Fission yeast Pik1p is one of three phosphatidylinositol 4-kinases associated with the Golgi comp... more Fission yeast Pik1p is one of three phosphatidylinositol 4-kinases associated with the Golgi complex, but its function is not fully understood. Deletion of pot1 þ causes telomere degradation and chromosome circularization. We searched for the gene which becomes synthetically lethal with pot1D. We obtained a novel pik1 mutant, pik1-1, which is synthetically lethal with pot1D. We found phosphoinositol 4phosphate in the Golgi was reduced in pik1-1. To investigate the mechanism of the lethality of the pot1D pik1-1 double mutant, we constructed the nmt-pot1-aid pik1-1 strain, where Pot1 function becomes low by drugs, which leads to telomere loss and chromosome circularization, and found pik1-1 mutation does not affect telomere resection and chromosome circularization. Thus, our results suggest that pik1 þ is required for the maintenance of circular chromosomes.
Thymidine kinase converts 5-fluorodeoxyuridine to 5-fluorodeoxyuridine monophosphate, which cause... more Thymidine kinase converts 5-fluorodeoxyuridine to 5-fluorodeoxyuridine monophosphate, which causes disruption of deoxynucleotide triphosphate ratios. The fission yeast Schizo-saccharomyces pombe does not express endogenous thymidine kinase but 5-fluorodeox-yuridine inhibits growth when exogenous thymidine kinase is expressed. Unexpectedly, we found that 5-fluorodeoxyuridine causes S phase arrest even without thymidine kinase expression. DNA damage checkpoint proteins such as the 9-1-1 complex were required for viability in the presence of 5-fluorodeoxyuridine. We also found that strains with circular chromosomes, due to loss of pot1 + , which have higher levels of replication stress, were more sensitive to loss of the 9-1-1 complex in the presence of 5-fluorodeoxyuridine. Thus, our results suggest that strains carrying circular chromosomes exhibit a greater dependence on DNA damage checkpoints to ensure viability in the presence of 5-fluorodeoxyuridine compared to stains that have linear chromosomes.
Nutritional value of tea leaf waste was improved significantly (p<0.05) by solid-state fermentati... more Nutritional value of tea leaf waste was improved significantly (p<0.05) by solid-state fermentation for 8 weeks with a white rot fungus, Lentinus sajor-caju. The proximate analysis revealed that crude protein, ash, cellulose-lignin ratio and reducing sugar contents were increased by 2001.53, 117.62, 31.38, and 619.10%, respectively. In contrary, crude fiber, lipid, carbohydrate, lignin, cellulose and hemicelluloses contents were decreased by 40.70, 71.87, 47.65, 35.63, 15.26, and 61.03%, respectively. Ascorbic acid and carotenoids were also increased by 129.17 and 398.79%, respectively. At 7 weeks of fermentation, the crude tea leaf waste extract showed very high endoglucanase, exoglucanase, cellobiase and amylase activity, moderate pectinase and poor xylanase activity. Furthermore, In vitro dry matter digestibility was increased by 50.35% at the end of fermentation. Therefore, it was concluded that L. sajor-caju efficiently degraded tea leaf waste and improved its nutritive value.
This study was undertaken to improve nutritional values and digestibility of water-hyacinth by so... more This study was undertaken to improve nutritional values and digestibility of water-hyacinth by solid-state fermentation with a white rot fungi, Pleurotus sajor-caju. At the end of 56 days fermentation of CaCO3 treated water-hyacinth, significant (p<0.05) changes of crude protein, lipid, carbohydrate, ash, lignin, cellulose, hemicellulose, cellulose-lignin ratio and reducing sugar contents were detected. Crude protein, ash, cellulose-lignin ratio and reducing sugar contents were increased by 685, 47, 106 and 680%, respectively. In contrary, crude fiber, lipid, carbohydrate, lignin, cellulose and hemicelluloses contents were decreased by 36.8, 72, 19, 72.33, 37.5 and 4.57%, respectively. Ascorbic acid and carotenoid were increased by 42.9 and 122.8%, respectively. At 49 days of fermentation, the crude water-hyacinth extract showed very high CMCase, avicelase and amylase, moderate cellobiase and very poor pectinase and xylanase activities. In-vitro dry matter digestibility was also increased by 76%. The study concluded with the finding that P. sajor-caju has the potential for efficient degradation of water-hyacinth to convert the lignocellulosic wastes into nutritionally improved animal feed.
Background and Objective: An enormous amount of lignocellulosic materials are produced every year... more Background and Objective: An enormous amount of lignocellulosic materials are produced every year throughout the world which can be converted to nutritionally enriched ruminant feed by combination of chemical and biological treatment. This study was undertaken to improve nutritional values of lime treated coconut coir, a lignocellulosic material, by solid-state fermentation with Pleurotus sajor-caju. Methodology: The CaCO3 treated coconut coir was fermented with P. sajor-caju for 56 days at 30EC. Changes of crude protein, lipid, carbohydrate, ash, lignin, cellulose, hemicellulose, reducing sugar, ascorbic acid and carotinoid contents due to fermentation were detected using standard methods. Results: At the end of 56 days fermentation, crude protein, ash and reducing sugar contents were increased by 744.44, 55.61 and 113.80%, respectively. However, crude fiber, lipid, carbohydrate, lignin, cellulose and hemicelluloses contents were decreased by 33.04, 63.42, 20.94, 25.75, 18.57 and 24.42%, respectively. Ascorbic acid and carotenoid were increased by 63.18 and 580.49%, respectively. Conclusion: Thus, bioconversion of coconut coir by P. sajor-caju offers a promising way to convert the lignocellulosic wastes into nutritionally improved animal feed.
The aim of this study was to investigate the potential antidiabetic activity of Piper betle in al... more The aim of this study was to investigate the potential antidiabetic activity of Piper betle in alloxen induced diabetics. Rats were divided into 6 groups and Piper betle was administered containing 50, 100 and 200 mg/kgbwt powder, respectively in 1ml water orally in group A, B and C rats. Metformin (150 mg/kgbwt) used as a reference standard drug. Blood glucose (BG), triglycerides (TG), total cholesterol (TC), high density lipoproteins (HDL), low density lipoproteins (LDL), serum glutamate oxaloacetate transaminase (SGOT) and serum glutamate pyruvate transaminase (SGPT) were estimated from the serum by using standard kits. Piper betle juice had shown significant lowered the blood glucose levels in all groups. In addition, body weight, organ (liver, kidney, heart and pancreas) weight, food intake, water intake were also examined in all treated groups and compared against diabetic control group. After 22 days daily administration of Piper betle, diabetic treated rats showed improvement in body weight, water intake as compared to diabetic control rats. In alloxan induced diabetic rats the maximum reduction in BG, TG, TC, HDL, LDL, SGOT and SGPT were observed at a dose level of 100 mg/kgbwt. The result of this study demonstrates the potentiality of Piper betle juice as a source of an antidiabetic action that could be harness for use in the health care delivery process.
Vitex negundo L. (Nisinda locally), belongs to the family Verbenaceae, found almost everywhere in... more Vitex negundo L. (Nisinda locally), belongs to the family Verbenaceae, found almost everywhere in Bangladesh is a
medicinal aromatic shrub. Materials and Methods: An attempt was taken to its micropropagation from field-grown explants
(shoot-tip) in Murashige and Skoog medium fortified with various concentrations of phytohormones. Results: Experimentally, the best shoot induction was observed in full strength MS medium supplemented with BAP 1.0mg/L and Kin 0.5mg/L. However, 0.5mg/L IBA in half strength MS medium was enabled to induce 80% root initiation with the highest root number and longest shoot length. Well-developed roots were successfully subjected to hardening process and acclimatized.
Conclusion: Regenerated plantlets were same as the natural plants and showed 80.56% survival frequency with frisky and
seductive appearances without any abnormalities.
There are seven SIRT isoforms in mammals, with different biological activities including gene reg... more There are seven SIRT isoforms in mammals, with different biological activities including gene regulation, metabolism and apoptosis. Despite recent controversy about sirtuins function in some organisms, among them SIRT3 is the only sirtuin whose increased expression has been shown to correlate with an extended life span in humans. SIRT3 is a member of the sirtuin family of NAD+ dependent deacetylases, which is localized to the mitochondria and is enriched in kidney, brown adipose tissue, heart, and other metabolically active tissues. It is an endogenous negative regulator of cardiac hypertrophy, which protects hearts by suppressing cellular levels of ROS and modulates mitochondrial intermediary metabolism and fatty acid utilization during fasting. Another one, Hydrogen sulfide is produced within the human body, and relaxes the vascular endothelium and smooth muscle cells, which is important to maintaining clean arteries as one age. It functions as an antioxidant and inhibits expression of pro-inflammatory factors, all of which imply an important role in aging and age associated diseases. The aim of this review is to find out the anti aging properties of SIRT3 and H2S that can be used to extend the life span of human as a preventive and therapeutic agent.
The fruit fly, Drosophila melanogaster, has been used to analyze genetics, development, and signa... more The fruit fly, Drosophila melanogaster, has been used to analyze genetics, development, and signaling for nearly a century. About 60% of the genes that are believed to cause human disease have found to a recognizable match in the genetic code of the common fruit fly (Drosophila melanogaster), and 50% of Drosophila’s protein sequences are similar to those of mammals. Fruit flies are mostly used in disease analysis of human because their gene and protein similarities are included in an organism with only four pairs of chromosomes, the X/Y sex chromosomes and three autosomes, numbered 2, 3 and 4. The advantages of using Drosophila are that they breed and mature rapidly, are inexpensive and easy to grow, produce several hundred offspring per generation, and need very little space. The fruit fly is also an ideal candidate for human disease studies because simple mutations cause obvious phenotype differences and its genome map has been fully sequenced.
In the last few years, there has been an exponential growth in the field of herbal medicine and g... more In the last few years, there has been an exponential growth in the field of herbal medicine and gaining popularity both in developing and developed countries because of their natural origin and less side effects. A comprehensive review was conducted to pile up information about medicinal plants used for the treatment of diabetes mellitus. It is a metabolic disorder of the endocrine system and affecting nearly 10% of the population all over the world also the number of those affected is increasing day by day. The profiles presented include information about the scientific and family name, plant parts and test model used, the degree of hypoglycemic activity, and the active chemical agents. The large number of plants described in this review (108 plant species belonging to 56 families) clearly demonstrated the importance of herbal plants in the treatment of diabetes. The effects of these plants may delay the development of diabetic complications and correct the metabolic abnormalities. This work stimulates the researchers for further research on the potential use of medicinal plants having antidiabetic potential.
Type 2 diabetes (T2D) develops while the body can still produce insulin, but not enough, or when ... more Type 2 diabetes (T2D) develops while the body can still produce insulin, but not enough, or when the insulin produced doesn’t work properly. It has become a health-care problem worldwide, with the raise in disease prevalence being all the more worrying as it not only affects the developed world but also developing nations with fewer resources to cope with yet another major disease burden. Furthermore, the problem is no longer restricted to the ageing population, such as young adults and children are also being diagnosed with T2D. Genes play an important role in the development of diabetes mellitus. Type 2 diabetes is a polygenic disorder with multiple genes located on different chromosomes contributing to its susceptibility, including TCF7L2, KCNJ11, PPARG, ENPP1, Adiponectin, Calpain 10, PTPN1, CDKAL1, ABCC8, HNF4A, SLC2A2, UCP2, INS, PIK3R1 and SOS1 gene. The environmental factor (arsenic, pesticides, selenium, bisphenol A, phthalates and microorganism) also associated with Type 2 diabetes. Researchers found that taking proper exercise, vaccination against causing enterovirous, regulation of taking diet and keep away from smoking are the best away prevent from type 2 diabetes. This review aims to provide the link of causative factor to develop type 2 diabetes and search the possible away of prevention against type 2 diabetes.
Type 1 diabetes (T1D) is characterized by autoimmune destruction of insulin-producing β-cells in ... more Type 1 diabetes (T1D) is characterized by autoimmune destruction of insulin-producing β-cells in the pancreas, an organ in the abdomen, produces very little or no insulin caused by a complex interaction of genetic and environmental factors. Insulin is a hormone that helps the body to absorb and use glucose and other nutrients from food, store fat, and build up protein and without insulin, blood glucose (sugar) levels become higher than normal. The genetic factors involved consist of multiple susceptibility genes, at least five of which, HLA, INS, CTLA4, PTPN22 and IL2RA/CD25. The excess mortality associated with the complications of type 1 diabetes and the increasing incidence of childhood type 1 diabetes emphasize the importance of therapeutic strategies to prevent this chronic disorder. Although no current "cure" exists, recent genetic data and preliminary trial results suggest T cells as a target for preventive strategies. Another potentially attainable target is induction of tolerance to the ß-cell proteins such as insulin that are inappropriately recognized. Other strategies involve ß-cell replacement, but currently there are insufficient donor cells available. But researchers revealed that breastfeeding, taking proper exercise, vaccination against causing enterovirous, vitamin D, regulation of maternal diet and keep away from smoking are the best away prevent from type 1 diabetes. This review aims to provide the link of causing type 1 diabetes and the away of prevention to the type 1 diabetes patient.
In recent years, Aloe vera Linn. (Ghritokumari locally) has become a subject of interest because ... more In recent years, Aloe vera Linn. (Ghritokumari locally) has become a subject of interest because of its beneficial effects on human health. The present ethnopharmacological review was conducted to evaluate the therapeutic properties of A. vera by scientific evidences. It belongs to the family Liliaceae, is a perennial herb with 30-60cm long juicy leaves which is found all over Bangladesh. To date, more than 75 active ingredients including aloesin, aloeemodin, acemannan, aloeride, methylchromones, flavonoids, saponin, amino acids, vitamins, and minerals have been identified from inner gel of leaves. It has antiinflammatory, antioxidant, antimicrobial, anticancer, antidiabetic, immuneboosting, and hypoglycemic properties. Daily supplementation with this is effective against stroke, heart attacks, leukemia, anemia, hypertension, AIDS, radiation burns, digestive disorders etc. This study also covers its taxonomy, distribution, morphology, and monograph.
The petroleum spirit, methanol, dichloromethane and ethyl acetate extracts of the leaves of Tinos... more The petroleum spirit, methanol, dichloromethane and ethyl acetate extracts of the leaves of Tinospora cordifolia (Menispermaceae) were screened for their anti-microbial activity using disc-diffusion method on nutrient agar medium. This plant was tested against four bacteria; two Gram-positive bacteria (Bacillus subtilis and Sarcina lutea) and two Gram-negative bacteria (Escherichia coli and Klebsiella pneumoniae).All the organic solvent extract showed susceptibility against Sarcina lutea, E.coli and Bacillus subtilis whereas Klebsiella pneumoniae showed resistant against all the organic solvent extract. It was found that the antimicrobial activity of the methanol extract (11mm) showed the maximum zone of inhibition against Escherichia coli. On the other hand petroleum spirit extract showed the maximum inhibition against Bacillus subtilis (3mm) respectively. The minimum inhibitory concentration for petroleum spirit and dichloromethane extracts of Tinospora cordifolia were ranged between 32-512μg/mL for tested bacteria. The result of this study demonstrates the potentiality of Tinospora cordifolia as a source of antimicrobials that could be harness for use in the health care delivery process.
ABSTRACT: In order to determine the morphometric characterization and molecular identification of... more ABSTRACT: In order to determine the morphometric characterization and molecular identification of cattle in Bangladesh, three districts, i.e., Pabna, Bogra and Jhenidah were selected. In each district, 15 outstanding different crossbred and local dairy female cattle's (cows) blood samples (total 45) were collected to carry out the morphometric, productive and reproductive characters. These characters were observed to identify the genetic resources of cattle in the selected regions such as eye color, coat color, horn pattern, age, breed types, conception rate, litter size, milk production, lactation length, heat period and gestation period. The quantity of DNA were found to 198.30±14.10 µg/ml, 193.70±6.44 µg/ml and 196.88± 10.54 µg/ml in Pabna cattle , Jhenidah cattle and Bogra cattle respectively. The purity of DNA were also analyzed and observed 1.43 ± 0.25, 1.52 ±0.15 and 1.401 ±0.22 (ODs) in Pabna cattle, Bogra cattle and Jhenidah cattle accordingly. For RAPD experiment, nine primers were randomly tested to evaluate their suitability for amplification of the DNA sequences among these two were matched and found polymorphic, BMC-1222(CCTGAGTGTTCCTCCTGAGT) and OPB-07(GGTGACGCAG). By studying the different data it was found that the Pabna cattle gives more milk, meat and possess better genetic resources rather than other two districts like Bogra and Jhenidah. The RAPD profile of PCR amplification in this study can be a useful tool for detecting molecular diversity and genetic variation. Thus, these data give an accession or set of accessions and also helpful for germplasm conservation and improvement program of cattle in our country.
Fission yeast Pik1p is one of three phosphatidylinositol 4-kinases associated with the Golgi comp... more Fission yeast Pik1p is one of three phosphatidylinositol 4-kinases associated with the Golgi complex, but its function is not fully understood. Deletion of pot1 þ causes telomere degradation and chromosome circularization. We searched for the gene which becomes synthetically lethal with pot1D. We obtained a novel pik1 mutant, pik1-1, which is synthetically lethal with pot1D. We found phosphoinositol 4phosphate in the Golgi was reduced in pik1-1. To investigate the mechanism of the lethality of the pot1D pik1-1 double mutant, we constructed the nmt-pot1-aid pik1-1 strain, where Pot1 function becomes low by drugs, which leads to telomere loss and chromosome circularization, and found pik1-1 mutation does not affect telomere resection and chromosome circularization. Thus, our results suggest that pik1 þ is required for the maintenance of circular chromosomes.
Thymidine kinase converts 5-fluorodeoxyuridine to 5-fluorodeoxyuridine monophosphate, which cause... more Thymidine kinase converts 5-fluorodeoxyuridine to 5-fluorodeoxyuridine monophosphate, which causes disruption of deoxynucleotide triphosphate ratios. The fission yeast Schizo-saccharomyces pombe does not express endogenous thymidine kinase but 5-fluorodeox-yuridine inhibits growth when exogenous thymidine kinase is expressed. Unexpectedly, we found that 5-fluorodeoxyuridine causes S phase arrest even without thymidine kinase expression. DNA damage checkpoint proteins such as the 9-1-1 complex were required for viability in the presence of 5-fluorodeoxyuridine. We also found that strains with circular chromosomes, due to loss of pot1 + , which have higher levels of replication stress, were more sensitive to loss of the 9-1-1 complex in the presence of 5-fluorodeoxyuridine. Thus, our results suggest that strains carrying circular chromosomes exhibit a greater dependence on DNA damage checkpoints to ensure viability in the presence of 5-fluorodeoxyuridine compared to stains that have linear chromosomes.
Nutritional value of tea leaf waste was improved significantly (p<0.05) by solid-state fermentati... more Nutritional value of tea leaf waste was improved significantly (p<0.05) by solid-state fermentation for 8 weeks with a white rot fungus, Lentinus sajor-caju. The proximate analysis revealed that crude protein, ash, cellulose-lignin ratio and reducing sugar contents were increased by 2001.53, 117.62, 31.38, and 619.10%, respectively. In contrary, crude fiber, lipid, carbohydrate, lignin, cellulose and hemicelluloses contents were decreased by 40.70, 71.87, 47.65, 35.63, 15.26, and 61.03%, respectively. Ascorbic acid and carotenoids were also increased by 129.17 and 398.79%, respectively. At 7 weeks of fermentation, the crude tea leaf waste extract showed very high endoglucanase, exoglucanase, cellobiase and amylase activity, moderate pectinase and poor xylanase activity. Furthermore, In vitro dry matter digestibility was increased by 50.35% at the end of fermentation. Therefore, it was concluded that L. sajor-caju efficiently degraded tea leaf waste and improved its nutritive value.
This study was undertaken to improve nutritional values and digestibility of water-hyacinth by so... more This study was undertaken to improve nutritional values and digestibility of water-hyacinth by solid-state fermentation with a white rot fungi, Pleurotus sajor-caju. At the end of 56 days fermentation of CaCO3 treated water-hyacinth, significant (p<0.05) changes of crude protein, lipid, carbohydrate, ash, lignin, cellulose, hemicellulose, cellulose-lignin ratio and reducing sugar contents were detected. Crude protein, ash, cellulose-lignin ratio and reducing sugar contents were increased by 685, 47, 106 and 680%, respectively. In contrary, crude fiber, lipid, carbohydrate, lignin, cellulose and hemicelluloses contents were decreased by 36.8, 72, 19, 72.33, 37.5 and 4.57%, respectively. Ascorbic acid and carotenoid were increased by 42.9 and 122.8%, respectively. At 49 days of fermentation, the crude water-hyacinth extract showed very high CMCase, avicelase and amylase, moderate cellobiase and very poor pectinase and xylanase activities. In-vitro dry matter digestibility was also increased by 76%. The study concluded with the finding that P. sajor-caju has the potential for efficient degradation of water-hyacinth to convert the lignocellulosic wastes into nutritionally improved animal feed.
Background and Objective: An enormous amount of lignocellulosic materials are produced every year... more Background and Objective: An enormous amount of lignocellulosic materials are produced every year throughout the world which can be converted to nutritionally enriched ruminant feed by combination of chemical and biological treatment. This study was undertaken to improve nutritional values of lime treated coconut coir, a lignocellulosic material, by solid-state fermentation with Pleurotus sajor-caju. Methodology: The CaCO3 treated coconut coir was fermented with P. sajor-caju for 56 days at 30EC. Changes of crude protein, lipid, carbohydrate, ash, lignin, cellulose, hemicellulose, reducing sugar, ascorbic acid and carotinoid contents due to fermentation were detected using standard methods. Results: At the end of 56 days fermentation, crude protein, ash and reducing sugar contents were increased by 744.44, 55.61 and 113.80%, respectively. However, crude fiber, lipid, carbohydrate, lignin, cellulose and hemicelluloses contents were decreased by 33.04, 63.42, 20.94, 25.75, 18.57 and 24.42%, respectively. Ascorbic acid and carotenoid were increased by 63.18 and 580.49%, respectively. Conclusion: Thus, bioconversion of coconut coir by P. sajor-caju offers a promising way to convert the lignocellulosic wastes into nutritionally improved animal feed.
The aim of this study was to investigate the potential antidiabetic activity of Piper betle in al... more The aim of this study was to investigate the potential antidiabetic activity of Piper betle in alloxen induced diabetics. Rats were divided into 6 groups and Piper betle was administered containing 50, 100 and 200 mg/kgbwt powder, respectively in 1ml water orally in group A, B and C rats. Metformin (150 mg/kgbwt) used as a reference standard drug. Blood glucose (BG), triglycerides (TG), total cholesterol (TC), high density lipoproteins (HDL), low density lipoproteins (LDL), serum glutamate oxaloacetate transaminase (SGOT) and serum glutamate pyruvate transaminase (SGPT) were estimated from the serum by using standard kits. Piper betle juice had shown significant lowered the blood glucose levels in all groups. In addition, body weight, organ (liver, kidney, heart and pancreas) weight, food intake, water intake were also examined in all treated groups and compared against diabetic control group. After 22 days daily administration of Piper betle, diabetic treated rats showed improvement in body weight, water intake as compared to diabetic control rats. In alloxan induced diabetic rats the maximum reduction in BG, TG, TC, HDL, LDL, SGOT and SGPT were observed at a dose level of 100 mg/kgbwt. The result of this study demonstrates the potentiality of Piper betle juice as a source of an antidiabetic action that could be harness for use in the health care delivery process.
Vitex negundo L. (Nisinda locally), belongs to the family Verbenaceae, found almost everywhere in... more Vitex negundo L. (Nisinda locally), belongs to the family Verbenaceae, found almost everywhere in Bangladesh is a
medicinal aromatic shrub. Materials and Methods: An attempt was taken to its micropropagation from field-grown explants
(shoot-tip) in Murashige and Skoog medium fortified with various concentrations of phytohormones. Results: Experimentally, the best shoot induction was observed in full strength MS medium supplemented with BAP 1.0mg/L and Kin 0.5mg/L. However, 0.5mg/L IBA in half strength MS medium was enabled to induce 80% root initiation with the highest root number and longest shoot length. Well-developed roots were successfully subjected to hardening process and acclimatized.
Conclusion: Regenerated plantlets were same as the natural plants and showed 80.56% survival frequency with frisky and
seductive appearances without any abnormalities.
There are seven SIRT isoforms in mammals, with different biological activities including gene reg... more There are seven SIRT isoforms in mammals, with different biological activities including gene regulation, metabolism and apoptosis. Despite recent controversy about sirtuins function in some organisms, among them SIRT3 is the only sirtuin whose increased expression has been shown to correlate with an extended life span in humans. SIRT3 is a member of the sirtuin family of NAD+ dependent deacetylases, which is localized to the mitochondria and is enriched in kidney, brown adipose tissue, heart, and other metabolically active tissues. It is an endogenous negative regulator of cardiac hypertrophy, which protects hearts by suppressing cellular levels of ROS and modulates mitochondrial intermediary metabolism and fatty acid utilization during fasting. Another one, Hydrogen sulfide is produced within the human body, and relaxes the vascular endothelium and smooth muscle cells, which is important to maintaining clean arteries as one age. It functions as an antioxidant and inhibits expression of pro-inflammatory factors, all of which imply an important role in aging and age associated diseases. The aim of this review is to find out the anti aging properties of SIRT3 and H2S that can be used to extend the life span of human as a preventive and therapeutic agent.
The fruit fly, Drosophila melanogaster, has been used to analyze genetics, development, and signa... more The fruit fly, Drosophila melanogaster, has been used to analyze genetics, development, and signaling for nearly a century. About 60% of the genes that are believed to cause human disease have found to a recognizable match in the genetic code of the common fruit fly (Drosophila melanogaster), and 50% of Drosophila’s protein sequences are similar to those of mammals. Fruit flies are mostly used in disease analysis of human because their gene and protein similarities are included in an organism with only four pairs of chromosomes, the X/Y sex chromosomes and three autosomes, numbered 2, 3 and 4. The advantages of using Drosophila are that they breed and mature rapidly, are inexpensive and easy to grow, produce several hundred offspring per generation, and need very little space. The fruit fly is also an ideal candidate for human disease studies because simple mutations cause obvious phenotype differences and its genome map has been fully sequenced.
In the last few years, there has been an exponential growth in the field of herbal medicine and g... more In the last few years, there has been an exponential growth in the field of herbal medicine and gaining popularity both in developing and developed countries because of their natural origin and less side effects. A comprehensive review was conducted to pile up information about medicinal plants used for the treatment of diabetes mellitus. It is a metabolic disorder of the endocrine system and affecting nearly 10% of the population all over the world also the number of those affected is increasing day by day. The profiles presented include information about the scientific and family name, plant parts and test model used, the degree of hypoglycemic activity, and the active chemical agents. The large number of plants described in this review (108 plant species belonging to 56 families) clearly demonstrated the importance of herbal plants in the treatment of diabetes. The effects of these plants may delay the development of diabetic complications and correct the metabolic abnormalities. This work stimulates the researchers for further research on the potential use of medicinal plants having antidiabetic potential.
Type 2 diabetes (T2D) develops while the body can still produce insulin, but not enough, or when ... more Type 2 diabetes (T2D) develops while the body can still produce insulin, but not enough, or when the insulin produced doesn’t work properly. It has become a health-care problem worldwide, with the raise in disease prevalence being all the more worrying as it not only affects the developed world but also developing nations with fewer resources to cope with yet another major disease burden. Furthermore, the problem is no longer restricted to the ageing population, such as young adults and children are also being diagnosed with T2D. Genes play an important role in the development of diabetes mellitus. Type 2 diabetes is a polygenic disorder with multiple genes located on different chromosomes contributing to its susceptibility, including TCF7L2, KCNJ11, PPARG, ENPP1, Adiponectin, Calpain 10, PTPN1, CDKAL1, ABCC8, HNF4A, SLC2A2, UCP2, INS, PIK3R1 and SOS1 gene. The environmental factor (arsenic, pesticides, selenium, bisphenol A, phthalates and microorganism) also associated with Type 2 diabetes. Researchers found that taking proper exercise, vaccination against causing enterovirous, regulation of taking diet and keep away from smoking are the best away prevent from type 2 diabetes. This review aims to provide the link of causative factor to develop type 2 diabetes and search the possible away of prevention against type 2 diabetes.
Type 1 diabetes (T1D) is characterized by autoimmune destruction of insulin-producing β-cells in ... more Type 1 diabetes (T1D) is characterized by autoimmune destruction of insulin-producing β-cells in the pancreas, an organ in the abdomen, produces very little or no insulin caused by a complex interaction of genetic and environmental factors. Insulin is a hormone that helps the body to absorb and use glucose and other nutrients from food, store fat, and build up protein and without insulin, blood glucose (sugar) levels become higher than normal. The genetic factors involved consist of multiple susceptibility genes, at least five of which, HLA, INS, CTLA4, PTPN22 and IL2RA/CD25. The excess mortality associated with the complications of type 1 diabetes and the increasing incidence of childhood type 1 diabetes emphasize the importance of therapeutic strategies to prevent this chronic disorder. Although no current "cure" exists, recent genetic data and preliminary trial results suggest T cells as a target for preventive strategies. Another potentially attainable target is induction of tolerance to the ß-cell proteins such as insulin that are inappropriately recognized. Other strategies involve ß-cell replacement, but currently there are insufficient donor cells available. But researchers revealed that breastfeeding, taking proper exercise, vaccination against causing enterovirous, vitamin D, regulation of maternal diet and keep away from smoking are the best away prevent from type 1 diabetes. This review aims to provide the link of causing type 1 diabetes and the away of prevention to the type 1 diabetes patient.
In recent years, Aloe vera Linn. (Ghritokumari locally) has become a subject of interest because ... more In recent years, Aloe vera Linn. (Ghritokumari locally) has become a subject of interest because of its beneficial effects on human health. The present ethnopharmacological review was conducted to evaluate the therapeutic properties of A. vera by scientific evidences. It belongs to the family Liliaceae, is a perennial herb with 30-60cm long juicy leaves which is found all over Bangladesh. To date, more than 75 active ingredients including aloesin, aloeemodin, acemannan, aloeride, methylchromones, flavonoids, saponin, amino acids, vitamins, and minerals have been identified from inner gel of leaves. It has antiinflammatory, antioxidant, antimicrobial, anticancer, antidiabetic, immuneboosting, and hypoglycemic properties. Daily supplementation with this is effective against stroke, heart attacks, leukemia, anemia, hypertension, AIDS, radiation burns, digestive disorders etc. This study also covers its taxonomy, distribution, morphology, and monograph.
The petroleum spirit, methanol, dichloromethane and ethyl acetate extracts of the leaves of Tinos... more The petroleum spirit, methanol, dichloromethane and ethyl acetate extracts of the leaves of Tinospora cordifolia (Menispermaceae) were screened for their anti-microbial activity using disc-diffusion method on nutrient agar medium. This plant was tested against four bacteria; two Gram-positive bacteria (Bacillus subtilis and Sarcina lutea) and two Gram-negative bacteria (Escherichia coli and Klebsiella pneumoniae).All the organic solvent extract showed susceptibility against Sarcina lutea, E.coli and Bacillus subtilis whereas Klebsiella pneumoniae showed resistant against all the organic solvent extract. It was found that the antimicrobial activity of the methanol extract (11mm) showed the maximum zone of inhibition against Escherichia coli. On the other hand petroleum spirit extract showed the maximum inhibition against Bacillus subtilis (3mm) respectively. The minimum inhibitory concentration for petroleum spirit and dichloromethane extracts of Tinospora cordifolia were ranged between 32-512μg/mL for tested bacteria. The result of this study demonstrates the potentiality of Tinospora cordifolia as a source of antimicrobials that could be harness for use in the health care delivery process.
ABSTRACT: In order to determine the morphometric characterization and molecular identification of... more ABSTRACT: In order to determine the morphometric characterization and molecular identification of cattle in Bangladesh, three districts, i.e., Pabna, Bogra and Jhenidah were selected. In each district, 15 outstanding different crossbred and local dairy female cattle's (cows) blood samples (total 45) were collected to carry out the morphometric, productive and reproductive characters. These characters were observed to identify the genetic resources of cattle in the selected regions such as eye color, coat color, horn pattern, age, breed types, conception rate, litter size, milk production, lactation length, heat period and gestation period. The quantity of DNA were found to 198.30±14.10 µg/ml, 193.70±6.44 µg/ml and 196.88± 10.54 µg/ml in Pabna cattle , Jhenidah cattle and Bogra cattle respectively. The purity of DNA were also analyzed and observed 1.43 ± 0.25, 1.52 ±0.15 and 1.401 ±0.22 (ODs) in Pabna cattle, Bogra cattle and Jhenidah cattle accordingly. For RAPD experiment, nine primers were randomly tested to evaluate their suitability for amplification of the DNA sequences among these two were matched and found polymorphic, BMC-1222(CCTGAGTGTTCCTCCTGAGT) and OPB-07(GGTGACGCAG). By studying the different data it was found that the Pabna cattle gives more milk, meat and possess better genetic resources rather than other two districts like Bogra and Jhenidah. The RAPD profile of PCR amplification in this study can be a useful tool for detecting molecular diversity and genetic variation. Thus, these data give an accession or set of accessions and also helpful for germplasm conservation and improvement program of cattle in our country.
Uploads
Papers by Dr. Mohammad Shamim Hossain
which can be converted to nutritionally enriched ruminant feed by combination of chemical and biological treatment. This study was
undertaken to improve nutritional values of lime treated coconut coir, a lignocellulosic material, by solid-state fermentation with
Pleurotus sajor-caju. Methodology: The CaCO3 treated coconut coir was fermented with P. sajor-caju for 56 days at 30EC. Changes
of crude protein, lipid, carbohydrate, ash, lignin, cellulose, hemicellulose, reducing sugar, ascorbic acid and carotinoid contents due to
fermentation were detected using standard methods. Results: At the end of 56 days fermentation, crude protein, ash and reducing sugar
contents were increased by 744.44, 55.61 and 113.80%, respectively. However, crude fiber, lipid, carbohydrate, lignin, cellulose and
hemicelluloses contents were decreased by 33.04, 63.42, 20.94, 25.75, 18.57 and 24.42%, respectively. Ascorbic acid and carotenoid
were increased by 63.18 and 580.49%, respectively. Conclusion: Thus, bioconversion of coconut coir by P. sajor-caju offers a promising
way to convert the lignocellulosic wastes into nutritionally improved animal feed.
medicinal aromatic shrub. Materials and Methods: An attempt was taken to its micropropagation from field-grown explants
(shoot-tip) in Murashige and Skoog medium fortified with various concentrations of phytohormones. Results: Experimentally, the best shoot induction was observed in full strength MS medium supplemented with BAP 1.0mg/L and Kin 0.5mg/L. However, 0.5mg/L IBA in half strength MS medium was enabled to induce 80% root initiation with the highest root number and longest shoot length. Well-developed roots were successfully subjected to hardening process and acclimatized.
Conclusion: Regenerated plantlets were same as the natural plants and showed 80.56% survival frequency with frisky and
seductive appearances without any abnormalities.
of herbal plants in the treatment of diabetes. The effects of these plants may delay the development of diabetic complications and correct the metabolic abnormalities. This work stimulates the researchers for further research on the potential use of medicinal plants having antidiabetic potential.
(Menispermaceae) were screened for their anti-microbial activity using disc-diffusion method on nutrient agar
medium. This plant was tested against four bacteria; two Gram-positive bacteria (Bacillus subtilis and Sarcina
lutea) and two Gram-negative bacteria (Escherichia coli and Klebsiella pneumoniae).All the organic solvent
extract showed susceptibility against Sarcina lutea, E.coli and Bacillus subtilis whereas Klebsiella pneumoniae
showed resistant against all the organic solvent extract. It was found that the antimicrobial activity of the
methanol extract (11mm) showed the maximum zone of inhibition against Escherichia coli. On the other hand
petroleum spirit extract showed the maximum inhibition against Bacillus subtilis (3mm) respectively. The
minimum inhibitory concentration for petroleum spirit and dichloromethane extracts of Tinospora cordifolia
were ranged between 32-512μg/mL for tested bacteria. The result of this study demonstrates the potentiality of
Tinospora cordifolia as a source of antimicrobials that could be harness for use in the health care delivery
process.
which can be converted to nutritionally enriched ruminant feed by combination of chemical and biological treatment. This study was
undertaken to improve nutritional values of lime treated coconut coir, a lignocellulosic material, by solid-state fermentation with
Pleurotus sajor-caju. Methodology: The CaCO3 treated coconut coir was fermented with P. sajor-caju for 56 days at 30EC. Changes
of crude protein, lipid, carbohydrate, ash, lignin, cellulose, hemicellulose, reducing sugar, ascorbic acid and carotinoid contents due to
fermentation were detected using standard methods. Results: At the end of 56 days fermentation, crude protein, ash and reducing sugar
contents were increased by 744.44, 55.61 and 113.80%, respectively. However, crude fiber, lipid, carbohydrate, lignin, cellulose and
hemicelluloses contents were decreased by 33.04, 63.42, 20.94, 25.75, 18.57 and 24.42%, respectively. Ascorbic acid and carotenoid
were increased by 63.18 and 580.49%, respectively. Conclusion: Thus, bioconversion of coconut coir by P. sajor-caju offers a promising
way to convert the lignocellulosic wastes into nutritionally improved animal feed.
medicinal aromatic shrub. Materials and Methods: An attempt was taken to its micropropagation from field-grown explants
(shoot-tip) in Murashige and Skoog medium fortified with various concentrations of phytohormones. Results: Experimentally, the best shoot induction was observed in full strength MS medium supplemented with BAP 1.0mg/L and Kin 0.5mg/L. However, 0.5mg/L IBA in half strength MS medium was enabled to induce 80% root initiation with the highest root number and longest shoot length. Well-developed roots were successfully subjected to hardening process and acclimatized.
Conclusion: Regenerated plantlets were same as the natural plants and showed 80.56% survival frequency with frisky and
seductive appearances without any abnormalities.
of herbal plants in the treatment of diabetes. The effects of these plants may delay the development of diabetic complications and correct the metabolic abnormalities. This work stimulates the researchers for further research on the potential use of medicinal plants having antidiabetic potential.
(Menispermaceae) were screened for their anti-microbial activity using disc-diffusion method on nutrient agar
medium. This plant was tested against four bacteria; two Gram-positive bacteria (Bacillus subtilis and Sarcina
lutea) and two Gram-negative bacteria (Escherichia coli and Klebsiella pneumoniae).All the organic solvent
extract showed susceptibility against Sarcina lutea, E.coli and Bacillus subtilis whereas Klebsiella pneumoniae
showed resistant against all the organic solvent extract. It was found that the antimicrobial activity of the
methanol extract (11mm) showed the maximum zone of inhibition against Escherichia coli. On the other hand
petroleum spirit extract showed the maximum inhibition against Bacillus subtilis (3mm) respectively. The
minimum inhibitory concentration for petroleum spirit and dichloromethane extracts of Tinospora cordifolia
were ranged between 32-512μg/mL for tested bacteria. The result of this study demonstrates the potentiality of
Tinospora cordifolia as a source of antimicrobials that could be harness for use in the health care delivery
process.