteria. Journal of Microbiological Method 63, 296-304. Crommentuijn, T., Sijm, D., de Bruijn, J., van den Hoop. M., van Leeuwen, K., van de Plassche, E., 2000. Maximum permissible and negligible concentrations for metals and metalloids in the Netherlands, taking into account background concentration. Journal of Environmental Management 60, 121-143.

129

Daly, J.W., 2004. Marine toxins and nonmarine toxins: convergence or symbiotic organisms? Journal of Natural Products 67, 1211-1215. Dean, R.J., Shimmield, T.M., Black, K.D., 2007. Copper, zinc and cadmium in marine cage fish farm sediments: an extensive survey. Environmental Pollution 145, 84-95. DeForest, D.K., Brix, K.V., Adams, W.J., 2007. Assessing metal bioaccumulation in aquatic environment: the inverse relationship between bioaccumulation factors, trophic transfer factors and exposure concentration. Aquatic Toxicology 84, 236-246. DePaola, A., Capers, G.M., Alexander, D., 1994. Densities of Vibrio vulnificus in the intestines of fish from the U.S. Gulf Coast. Applied and Environmental Microbiology 60, 984-988. Dewanti-Hariyadi, R., Nuraida, S.L., Fardiaz, S., 2005. Determination of contamination profiles of human bacterial pathogens in shrimp, obtained from Java, Indonesia. Proceedings of a final Research Coordination Meeting held in Mexico City, Mexico, 2226 July 2002. Diana, J.S., Lin, C.K., Schneeberger, P.J., 1991. Relationships among nutrient inputs, water nutrient concentrations, primary production, and yield of Oreochromis niloticus in ponds. Aquaculture 92, 323-341. Dohrmann, R., 2006. Cation exchange capacity methodology II: a modified silver-thiourea method. Applied Clay Science 34, 38-46. Domek, M.J., LeChevallier, Cameron, S.C., McFeters, G.A., 1984. Evidence for the role of copper in the injury process of Coliform bacteria in drinking water. Applied and Environmental Microbiology 48, 289-293. Donker, M.H., Koevoets, P., Verkleij, J.A.C., Van Straalen, N.M., 1990. Metal binding compounds in hepatopancreas and haemolymph of Porcellio scaber (Isopoda) from contaminated and reference areas. Comparative Biochemistry and Physiology 97C, 119-126. Dumalagan, H.G.D., Gonzales, A.C., Hallare, A.V., 2010. Trace metal content in mussels, Perna viridis L., obtained from selected seafood markets in a Metropolitan City. Bulletin of Environmental Contamination and Toxicology 84, 492-496.

130

Duquesne, S., Riddle, M., Schulz, R., Liess, M., 2000. Effects of contaminants in the Antarctic environment potential of the gammarid amphipod crustacean Paramorea walkeri as a biological indicator for Antarctic ecosystems based on toxicity and bioaccumulation of copper and cadmium. Aquatic Toxicology 49, 131-143. Eastaugh, J., Shepherd, S., 1989. Infectious and toxic syndromes from fish and shellfish consumption. Archives of Internal Medicine 149, 1735-1740. Egoz, N., Shihab, S., Leitner, I., Lucian, M., 1988. An outbreak of typhoid fever due to contamination of municipal water supply in Northern Israel. Israel Journal of Medical Science 24, 640-643. Einarsson H., Emerson, W., 2009. International seafood trade: challenges and opportunities. Food and Agriculture Organization of the United Nations, Rome. Emborg, J., Laursen, B.G., Dalgaard, P., 2005. Significant histamine formation in tuna (Thunnus albacares ) at 2 oC - effect of vacuum- and modified atmosphere-packaging on psychrotolerant bacteria. International Journal of Food Microbiology 101, 263-279. Engel, D.W., 1987. Metal regulation and molting in the blue crab, Callinectes sapidus: copper, zinc and metallothionein. The Biological Bulletin 172, 69-82. Evenson, R.E., Gollin, D., 2003. Assessing the impact of the green-revolution, 1960 to 2000. Science 300, 758-762. Ewan, P.W., 1996. Clinical study of peanut and nut allergy on 62 consecutive patients: new features and associations. British Medical Journal 312, 1074. Fabris, G., Turoczyb, N.J., Stagnitti, F., 2006. Trace metal concentrations in edible tissue of snapper, flathead, lobster, and abalone from coastal waters of Victoria, Australia. Ecotoxicology and Environmental Safety 63, 286-292. Falco, G., Llobet, J.M., Bcio, A., Domingo, J.L., 2006. Daily intake of arsenic, cadmium, mercury and lead by consumption of edible marine species. Journal of Agricultural and Food Chemistry 54, 6106-6112. FAO, 1998. Integrated coastal area management and agriculture, forestry and fisheries. Food and Agriculture Organization of the United Nations, Rome.

131

FAO, 2006. State of world aquaculture. Food and Agriculture Organization of the United Nations, Rome. FAO, 2010. The state of food insecurity in the world. Food and Agriculture Organization of the United Nations, Rome. Farrington, J.W., Goldberg, E.D., Risebrough, R.W., Marlin, J.H., Bowed, V.T., 1983. U.S. Mussel Watch 1976-1 978: An Overview of the TraceMetal, DDE, PCB, Hydrocarbon, and Artificial Radionuclide Data. Environmental Science and Technology 17, 490-498. Feldhusen, F., 2000. The role of seafood in foodborne diseases. Microbes and Infection 2, 1651-1660. Feijtel, T., Kloepper-Sams, P., de Haan, K., van Egmond, R., Comber, M., Heusel, R., Wierich, P., Ten Berge, W., Gard, A., de Wolf, W., Niessen, H., 1997. Integration of bioccumulation in an environmental risk assessment. Chemosphere 34, 2337-2350. Fernandes, H.M., Bidone, E.D., Veiga, L.H.S., Patchineelam, S.R., 1994. Heavy-metal pollution assessment in the coastal lagoons of Jacarepagua, Rio de Janeiro, Brazil. Environmental Pollution 85, 259-264. Flemming, C.A., Trevors, J.T., 1989. Copper toxicity and chemistry in the environment: a review. Water, Air and Soil Pollution 44, 143-158. Freeman, M.H., McIntyre, C.R., 2008. A comprehensive review of copperbased wood preservative. Forest Products Journal 58, 4-22 Garver, J.I., Royce, P.R., Smick, T.A., 1996. Chromium and Nickel in shale of the taconic foreland: a case study for the provenance of fine-grained sediments with an ultramafic source. Journal of Sediment Research 6, 100-106. Gasem, M.H., Dolmans, W.M.V., Keuter, M., Djokomoeljanto, R., 2001. Poor food hygiene and housing as risk factors for typhoid fever in Semarang, Indonesia. Tropical Medicine and International Health 6, 484-490. GESAMP, 1997. Towards safe and effective use of chemicals in coastal aquaculture. IMO / FAO / Unesco / WMO / WHO / IAEA / UN / UNEP Joint Group of Experts on the Scientific Aspects of Marine Pollution. Report and studies no. 65.

132

Gibson, C.E., 1972. The algicidal effect of copper on a green and a blue-green alga and some ecological implications. British Ecological Society 9, 513-518. Gillespie, R.G., Clague, D.A. (Eds), 2009. Encyclopaedia of Islands. University of California Press, Barkeley. Graedel, T.E., Bertram, M., Kapur, A., Reck, B., Spatari, S., 2004. Exploratory data analysis of the multilevel anthropogenic copper cycle. Environmental Science and Technology 38, 1253-1261. Graedel, T.E., Bertram, M., Fuse, K., Gordon, R.B., Lifset, R., Rechberger, H., Spatari, S., 2002. The contemporary European copper cycle: the characterization of technological copper cycles. Ecological Economics 42, 926. Grslund, S., Bengtsson, B.E., 2001. Chemicals and biological products used in South-East Asian shrimp farming, and their potential impact on the environment a review. Science Total Environment 280, 93-131. Guner, U., 2007. Freshwater crayfish Astacus leptodactylus (Eschscholtz, 1823) accumulates and depurates copper. Environmental Monitoring and Assessment 133, 365-369. Hajeb, P., Jinap, S., Ismail, A., Fatimah, A.B., Jamilah, B., Abdul Rahim, M.A., 2009. Assessment of mercury level in commonly consumed marine fishes in Malaysia. Food Control 20, 79-84. Han, B.C., Jeng, W.L., Hung, T.C., Jeng, M.S., 1994. Copper intake and health threat by consuming seafood from copper-contaminated coastal environments in Taiwan. Environmental Toxicology and Chemistry 5, 775-780. Harris, R.R., Santos, M.C.F., 2000. Heavy metal contamination and physiology variability in the Brazilian mangrove crabs Ucides cordatus and Callinectes danae (Crustacea: Decapoda). Marine Biology 137, 691-703. Hashmi, M.I., Mustafa, S., Tariq, S.A., 2002. Heavy metal concentrations in water and tiger prawn (Penaeus m onodon) from grow-out farms in Sabah, North Borneo. Food Chemistry 79, 151-156. Helland, A., Bakke, T., 2002. Transport and sedimentation of Cu in microtidal estuary, SE Norway. Marine Pollution Bulletin 44, 149-155.

133

Hopkins, S.J., Hamilton II, R.D., Sandifer, P.A., Browdy, C.L., Stokes, A.D., 1993. Effect of water exchange rate on production, water quality, effluent characteristics and nitrogen budgets of intensive shrimp ponds. Journal of the World Aquaculture Society 24, 304-320. Icely, J.D., Not, J.A., 1980. Accumulation of copper within the "hepatopancreatic" caeca of Corophium volutator (Crustacea: Amphipoda). Marine Biology 57, 193-199. Inaba, T., Kobayashi, E., Suwazono, Y., Uetani, M., Oishi, M., Nakagwa, H., Nogawa, K., 2005. Estimation of cumulative cadmium intake causing Itai-itai disease. Toxicology Letters 159, 192-201. Isaac, R.A., Gil, L., Cooperman, A.N., Hulme, K., Eddy, B., Ruiz, Jacobson, K., Larson, C., Pancorbo, O.C., 1997. Corrosion in drinking water distribution systems: a major contributor of copper and lead to wastewaters and effluents. Environmental Science and Technology 31, 3198-3203. Jacinthe, P.A., Filippelli, G.M., Tedesco, L.P., Licht, K.J., 2010. Distribution of copper in sediments from fluvial reservoirs treated with copper triethanolamine complex algicide. Water Air and Soil Pollution 211, 3548. Janssen, M.P.M., Bruins, A., De Vries, T.H., Van Straalen, N.M., 1991. Comparison of cadmium kinetics in four soil arthropod species. Archives of Environmental Contamination and Toxicology 20, 305-312. Jimenez, S.A., Faulkes, Z., 2010. Can the parthenogenetic marbled crayfish Marmokrebs compete with other crayfish species in fight? Journal of Ethology 29, 115-120. Jonas, R.B., 1989. Acute copper and cupric ion toxicity in an estuarine microbial community. Applied and Environmental Microbiology 55, 43-49. Kadiyala, S and Gillespie, S., 2003. Rethinking food aid to fight AIDS. FCND discussion paper no. 159. International Food Policy Research Institute, Washington, D.C. Khan, A.T., Weis, J.S., DAndrea, L., 1989. Bioaccumulation of four heavy metals in two populations of grass shrimp, Palaemonetes pugio . Bulletin of Environmental Contamination and Toxicology 42, 339-343.

134

Kim, S.H., An, H., Price, R.J., 1999. Histamine formation and bacterial spoilage of Albacore harvested off the U.S. Northwest Coast. Journal of Food Science 64, 340-343. King, C.C., Chen, C.J., You, S.L. 1989. Community-wide epidemiological investigation of a typhoid outbreak in a rural township in Taiwan, Republic of China. International Journal of Epidemiology 18, 254-260. Kirby, J., Maher, W., Krikowa, F. 2001. Selenium, cadmium, copper and zinc concentration in sediments and Mullet (Mugil cephalus ) from the southern basin of Lake Macquarie, NSW, Australia. Archives of Environmental Contamination and Toxicology 40, 246-256. Klaassen, C.D., Watkins III, J.B., 2010. Casarett and Doulls Essential of Toxicology, 2nd Ed. McGraw-Hill Companies, Inc. New York. Kubota, K., Kobayashi, A., 1988. Identification of unknown methyl ketones in volatile flavor components from cooked small shrimp. Journal of Agricultural and Food Chemistry 36, 121-123. Kucuksezgin, F., Kacar, A., Kucuksezgin, G., Uluturhan, E., 2010. Monitoring metal contamination levels and fecal pollution in clam (Tapes decussatu s) collected from Izmir Bay (Turkey). Environmental Monitoring and Assessment 162, 407-415. Kuiper, H.A., Kleter, G.A., Noteborn, H.P.J.M., Koket, E.J., 2001. Assessment of the food safety issues related to genetically modified foods. The Plant Journal 27, 503-528. Lee, M.H; Shiau, S.Y., 2002. Dietary copper requirement of juvenile grass shrimp, Penaeus monodon, and effects on non-specific immune response. Fish and Shellfish Immunology 13, 259-270. Lehane, L., Olley, J., 2000. Histamine fish poisoning revisited. International Journal of Food Microbiology 58, 1-37. Linder, M.C., Hazegh-Azam, M. 1996. Copper biochemistry and molecular biology. American Journal of Clinical Nutrition 63, 797S-811S.

135

Li, N., Zhao, Y.L., Yang, J., 2005. Accumulation, distribution, and toxicology of copper sulfate in juvenile giant fresh water prawns, Macrobrachium rosenbergii. Bulletin of Environmental Contamination and Toxicology 75, 479-504. Li, N., Zhao, Y., Yang, J., 2007. Impact of waterborne copper on the structure of gills hepatopancreas and its impact on the content of metallothionein in juvenile giant freshwater prawn Macrobrachium rosenbergii (Crustacea: Decapoda). Archives of Environmental Contamination and Toxicology 52, 7379. Li, N., Ma, Q., Yang, J., Zhao, Y., Brochon, J.C., 2008. Effects of water-borne copper on the gills and hepatopancreas of Macrobrachium rosenbergii . Integrative Zoology 3, 299-310. Lpez-Sabater, E.I., Rodrguez-Jerez, J.J., Roig-Sagus, A.X., Mora-Ventura, M.A.T., 1994. Bacteriological quality of tuna fish (Thunnus thynnus) destined for canning: effect of tuna handling on presence of histidine decarboxylase bacteria and histamine level. Journal of Food Protection 57, 318-323. Lubis, A.M., Sato, T., Tomiyama, N., Izesaki, N., Yamanokuchi, T., 2011. Ground subsidence in Semarang-Indonesia investigated by ALOS-POLSAR satellite SAR interferometry. Journal of Asian Earth Science 40, 1078-1088. Luoma, S.N., Rainbow, P.S., 2005. Why is metal bioaccumulation so variable? Biodynamics as a unifying concept. Environmental Science and Technology 39, 1921-1931. Luoma, S.N., Rainbow, P.S., 2008. Metal contaminations in aquatic environments. Cambridge University Press, Cambridge. Lyon, R., Taylor M., Simkiss K., 1983. Metal-binding proteins in the hepatopancreas of the crayfish (Austropotamobius pallipes ). Comparative Biochemistry and Physiology 74C, 51-54. Madany, I.M., Wahab, A.A.A., Al-Alawi, Z., 1995. Trace metals concentrations in marine organisms from the coastal areas of Bahrain, Arabian Gulf. Water Air and Soil Pollution 91, 233-248. Maher, W.A. 1985. Trace metal concentrations in marine organisms from St. Vincent Gulf, South Australia. Water Air and Soil Pollution 29, 77-84.

136

Malm, O., Branches, F.J.P., Akagi, H., Castro, M.B., Pfeiffer, W.C., Harada, M., Bastos, W.R., Kato, H., 1995. Mercury and Methylmercury in fish and human hair from Tapajs river basin, Brazil. Science Total Environment 175, 141-150. Manisseri, M.K., Menon, N.R., 1995. Copper-induced damage to the hepatopancreas of the penaeid shrimp Metapenaeus dobsoni an ultrastructural study. Disease of Aquatic Organisms 22, 51-57. Marfai, M.A., King, L., 2008. Coastal flood management in Semarang, Indonesia. Environmental Geology 55, 1507-1518. Martin, P., Kohlmann, K., Scholtz, G., 2007. The parthenogenetic Marmorkrebs (marbled crayfish) produces genetically uniform offspring. Naturwissenschaften 94, 843-846. Martins, C.D.M.G., Barcarolli, I.F., de Menezes, E.J., Giacomin, M.M., Wood, C.M., Bianchini, A., 2011. Acute toxicity, accumulation and tissue distribution of copper in the blue crab Callinectes sapidus acclimated to different salinities: in vivo and in vitro studies. Aquatic Toxicology 101, 88-99. Marzano, F.N., Scalici, M., Chiesa, S., Gherardi, F., Piccinini, A., Gilbertini, G., 2009. The first record of the marbled crayfish adds further threats to fresh waters in Italy. Aquatic Invasion 4, 401-404. Mastin, B.J., Rodgers, Jr., J.H., 2000. Toxicity and bioavailability of copper herbicides (Clearigate, Cutrine-Plus, and copper sulfate) to freshwater animals. Archives of Environmental Contamination and Toxicology 39, 445-451. Matthiessen, P., Reed, J., Johnson, M. (1999). Sources and potential effects of copper and zinc concentrations in the estuarine waters of Essex and Suffolk, United Kingdom. Marine Pollution Bulletin 38, 908-920. McGeer, J.C., Brix, K.V., Skeaff, C.M., DeForest, D.K., Bringham, S.I., Adams, W.J., Green, A., 2003. Inverse relationship between bioconcentration factor and exposure concentration for metals: implications for hazard assessment of metals in the aquatic environment. Environmental Toxicology and Chemistry 22, 1017-1037. McKim, J.M., Eaton, J.G., Holcombe, G.W., 1978. Metal toxicity to embryos and larvae of eight species of freshwater fish-II: copper. Bulletin of Environmental Contamination and Toxicology 19, 608-616. 137

Micknien, L., yvokien, J., 1999. The effect of heavy metals on microorganisms of digestive tract of crayfish. Acta Zoologica Lituanica Hydrobiologia 9, 37-39. Mietz, J.L., Karmas, A., 1978. Polyamine and histamine content of rockfish, salmon, lobster, and shrimp as an indicator of decomposition. Journal of the Association of Official Analytical Chemists 61, 139-145. Mishra, S., Bhalke, S., Saradhi, I.V., Suseela, B., Tripathi, R.M., Pandit, G.G., Puranik, V.D., 2007. Trace metals and organometals in selected marine species and preliminary risk assessment to human beings in Thane Creek area, Mumbai. Chemosphere 69, 972-978. Moon, H.B., Ok, G., 2006. Dietary intake of PCDDs, PCDFs and dioxin-like PCBs, due to the consumption of various marine organisms from Korea. Chemosphere 62, 11421152. Morse, D. L., Guzewich, J.J., Hanrahan, J.P., Stricof, R., Shayegani, M., Deibel, R., Grabau, J.C., Nowak, N.A., Herrmann, J.E., Cukor, G., Blacklow, N.R., 1986. Widespread outbreaks of clam- and oyster-associated gastroenteritis. The New England Journal of Medicine 314, 678-681. Moullac, G.L., Haffner, P., 2000. Environmental factors affecting immune responses in Crustacea. Aquaculture 191, 121-131. Munari, C., Mistri, M., 2007. Effect of copper on the scope for growth of clams (Tapes philippinarum) from a farming area in the Northern Adriatic Sea. Marine Environmental Research 64, 347357. Muyzer, G., De Wall, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S r-RNA. Applied and Environmental Microbiology 59, 695-700. Nan, Z.B., 1995. Fungicide seed treatments of sainfoin control seed-borne and root-invading fungi. New Zealand Journal of Agricultural Research 38, 413420. NAS, 1989. Recommended dietary allowances, 10th ed. National Academy of Sciences, Food and Nutrition Board, Washington, D.C. pp. 224-230.

138

Nauen, C.E., 1983. Compilation of legal limits for hazardous substances in fish and fishery products. FAO Fisheries Circular No. 764, 102. Food and Agriculture Organization of the United Nations, Rome. Naylor, R.L., Goldberg, R.J., Primavera, J.H., Kautsky, N., Beveridge, M.C.M., Clay, J., Folke, C., Lubchenco, J., Mooney, H., Troell, M., 2000. Effect of aquaculture on world fish supplies. Nature 405, 1017-1024. Nesreddine, L., Parent-Massin, D., 2002. Food contamination by metals and pesticides in the European Union. Should we worry? Toxicology Letters 127, 29-41. Nettleton, J.A., 1991. Omega-3 fatty acids: comparison of plant and seafood sources in human nutrition. The American Journal of Diet Association 91, 331-337. Nicholson, S., Lam, P.K.S., 2005. Pollution monitoring in Southeast Asia using biomarkers in the mytilid mussel Perna viridis (Mytilidae: Bivalvia). Environment International 31, 121 132. Niven, Jr. C.F., Jeffrey, M.B., Corlett, Jr. D.A., 1981. Differential plating medium for quantitative detection of histamine-producing bacteria. Applied and Environmental Microbiology 41, 321-322. Nolan, K.R., 1983. Copper toxicity syndrome. Journal of Orthomolecular Psychiatry 12, 270-282. Nriagu, J.O., 1979. Global inventory of natural and anthropogenic emissions of trace metals to the atmosphere. Nature 279, 409 411. Nriagu, J.O., Rao, S.S., 1987. Response lake sediments to changes in trace metals emission from the Smelters at Sudbury Ontario. Environmental Pollution 44, 211-218. Ohlson, R., Anjou, K., 1979. Rapeseed protein products. Journal of the American Oil Chemists Society 5, 431-437. Olivares, M., Araya, M., Pizarro, F., Uauy, R., 2001. Nausea threshold in apparently healthy individuals who drink fluids containing graded concentrations of copper. Regulatory Toxicology and Pharmacology 33, 271275. Osunde, I.M, Coyle, S, Tidwell, J., 2004. Acute toxicity of copper to juvenile 139

freshwater prawns, Macrobrachium rosenbergii . Aquaculture 14, 71-79.

Journal

of Applied

Oyewo, E.O., Don-Pedro, K.N., 2003. Estimated annual discharge rates of heavy metals from industrial sources around Lagos; a West African metropolis. West African Journal of Applied Ecology 4, 115-123. Paganini, C.L., Bianchini, A., 2009. Copper accumulation and toxicity in isolated cells from gills and hepatopancreas of the Blue Crab (Callinectes sapidus). Environmental Toxicology and Chemistry 28, 1200-1205. Payne, P.R., 1975. Safe protein-calorie ratios in diet. The relative importance of protein and energy intake as causal factors in malnutrition. The American Journal of Clinical Nutrition 28, 281-286. Pea, M.M.O., Jaekwon, L. & Thiele, D.J., 1999. A delicate balance: homeostatic control of copper uptake and distribution. Journal of Nutrition 129, 1251-1260. Pourang, N., 1995. Heavy metal bioaccumulation in different tissues of two fish species with regards to their feeding habits and trophic levels. Environmental Monitoring and Assessment 35, 207-219. Pourang, N., Tanabe, S., Rezvani, S., Dennis, J.H., 2005. Trace elements accumulation in edible tissues of five sturgeon species from the Caspian Sea. Environmental Monitoring and Assessment 100, 89-108. Powell, J.D., 1988. Origin and influence of coal mine drainage on streams of the United States. Environmental Geology and Water Sciences 11, 141-152. Pulver, S.R., Thirumalai, V., Richards, K.S., Marder, E., 2003. Dopamine and histamine in developing stomatogastric system of lobster Homarus americanus. Journal of Comparative Neurology 462, 400-414. Rainbow, P.S., 1992. The significance of accumulated heavy metal concentrations in marine organisms, in: Miskiewicz, A.G. (Ed.), Proceedings of a bioaccumulation workshop: Assessment of the distribution, impacts and bioaccumulation of contaminants in aquatic sediments. Water Board and Australian Marine Sciences Association Inc., Sydney, pp. 1-13. Rainbow, P.S., 2002. Trace metal concentrations in aquatic invertebrates: why and so what? Environmental Pollution 120, 497507. 140

Rainbow, P.S., White, S.L., 1989. Comparative strategies of heavy metal accumulation by crustaceans: zinc, copper and cadmium in a decapod, an amphipod and a barnacle. Hydrobiologia 174, 245-262. Reddy, R., Pillai, B.R., Adhikari, S., 2006. Bioaccumulation of copper in postlarvae and juveniles of freshwater prawn Macrobachium rosenbergii (de Man) exposed to sub-lethal levels of copper sulfate. Aquaculture 252, 356-360. Reilly, A., Kferstein, F., 1999. Food safety and products from aquaculture. Journal of Applied Microbiology Symposium Supplement 85, 249S-257S. Reteuna, C., Vasseur, P., Cabridenc, R., 1989. Performances of three bacterial assays in toxicity assessment. Hydrobiologia 188/189, 149-153. Rieger, V., Harzsch, S., 2008. Embryonic development of the histaminergic system in the ventral nerve cord of the Marbled Crayfish (Marmorkrebs). Tissue Cell 40, 113-126. Russel, F.E., Maretic, Z., 1986. Scombroid poisoning: mini-review with case histories. Toxicon 24, 967-973. Ryser, E.T., Marth, E.H., and Taylor, S.L. (1984). Histamine production by psychrotrophic Pseudomonas isolated from tuna fish. Journal of Food Protection 47, 378-380. Sanchez, P.A., Swaminathan, M.S., 2005. Cutting world hunger in half. Science 37, 357-359. Santos, M.A.P.F., Melo, M.G.G., Lombardi, A.T., 2008. The effects of humic substances on copper toxicity to Ceriodaphnia silvestrii Daday (Crustacea, Cladocera). Ecotoxicologia 17, 449-454. Sastre, M.P., Reyes, P., Ramos, H., Romero, R., Rivera, J., 1999. Heavy metal bioaccumulation in Puerorican blue crabs (Callinectes s pp.). Bulletin of Marine Science 64, 209-217. Sato T., Horiuchi, T., Nishimura, I., 2005. Simple and rapid determination of histamine in food using a new histamine dehydrogenase from Rhizobium sp. Analytical Biochemistry 346, 320-326. Schlitzer R., 2008. Ocean Data View. http://odv.awi.de (accessed July 2011). 141

Schiewek, R., Wirtz, R., Thiemann, M., Plitt, K., Vogt, G., Schmitz, O.J., 2007. Determination of DNA methylation level of the marbled crayfish: an increase in sample throughput by an optimised sample preparation. Journal of Chromatography 850, 548-552. Schiff, K., Brown, J., Diehl, D., Greenstein, D., 2007. Extend and magnitude of copper contamination in marinas of the San Diego region, California, USA. Marine Pollution Bulletin 54, 322-328. Scholtz, G., Braband, A., Tolley, L., Reiman, A., Mittmann, B., Lukhaup, C., Steuerwald, F., Vogt, G., 2003. Parthenogenesis in an outsider crayfish. Nature 421, 806. Schwarzenbach, R.P., Egli, T., Hofstetter, T.B., von Gunten, U., Wehrli, B., 2010. Global water pollution and human health. The Annual Review Environment and Resources 35, 109-36. Senkebeil, E.G., Wriston Jr., J.C., 1981. Haemocyanin synthesis in the American lobster, Homarus americanus . Comparative Biochemistry and Physiology 68B, 263-171. Seitz, R., Vilpoux, K., Hopp, U., Harzsch, S., Maier, G., 2005. Ontogeny of the Marmorkrebs (Marbled Crayfish): a parthenogenetic crayfish with unknown origin and phylogenetic position. Journal of Experimental Zoology 303A, 393-405. Short, A.I.K., Watling, R., MacDonald, M.K., Robson, J.S., 1980. Poisoning by Cortinarius speciosissimus. The Lancet 1, 942-943. Simpson, B.K., Nayeri, G., Yaylayana, V., Ashie, I.N.A., 1998. Enzymatic hydrolysis of shrimp meat. Food Chemistry 61, 131-138. Simpson, S.L., Batley, G.E., Chariton, A.A., Stauber, J.L., King, C.K., Chapman, J.C., Hyne, R.V., Gale, S.A., Roach, A.C., Maher, W.A., 2006. Handbook for sediment quality assessment. Centre for Environmental Contaminants Research, CSIRO New South Wales. Simpson, S.L., Angel, B.M., Jolley, D.F., 2004. Metal equilibration in laboratory-contaminated (spiked) sediments used for the development of whole-sediments toxicity tests. Chemosphere 54, 597-609.

142

Sioen, I., Matthys, C., De Backer, G., Van Camp, J., De Henauw, S., 2007. Importance of seafood as nutrient source in the diet of Belgian adolescents. Journal of Human Nutrition and Diet 20, 580-589. Sioen, I., Van Camp, J., Verdonck, F., Wim Verbeke, W., Vanhonacker, F., Willems, J., De Henauw, S., 2008. Probabilistic intake assessment of multiple compounds as a tool to quantify the nutritional-toxicological conflict related to seafood consumption. Chemosphere 71, 1056-1066. Sivaperumal, P., Sankar, T.V., Nair, P.G.V., 2007. Heavy metal concentrations in fish, shellfish and fish products from internal market of India vis-a-vis international standards. Food Chemistry 102, 612-620. Smith, A.G., Gangolli, S.D., 2002. Organochlorine chemicals in seafood: occurrence and health concerns. Food and Chemical Toxicology 40, 767-779. Smith, M.D., Roheim, C.A., Crawder, L.B., Halpern, B.S., Turnipseed, M., Anderson, J.L., Asche, F., Bourillon, L., Guttormsen, A.G., Khan, A., Liguori, L.A., McNavin, A., OConnor., M.I., Squires, D., Tyedmers, P., Brownstein, C., Carden, K., Klinger, D.H., Saragin, R., Selkoe, K.A., 2010. Sustainability and global seafood. Science 327, 784-786. Sobel, J., Painter, J., 2005. Illness caused by marine toxins. Food Safety 41, 1290-1296. Soegianto, A., Moehammadi, N., Irawan, B., Affandi, M., Hamami., 2010. Mercury concentrations in edible species harvested from Gresik coast, Indonesia and its health risk assessment. Cahiers de Biologie Marine 51, 1-8. Song, L., Marsh, T.L., Voice, T.C., Long, D.T., 2010. Loss of seasonal variability in a lake resulting from copper sulphate algaecide treatment. Physics and Chemistry of the Earth 36, 430-435. Sosulsky, F.W., Imafidon, G.I., 1990. Amino acid composition and nitrogento-protein conversion factors for animal and plant foods. Journal of Agriculture and Food Chemistry 38, 1351-1356. Spehar, R.L., Anderson, R.L., Fiandt, J.T., 1978. Toxicity and bioaccumulation of cadmium and lead in aquatic invertebrates. Environmental Pollution 15, 195-208.

143

Srinivasan, M., Swain, G.W., 2007. Managing the use of copper-based antifouling paints. Environmental Management 39, 423-441. Stall, R. E., Loschke, D. C., Jones, J. B., 1986. Linkage of copper resistance and avirulence loci on a self transmissible plasmid in Xanthomonas campestris pv. vesicatoria. Phytopathology 76, 240-243. Storelli, M.M., 2008. Potential human health risks from metals (Hg, Cd, and Pb) and polychlorinated biphenyls (PCBs) via seafood consumption: Estimation of target hazard quotients (THQs) and toxic equivalents (TEQs). Food and Chemical Toxicology 46, 2782-2788. Sugawara, A., Nishimura, T., Yamamoto, Y., Inoue, H., Nagasawa, H., Kato, T., 2006. Self-organization of oriented calcium carbonate/polymer composites: effects of a matrix peptide isolated from the exoskeleton of a crayfish. Angewandte Chemie International 45, 2876-2879. Szefer, P., Szefer, K., Skwarzec, B., 1990. Distribution of trace metals in some representative fauna of the Southern Baltic. Marine Pollution Bulletin 21, 6062. Tahvonen, R., Kumpulainen, J., 1996. Content of lead and cadmium in selected fish species consumed in Finland in 1993-1994. Food Additives and Contaminants 6, 647-654. Takahashi, H., Kimura, B., Yoshikawa, M., Fujii, T., 2003. Cloning and sequencing of the histidine decarboxylase genes of Gram-negative histamineproducing bacteria and their application in detection and identification of these organisms in fish. Applied and Environmental Microbiology 69, 2568-2579. Takarina, N.D., Browne, D.R., Risk, M.J., 2004. Speciation of heavy metal in coastal sediments of Semarang, Indonesia. Marine Pollution Bulletin 49, 854874. Takeuchi, T., Morikawa, N., Matsumoto, H., Shiraishi, Y., 1962. A pathological study of Minamata disease in Japan. Acta Neuropathology 2, 4057. Taylor, S.L., Stratton, J.E., Nordlee, J.A., 1989. Histamine poisoning (scombroid fish poisoning): an allergy-like intoxication. Clinical Toxicology 27, 225-240.

144

Thongra-ar, W., Musika C., Wongsudawan, W., Munhapol, A., 2008. Heavy metals contamination in sediment along the Eastern Coast of the Gulf of Thailand. Environment Asia 1, 37-45. Tilman, D., Fargione, J., Wolff, B., DAntonio C., Dobson, A., Howarth, R., Schindler, D., Schlesinger, W.H., Simberloff, D., Swackhamer, D., 2001. Forecasting agriculturally driven global environmental change. Science 292, 281-284. Timbrell, J.A., 1989. Introduction to toxicology. Taylor and Francis Ltd. London. Toyokuni, S., Sagripanti, J.L., 1994. Increased 8-hydroxydeoxyguanosine in kidney and liver of rats continuously exposed to copper. Toxicology and Applied Pharmacology 126, 91-97. Tsai, Y.H., Kung, H.F., Lee, T.M., Hwang, D.F., 2004. Histamine related hygienic qualities and bacteria found in popular commercial scromboid fish fillets in Taiwan. Journal of Food Protection 67, 407-412. Tubbing, D.M.J., Admiraal, W., Cleven, R.F.M.J., Iqbalt, M., van de Meent, D., Verweij, W., 1994. The contribution of complexed copper to the metabolic inhibition of algae and bacteria in synthetic media and river water. Water Research 28, 37-44. Tucker, C.S., 2000. Off-flavor problems in aquaculture. Reviews in Fishery Science 8, 45-88. United States Food and Drug Administration, 2011. Fish and fishery products hazards and controls guidance fourth edition. U.S. Department of health and human services. Chapter 7, p. 132. United State Patent, 1987. Patent Number 4,704,133: Process for photochemical stabilization of synthetic polyamide fiber materials with watersoluble copper complex dye. United State Patent, 1995. Patent Number 5,401,379: Chrome plating process. US EPA,1991. Maximum contaminant level goals and national primary drinking water regulations for lead and copper; final rule. US Environmental Protection Agency, Federal Register 56, 26460-26564.

145

US-EPA, 2007. Aquatic life ambient freshwater quality criteria copper (revision). United States Environmental Protection Agency, Office of Water, Office of Science and Technology, Washington DC, the United States of America. EPA-822-R-07-001, February 2007. U.S. FDA, 2011. Fish and fishery products hazards and controls guidance. U.S. Department of Health and Human Services Food and Drug Administration Center for Food Safety and Applied Nutrition. Van Egmond, H.P., 2004. Natural toxins: risks, regulations and the analytical situation in Europe. Analytical and Bioanalytical Chemistry 378, 1152-1160. Van Heerden, D., Vosloo, A., Nikinmaa, M., 2004. Effect of short-term copper exposure on gill structure, metallothionein and hypoxia-inducible factor-1 (HIF-1) levels in rainbow trout (Oncorhynchus mykiss). Aquatic Toxicology 69, 271-280. Van Lysebetten, J., Delbeke, K., Servin, G., 2010. Short literature review on the copper content in food, processed in copper vessels. European Copper Institute, Brussels. Van Straalen, N.M., 2008. Contaminant concentrations in organisms as indicator of bioavailability: a review of kinetic theory and the use of target species in biomonitoring. In: Chemical Bioavailability in Terrestrial Environments. Developments in Soil Sciences, vol. 32 (R. Naidu, Ed.). Elsevier, Amsterdam. Van Verseveld, H.W., Rling, W.F.M., 2004. Cluster analysis and statistical comparison of molecular community profile data. Molecular Microbial Ecology Manual. 2nd Edition., 1-24. Veltman, K., Huijbregts, M.A.J., van Kolck, M., Wang, W.X., Hendriks, A.J., 2008. Metal bioaccumulation in aquatic species: quantification of uptake and elimination rate constants using physicochemical characteristics of metals and physiological characteristics of species. Environmental Science and Technology 42, 852-858. Vilpoux, K., Sandeman, R., Harzsch, S., 2006. Early embryonic development of the central nervous system in the Australian crayfish and the Marbled crayfish (Marmorkrebs). Development Genes and Evolution 216, 209-223. Vogt, G., 2008. The marbled crayfish: a new model organism for research on 146

development, epigenetics and evolutionary biology. Journal of Zoology 276, 1-13. Vogt, G., Quinitio, E.T., 1994. Accumulation and excretion of metal granules in the prawn, Penaeus monodon, exposed to water-borne copper, lead, iron and calcium. Aquatic Toxicology 28, 223-241. Vogt, G., Tolley, L., Scholtz, G., 2004. Life stages and reproductive components of the Marmokrebs (Marbled crayfish), the first parthenogenetic decapod crustacean. Journal of Morphology 261, 286-311. Vosloo, A., van Aardt, W.J., Mienie, L.J., 2002. Sublethal effects of copper on the freswater crab Potamonautes warreni . Comparative Biochemistry and Physiology 133, 695-702. Wallace, B.J., Guzewich, J.J., Cambridge, M., Altekruse, S., Morse, D.L., 1999. Seafood-associated disease outbreaks in New York, 19801994 American Journal of Preventive Medicine 17, 48-54. Warnken, J., Dunn, R.J.K., Teasdale, P.R., 2004. Investigation of recreational boats as a source of copper at anchorage sites using time-integrated diffusive gradients in thin film and sediment measurements. Marine Pollution Bulletin 49, 833-843. Watson, C., Yanong, R.P.E., 2006. Use of copper in freshwater aquaculture and farm ponds. Fact Sheet FA-13 Department of Fisheries and Aquatic Sciences, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida. Watters, M.R. 1995. Organic neurotoxins in seafoods. Clinical Neurology and Neurosurgery. 97, 119-124. White, S.L., Rainbow, P.S., 1985. On the metabolic requirements for copper and zinc in molluscs and crustaceans. Marine Environmental Research 16, 215-219. Whitten, T., Soeriaatmadja, R.E., Affif, S.A., 1996. The ecology of Java and Bali. The ecology of Indonesia series, Vol. II, Periplus, Singapore. WHO, 1987. Principles for the safety assessment of food additives and contaminants in food. Environmental Health Criteria 70. World Health Organization, Geneva. 147

WHO, 1998. Guidelines for drinking-water quality - second edition - volume 2 health criteria and other supporting information addendum. World Health Organization of the United Nations, Geneva. WHO, 2002. WHO Global strategy for food safety. Food Safety Department World Health Organization, Geneva. Widianarko, B., Verweij, R.A., van Gestel, C.A.M., van Straalen, N.M., 2000a. Spatial distribution of trace metals in sediments from urban streams of Semarang, Central Java, Indonesia. Ecotoxicology and Environmental Safety 46, 95-100. Widianarko, B., van Gestel, C.A.M., Verweij, R.A., van Straalen, N.M., 2000b. Associations between trace metals in sediment, water, and guppy, Poecilia reticula ta (Peters) from urban streams of Semarang Indonesia. Ecotoxicology and Environmental Safety 46, 101-107. Widmer, R., Oswald-Krapf, H., Sinha-Khetriwalb, D., Schnellmannc, M., Bonia, H., 2005. Global perspectives on e-waste. Environmental Impact Assessment Review 25, 436-458. Winner, R.W., 1985. Bioaccumulation and toxicity of copper as affected by interactions between humic acid and water hardness. Water Research 19, 449455. WWAP, 2000. Water pollution, environment degradation and disasters. World Water Assessment Programme. www.unwater.org/statistic_polu.html. (accessed 1 May, 2011). Yang, Z.B., Zhao, Y.L., Li, N., Yang, J., 2007. Effect of waterborne copper on the microstructures of gill and hepatopancreas in Eriocheir sinensis and its induction of metallothionein synthesis. Archives of Environmental Contamination and Toxicology 52, 222-228. Zevenhuizen, L.P.T.M., Dolfing, J., Eshuis, E.J., Scholten-Koerselman, I.J., 1979. Inhibitory effects of copper on bacteria related to the free ion concentration. Microbial Ecology 5, 139-146. Zhou, Q., Zhang, J., Fu, J., Shi, J., Jiang, G., 2008. Biomonitoring: an appealing tool for assessment of metal pollution in the aquatic ecosystem. Analytica Chemica Acta 606, 135-150. 148

Zia, S., Alikhan, M.A., 1989. Copper uptake and regulation in a coppertolerant decapod Cambarus bartoni (Fabricius) (Decapoda, Crustacea). Bulletin Environmental Contamination and Toxicology 42, 103-110.

149

150

Acknowledgement

151

When I recall, all the things associated with my studies in the department of Ecological Science, VU University Amsterdam, they were full of the miraculous works of God. After nearly five years of effort to achieve a scholarship for pursuing a PhD abroad, on September 2008 I finally won a three year full scholarship provided by the Indonesian government. Something that sounded impossible considering that Indonesia is a developing country that still is struggling to emerge from a long economical crisis. Completing a set of experiments and writing the thesis under a very tight schedule and relatively little time was another proof of the divine intervention of God. So, my first gratitude goes to Jesus Christ and Mother Mary for all the miraculous works, for turning the missions impossible into a reality, and for all the blessings I received throughout the three years and three months of my study in The Netherland. Also, I am truly appreciative of the Indonesian government, especially the Directorate General of Higher Education for providing a three years full scholarship for PhD study abroad with regards to improving my academic capabilities. I would like to express my deep gratitude to my promotors and copromotors, Prof. N.M. van Straalen (Nico), Prof. B. Widianarko (Pak Bud), Dr. C.A.M. van Gestel (Kees) and Dr. W.F.M. Rling (Wilfred) for the trust and exceptional opportunity considering that my educational background is in food science rather than in biology. I also express my sincere gratitude for their wonderful support throughout the years of my study. It was definitely an extraordinary good luck to have a combination of four magnificent professors! Nico and Pak Bud, both of you always came up with wise advise and strategic decisions. Your empathy and caring, from the beginning of my study, or actually long before any scholarship was available for me, that still exist until now is just expression of your genuine kindness. Nico, that was a

152

great experience to have you picked me up from the Schiphol airport and drive me by car to the FIC monastery Den Haag (a special housing arrangement where I stayed for the first three months in The Netherland). Pak Bud, I will never forget your willingness to guide me finding the shrimp ponds even when it was under a heavy tropical rain! For Kees, I am really grateful for the in depth mentoring you carried out in many ways, including a weekly discussion on the book entitle Metal contamination in aquatic environments. Your expertise on ecotoxicology combined with high accuracy, also your patience and indulgence gave me such confident and comfort on dealing with the toxicokinetic subject. The twice Christmas dinners, at the end 2009 and 2010, you arranged in your house in the Bilthoven were unforgettable moments! Wilfred, without your thoughtful guidance, constructive advice and keen interest, I would never have been able to complete the crucial topic of my thesis. Thank you so much for the kind offer of the Brock-Biology of microorganism book! I wish that there will be other opportunities for me to collaborate with each of you in the near future. Special thank to Dr. Ad Ragas, Dr. Ansje Lhr, Dr. Ir. Dick Roelofs, Dr. Michiel Rutgers and Prof. dr. Margot van Eck v.d. Sluijs van de Bor for spending valuable time, carefully reading, correcting and giving evaluation to this dissertation. I am thankful to Rudo Verweij for his genuine kindness and serious assistance, not only when dealing with the laboratory analysis, but also picking the crayfish up from the Alterra in Wageningen. Together with Janine, you revived my dormant-talent for pedalling a bicycle. Also, you provided a great help when I had to move from the Laan van Kronenburg

153

117 to the Bouwmeester 61 in Amstelveen. Rudo, I wish one of these days you will get a chance to visit UNIKA Semarang again; and for sure, I will bring you to the best food court in Semarang! I am also gratified to Dr. Ivo Roessink who provided the crayfish and critical reading of some chapters in this dissertation. I really appreciate Linda Klaver, a master student from the department of Health Science VU University, for her dedication and helpful collaboration on the experiments with crayfish. I also thank Jorke Kamstra for kind assistance on dealing with the Versamax plate reader. It was a great experience to get the opportunity to socialize with all member of the sub department of animal ecology, of course under an internationalwarm atmosphere. The professors and staffs (Prof. Jacintha Ellers, Prof.dr. Herman A. Verhoef, Dr. Dick Roelofs, Dr. Joris Koene, Dr. Gerard Driessen, Dr. Matty Berg and Dr. Toby Kiers), the former and current post-docs (Thierry Janssens, Roel Pel, Ben Nota, Tjalf de Broer, Andr Tavares Dias, Fernando Monroy and Wei Luo), the lab-technicians (Janine, Riet, Kora and Florrie), the PhD students, the guests, the master and the undergraduate students who were all friendly, kind and supportive just makes me simply homy. Also, I really thank the secretary of the department of Ecological Science, Desiree Hoonhoud and Karin, for their truly kind and hospitality. In particular, special thanks to Maria Diez Ortiz the angel of the hearth , Daniel Giesen the disseminator of the youth spirit , Ccile Le Lan the cheerful lady, Elferra Swart the big mama , Valentina Zizzari the Italian princes , also Masoud Ardestani, Pauline Kool, Yumi Nakadera, Elaine van Ommen Kloeke, Bertanne Visser, Erik Verbruggen, Yifu Pei and Marta Ferreira for friendship, kindness and caring. Further, I greatly appreciate the member of the molecular cell physiology group, especially

154

Suzana Dirieto, Raquel Vargas, Annachiara, James Weedon, Egia Zaura and Martin Braster for support. I would like to express my gratitude to the leadership of UNIKA Soegijapranata Semarang (Prof. Dr. Ir. Budi Widianarko; Ibu Theresia Dwi Hastuti, S.E., MSi., Akt.; Dr. Angelina Ika Rahutami, MSi., Benedictus Danang Setyanto, SH., LLM; also Ferdinandus Hindiarto, S.Psi, MSi) for their constant support. Also, I thank Lenny Setyowati and Susana Jawi for assistance on the administrative matters. My sincere thanks also to the members of Department of Food Technology UNIKA Soegijapranata: Ita Sulistyawati, Inneke Hantoro, Kristina Ananingsih, Kartika Puspa Dwiana, Lindayani, Laksmi Hartayani, Probo Yulianto, Retnaningsih, Rika Pratiwi, and Sumardi, also Roswari, Agus Waskito, Wati, Supriyana and Wartono for consideration and support. Also I would like to thank my colleagues: Yulita Titik, Octavianus Digdo and Marcella Elwina for the nice time in the IHS housing Den Haag. Special thanks for Tyas Susanty and Trihoni Nalesti Dewi, friends who were always supportive and kind. Last but not least, I would like to express my gratefulness to Felix Sholeh and pak Sondakh, for assistance on collecting sediments from the ten shrimp ponds. Mas Sholeh and pak Sondakh, without your help, I would never have been able to bring any sediment samples to The Netherlands! During my stay in the Netherlands, I enjoyed the Christmas 2009 in the FIC house in Maastricht and for the wonderful occasion, I am really grateful to Bruder Dr. Martinus Handoko the former Rector of UNIKA , Bruder Anton Hadiwardoyo, Bruder Guido and also Bruder Lou. I am so sorry Bruders, that during the last one and half year I was not able to visit the FIC house. I will never forget the nice warm house with special arrangement of

155

breakfast and supper! I also thank Alida Ruitinga for providing a cozy room in her house during the last seven months of my stay. Special thanks to Erryana Martati for the long term friendship and valuable sharing. Also for the authentic Indonesian cuisine you always provided everytime I visited your apartment in Bornsesteeg, Wageningen. I am so lucky to meet several Indonesian friends as the member of maksi-ma: Lia Auliaherliaty, Rully Adi Nugroho, mas Herman, Dessy Rahmawati, Enade and Romo Sunu Hardiyanto. Lia, without your help, I would never have a representative map of Semarang in my dissertation. I really enjoyed our friendship and I thank you very much for showing me many interesting spots of Amsterdam, Roermond and Lelystad. Pak Rully, thank you very much for all the smarttips and valuable sharing! Romo Sunu, I really thank you for letting me know a piece of the Jesuit techniques on dealing with negative emotions. Oom Bambang and Tante Ida, Oom Markoni and Tante Titin, I will never forget the celebration of the New Year 2010, which was full of Indonesian delicious menu! Furthermore, I express my sincere thanks to Ibu Widji Mardiningsih in Semarang, for her truly caring and deep hospitality since 1998 until now. For Hartati and Sandra sisters in the faith thank you very much for all the prayers. I missed the monthly devotion in Gua Maria Kerep Ambarawa for many times! Finally, I would like to convey my sincere gratitude to my parent, Bapak Ibu Atmawiyana in Yogyakarta, my brother Adi Santosa and my sister Felicitas Sumarmi for their everlasting supports, deep understanding, love and prayer. Last but not least, I would like to thank Michael J. McCann, the American partner in crime, for unconditional affection and support, for sharing the Irish inspiring prayer as well as showing the well-known pilgrimage sites in Europe.

156

Curriculum vitae Bernadeta Soedarini was born in Yogyakarta - Central Java, Indonesia on Sunday, February 4, 1968. Prior to starting her academic career in the Soegijapranata Catholic University (UNIKA) - Semarang in 1993, she completed all her formal education in Yogyakarta. In 1998, she earned a Master degree in Food Science and Technology from the Postgraduate Program, Gadjah Mada University - Yogyakarta. Further in 2001, she got an opportunity as a UNESCO fellow at the Osaka University, Japan and earned a diploma in Advance Microbiology in 2002. Following her UNESCO fellowship, she got a three years full scholarship from the Directorate General Higher Education of the Indonesian Government on September 2008; and she started her PhD degree at the Department of Ecological Science, Vrije Universiteit Amsterdam, the Netherlands. As of now, she is affiliated as a permanent lecturer in the Department of Food Technology, Faculty of Agricultural Technology, UNIKA Semarang, Indonesia. Amsterdam, October 2011

157