Phylogenetic relationships in Seslerieae (Poaceae) including resurrection of Psilathera and Sesleriella , two monotypic genera endemic to the Alps

Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Phylogenetic relationships in Seslerieae (Poaceae) including resurrection of Psilathera and Sesleriella, two monotypic genera endemic to the Alps Nevena Kuzmanović,1* Dmitar Lakušić,1* Božo Frajman,2 Antun Alegro3 & Peter Schönswetter2 1 Institute of Botany and Botanical Garden, Faculty of Biology, University of Belgrade, Takovska 43, 11000 Belgrade, Serbia 2 Institute of Botany, University of Innsbruck, Sternwartestraße 15, 6020 Innsbruck, Austria 3 Department of Botany, Faculty of Science, University of Zagreb, Marulićev trg 20/II, 10000 Zagreb, Croatia * Contributed equally to this work Authors for correspondence: Nevena Kuzmanović, nkuzmanovic@bio.bg.ac.rs; Dmitar Lakušić, dlakusic@bio.bg.ac.rs ORCID NK, http://orcid.org/0000-0003-3463-5541; DL, http://orcid.org/0000-0001-6708-6652; BF, http://orcid.org/0000-0002-3667-1135; AA, http://orcid.org/0000-0001-6193-2395; PS, http://orcid.org/0000-0001-9225-4566 DOI https://doi.org/10.12705/666.5 Abstract Sesleria (Poaceae) is a species-rich, taxonomically difficult genus due to high morpho-anatomical variability and weak differentiation of many species. It is distributed throughout western Eurasia and North Africa with highest taxonomic diversity on the Balkan Peninsula. Of the more than 40 species only two are diploid, all others are tetra- to dodecaploid, and many species comprise several ploidy cytotypes. We sequenced the plastid trnL-ndhF region and produced amplified fragment length polymorphisms (AFLPs) from a comprehensive, ploidy-cytotyped sampling including 292 populations, and produced nuclear ribosomal internal transcribed spacer (ITS) sequences for a subsample. Our first aim was to determine the relationships among Sesleria and putatively closely related genera. Further, we explored whether diploid S. sphaerocephala and S. ovata should be treated as separate genera Sesleriella and Psilathera as proposed previously, or rather included in Sesleria, following most recent Floras. Finally, we tested previous hypotheses of infrageneric classifications. In the ITS phylogeny tetra- to dodecaploid Sesleria s.str. grouped with diploid S. ovata whereas diploid S. sphaerocephala was more distantly related. In contrast, in the plastid phylogeny Sesleria s.str. grouped with S. sphaerocephala, whereas S. ovata was sister to Echinaria. This suggests an allopolyploid origin of Sesleria s.str. with S. sphaerocephala acting as maternal and S. ovata as paternal species. The lack of monophyly of Sesleria s.l. thus supports the recognition of S. ovata and S. sphaerocephala as separate genera Psilathera and Sesleriella. Their segregation, which is also supported by morphology, increases the number of angiosperm genera endemic to the European Alps from three to five. In congruence with the plastid sequences, AFLPs resolved the traditionally recognized sections (sect. Argenteae, sect. Sesleria) as non-overlapping clusters and identified S. vaginalis as a probably recently evolved intersectional hybrid. Within the two sections, several informal species groups could be recognized, which show limited congruence with those proposed in the most comprehensive taxonomic treatment of the genus. From an evolutionary point of view it is obvious that ancient as well as recent hybridization coupled with polyploidisation have played a crucial role in diversification within Sesleria. Keywords Alps; Balkan Peninsula; hybridisation; monotypic genus; polyploidy; Sesleria Supplementary Material The Electronic Supplement (Table S1; Figs. S1, S2) and DNA sequence alignments are available in the Supplementary Data section of the online version of this article (http://www.ingentaconnect.com/content/iapt/tax) INTRODUCTION The genus Sesleria Scop. (Poaceae) is taxonomically intricate (Clayton & Renvoize, 1986) and various authors have suggested differing numbers of species (Deyl, 1980: 27 spp.; Strgar, 1981: 33 spp.; Valdés & Scholz, 2009: 32 spp.). Several species have been described recently (e.g., S. rhodopaea Tashev & D.Dimitrov; Tashev & Dimitrov, 2012) and so far the status of only a few taxa was clarified using molecular phylogenies (e.g., Kuzmanović & al., 2013a). The genus is distributed from Spain in the west to the Caucasus and Iran in the east, and from Iceland and Scandinavia in the north to Libya and Lebanon in the south. Its diversity centre is the Balkan Peninsula, but also the Italian Peninsula is species-rich (Deyl, 1946; Ujhelyi, 1965). The Alps were suggested to be the genus’ centre of origin (Deyl, 1946) since the only diploid representatives, S. sphaero­ cephala Ard. (including S. leucocephala DC., see below) and S. ovata (Hoppe) A.Kern., are restricted to this mountain range (Lazarević & al., 2015); reports of diploids from Bulgaria (Kožuharov & Petrova, 1991; Petrova, 2000) are erroneous (Kuzmanović & Schönswetter, 2016). In the same line, the putatively most closely related genus Oreochloa Link occurs in the Alps, the Pyrenees and the Carpathians (Deyl, 1980). Both genera were, sometimes together with Ammochloa Boiss. Received: 31 Jan 2017 | returned for (first) revision: 16 Apr 2017 | (last) revision received: 24 Jul 2017 | accepted: 25 Jul 2017 || publication date(s): online fast track, 30 Nov 2017; in print and online issues, 22 Dec 2017 || © International Association for Plant Taxonomy (IAPT) 2017 Version of Record 1349 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 and Echinaria Desf., classified in tribe Seslerieae (Quintanar & al., 2007). In recent decades, phylogenetic studies have helped clarify the evolutionary relationships within subfamily Pooideae (Soreng & al., 1990; Davis & Soreng, 1993; Hsiao & al., 1994; Nadot & al., 1994; Catalan & al., 1997; Grass Phylogeny Working Group, 2001). However, some relationships are still debated, for instance the placement of tribe Seslerieae with respect to Aveneae and Poeae (see, e.g., Soreng & Davis, 1998; Catalán & al., 2004; Quintanar & al., 2007; Soreng & al., 2007; Saarela & al., 2010). The molecular studies including single or a few representatives of Sesleria (Soreng & Davis, 2000 – S. insularis Somm.; Catalan & al., 2004 – S. argentea (Savi) Savi; Quintanar & al., 2007 – S. caerulea (L.) Ard. and S. argentea; Gillespie & al., 2008 – S. insularis; Schneider & al., 2009 – S. argentea, S. insularis and S. ovata; Saarela & al., 2010 – S. caerulea and S. argentea; Hochbach & al., 2015 – S. sphaerocephala) resolved conflicting relationships with Aveneae and Poeae dependent on whether nuclear or plastid data were analysed, suggesting that Seslerieae (including Mibora Adans.) might be of hybrid origin (Quintanar & al., 2007; Gillespie & al., 2008). Although these studies have not fully resolved the position of Seslerieae within “core” Pooideae, they have undoubtedly shown that Sesleria and Oreochloa belong to Seslerieae. The relationships of Echinaria and Ammochloa with Oreochloa and Sesleria were resolved differently. Based on plastid trnT-trnF sequences, Mibora and Oreochloa together formed the sister group to S. argentea and S. caerulea within the Seslerieae lineage, and the Mediterranean annual Echinaria was their consecutive sister. The Seslerieae lineage was sister to Parapholiinae and Cynosurineae within the Poeae clade. In the ITS dataset relationships remained unresolved; the Seslerieae lineage was closely related to Aveninae of the core Aveneae clade (Quintanar & al., 2007). Similar relationships as suggested by trnT-trnF were resolved by plastid matK-trnK sequences. In contrast, concatenated low-copy nuclear sequences resolved Echinaria and S. sphaerocephala as sister to Briza media L. (Hochbach & al., 2015). In the ITS and plastid datasets Briza media, which is also morphologically divergent, was positioned in a separate clade within core Aveneae, but rather distant to Seslerieae (Quintanar & al., 2007). Based on the incongruences, Quintanar & al. (2007) called for further analyses including more samples from Seslerieae and presumably closely related genera to clarify their relationships to Aveneae and Poeae. Miloš Deyl (1906–1985), the eminent authority for the taxonomy of Sesleria, provided a classification and detailed descriptions of the representatives of Sesleria and Oreochloa in the monograph “Study of the genus Sesleria” (Deyl, 1946), the single monographic work encompassing the entire genus. An important change between Deyl’s early (Deyl, 1946) and later (Deyl, 1980) views concerns the taxonomic status of the diploid species S. ovata and S. sphaerocephala. He initially treated them as separate genera Psilathera Link and Sesleriella Deyl, but later included them in Sesleria, a concept followed by almost all later authors (e.g., Conert, 1992; Watson & Dallwitz, 1992; Jogan, 2007; Fischer & al., 2008; Valdés & Scholz, 2009). Within Sesleria s.str. (i.e., excluding Psilathera and Sesleriella) 1350 Deyl (1946) suggested species groups (referred to by him as “turmae”) based on morpho-anatomical and ecological traits, which he classified in the two sections S. sect. Argenteae Deyl and S. sect. “Calcariae” Deyl; the correct name of the latter is, however, S. sect. Sesleria as noted by Lazarević & al. (2015). Members of S. sect. Argenteae differ from S. sect. Sesleria by later flowering time, thicker spikes, mostly glabrous leaves, lemmas and paleas, as well as by the presence of a long and acute uppermost culm leaf. Within S. sect. Argenteae Deyl (1946) distinguished “argentea” and “nitida” groups, and within S. sect. Sesleria “calcaria”, “coerulans”, “phleoides”, “rigida” and “uliginosa” groups. The taxonomic intricacy of Sesleria likely relates to the frequent occurrence of hybridisation and polyploidy within the genus (Deyl, 1946). Tetraploids (2n = 4x = 28) are most frequent, followed by octoploids (2n = 8x = 56, e.g., Strgar, 1979; Lysak & Doležel, 1998; Petrova, 2000; Budžakova & al., 2014; Lazarević & al., 2015), whereas dodecaploids (2n = 12x = 84) are rare and have been reported for only three species from southern Italy and Albania (Di Pietro & al., 2005; Lazarević & al., 2015). Deyl (1946) hypothesized a hybrid origin of many species, for instance S. kalnikensis Jáv. (S. juncifolia s.l. × S. caerulea). Moreover, he suggested that when two species come into contact, forms with intermediate morphological characters could appear. Despite a number of contributions carried out from the late 1930s onwards (Ujhelyi, 1938, 1940, 1959a, b, 1960, 1965; Deyl, 1946; Ujhelyi & Felföldy, 1948; Strgar, 1966, 1968, 1973, 1979, 1980, 1981, 1982, 1985, 1988, 1990; Lysák & al., 1997, 2000; Lysák & Doležel, 1998; Foggi & al., 2001, 2007; Reisch & al., 2003; Di Pietro & al., 2005; Alegro, 2007; Di Pietro, 2007; Kuzmanović & al., 2013a, b, 2015; Budžakova & al., 2014), a comprehensive phylogenetic study of Sesleria is still missing. Some recent studies have focused on groups of allegedly closely related species (Di Pietro & al., 2005; Alegro, 2007; Kuzmanović & al., 2013a; Budžakova & al., 2014) or on nomenclatural issues (Di Pietro & al., 2013; Kuzmanović & al., 2015). Others have explored genome size variation and patterns of polyploidisation within Sesleria (Lazarević & al., 2015; Kuzmanović & Schönswetter, 2016), but overall taxonomy and relationships among different species groups remain unclear. Here, we apply an array of complementary molecular markers – sequences of the nuclear ribosomal ITS and the plastid trnL-ndhF region (maternally inherited in Poaceae: Corriveau & Coleman, 1988) along with highly resolving, mostly nuclear-derived (Bussell & al., 2005) AFLPs – on a comprehensive, ploidy-cytotyped sampling including 284 populations of 43 species of Sesleria. (1) Taking into account the controversies regarding the circumscription of tribe Seslerieae (for details about previous classifications see Quintanar & al., 2007), our first aim was to determine the relationships between Sesleria on the one hand and Ammochloa, Echinaria, Oreochloa and other putatively closely related genera on the other hand. (2) Further, we explored whether S. sphaerocephala and S. ovata are the parental lineages of exclusively polyploid Sesleria s.str. and if they should be treated as separate genera Sesleriella and Psilathera as proposed by Deyl (1946), or rather included in Version of Record Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Sesleria, following Deyl (1980) and national Floras (Pignatti, 1982; Jogan, 2007; Guinochet & Vilmorin, 1978; Aeschimann & al., 2005; Fischer & al., 2008). (3) Finally, our main aim was to test Deyl’s (1946) hypotheses of infrageneric classifications, i.e., S. sect. Argenteae and S. sect. Sesleria as well as the proposed informal species groups. MATERIALS AND METHODS Plant material. — Analyses are based on field collected, silica dried leaf samples the ploidy of which had previously been determined by Lazarević & al. (2015). Our sampling aimed at taxonomic completeness and inclusion of several populations at least of the widespread species. As we were not interested in intrapopulation genetic diversity, we maximised the number of populations at the expense of the number of samples per population. We included 292 populations pertaining to 43 species of Sesleria (Fig. 1; Appendix 1; Electr. Suppl.: Table S1), 2 species of Oreochloa (3 populations) as well as several outgroup taxa, whose selection was informed by available phylogenies (e.g., Quintanar & al., 2007; Schneider & al., 2009). Two species of Sesleria (S. araratica Kit Tan, S. polyathera K.Koch) could not be sampled. Whereas 1035 individuals from 286 populations of Sesleria and Oreochloa were included in the AFLP analyses, the plastid trnL-ndhF region was sequenced for one individual per population (291 populations) and ITS was sequenced for 11 accessions of Sesleria as well as 3 accessions of Oreochloa in order to infer the phylogenetic position of these genera (Electr. Suppl.: Table S1). Nomenclature and taxonomic concepts follow Flora Europaea (Deyl, 1980) and Euro + Med Plant Base (Valdés & Scholz, 2009) with the following exceptions applied also in Lazarević & al. (2015). For the S. juncifolia complex we adopted the concepts proposed by Strgar (1981), Alegro (2007), Di Pietro (2007) and Di Pietro & al. (2013), i.e., recognition of S. albanica Ujhelyi, S. apennina Ujhelyi, S. calabrica (Deyl) Di Pietro, S. interrupta Vis., S. juncifolia Suffren, S. kalni­ kensis and S. ujhelyii Strgar. In the S. rigida Heuff. ex Rchb. complex we followed Kuzmanović & al. (2013a) in recognising S. achtarovii Deyl, S. filifolia Hoppe and S. rigida. Further, we included S. leucocephala in S. sphaerocephala following recent Floras covering the distribution areas of both taxa (e.g., Aeschimann & al., 2005). We identified the taxa using Deyl (1946) and Flora Europaea (Deyl, 1980), as well as national and regional Floras (Pignatti, 1982; Davis, 1985; Aeschimann & al., 2005; Ciocarlan, 2009), with the exception of the following taxa (literature used for determination is given in parentheses): S. albanica and S. skipetarum Ujhelyi (Ujhelyi, 1959b), S. ujhelyii and S. interrupta (Strgar, 1981), S. insularis subsp. barbaricina Arrigoni (Arrigoni, 1983), S. nitida subsp. sicula Brullo & Giusso (Brullo & Giusso Del Galdo, 2006), S. apen­ nina, S. calabrica and S. juncifolia (Di Pietro, 2007), S. pichi­ ana Foggi & al. (Foggi & al., 2007), S. rhodopaea Tashev & D.Dimitrov (Tashev & Dimitrov, 2012), as well as S. achtarovii and S. serbica (Adam.) Ujhelyi (Kuzmanović & al., 2013а). Voucher specimens are either deposited at BEOU, HFLA, IB, KRAM, NHMR or ZA. Voucher numbers and collecting details are given in Appendix 1. Molecular methods. — Total genomic DNA was extracted from ca. 10 mg of dried tissue with the DNeasy 96 plant kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. Four regions (petN(ycf6)-psbM, trnL(UAG)-ndhF, ndhJtrnT, trnQ-trnK) of the plastid genome were tested for DNA sequence variation. The trnL-ndhF region yielded the highest variability and was sequenced for one individual from 291 populations of Sesleria and some putatively closely related outgroup taxa (Appendix 1). The PCR products were obtained using the primer trnL (Shaw & al., 2007) and the newly designed primer ndhF_Ses_F (GCATATTGATATGTATGTTCC) in reaction volumes of 36.5 μl including 3.64 μl 10× TaKaRa Buffer, 0.22 μl TaKaRa Taq polymerase (Takara Bio, Kusatsu, Japan), 2.92 μl of dNTPs (Applied Biosystems, Foster City, California, U.S.A.), 1.46 µl 10 µM of each forward and reverse primers and 1.5 μl DNA of unknown concentration. The PCR conditions were as follows: 80°C for 5 min followed by 30 cycles of 1 min at 95°C, 1 min at 53°C and 4 min at 65°C and a final elongation step of 5 min at 65°C. The nuclear ribosomal ITS region was sequenced for 11 Sesleria accessions sampled from all major clades resolved in the plastid analyses and 10 outgroup accessions. The PCR products were obtained using the primers 17SE and 26SE (Sun & al., 1994) in reaction volumes of 16.5 μl including 6 μl REDTaq ReadyMix PCR reaction mix (Sigma-Aldrich, Steinheim, Germany), 0.7 μl of 1 mg/ml BSA (bovine serum albumin; Promega, Madison, Wisconsin, U.S.A.), 0.4 µl 10 µM each of forward and reverse primers and 1 µl DNA of unknown concentration. The PCR conditions were as follows: 95°C for 5 min followed by 35 cycles of 30 s at 95°C, 1 min at 58°C, 2 min at 72°C; and a final elongation step of 10 min at 72°C. PCR programs were run on Eppendorf 5331 thermocyclers (Applied Biosystems). PCR products were purified with E. coli Exonuclease I and SAP (Shrimp Alkaline Phosphatase; Fermentas, St. Leon-Rot, Germany) following the manufacturer’s instructions. Cycle sequencing reactions were performed using 8 µl of purified template and 1 μl BigDye Terminator (Applied Biosystems), then cleaned with Sephadex G-50 Fine (GE Healthcare Bio-Sciences, Uppsala, Sweden) and sequenced on an ABI 3770 DNA Analyzer (Applied Biosystems). In the case of the trnL-ndhF region, the primer rpl32-F (Shaw & al., 2007) and the newly designed primer rpl32_Ses_R (CGAATACGCTTTTTTGAC) were used for sequencing, whereas in the case of ITS only the PCR primers were used. AFLP fingerprinting was performed for one to five individuals per population following Vos & al. (1995) with the modifications described in Schönswetter & al. (2009). In addition, 0.25 U of polymerase were used in the preselective and selective amplifications (0.4 U for the NED-labelled primer combination). Fifteen selective primer combinations have been initially screened. The three final selective primer combinations for the selective PCR (fluorescent dye in brackets) were EcoRI (6-FAM)-ACT / MseI-CAC, EcoRI (VIC)-ACG / MseI-CAC, Version of Record 1351 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 S. caerulea (DQ539586, EF565132), S. insularis (EU792326, FM179435), S. tenerrima (Fritsch) Hayek EU792327, Trisetum spicatum (L.) K.Richt. (AY752486), T. tenellum (Petrie) Allan & Zotov ex Laing & Gourlay (AY752487) and Triticum aesti­ vum (DQ981410). The alignments were visually inspected and improved manually and are available as online supplementary material. Phylogenetic relationships within both the ITS and the plastid datasets were inferred using maximum parsimony as well as Bayesian analyses. The ITS dataset included 21 new sequences, of which 11 belong to Sesleria s.l., and 29 GenBank sequences (6 of them of Sesleria s.l.), whereas the plastid dataset included 309 sequences, of which 304 were newly generated (291 belonging to Sesleria s.l.). Maximum parsimony (MP) as well as MP bootstrap analyses of both datasets were performed using PAUP v.4.0b10 (Swofford, 2002). The most parsimonious trees were searched heuristically with TBR swapping, MulTrees off, and 10,000 replicates of random sequence addition for the plastid dataset and with 1000 replicates and swapping performed on a maximum of 1000 trees (nchuck = 1000) for the ITS dataset. All characters were equally weighted and unordered. Brachypodium distachyon was used for rooting. The datasets were bootstrapped using full heuristics, 1000 replicates, TBR branch swapping, MulTrees option off, and random addition sequence with five replicates. Bayesian analyses were performed employing MrBayes v.3.2.1 (Ronquist & al., 2012) applying the GTR + Γ (plastid dataset) and GTRI + Γ (ITS) substitution models proposed by the Akaike information criterion implemented in MrAIC.pl v.1.4 (Nylander, 2004) (Table 1). Values for all parameters, such as the shape of the gamma distribution, were estimated during the analyses. The settings for the Metropolis-coupled Markov chain Monte Carlo (MC3) process included four runs with four chains each (three heated ones using the default heating scheme), run simultaneously for 10 million generations each, sampling trees every 1000th generation using default priors. The posterior probability (PP) of the phylogeny and its branches was determined from the combined set of trees using the command “sumt”, discarding the first 1001 trees of each run as burn-in. Brachypodium distachyon was used for rooting. Plastid data were also analysed with PopArt v.1.7 (available at http://popart.otago.ac.nz) using TCS networks (Clement & al., 2000) with the connection limit set to 95%. Since gaps were treated as fifth character state, indels longer than 1 bp were re-coded as single characters by reducing them to single base pair columns. One mononucleotide repeat (poly-A-stretch) was removed. AFLP data analysis. — A neighbor-joining (NJ) analysis based on a matrix of Nei-Li genetic distances (Nei & Li, 1979) was conducted and bootstrapped (1000 pseudo-replicates) with TREECON v.1.3b (Van de Peer & De Wachter, 1997). The Fig. 1. Sampled populations of 43 species of Sesleria s.l. Population identifiers correspond to Appendix 1. Inserts in A show populations from the Black sea coast (left) and the northern Iberian Peninsula (right); the insert in B shows populations from Crete; inserts in E show populations from Ireland and Scandinavia (upper left corner) and the Lesser Caucasus (lower left corner). Colour coding of population symbols reflects the ten AFLP groups derived from K-means clustering and used for the discriminant analysis of principle components shown in Fig. 6; S. ovata and S. sphaerocephala were not included (see text). 1352 Version of Record ◄ and EcoRI (NED)-ACC / MseI-CAC. Purification and visualisation of PCR products were done as described in Rebernig & al. (2010). Electropherograms of AFLP fingerprints were analysed with Peak Scanner v.1.0 (Applied Biosystems) using default peak detection parameters. Automated binning and scoring was performed using the package RawGeno v.2.0 (Arrigo & al., 2009) for R v.3.1 (R Development Core Team, 2012) with the following settings: scoring range = 75–500 bp, minimum intensity = 100 relative fluorescence units (rfu), minimum bin width = 1 bp, and maximum bin width = 1.5 bp. Fragments with a reproducibility lower than 80% based on 86 sample-replicate comparisons as well as fragments present/absent in only one individual were eliminated. Sequence data analysis. — Sequences were edited and aligned using Geneious Pro v.5.3.6 (Drummond & al., 2011). Base polymorphisms in ITS sequences were coded using the NC-IUPAC ambiguity codes; polymorphisms were scored when the weaker signal reached at least one-third of the height of the stronger signal in both strands. All sequences were deposited in GenBank (Appendix 1). Along with the newly sequenced accessions (Appendix 1) the following GenBank sequences were used (accession numbers in brackets) for plastid data analyses: Aegilops triuncialis L. (GQ250568), Agrostis stolonifera L. (EF115543), Brachypodium distachyon (L.) P.Beauv. (EU325680), Festuca altissima All. (JX871939) and Triticum aestivum L. (AB042240). The selection of outgroup taxa in the plastid dataset was mainly based on Quintanar & al. (2007), Schneider & al. (2009) and Hochbach & al. (2015), where accessions of all three main Sesleria lineages were included together with representatives of Aveneae and Poeae lineages (taxa belonging to Aveninae, Agrostidinae, Koeleriinae and Loliinae clades). In contrast, in the previous ITS phylogenies (e.g., Quintanar & al., 2007; Schneider & al., 2009) only members of Sesleria s.str. were included; we therefore included a broader sampling of outgroup taxa. Alongside 11 newly sequenced accessions (Appendix 1) we included the following GenBank sequences: Aegilops triuncialis (KJ459885), Agrostis stolonifera (JN040623), Ammochloa palaestina Boiss. (DQ539587), Arrhenatherum elatius (L.) J.Presl & C.Presl (JF904803), Avena sativa L. (AY520821), A. macrostachya Balansa & Durieu (AY522433), Bellardiochloa variegata (Lam.) Kerguélen (EU792362), Brachypodium distachyon (JX665601), Calamagrostis purpurascens R.Br. (FJ377651), Deschampsia brevifolia R.Br. (EU792328), D. tenella Petrie (AY752475), Festuca altissima (AF303411), Helictotrichon convolutum (C.Presl) Henrard (EU792324), H. filifolium (Lag.) Henrard (DQ336819), Mibora minima (L.) Desv. (DQ539589), Oreochloa disticha Link (DQ539588), Phleum pratense L. (EU792341), Poa palustris L. (EU792396), Puccinellia vahliana (Liebm.) Scribn. & Merr. (EU792336), Sesleria argentea (AF532931), Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Version of Record 1353 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Table 1. Matrix and phylogenetic analysis statistics for ITS and the plastid marker trnL-ndhF as well as substitution models proposed by MrAIC and used in the Bayesian analyses. ITS trnL-ndhF Number of terminals 50 309 Number of included characters 799 2251 Number / percentage of parsimony-informative characters 202 / 25.3% 342 / 15.2% Number of most parsimonious trees 23005 7754 Length of most parsimonious trees 753 796 Consistency index (excluding uninformative characters) 0.548 (0.481) 0.746 (0.673) Retention index 0.685 0.928 Substitution model GTRI + Γ GTR + Γ tree was rooted with the close outgroup Oreochloa disticha, which reduces problems arising from non-homologous AFLP fragments. A principal coordinate analysis (PCoA) based on a matrix of Jaccard distances among individuals of Sesleria s.str. was calculated using Past v.2.17c (Hammer & al., 2001). Finally, we used discriminant analysis of principal components (DAPC) implemented in the package adegenet (Jombart, 2008; Jombart & al., 2010) for R v.3.1 (R Development Core Team, 2012) for the same dataset. We ran DAPC by first performing a principal components analysis (PCA) to transform the raw genetic data, retaining 400 principal components in order to extract a large portion of the variation in the data. We applied K-means clustering (function find.clusters) to identify K, the most likely number of clusters that minimizes the variation within clusters, based on the Bayesian information criterion (BIC). The analysis was run for Ks ranging from 1 to 20 based on preliminary analyses. A discriminant analysis was run (function dapc) for K = 10, identified as the most likely number of clusters using 300 principal components, which explained more than 80% of the total variance. Relationships between clusters in the DAPC space were visualized using scatterplots and a NJ tree (R package ape, Paradis & al., 2004), which was computed based on the distances between centroids of the different clusters. Additionally, we ran DAPC for K = 2 in order to test Deyl’s (1946) hypothesis of division of Sesleria s.str. into two sections. RESULTS The number of terminals, included characters, number and percentage of parsimony-informative characters, number and lengths of MP trees, consistency and retention indices for both DNA regions, as well as the model of evolution proposed by MrAIC and used in MrBayes analyses are presented in Table 1. ITS. — The ITS sequences of Sesleria were 777 (S039) to 778 bp (all other accessions) long. Sequences of polyploid Sesleria s.str. contained two (S019, S021) to ten (S039) polymorphic sites, whereas those of diploid S. ovata and S. sphaerocephala contained five (S092) to six (S033) and three (S024) to eight (S065, S075) polymorphic sites, respectively (Table 2). Parsimony and Bayesian analyses yielded largely congruent trees (Fig. 2) and revealed that Sesleria is not monophyletic. Whereas S. ovata grouped with Sesleria s.str. with low bootstrap support (BS 66%), S. sphaerocephala was positioned outside of this clade. In the same line, Sesleria s.str. and S. ovata shared 12 nucleotide positions (bold in Table 2), where S. sphaerocephala had a different nucleotide, whereas there were no positions shared between Sesleria s.str. and S. sphaerocephala. Only at position 157 one accession of S. sphaerocephala (S075) and one accession of Sesleria s.str. (S039) had a polymorphic site (Y), thus sharing thymin, whereas all other accessions had the position fixed for cytosin. Table 2. ITS variation in newly sequenced Sesleria Scop. s.str., S. ovata (Hoppe) A.Kern. and S. sphaerocephala Ard. Position in the alignment 150 157 160 165 166 169 190 201 213 226 276 288 301 308 464 → S. sphaerocephala C C/Y C/Y C/Y C C Y T G A C C T C T S. ovata Y C Y T C C C C G G C T Sesleria s.str C C/Y C/Y T C/Y C/T/Y C C G/T/K G Position in the alignment → 457 519 522 530 549 564 577 596 603 S. sphaerocephala G/K C A R C T/K G C C S. ovata G A T T C G R T C Sesleria s.str G A T T/Y C/T/Y G G T C Y C C/T/Y T C/Y C C 620 653 659 666 678 G C G A C A T R G T C/T/Y A T G G T The alignment was reduced to polymorphic positions as well as to nucleotides shared between Sesleria s.str. and S. ovata (bold) to the exclusion of S. sphaerocephala. Only those polymorphic sites are shown where at least two accessions were polymorphic. 1354 Version of Record Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Similarly, at position 301 one Sesleria s.str. (S009) had a polymorphic signal (Y), where thymin was shared with S. sphaer­ ocephala and cytosin with S. ovata and Sesleria s.str. All other polymorphisms/nucleotides were either autapomorphic for single or a few individuals belonging to the same lineage or shared between Sesleria s.str. and S. ovata (Table 2). Echinaria capitata (L.) Desf. was most closely related to the Sesleria s.str.–S. ovata clade (BS 91%, PP 1) and their sister (PP 0.94) was a clade formed by Mibora minima, Oreochloa disticha and O. seslerioides (All.) K.Richt. (PP 0.99). Also Avena sativa and A. macrostachya were included in the same clade with Echinaria capitata, Mibora minima, Oreochloa disticha and O. seslerioides, and Sesleria spp. (PP 0.95), their closest relatives (BS 63%, PP 1) were Agrostis stolonifera, Arrhenatherum elatius, Calamagrostis purpurascens, Helictotrichon convo­ lutum, H. filifolium, Trisetum spicatum and T. tenellum from “core Aveneae” (Quintanar & al., 2007). Seslerieae (Echinaria capitata, Mibora minima, Oreochloa disticha, O. seslerioides, Sesleria spp.) are closest to a grade formed by members of Aveninae (Avena sativa, A. macrostachya, Arrhenatherum ela­ tius, Helictotrichon convolutum, H. filifolium), which is sister to the Koeleriinae clade (Trisetum spicatum, T. tenellum), and this clade is in turn sister to the Agrostidinae clade (Agrostis stolonifera, Calamagrostis purpurascens) as previously shown by Quintanar & al. (2007). Plastid DNA. — The trnL-ndhF sequences of Sesleria were 1761 (S121) to 1824 bp (S213) long. Parsimony and Bayesian analyses yielded largely congruent trees and revealed that Sesleria is not monophyletic. Whereas S. sphaerocephala was not monophyletic but rather grouped together with Sesleria s.str. with high support (BS 85%, PP 1; Electr. Suppl.: Fig. S1), S. ovata was positioned outside of this clade. With the exception of the changed position of Sesleria s.str., the relationships with Echinaria, Mibora and Oreochloa were congruent with the topology inferred by ITS data and the support in the plastid tree was higher (Electr. Suppl.: Fig. S1). The clade including Echinaria capitata, Mibora minima, Oreochloa and Sesleria s.l. received high support (BS 94%, PP 1). Their closest relatives (PP 1) were Ammochloa involucrata Murb., A. palaes­ tina, Cynosurus echinatus L., Festuca altissima and Parapholis incurva (L.) C.E.Hubb.; relationships among them as well as to the clade including Sesleria were unresolved. Aegilops triuncialis KJ459885 Triticum aestivum DQ981410 100 Cynosurus echinatus MF155200 100 1 Cynosurus echinatus MF155201 1 Parapholis incurva MF155208 77 0.72 Festuca altissima AF303411 1 Ammochloa involucrata MF155199 100 Echinaria capitata MF155202 1 Echinaria capitata MF155203 Sesleria ovata S033 91 Sesleria ovata S092 Sesleria interrupta S009 1 Sesleria skipetarum S021 Sesleria insularis EU792326 66 Sesleria wettsteinii S019 0.66 Sesleria doerfleri S039 69 Sesleria argentea AF532931 Sesleria caerulea DQ539586 Sesleria caerulea EF565132 0.94 Sesleria insularis FM179435 63 Sesleria filifolia S228 0.96 Sesleria tenerrima EU792327 100 Mibora minima MF155204 1 Mibora minima DQ539589 Oreochloa disticha S044 89 0.99 0.98 Oreochloa disticha S091 97 Oreochloa disticha FM179421 0.88 Oreochloa seslerioides S078 0.95 Oreochloa disticha DQ539588 Sesleria sphaerocephala S024 98 Sesleria sphaerocephala S035 1 Sesleria sphaerocephala S065 0.72 Sesleria sphaerocephala S075 72 Avena sativa AY520821 0.99 Avena macrostachya AY522433 66 85 Arrhenatherum elatius JF904803 0.98 98 Helictotrichon convolutum EU792324 0.97 1 Helictotrichon filifolium DQ336819 63 100 Trisetum spicatum AY752486 1 1 Trisetum tenellum AY752487 93 Agrostis stolonifera JN040623 1 Calamagrostis purpurascens FJ377651 Ammochloa palaestina DQ539587 Bellardiochloa variegata EU792362 72 0.9 Puccinellia vahliana EU792336 1 Phleum pratense EU792341 Poa palustris EU792396 100 Deschampsia brevifolia EU792328 1 Deschampsia tenella AY752475 Brachypodium distachyon JX665601 100 1 0.03 Fig. 2. Bayesian consensus phylogram of ITS sequences of Sesleria s.l. and outgroup taxa selected based on available phylogenies (Quintanar & al., 2007; Schneider & al., 2009); numbers above branches are bootstrap values > 50 %, those below branches PP values > 0.65. GenBank accession numbers are given for sequences retrieved from GenBank; the other accessions bear the identifiers corresponding to Electr. Suppl.: Table S1. Version of Record 1355 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) A TAXON 66 (6) • December 2017: 1349–1370 100 100 1 1 Ammochloa Cynosurus echinatus Parapholis incurva 100 Echinaria 63 1Sesleria ovata 0.81 100 1 Oreochloa Festuca altissima 1 0.80 1 100 1 100 1 83 0.93 Mibora sect. Argenteae - 1 sect. Sesleria - 52 K1 (2) K2 (28) K3 (13) K4 (3) K5 (5) 0.99 94 1 B H12 sect. Argenteae - 72 H11 H13 H14 sect. Sesleria - 7 66 1 0.82 K 3 (7) K 4 (1) K 5 (1) K 6 (1) H15 K 8 (34) K 9 (16) K 10 (17) H10 H9 H8 H1 H16 H17 H18 H19 H20 sect. Sesleria - 65 0.98 66 1 85 1 72 1 K 1 (27) K 2 (1) K 4 (18) K 5 (11) K 6 (1) K 7 (5) K 9 (11) K 10 (9) H2 H21 H28 H27 H30 H32 H31 sect. Argenteae - 20 H5 H4 H3 H29 0.97 10 samples 1 sample H7 H6 H22 H26 H36 H25 H33 H34 H35 H24 H41 H42 H37 H39 H23 H38 H40 H44 H43 H48 H46 H45 H53 sect. Argenteae - 2 1 H54 sect. Sesleria - 50 H55 70 1 K 1 (10) K 2 (3) K 3 (1) K 4 (12) H57 K 5 (13) K 6 (10) K 10 (2) Sesleria sphaerocephala AT, SLO H61 Sesleria sphaerocephala IT sect. Sesleria - 10 75 1 0.1 H69 H63 K 4 (4) K 5 (6) Version of Record H80 H87 H86 H78 H81 H79 H76 H72 H68 1356 H70 H71 H50 H51 H60 H74 H73 H75 H64 H66 H67 C H77 H58 H59 H62 H65 H52 H49 H47 H56 H82 H83 H84 H85 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 All accessions of Sesleria s.str. formed a maximally supported clade including S. sphaerocephala. A basal polytomy included Italian accessions of S. sphaerocephala (Yellow haplotype group in the TCS network, Fig. 3B) and a clade (BS 75%, PP 1; Violet haplotype group) comprising a few accessions of S. interrupta, S. juncifolia, S. serbica, and S. ujhelyii from the western Balkan Peninsula (Fig. 3C). All remaining samples were included in four clades, each of which received support (PP ≥ 0.99), corresponding to groups separated by several mutation steps in the TCS haplotype network. One of them included Austrian and Slovenian accessions of S. sphaerocephala (BS 70%, PP 1; Orange haplotype group). All remaining accessions belong to Sesleria s.str. The early diverging Red haplotype group (PP 0.99) contained almost exclusively members of S. sect. Sesleria distributed in the Southern Carpathians and the southern and central-eastern Balkan Peninsula, with disjunct occurrences in the Western Carpathians and the Caucasus. This group was also genetically most diverse, including haplotypes separated by several mutational steps (Fig. 3B). All other distinct haplotype groups are more widespread, spanning almost the entire distribution area of Sesleria s.str. The Green haplotype group (BS 66%, PP 1), which contained mostly accessions of S. sect. Argentea, extends from the Pyrenees to the Caucasus, whereas the Blue haplotype group (BS 72%; PP 1) included mostly members of S. sect. Sesleria and extends north of the Alps to Ireland and Scandinavia. The latter group was divided into two subgroups, the Grey-blue haplotype subgroup ranging from the Alps, Apennines and Sardinia/Corsica to the Carpathians and the western Balkan Peninsula and a paraphyletic remainder, the Clear-blue haplotype subgroup spanning from Ireland and Scandinavia over the Alps to the Apennines, the Carpathians and the western Balkan Peninsula (Fig. 3); the accessions of the latter formed a polytomy. Most of the haplotype groups included members of different AFLP K-means groups, of which one K-mean group was mostly prevailing (Fig. 3A). A comparison of phylogenetic relationships among Sesleria s.str. and closely related genera based on ITS, plastid DNA and AFLPs is shown in Fig. 4. AFLPs. — A total of 1831 AFLP fragments were scored in 1035 individuals from which high-quality, reproducible AFLPfingerprints were obtained; 97 fragments were found in only one individual and were excluded from further analyses. The average replicate error rate was 3.38%. We acknowledge that the number of fragments is high, which could introduce considerable homoplasy. Empirical tests, however, showed that reducing the number of fragments by applying more conservative scoring strategies yielded considerably worse resolution in terms of tree structure and bootstrap support. This indicates that the increased amount of data was not outweighed by increased homoplasy. The NJ analysis (Electr. Suppl.: Fig. S2) revealed four main clusters with high bootstrap support, i.e., the outgroup Oreochloa (O. disticha, O. seslerioides, BS 100%), S. ovata (BS 100%), S. sphaerocephala (BS 100%), and Sesleria s.str. (BS 89%) (Fig. 4). Within Sesleria s.str. cluster relationships were unresolved and only nine species represented by a limited number of populations received bootstrap support > 80% (S. achtarovii, 98%; S. albanica, 84%; S. anatolica Deyl, 100%; S. doerfleri Hayek, 99%; S. filifolia, 94%; S. insularis, 99%; S. phleoides Steven ex Roem. & Schult., 100%; S. taygetea Hayek, 100%; S. uliginosa Opiz, 81%). Sesleria alba Sm., S. serbica and S. skipetarum formed unsupported clusters, ITS 100 91 1 Echinaria 1 66 Sesleria s.str., S. ovata 0.66 100 0.94 Mibora 1 0.99 98 1 97 0.88 Oreochloa Sesleria sphaerocephala plastid DNA 100 1 100 1 63 Sesleria ovata 0.81 100 96 1 94 1 85 1 AFLP 89 88 100 100 100 100 Echinaria 1 Mibora 83 Oreochloa 0.93 Sesleria s.str., S. sphaerocephala Sesleria s.str. Sesleria sphaerocephala Sesleria ovata Oreochloa Fig. 4. Comparison of phylogenetic relationships among Sesleria s.l. and related genera based on ITS, trnL-ndhF and AFLPs, summarised from Fig. 2 (ITS), Electr. Suppl.: Fig. S1 (trnL-ndhF) and an AFLP neighbor-joining tree (Electr. Suppl.: Fig. S2). Numbers above branches are BS values > 50 %, those below branches PP values > 0.65. ◄ Fig. 3. Plastid DNA diversity in Sesleria s.l. A, Simplified trnL-ndhF tree presented in detail in Electr. Suppl.: Fig. S1. Values above and below branches are parsimony bootstrap values > 50 and posterior probabilities derived from Bayesian analysis > 0.80, respectively. Polytomies and subordinate nodes were collapsed into triangles, whose height reflects the number of included accessions. Black-and-white pie charts to the right of the triangles show the affiliation of the included accessions to S. sect. Argenteae and S. sect. Sesleria plus the respective samples sizes. Coloured pie charts reflect the AFLP clusters (K1 to K10) derived from the discriminant analysis of principle components shown in Fig. 6; numbers reflect individuals assigned to a particular cluster. B, Statistical parsimony network of the 87 plastid haplotypes found; their numbering corresponds to Electr. Suppl.: Table S1; mutational steps are shown as black dots or bars. C, Geographical distribution of the groups of plastid haplotypes shown in A and B; inserts show the Iberian Peninsula (upper right), the British Isles and Scandinavia (lower left) as well as the Great and Lesser Caucasus (lower right). Version of Record 1357 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 whereas the remaining 28 species of Sesleria s.str. failed to form clusters. The PCoA of Sesleria s.str. revealed two groups that almost fully correspond to Deyl’s (1946) S. sect. Argenteae and S. sect. Sesleria; individuals of S. vaginalis Boiss. & Orph. were positioned between the two groups (Fig. 5A). Accordingly, the DAPC (Fig. 5B) supported separation of the two sections. Sequential K-means clustering conducted for Sesleria s.str. showed that the most likely number of clusters was K = 10 (Fig. 6A). The neighbour-joining tree based on distances among centroids of the different clusters (Fig. 6B) showed that the most divergent groups were the Tenerrima group and the Insularis group, whereas the Juncifolia 1 and Juncifolia 2 groups were most similar (Fig. 6B). The sequential separation of the ten groups is shown in Fig. 6C–F, and their geographic and taxonomic distribution is given in Fig. 1. Along the first and second discriminant functions Argentea, Latifolia and Robusta groups were clearly separated, while the Tenerrima group slightly overlapped with the remaining groups (Fig. 6C). Insularis and Uliginosa groups were separated along the third and fourth discriminant functions (Fig. 6D), and Caerulea and Coerulans groups along the seventh and eighth discriminant functions (Fig. 6E). Finally Juncifolia 1 and Juncifolia 2 groups were separated along the eighth and ninth discriminant functions (Fig. 6F). The species constituting each of the ten clusters are listed in Table 3, which also presents a comparison with Deyl’s (1946) taxonomic concept. Relationships among Sesleria s.l. and its closest relatives. — Our phylogenies based on nuclear ribosomal ITS and plastid DNA sequences (Figs. 2–4) congruently showed that Echinaria, Mibora, Oreochloa and Sesleria form a monophyletic lineage, which is in accordance with previous studies (Quintanar & al., 2007; Gillespie & al., 2008; Saarela & al., 2010). The placement of this lineage was, however, highly incongruent. The ITS data resolved Echinaria, Mibora, Oreochloa and Sesleria s.l. as close relatives of members of “core Aveneae” sensu Quintanar & al. (2007), whereas the plastid data identified Echinaria, Mibora, Oreochloa and Sesleria s.l. to be closely related to “core Poeae”. Echinaria, Mibora, Oreochloa and Sesleria s.l. thus have “avenoid” nuclear genomes and “poeoid” plastid genomes, which indicates that this lineage might be of intertribal hybrid origin as suggested previously (Quintanar & al., 2007; Gillespie & al., 2008; Saarela & al., 2010, 2015), but other processes such as lineage sorting (Pamilo & Nei, 1988) might as well have contributed to the observed incongruences. Apart from that, Ammochloa is closely related to Poeae in both nuclear and plastid trees, which is in contrast with previous, morphology-based concepts, where it was placed in Seslerieae (e.g., Maire & al., 1953; Tutin & al., 1980; Valdés & Scholz, 2009). In turn, the inclusion of Mibora in Seslerieae was evident, as already shown by Quintanar & al. (2007). 0.3 0.3 0.2 0.0 0.2 B 0.1 Density 0.4 S. sect. Sesleria S. sect. Argenteae ||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||| | | | -5 | | 0 | | || |||||||||||||||||||||||||| ||| ||||||| |||| ||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| 5 | 10 Discriminant function 1 0.1 PCoA 2 (2.79%) Fig. 5. Deyl’s (1946) sections S. sect. Sesleria and S. sect. Argenteae based on AFLP diversity in Sesleria s.str. A, Principal coordinate analysis. Individuals of S. vaginalis, which likely is an intersectional hybrid (see text), are illustrated with asterisks. B, Discriminant analysis of principal components (DAPC) for K = 2. DISCUSSION 0.0 -0.1 -0.2 A -0.3 -0.3 -0.2 -0.1 0.0 0.1 PCoA 1 (6.34%) 1358 Version of Record 0.2 0.3 0.4 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Fig. 6. Discriminant analysis of principle components (DAPC). A, Bayesian information criterion (BIC) value for 1–20 clusters. B, Neighborjoining tree based on distances among centroids of the ten inferred clusters. C–F, Scatterplots along the discriminant functions highlighted in the respective insert: C, Discriminant functions 1 and 2; D, Discriminant functions 3 and 4; E, Discriminant functions 7 and 8; F, Discriminant functions 8 and 9. — Discriminant functions 5 and 6 are not shown as they do not provide additional information. Discriminant analysis eigenvalues are shown in inserts in lower left corners. Version of Record 1359 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Possible hybrid origin of polyploid Sesleria s.str. and resurrection of the diploid, monotypic Alpine endemic genera Psilathera and Sesleriella. — Our phylogenies do not confirm the circumscription of Sesleria applied in recent classifications (Deyl, 1980; Valdés & Scholz, 2009; Clayton & al., 2017), as the genus is not monophyletic. In the ITS tree (Fig. 2) diploid S. ovata grouped with tetra- to dodecaploid Sesleria s.str. (i.e., excluding S. ovata and S. sphaerocephala), whereas diploid S. sphaerocephala was distantly related. In contrast, in the plastid phylogeny (Fig. 3; Electr. Suppl.: Fig. S1) Sesleria s.str. grouped with S. sphaerocephala, whereas S. ovata was sister to Echinaria. Clustering of Sesleria s.str. with S. sphaerocephala was also supported by the AFLP tree, where, however, other closely related taxa were not included (Fig. 4). In accordance with the hypothesis that intergeneric and even intertribal hybridization are important evolutionary forces in grasses (Kellog & Watson, 1993; Soreng & Davis, 2000), the resolved topologies indicate a possible allopolyploid origin of Sesleria s.str. with S. sphaerocephala acting as maternal and S. ovata as paternal species. Based on our – albeit not cloned – sequences, the maternal ITS copies could have been replaced by concerted evolution (Wendel & al., 1995), as there are no consistently shared (synapomorphic) nucleotides between Sesleria s.str. and S. sphaerocephala, even when the polymorphic sites are considered (Table 2). Alternatively, such a pattern could have been caused by differential sorting of ancient polymorphisms (Pamilo & Nei, 1988; Linder & Rieseberg, 2004; Frajman & al., 2009) in different lineages of Sesleria. Given that the branches leading to the main Sesleria lineages are relatively long both in the ITS and plastid trees – thus probably giving the genes enough time to coalesce (Frajman & al., 2009), we suggest that lineage sorting is a less likely scenario for incongruences observed among the three main Sesleria lineages, but cannot be entirely ruled out. In any case, the lack of monophyly of Sesleria s.l. supports the recognition of S. ovata and S. sphaerocephala as separate genera Psilathera and Sesleriella. Psilathera was described by Link (1827) and has been repeatedly separated from Sesleria s.str. in the past (e.g., Bews, 1929; Mössler, 1829; Schultz, 1832; Deyl, 1946; Ujhelyi, 1959a; Watson & Dallwitz, 1992; Conti & al., 2005), Table 3. Revised formal and informal classification of Sesleria s.str. and related genera and comparison with the treatment by Deyl (1946). Species falling into more than a single AFLP group are highlighted with “p.p.” (pro parte). Species Ploidy Deyl (1946) Psilathera Link Genus P. ovata (Hoppe) Deyl 2x – Sesleriella Deyl S. sphaerocephala Ard. 2x – S. argentea (Savi) Savi 4x Argentea S. italica (Pamp.) Ujhelyi 4x S. nitida Ten. 4x Nitida S. tuzsonii Ujhelyi 4x Argentea S. alba Sm. 4x Argentea S. anatolica Deyl 4x Argentea S. autumnalis (Scop.) F.W. Schultz 4x, 8x Argentea S. latifolia (Adamović) Degen 4x, 8x Argentea S. skipetarum Ujhelyi 4x – S. doerfleri Hayek 4x Nitida S. robusta Schott & al. 4x, 8x Nitida S. wettsteinii Dörfl. & Hayek 4x Nitida Uliginosa S. uliginosa Opiz. 4x Uliginosa Insularis S. insularis Sommier 4x Rigida Caerulea S. apennina Ujhelyi p.p. 8x – S. caerulea (L.) Ard. 4x, 8x Calcaria S. heuflerana Schur 4x, 8x Uliginosa S. kalnikensis Jáv. p.p. 4x, 8x Rigida S. pichiana Foggi & al. 8x – S. sadlerana Janka 8x Calcaria S. tatrae (Degen) Deyl 8x Coerulans Sesleria Scop. Section Argenteae Deyl AFLP group Argentea Latifolia Robusta Sesleria 1360 Version of Record Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 albeit in none of the recent national and regional Floras covering its distribution area (e.g., Aeschimann & al., 2005; Fischer & al., 2008). Similarly, Sesleriella, which was described by Deyl (1946), was later recognised by Ujhelyi (1959a), Watson & Dallwitz (1992) and Conti & al. (2005), but is nowadays mostly included in Sesleria (e.g., Aeschimann & al., 2005; Fischer & al., 2008; Valdés & Scholz, 2009; Clayton & al., 2017). Recognition of Psilathera and Sesleriella as separate genera is also supported by morphological and anatomical features (Conert, 1992); the latter often provide important characters for the systematics of the Poaceae (e.g., Ellis, 1976; Lakušić, 1999). The most striking differences between Psilathera and Sesleria s.str. are in leaf anatomy, with cross-sections of Psilathera showing two to four lateral ribs with conspicuous intercostal crypts (Festuca-type of leaf blade cross section) and Sesleria s.str. and Sesleriella having a single midrib (Poa-type of leaf blade cross section; Fig. 7). Further, in Sesleriella and Psilathera leaf sheaths are open, whereas in Sesleria s.str. they are closed or open at the top only. In Sesleriella the central axis of the spike is very short and the caryopsis is glabrous, whereas in Sesleria s.str. and Psilathera the central axis of the spike is well developed and the caryopsis is hairy at the top. Segregation of Psilathera and Sesleriella increases the number of genera of flowering plants endemic to the European Alps from three (Berardia Vill., Physoplexis Schur, Rhizobotrya Tausch; Aeschimann & al., 2005) to five and further shifts the distributional imbalance towards the Eastern Alps, as only Berardia is restricted to the Western Alps. Two further points are worth mentioning. First, all five endemic genera are monospecific; the doubtful separation of two subspecies in Sesleriella sphaerocephala (Deyl, 1980; Valdés & Scholz, 2009; Clayton & al., 2017) is the single example of any taxonomically recognised intrageneric diversification. We emphasise that the divergence seen in the plastid data (Fig. 3) does not reflect the colour of the inflorescence, which is the main character separating the two subspecies (e.g., Fischer & al., 2008). Second, the main distribution areas of Psilathera and Sesleriella overlap with well-recognised centres of endemism in the Eastern Alps, i.e., the eastern Central Alps and the southeastern Calcareous Alps, respectively (Tribsch & Schönswetter, Table 3. Continued. Genus Section AFLP group Species Ploidy Deyl (1946) Sesleria (continued) Sesleria (continued) Juncifolia S. angustifolia (Hack. & Beck) Deyl 8x Calcaria S. apennina Ujhelyi p.p. 8x - S. calabrica (Deyl) Di Pietro 12x Rigida S. interrupta Vis. 4x, 8x Rigida S. juncifolia Suffren 8x Rigida S. kalnikensis Jáv. p.p. 4x, 8x Rigida S. serbica (Adamović) Ujhelyi p.p. 4x Rigida S. taygetea Hayek 4x Rigida S. ujhelyii Strgar 4x, 8x - S. achtarovii Deyl 4x Rigida S. bielzii Schur 8x Coerulans S. coerulans Friv. 4x, 8x Coerulans S. comosa Velen. 4x, 8x Coerulans S. filifolia Hoppe 4x, 8x Rigida S. klasterskyi Deyl 8x Coerulans S. phleoides Steven ex Roem. & Schult. 4x Phleoides S. rigida Heuff. ex Rchb. 4x Rigida S. serbica (Adamović) Ujhelyi p.p. 4x Rigida S. albanica Ujhelyi 12x - S. korabensis (Kümmerle & Jáv.) Deyl 8x Coerulans Coerulans Tenerrima Incertae sedis S. tenerrima (Fritsch) Hayek 4x, 8x Coerulans S. vaginalis Boiss. & Orph. 4x, 8x, 12x Nitida Version of Record 1361 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 2003), which have also been repeatedly confirmed by phylogeographic evidence (reviewed in Schönswetter & al., 2005). An origin of Sesleria s.str. in the Alps – or in adjacent areas – is not only suggested by the restriction of its progenitor genera Psilathera and Sesleriella to that mountain range (Fig. 1), but also by the distribution of early divergent haplotype groups (Fig. 3A). Haplotypes falling into these clades were not only detected in Sesleriella (H78–H82), but also in a group of closely related species (S. interrupta, S. juncifolia, S. serbica, S. ujhe­ lyii) from Sesleria s.str. (H83–H87, Violet haplotype group; Fig. 3) distributed from the southeastern vicinity of the Alps towards the southeast. The Red haplotype group, which is most closely connected to Sesleriella and to early-diverging Sesleria s.str. haplotypes in the parsimony network, spans the southern and eastern Balkan Peninsula and the Carpathians. It is thus widely separated from the closest occurrences of Sesleriella but adjacent to the Violet haplotype group from the northern Balkan Peninsula. The Red haplotype group is highly diverse, which may indicate long-term persistence in this area. The haplotype diversity pattern is in line with other phylogenetic studies in different plant groups, which have unravelled high genetic variation in the southern Balkan Peninsula (Lakušić & al., 2013; Surina & al., 2014; Caković & al., 2015; Đurović & al., 2017). In addition, H74 belonging to the Red haplotype group was detected in S. phleoides from eastern Anatolia and adjacent Armenia (Fig. 3B), suggesting range expansion from the Balkans to the Lesser Caucasus. All other haplotype groups comprise more closely related haplotypes than the Red haplotype group, indicating recent radiations. Genetic data support recognition of two sections within Sesleria s.str. but question Deyl’s (1946) species groups. — Our AFLP analyses allowed to test Deyl’s (1946) morphology-based sectional classification of Sesleria s.str. into S. sect. Argenteae and S. sect. Sesleria, and provided relatively detailed insights into intrasectional species groups. On the one hand, the AFLP data resolved Deyl’s two sections as non-overlapping clusters and identified S. vaginalis as a probably recently evolved intersectional hybrid (Fig. 5). The plastid data (Fig. 3) largely supported the sectional differentiation as 86% of accessions falling into the Red and Blue haplotype groups were from S. sect. Sesleria, whereas the Green haplotype group was mostly constituted by S. sect. Argenteae (90%). On the other hand, the AFLP-based species groups within the two sections strongly differed from Deyl’s informal groups (Fig. 6; Table 3). In addition, we observed no congruence between groups based on AFLPs and plastid haplotypes (Fig. 3A). Within S. sect. Argenteae only the geographically strongly isolated S. anatolica from the Caucasus and S. doerfleri from Crete received high bootstrap support. All other species received low support, indicating that interspecific relationships are poorly resolved. However, S. sect. Argenteae was differentiated into three well-defined groups, which we termed Argentea, Latifolia and Robusta groups. The Argentea group comprises S. argentea, S. italica (Pamp.) Ujhelyi, S. nitida Ten. and S. tuzsonii Ujhelyi and is distributed in the Iberian and Apennine Peninsulas. The inflorescences are fairly dense and wide, whereas in the Latifolia group they tend to be lax and narrower. The latter comprises S. alba, S. anatol­ ica, S. autumnalis (Scop.) F.W.Schultz, S. latifolia Degen and S. skipetarum and spans Mediterranean, sub-Mediterranean and supra-Mediterranean areas from the Apennine Peninsula to the Caucasus. Species belonging to these two groups are morphologically similar and have elongated cylindrical inflorescences as well as elongated rhizomes with prominent contractile portion; many species are growing in forests. The fact that S. skipetarum is nested within the Latifolia group is surprising, as its narrow leaves and spikes rather resemble S. insularis of S. sect. Sesleria, with which it was recently synonymised (Clayton & al., 2002–; Valdés & Scholz, 2009). Finally, the Robusta group restricted to the Balkan Peninsula and Crete comprises S. doerfleri, S. robusta Schott & al. and S. wettsteinii Dörfl. & Hayek, which all form robust tufts; they have very dense inflorescences, glabrous leaf sheaths and wide (up to 5.5 mm) leaves and often woody rhizomes. As in S. sect. Argenteae, geographically isolated species of S. sect. Sesleria such as S. achtarovii (Rhodope Mountains, Thasos), S. insularis (Corsica, Sardinia), S. phleoides (eastern Anatolia to Iran) and S. taygetea (Peloponnese) were strongly divergent. In addition, S. albanica, S. filifolia, S. heuflerana, S. serbica and S. uliginosa received bootstrap support values Fig. 7. Tiller leaf cross sections of Psilathera ovata (A), Sesleria filifolia (B) and Sesleriella sphaerocephala (C). Note that cross-sections of Psilathera show two to four lateral ribs with conspicuous intercostal crypts (Festuca-type of leaf blade cross section), whereas Sesleria s.str. and Sesleriella have a single midrib. 1362 Version of Record Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 > 50%. Sesleria sect. Sesleria was divided into seven genetic groups (Fig. 6); S. uliginosa and S. insularis form monospecific groups (Uliginosa group, Insularis group), whereas the remaining species fell into the Caerulea, Coerulans, Juncifolia 1, Juncifolia 2 and Tenerrima groups. The Caerulea group comprises S. apennina p.p., S. caerulea, S. heuflerana, S. kalniken­ sis p.p., S. pichiana, S. sadlerana Janka and S. tatrae (Degen) Deyl; it is widespread in central and western Europe, the northern Apennine Peninsula and the northwestern Balkan Peninsula, with a disjunct occurrence (S. heufflerana) in the Eastern Carpathians. The suggested occurrence of hybrids with intermediate morphological characters (Strgar, 1966, 1968) in the area of overlap with the Juncifolia groups in northeastern Italy was confirmed by strong admixture between the groups (Fig. 1). The Coerulans group includes S. achtarovii, S. bielzii Schur, S. coerulans Friv., S. comosa Velen., S. filifolia, S. klasterskyi Deyl, S. phleoides, S. rigida and S. serbica p.p. It is distributed in the eastern and central Balkan Peninsula and the Southern Carpathians, with disjunct occurrences from eastern Anatolia to Iran. The group is heterogeneous and comprises two morphologically and ecologically divergent subgroups. The first subgroup (S. bielzii, S. coerulans, S. comosa, S. klasterkyi, S. phleoides) contains high-mountain species growing in subalpine and alpine grasslands with hairy lemmas with a usually long (up to 4.5 mm) middle awn. The second subgroup (S. achtarovii, S. filifolia, S. rigida, S. serbica) comprises species inhabiting rock crevices, open grasslands and subalpine pastures, with lemmas sparsely pubescent to glabrous between the veins, and short middle awns (ca. 1 mm). Fine characteristics of leaf blade anatomy (involute to plicate in the first subgroup vs. conduplicate in the second subgroup) can also be used to easily differentiate these two subgroups. The amphiadriatic Juncifolia 1 and Juncifolia 2 groups are very closely related (Fig. 6B) and, consequently, comprise many admixed populations (Fig. 1). As they include strongly overlapping sets of species and show no geographic separation we here combine them in the Juncifolia group rather than discussing the two groups separately. Members of the Juncifolia group – S. angustifolia p.p., S. apennina p.p., S. calabrica, S. interrupta, S. juncifolia, S. kalnikensis p.p., S. serbica p.p., S. taygetea and S. ujhelyii – are primarily distributed in the Apennines and the Dinaric Mountains. Most species of the Juncifolia group can be easily distinguished from all other species of S. sect. Sesleria by the presence of reticulate old basal leaf sheaths. The inclusion of a few populations of other species with different morphology, such as S. angustifolia (Hack. & Beck) Deyl, S. coerulans, S. comosa and S. serbica, may be explained by introgressive hybridisation. The Tenerrima group comprises S. albanica, S. korabensis (Kumm. & Javorka) Deyl and S. tenerrima as well as a single population each of S. an­ gustifolia and S. coerulans; it is widespread in the southern Balkan Peninsula. Except for S. albanica, which has reticulate basal leaf sheaths as a typical morphological character of the Juncifolia group, species of the Tenerrima group are ecologically and morphologically similar to the Coerulans group. They are characterized by densely villous tiller leaf sheaths, and hairy lemmas with 2–3 mm long middle awn. Altogether, interspecific relationships within S. sect. Sesleria inferred by us differ from those suggested by Deyl (1946) (Table 3). For instance, whereas his “calcaria” and “uliginosa” groups correspond well with our Caerulea and Uliginosa groups, there is fundamental disagreement with his “coerulans” and “rigida” groups. Specifically, species from Deyl’s (1946) “rigida” group are clearly divided into our Juncifolia and Coerulans groups. In addition, S. taygetea and S. insularis classified in Deyl’s (1946) “rigida” group fell in our Juncifolia and Insularis groups, respectively. Furthermore, the species belonging to the Argentea and Latifolia groups were placed in Deyl’s (1946) “argentea” and “nitida” groups, but groupings are not congruent. From the species included in Deyl’s (1946) “nitida” group, S. nitida falls into the Argentea group, whereas S. doerfleri, S. robusta and S. wettsteinii constitute our Robusta group (Table 3) and S. vaginalis appears to be an intersectional hybrid (Fig. 5), thus we left it unclassified. From an evolutionary point of view, hybridization coupled with polyploidisation was likely responsible for diversification of Sesleria s.str. This is not only exemplified by (1) incongruence between nuclear (AFLP) and plastid phylogenies at the sectional level (10%–15% of individuals carry haplotypes of the other section; Fig. 4A), but also by (2) the intersectional position of S. vaginalis in the unconstrained AFLP analysis (Fig. 5). Moreover, (3) within the sections, AFLP groups and the plastid lineages fail to show any congruence (Fig. 4A), which may be explained by both differential sorting of ancestral polymorphisms and hybridization, two processes that are notoriously difficult to disentangle (Holder & al., 2001; Joly & al., 2006; Holland & al., 2008; Frajman & al., 2009). In addition, (4) most species are not resolved as monophyletic in the AFLP phylogeny; this concerns also morphologically well-defined and easily identifiable species such as S. autum­ nalis and S. comosa. Further, (5) some species exhibit mosaic combinations of morphological characters, partly across the sectional boundary. A good example is provided by dodecaploid S. albanica, which has reticulate basal leaf sheaths as typical for the Juncifolia group of S. sect. Sesleria and a leaf anatomy similar to the Robusta group of S. sect. Argenteae. TAXONOMIC TREATMENT Our molecular analyses have shown that previous infrageneric classifications of Sesleria (Deyl, 1980; Valdés & Scholz, 2009; Clayton & al., 2017) need to be revised. For the reasons outlined above we segregate Psilathera and Sesleriella from Sesleria. Within Sesleria, the two sections defined by Deyl (1946) can be retained with a slightly altered circumscription (Table 3). However, there was a strong need to modify Deyl’s informal infrasectional classification; a new concept based on AFLP data is proposed in Table 3. Below we provide an identification key to the genera of the tribe Seslerieae and the two sections of Sesleria s.str. as well as a taxonomic treatment for Psilathera, Sesleriella and Sesleria. A taxonomic treatment for all species included in Sesleria s.str. is beyond the scope of our study. Version of Record 1363 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Key to the genera of tribe Seslerieae 1 1 2 2 3 3 4 4 5 5 6 6 Annuals ........................................................ 2 Rhizomatous perennials ..................................... 3 Inflorescence spike-like, unilateral. Spikelets laterally compressed, with 1 floret ........................... Mibora Inflorescence a dense, ovoid or globose, prickly head. Spikelets subsessile, somewhat compressed laterally, with (1)3–4 florets . ..................................... Echinaria Inflorescence a distichous or unilateral spike-like panicle; bracts at base of inflorescence absent, or very small. Lemma obscurely 5- to 7-veined, usually not awned. Palea shorter than lemma ............................... Oreochloa Inflorescence spike-like, cylindrical to globose, bracts at base of inflorescence well-developed. Lemma 5-veined, with 2–5 usually aristulate teeth at apex. Palea as long as or longer than lemma ........................................ 4 Stems not more than 15 cm long at anthesis; ligule more than 0.5 mm long; sheaths open ............................ 5 Stems usually more than 15 cm long at anthesis; ligule usually less than 0.5 mm; sheaths closed, or open at the top only ........................................................ 6 Bracts ovate to lanceolate; spikelets with 2–3 florets; lemma with 5 awns, the middle 1.8–2.5 mm ........... Psilathera Bracts suborbicular; spikelets often with 4 florets; lemma with 1 or 3 inconspicuous awns, middle (if more than one present) not longer than 1 mm .................. Sesleriella Leaves with more than 13 sclerenchymatic girders, mostly glabrous. Lemmas glabrous or slightly pubescent between the veins. Uppermost culm leaf ca. 3–8 cm ................ ...................................... Sesleria sect. Argenteae Leaves with fewer than 13 sclerenchymatic girders, mostly hairy. Lemmas sparsely ciliate to densely villous. Uppermost culm leaf ca. 1–3 cm .. Sesleria sect. Sesleria Psilathera Link, Hort. Berol. 1: 121. 1827 – Type: Psilathera ovata (Hoppe) Deyl (≡ Sesleria ovata Hoppe). Included species. – Psilathera ovata (Hoppe) Deyl in Opera Bot. Čech. 3: 223. 1946. Monospecific genus. Distribution. – Throughout most of the Eastern Alps from the Ortler mountain range in Südirol-Alto Adige (Italy) in the west to the southeastern and northeastern Calcareous Alps (Austria, Germany, Italy, Slovenia); disjunct in the Alpi Graie/ Alpes grées (Vanoise, France; Gran Paradiso group, Italy). Sesleria Scop., Fl. Carniol.: 189. 1760 – Type (unintentionally designated by Hubbard in Farr & al. in Regnum Veg. 102: 1607. 1979, and confirmed by Foggi & al. in Taxon 50: 1104. 2001): Sesleria caerulea (L.) Ard. (≡ Cynosurus caeruleus L.). Distribution. – From Spain to the Caucasus and Iran, and from Iceland and Scandinavia to Morocco, Libya and Lebanon. Sesleria sect. Argenteae Deyl in Opera Bot. Čech. 3: 77. 1946 – Type (designated here): Sesleria argentea (Savi) Savi (≡ Festuca argentea Savi). Included species. – Sesleria alba Sm., S. anatolica Deyl, 1364 S. argentea (Savi) Savi, S. autumnalis (Scop.) F.W.Schultz, S. doerfleri Hayek, S. italica (Pamp.) Ujhelyi, S. latifolia (Adamović) Degen, S. nitida Ten., S. robusta Schott & al., S. skipetarum Ujhelyi, S. tuzsonii Ujhelyi, S. wettsteinii Dörfl. & Hayek. Distribution. – Mediterranean, sub-Mediterranean and supra-Mediterranean areas. From the Iberian and Apennine Peninsulas to the western Caucasus and to Morocco. Sesleria sect. Sesleria ≡ Sesleria sect. Calcariae Deyl in Opera Bot. Čech. 3: 77. 1946 – Type: Cynosurus caeruleus L. Included species. – Sesleria achtarovii Deyl, S. albanica Ujhelyi, S. angustifolia (Hack. & Beck) Deyl, S. apennina Ujhelyi, S. bielzii Schur, S. caerulea (L.) Ard., S. calabrica (Deyl) Di Pietro, S. coerulans Friv., S. comosa Velen., S. filifolia Hoppe, S. heuflerana Schur, S. insularis Sommier, S. inter­ rupta Vis., S. juncifolia Suffren, S. kalnikensis Jáv., S. klaster­ skyi Deyl, S. korabensis (Kümmerle & Jáv.) Deyl, S. phleoides Roem. & Schult., S. pichiana Foggi & al., S. rigida Rchb., S. sadlerana Janka, S. serbica (Adamović) Ujhelyi, S. tatrae (Degen) Deyl, S. taygetea Hayek, S. tenerrima (Fritsch) Hayek, S. ujhelyii Strgar, S. uliginosa Opiz. Distribution. – From western and northwestern Europe (Iberian Peninsula, Ireland, Scandinavia) across central Europe, the Apennine and Balkan Peninsulas and the Carpathians to the southern Caucasus (eastern Anatolia to Iran). Sesleriella Deyl in Opera Bot. Čech. 3: 230. 1946 – Type: Sesleriella sphaerocephala (Ard.) Deyl (≡ Sesleria sphaer­ ocephala Ard.). Included species. – Sesleriella sphaerocephala (Ard.) Deyl in Opera Bot. Čech. 3: 230. 1946. Monospecific genus. Distribution. – Throughout the southern Eastern Alps from the Alpi Bergamasche (Italy) to the Karavanke/Karawanken (southeastern-most Switzerland, Italy, Austria, Slovenia). Incertae sedis. — Sesleria vaginalis Boiss. & Orph. ACKNOWLEDGEMENTS This study was financed by the European Commission in the SEE-ERA.NET PLUS framework (project “Evolution, biodiversity and conservation of indigenous plant species of the Balkan Peninsula”, acronym: BalkBioDiv, to P.S.). We acknowledge the financial support provided by the Serbian Ministry of Education, Science and Technological Development (project no. 173030 to D. Lakušić). Our thank goes to all collectors listed in Appendix 1/Electr. Suppl.: Table S1, to M. Magauer, D. Pirkebner and M. Winkler for performing the laboratory work in an excellent way, as well as to R. Riina (Real Jardín Botánico, Madrid, Spain) and F. Conti (Parco Nazionale del Gran Sasso e Monti della Laga – Università di Camerino, Italy) that provided the material of outgroup species for sequencing. We are most grateful to P. Daniel Schlorhaufer, M. Imhiavan and their colleagues from the Botanical Gardens of the University of Innsbruck for successfully cultivating our living collection of Sesleria. O. Lepais (INRA Bordeaux-Aquitaine Centre, France) helped with the DAPC analysis. Version of Record Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Two anonymous reviewers and the editors H.-P. Comes, J.W. Kadereit, J. Prado and F. Stadler provided valuable comments, which improved the previous version of the manuscript. LITERATURE CITED Aeschimann, D., Lauber, K., Moser, D.M. & Theurillat, J.P. 2005. Flora Alpina, vol. 2. Berne: Haupt. Alegro, A. 2007. Sistematika i rasprostranjenost kompleksa Sesleria juncifolia na području Dinarida = Systematics and distribution of Sesleria juncifolia complex in the Dinaric area. Dissertation, Faculty of Mathematics and Natural Sciences, University of Zagreb, Croatia. [In Croatian with English summary] Arrigoni, P.V. 1983. Le piante endemiche della Sardegna. Boll. Soc. Sarda Sci. Nat. 22: 259–316. Arrigo, N., Tuszynski, J.W., Ehrich, D., Gerdes, T. & Alvarez, N. 2009. Evaluating the impact of scoring parameters on the structure of intra-specific genetic variation using RawGeno, and R package for automating AFLP scoring. B. M. C. Bioinf. 10: 33. https://doi.org/10.1186/1471-2105-10-33 Bews, J.W. 1929. The world’s grasses: Their differentiation, distribution, economics, and ecology. London, New York: Longmans, Green. Brullo, S. & Guisso del Galdo, G.P. 2006. Taxonomic remarks on Sesleria nitida Ten. (Poaceae), an orophyte endemic to Sicily and the central-southern Apennines. Pl. Biosyst. 140: 43–49. https://doi.org/10.1080/11263500500519911 Budzáková, M., Hodálová, I., Mereda, P., Jr., Somlyay, L., Bisbing, S.M. & Šibík, J. 2014. Karyological, morphological and ecological differentiation of Sesleria caerulea and S. tatrae in the Western Carpathians and adjacent regions. Preslia 86: 245–277. Bussell, J.D., Waycott, M. & Chappill, J.A. 2005. Arbitrarily amplified DNA markers as characters for phylogenetic inference. Perspect. Pl. Ecol. Evol. Syst. 7: 3–26. https://doi.org/10.1016/j.ppees.2004.07.001 Caković, D., Stešević, D., Schönswetter, P. & Frajman, B. 2015. How many taxa? Spatiotemporal evolution and taxonomy of Amphoricarpos (Asteraceae, Carduoideae) on the Balkan Peninsula. Organisms Diversity Evol. 15: 429–445. https://doi.org/10.1007/s13127-015-0218-6 Catalán, P., Kellogg, E.A. & Olmstead, R.G. 1997. Phylogeny of Poaceae subfamily Pooideae based on chloroplast ndhF gene sequences. Molec. Phylogen. Evol. 8: 150–166. https://doi.org/10.1006/mpev.1997.0416 Catalán, P., Torrecilla, P., Rodríguez, J.A.L. & Olmstead, R.G. 2004. Phylogeny of the festucoid grasses of subtribe Loliinae and allies (Poeae, Pooideae) inferred from ITS and trnL-F sequences. Molec. Phylogen. Evol. 31: 517–541. https://doi.org/10.1016/j.ympev.2003.08.025 Ciocarlan, V. 2009. Flora ilustrată a României, Pteridophyta et Spermatophyta. Bucharest: Ceres. Clayton, W.D. & Renvoize, S.A. 1986. Genera graminum – Grasses of the world. Kew Bulletin Additional Series 13. Richmond: Royal Botanic Gardens, Kew. Clayton, W.D., Vorontsova, M.S., Harman, K.T. & Williamson, H. 2002–. World grass species: Synonymy. http://www.kew.org/data/ grasses-syn.html (accessed 10 Jan 2017). Clayton, W.D., Govaerts, R.H.A., Vorontsova, M.S., Harman, K.T. & Williamson, H. 2017. World checklist of Poaceae. Facilitated by the Royal Botanic Gardens, Kew. Published on the Internet. http:// apps.kew.org/wcsp/ (accessed 10 Jan 2017). Clement, M., Posada, D. & Crandall, K.A. 2000. TCS: A computer program to estimate gene genealogies. Molec. Ecol. 9: 1657–1660. https://doi.org/10.1046/j.1365-294x.2000.01020.x Conert, H.J. 1992. Sesleria Scop. Pp. 473–486 in: Hegi, G. (ed.), Illustrierte Flora von Mitteleuropa, vol. 1(3). Berlin: Parey. Conti, F., Abbate, G., Alessandrini, A. & Blasi, C. (eds.) 2005. An annotated checklist of the Italian vascular flora. Rome: Palombi & Partner. Corriveau, J.L. & Coleman A.W. 1988. Rapid screening method to detect potential biparental inheritance of plastid DNA and results for over 200 angiosperm species. Amer. J. Bot. 75: 1443–1458. Davis, J.I. & Soreng, R.J. 1993. Phylogenetic structure in the grass family (Poaceae) as inferred from chloroplast DNA restriction site variation. Amer. J. Bot. 80: 1444–1454. Davis, P.H. (ed.) 1985. Flora of Turkey and the East Aegean Islands, vol. 9. Edinburgh: Edinburgh University Press. Deyl, M. 1946. Study of the genus Sesleria. Opera Bot. Čech. 3: 1–246. Deyl, M. 1980. Sesleria Scop. Pp. 173–177 in: Tutin, T.G., Heywood, V.H., Burges, N.A., Moore, D.M., Valentine, D.H., Walters, S.M. & Webb, D.A. (eds.), Flora Europaea, vol. 5, Alismataceae to Orchidaceae. Cambridge: Cambridge University Press. Di Pietro, R. 2007. Taxonomic features of Sesleria calabrica (Poaceae), a neglected species from southern Italy. Folia Geobot. 42: 289–313. https://doi.org/10.1007/BF02806468 Di Pietro, R., D’Amato, G. & Trombetta, B. 2005. Karyology and distribution of Sesleria tenuifolia complex in the Italian Peninsula. Nordic J. Bot. 23: 615–623. https://doi.org/10.1111/j.1756-1051.2003.tb00442.x Di Pietro, R., Kuzmanović, N., Iamonico, D., Pignotti, L., Barina, Z., Lakušić, D. & Alegro, A. 2013. Typification of names in the Sesleria juncifolia species complex (Poaceae). Phytotaxa 152: 18–32. https://doi.org/10.11646/phytotaxa.152.1.2 Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Cooper, A., Duran, C., Field, M., Heled, J., Kearse, M., Markowitz, S. Moir, R., Stones-Havas, S., Sturrock, S., Thierer, T. & Wilson, A. 2011. Geneious, version 5.4. Auckland: Biomatters. http://www.geneious.com/ Đurović, S., Schönswetter, P., Niketić, M., Tomović, G. & Frajman, B. 2017. Disentangling relationships among the members of the Silene saxifraga alliance (Caryophyllaceae): Phylogenetic structure is geographically rather than taxonomically segregated. Taxon 66: 343–364. https://doi.org/10.12705/662.4 Ellis, R. 1976. A procedure for standardizing comparative leaf anatomy in the Poaceae. Ι. The leaf-blade as viewed in transverse section. Bothalia 12: 65–109. Fischer, M.A., Oswald, K. & Adler, W. 2008. Exkursionsflora für Österreich, Liechtenstein und Südtirol, ed. 3. Linz: Biologiezentrum der Oberösterreichischen Landesmuseen. Foggi, B., Nardi, E. & Rossi, G. 2001. Nomenclatural notes and typification in Sesleria Scop. (Poaceae). Taxon 50: 1101–1106. https://doi.org/10.2307/1224726 Foggi, B., Rossi, G. & Pignotti, L. 2007. Sesleria pichiana (Poaceae): A new species from north-west Italian peninsula. Webbia 62: 1–10. https://doi.org/10.1080/00837792.2007.10670813 Frajman, B., Eggens, F. & Oxelman, B. 2009. Hybrid origins and homoploid reticulate evolution within Heliosperma (Sileneae, Caryophyllaceae) – A multigene phylogenetic approach with relative dating. Syst. Biol. 58: 328–345. Gillespie, L.J., Soreng, R.J., Bull, R.D., Surrey, W.L. & RefulioRodriguez, N.F. 2008. Phylogenetic relationships in subtribe Poinae (Poaceae, Poeae) based on nuclear ITS and plastid trnT­ trnL-trnF sequences. Botany 86: 938–967. https://doi.org/10.1139/B08-076 Grass Phylogeny Working Group 2001. Phylogeny and subfamilial classification of the grasses (Poaceae). Ann. Missouri Bot. Gard. 88: 373–457. https://doi.org/10.2307/3298585 Guinochet, M. & Vilmorin, R. 1978. Flore de France, vol. 3. Paris: CNRS. Hammer, Ø., Harper, D.A.T. & Ryan, P.D. 2001. PAST: Paleontological statistics software pachage for education and data analysis. Palaeontol. Electronica 4: 1–9. http://palaeo-electronica.org/2001_1/past/issue1_01.htm Version of Record 1365 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Hochbach, A., Schneider, J. & Röser, M. 2015. A multi-locus analysis of phylogenetic relationships within grass subfamily Pooideae (Poaceae) inferred from sequences of nuclear single copy gene regions compared with plastid DNA. Molec. Phylogen. Evol. 87: 14–27. https://doi.org/10.1016/j.ympev.2015.03.010 Holder, M.T., Anderson, J.A. & Holloway, A.K. 2001. Difficulties in detecting hybridization. Syst. Biol. 50: 978–982. https://doi.org/10.1080/106351501753462911 Holland, B.R., Benthin, S., Lockhart, P.J., Moulton, V. & Huber, K.T. 2008. Using supernetworks to distinguish hybridization from incomplete lineage sorting. B. M. C. Evol. Biol. 8: 202. https://doi.org/10.1186/1471-2148-8-202 Hsiao, C., Chatterton, N.J., Asay, K.H. & Jensen, K.B. 1994. Phylogenetic relationships of 10 grass species: An assessment of phylogenetic utility of the internal transcribed spacer region in nuclear ribosomal DNA in monocots. Genome 37: 112–120. Jogan, N. 2007. Poaceae. Pp. 873–876 in: Martinčič, A., Wraber, T., Jogan, N., Podobnik, A., Turk, B., Vreš, B., Ravnik, V., Frajman, B., Strgulc Krajšek, S., Trčak, B., Bačič, T., Fischer, M.A., Eler, K. & Surina, B., Mala flora Slovenije. Ključ za določanje praprotnic in semenk. Ljubljana: Tehniška založba Slovenije. Jombart, T. 2008: adegenet: A R package for the multivariate analysis of genetic markers. Bioinformatics 24: 1403–1405. https://doi.org/10.1093/bioinformatics/btn129 Jombart, T., Devillard, S. & Balloux, F. 2010. Discriminant analysis of principal components: A new method for the analysis of genetically structured populations. B. M. C. Genet. 11: 94. https://doi.org/10.1186/1471-2156-11-94 Joly, S., Starr, J.S., Lewis, W.H. & Bruneau, A. 2006. Polyploid and hybrid evolution in roses east of the Rocky Mountains. Amer. J. Bot. 93: 412–425. https://doi.org/10.3732/ajb.93.3.412 Kellogg, E.A. & Watson, L. 1993. Phylogenetic studies of a large data set. I. Bambusoideae, Andropogonoeae and Pooideae (Gramineae). Bot. Rev. (Lancaster) 59: 273–320. Kožuharov, S. & Petrova, A. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77. Kuzmanović, N. & Schönswetter, P. 2016. No confirmation for previously suggested presence of diploid cytotypes of Sesleria (Poaceae) on the Balkan Peninsula. Biologia 71: 639–641. https://doi.org/10.1515/biolog-2016-0087 Kuzmanović, N., Comanescu, P., Frajman, B., Lazarević, M., Paun, O., Schönswetter, P. & Lakušić, D. 2013a. Genetic, cytological and morphological differentiation within the Balkan-Carpathian Sesleria rigida sensu Fl. Eur. (Poaceae), a taxonomically intricate tetraploid-octoploid complex. Taxon 62: 458–472. https://doi.org/10.12705/623.13 Kuzmanović, N., Vukojičić, S., Barina, Z. & Lakušić, D. 2013b. Sesleria serbica (Poaceae), a neglected species of the Balkan Peninsula. Bot. Serbica 37: 113–120. Kuzmanović, N., Barina, Z., Šida, O. & Lakušić, D. 2015. Typification of names in the group Coerulans of the genus Sesleria (Poaceae). Phytotaxa 202: 103–120. https://doi.org/10.11646/phytotaxa.202.2.3 Lakušić, D. 1999. Ekološka i morfološka diferencijacija uskolisnih vijuka (Festuca L. subgen. Festuca) na prostoru Durmitora = Ecological and morphological differentiation of narrow­leaved fescue (Festuca L. subgen. Festuca) in the area of Mt. Durmitor. Dissertation, Faculty of Biology, University of Belgrade, Belgrade, Serbia. [In Serbian with English summary] Lakušić, D., Liber, Z., Nikolić, T., Surina, B., Kovačić, S., Bogdanović, S. & Stefanović, S. 2013. Molecular phylogeny of the Campanula pyramidalis species complex (Campanulaceae) inferred from chloroplast and nuclear non-coding sequences and its taxonomic implications. Taxon 62: 505–524. https://doi.org/10.12705/623.1 Lazarević, M., Kuzmanović, N., Lakušić, D., Alegro A., Schönswetter, P. & Frajman, B. 2015. Patterns of cytotype distribution and genome size variation in the genus Sesleria Scop. (Poaceae). Bot. J. Linn. Soc. 179: 126–143. https://doi.org/10.1111/boj.12306 1366 Linder, C.R. & Rieseberg, L.H. 2004. Reconstructing patterns of reticulate evolution in plants. Amer. J. Bot. 91: 1700–1708. Link, F. 1827. Hortus regius botanicus Berolinensis, vol. 1. Berolini [Berlin]: apud G. Reimer. https://doi.org/10.5962/bhl.title.13688 Lysak, M.A. & Doležel, J. 1998. Estimation of nuclear DNA content in Sesleria (Poaceae). Caryologia 51: 123–132. https://doi.org/10.1080/00087114.1998.10589127 Lysak, M.A., Číhalíková, J. & Doležel, J. 1997. Morphometric and kariological analysis of a population of Sesleria sadleriana Janka in the Biele Karpaty Mountains (Slovakia). Folia Geobot. Phytotax. 32: 47–55. https://doi.org/10.1007/BF02803884 Lysak, M.A., Rostkova, A., Dixon, J.M., Rossi, G. & Doležel, J. 2000. Limited genome size variation in Sesleria albicans. Ann. Bot. (Oxford) 86: 399–403. https://doi.org/10.1006/anbo.2000.1200 Maire, R., Guinochet, M. & Faurel, L. 1953. Flore de l’Afrique du Nord, vol. 2. Paris: P. Lechevalier. Mössler, J.C. 1829. Handbuch der Gewächskunde: Enthaltend eine Flora von Deutschland, mit Hinzufügung der wichtigsten auslän­ dischen Cultur-Pflanzen, ed. 2, vol. 3. Altona: J.F. Hammerich. https://hdl.handle.net/2027/mdp.39015061234772 Nadot, S., Bajon, R. & Lejeune, B. 1994. The chloroplast gene rps4 as a tool for the study of Poaceae phylogeny. Pl. Syst. Evol. 191: 27–38. https://doi.org/10.1007/BF00985340 Nei, M. & Li, W.H. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. U.S.A. 76: 5269–5273. https://doi.org/10.1073/pnas.76.10.5269 Nylander, J.A.A. 2004. MrAIC.pl. Program distributed by the author. Uppsala: Evolutionary Biology Centre, Uppsala University. https:// github.com/nylander/MrAIC Pamilo, P. & Nei, M. 1988. Relationships between gene trees and species trees. Molec. Biol. Evol. 5: 568–583. Paradis, E., Claude, J. & Strimmer, K. 2004. APE: Analyses of phylogenetics and evolution in R language. Bioinformatics 20: 289–290. https://doi.org/10.1093/bioinformatics/btg412 Petrova, A. 2000. Karyological study of some species of Sesleria (Poaceae) growing in Bulgaria. Bot. Chron. (Patras) 13: 133–140. Pignatti, S. 1982. Flora d’Italia, vol. 3. Bologna: Edagricole. Quintanar, A., Castroviejo, S. & Catalan, P. 2007. Phylogeny of the tribe Aveneae (Pooideae, Poaceae) inferred from plastid trnT-F and nuclear ITS sequences. Amer. J. Bot. 94: 1554–1569. https://doi.org/10.3732/ajb.94.9.1554 R Development Core Team 2012. R: A language and environment for statistical computing. Vienna: R Foundation for Statistical Computing. http://www.R-project.org (accessed 15 Oct 2016). Rebernig, C.A., Schneeweiss, G.M., Bardy, K.E., Schönswetter, P., Villasenor, J.L., Obermayer, R., Stuessy, T.F. & WeissSchneeweiss, H. 2010. Multiple Pleistocene refugia and Holocene range expansion of an abundant southwestern American desert plant species (Melampodium leucanthum, Asteraceae). Molec. Ecol. 19: 3421–3443. https://doi.org/10.1111/j.1365-294X.2010.04754.x Reisch, C., Poschlod, P. & Wingender, R. 2003. Genetic differentiation among populations of Sesleria albicans Kit. ex Schultes (Poaceae) from ecologically different habitats in central Europe. Heredity 91: 519–527. https://doi.org/10.1038/sj.hdy.6800350 Ronquist, F., Teslenko, M., Van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M.A. & Huelsenbeck, J.P. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 61: 539–542. https://doi.org/10.1093/sysbio/sys029 Saarela, J.M., Liu, Q., Peterson, P.M., Soreng, R.J. & Paszko, B. 2010. Phylogenetics of the grass ‘Aveneae-type plastid DNA clade’ (Poaceae: Pooideae, Poeae) based on plastid and nuclear ribosomal DNA sequence data. Pp. 557–587 in: Seberg, O., Petersen, G., Barfod, A. & Davis, J.I. (eds.), Diversity, phylogeny, and evolu­ tion in the monocotyledons. Denmark: Aarhus University Press. Saarela, J.M., Wysocki, W.P., Barrett, C.F., Soreng, R.J., Davis, J.I., Clark, L.G., Kelchner, S.A., Pires, J.C., Edger, P.P., Mayfield, Version of Record Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 D.R. & Duvall, M.R. 2015. Plastid phylogenomics of the coolseason grass subfamily: Clarification of relationships among earlydiverging tribes. AoB Plants 7: plv046. https://doi.org/10.1093/aobpla/plv046 Schneider, J., Döring, E., Hilu, K.W. & Röser, M. 2009. Phylogenetic structure of the grass subfamily Pooideae based on comparison of plastid matK gene-3′trnK exon and nuclear ITS sequences. Taxon 58: 404–424. Schönswetter, P., Stehlik, I., Holderegger, R. & Tribsch, A. 2005. Molecular evidence for glacial refugia of mountain plants in the European Alps. Molec. Ecol. 14: 3547–3555. https://doi.org/10.1111/j.1365-294X.2005.02683.x Schönswetter, P., Solstad, H., García, P.E. & Elven, R. 2009. A combined molecular and morphological approach to the taxonomically intricate European mountain plant Papaver alpinum s.l. (Papaveraceae) – Taxa or informal phylogeographical groups? Taxon 58: 1326–1343. Schultz, K.H. 1832. Natürliches System des Pflanzenreichs nach seiner inneren Organisation; nebst einer vergleichenden Darstellung der wichtigsten aller früheren künstlichen und natürlichen Pflanzensysteme. Berlin: im Verlage von August Hirschwald. Shaw, J., Lickey, E.B., Schilling, E.E. & Small, R.L. 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: The tortoise and the hare III. Amer. J. Bot. 94: 275–288. https://doi.org/10.3732/ajb.94.3.275 Soreng, R.J. & Davis, J.I. 1998. Phylogenetics and character evolution in the grass family (Poaceae): Simultaneous analysis of morphological and chloroplast DNA restriction site character sets. Bot. Rev. (Lancaster) 64: 1–85. https://doi.org/10.1007/BF02868851 Soreng, R.J. & Davis, J.I. 2000. Phylogenetic structure in Poaceae subfamily Pooideae as inferred from molecular and morphological characters: Misclassification versus reticulation. Pp. 61–74 in: Jacobs, S.W.L. & Everett, J. (eds.), Grasses: Systematics and evo­ lution [= Proceedings of the Third International Conference on Grass Systematics and Evolution, Sydney, September 1998, vol. 2]. Melbourne: CSIRO. Soreng, R.J., Davis, J.I. & Doyle, J.J. 1990. A phylogenetic analysis of chloroplast DNA restriction site variation in Poaceae subfam. Pooideae. Pl. Syst. Evol. 172: 83–97. https://doi.org/10.1007/BF00937800 Soreng, R.J., Davis, J.I. & Voionmaa, M.A. 2007. A phylogenetic analysis of Poaceae tribe Poeae sensu lato based on morphological characters and sequence data from three plastid-encoded genes: Evidence for reticulation, and a new classification for the tribe. Kew Bull. 62: 425–454. Strgar, V. 1966. Zur Unterscheidung der Komplexe Sesleria calcaria und Sesleria tenuifolia in Slowenien und Kroatien. Biol. Vestn. 14: 53–56. Strgar, V. 1968. Geografska razširjenost in taksonomsko razlikovanje skupin Calcaria Deyl in Tenuifolia Pawlowski genusa Sesleria Scop. na Hrvaškem in v Sloveniji. Dissertation Biotechnical Faculty, Department of Biology, University of Ljubljana, Ljubljana, Slovenia. [In Slovenian] Strgar, V. 1973. Zur Verbreitung von Sesleria angustifolia (Hachel & Beck) Deyl in Bosnien und Serbien sowie Sesleria autumnalis (Scop.) F.W. Schulz in Mazedonien. Biol. Vestn. 21: 127–155. Strgar, V. 1979. Kromosomska števila treh balkanskih seslerij. Biol. Vestn. 27: 71–74. Strgar, V. 1980. Sesleria na subpanonskem vegetacijskem območju severnovzhodne Slovenije in severozahodne Hrvaške. Biol. Vestn. 28: 99–116. Strgar, V. 1981. Die Sippenstruktur von Sesleria auf der Balkanhalbinsel. Bot. Jahrb. Syst. 102: 215–224. Strgar, V. 1982. Sesleria ujhelyii spec. nova. Biol. Vestn. 30: 155–170. Strgar, V. 1985. Sesleria na območju karte Postojna L 33–77 v južni Sloveniji. Biol. Vestn. 33: 61–72. Strgar, V. 1988. Der Nordwestteil des Areals des Komplexes Sesleria juncifolia, 2 Posočje, Trnovski gozd. Biol. Vestn. 36: 63–78. Strgar, V. 1990. Der Nordwestteil des Areals des Komplexes Sesleria juncifolia, 1. Biol. Vestn. 38: 81–96. Sun, Y., Skinner, D.Z., Liang, G.H. & Hulbert, S.H. 1994. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theor. Appl. Genet. 89: 26–32. https://doi.org/10.1007/BF00226978 Surina, B., Schneeweiss, G.M., Glasnović, P. & Schönswetter, P. 2014. Testing the efficiency of nested barriers to dispersal in the Mediterranean high mountain plant Edraianthus graminifolius (Campanulaceae). Molec. Ecol. 23: 2861–2875. https://doi.org/10.1111/mec.12779 Swofford, D.L. 2002. PAUP*. Phylogenetic analysis using parsimony (*and other methods), version 4. Sunderland, Mass.: Sinauer. Tashev, A. & Dimitrov, D. 2012. Sesleria rhodopaea Tashev & Dimitrov (Poaceae) sp. nova – A new graminean from Bulgaria. Compt. Rend. Acad. Bulg. Sci. 65: 169–172. Tribsch, A. & Schönswetter P. 2003. Patterns of endemism and comparative phylogeography confirm palaeo-environmental evidence for Pleistocene refugia in the Eastern Alps. Taxon 52: 477–497. Tutin, T.G., Heywood, V.H., Burges, N.A., Moore, D.M., Valentine, D.H., Walters, S.M. & Webb, D.A. (eds.) 1980. Flora Europaea, vol. 5, Poaceae. Cambridge: Cambridge University Press. Ujhelyi, J. 1938. Sesleria Studien. Index Horti Bot. Univ. Budapest 4: 109–142. Ujhelyi, J. 1940. Contributions à la systématique du groupe de Sesleria autumnalis. Index Horti Bot. Univ. Budapest 5: 60–77. Ujhelyi, J. 1959a. Révision des espèces du genre «Sesleria» en Italie. Webbia 14: 597–613. Ujhelyi, J. 1959b. Species Sesleriae generis novae. Feddes Repert. Spec. Nov. Regni Veg. 62: 59–70. https://doi.org/10.1002/fedr.19590620108 Ujhelyi, J. 1960. Weitere zytotaxonomische Beiträge zur Kenntnis der Gattung Sesleria. Bot. Közlem. 48: 278–280. Ujhelyi, J. 1965. Trib. Poeae subtrib. Sesleriinae. Pp. 90–91 in: Meusel, H., Jäger, E. & Weinert, E. (eds.), Vergleichende Chorologie der zentraleuropäischen Flora, vol. 1. Jena: Fischer. Ujhelyi, J. & Felföldy, L.J.M. 1948. Cyto-taxonomical studies of Sesleria sadleriana Janka and S. varia (Jacq.) Wettst. Arch. Biol. Hung. 18: 52–58. Valdés, B., Scholz, H. (with contributions from Raab-Straube, E. von & Parolly, G.) 2009. Poaceae (pro parte majore). Euro+Med Plantbase – The information resource for Euro-Mediterranean plant diversity. http://ww2.bgbm.org/EuroPlusMed/PTaxonDetail. asp?NameId=136237&PTRefFk=7100000 (accessed 10 Jan 2017). Van de Peer, Y. & De Wachter, R. 1997. Construction of evolutionary distance trees with TREECON for Windows: Accounting for variation in nucleotide substitution rate among sites. Computer Applic. Biosci. 13: 227–230. Vos, P., Hogers, R., Bleeker, M., Reijans, M., Van de Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M. & Zabeau, M. 1995. AFLP: A new technique for DNA fingerprinting. Nucl. Acids Res. 23: 4407–4414. https://doi.org/10.1093/nar/23.21.4407 Watson, L. & Dallwitz, M.J. 1992. The grass genera of the world. Wallingford: CAB International. Wendel, J.F., Schnabel, A. & Seelanan, T. 1995. Bidirectional interlocus concerted evolution following allopolyploid speciation in cotton (Gossypium). Proc. Natl. Acad. Sci. U.S.A. 92: 280–284. Version of Record 1367 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Appendix 1. Specimens used in this study. For an extended tabular version (including ID, longitude/latitude and information about ecology, substrate, plastid haplotype, haplotype group, estimated ploidy and number of individuals included in AFLPs) see Electr. Suppl.: Table S1. More information can be retrieved from http://www.uibk.ac.at/botany/balkbiodiv/?BALKBIODIV under “Sampling sites”. Taxon name + authority, Country, Collector(s) + Collector number, Herbarium code + voucher number/barcode), ITS GenBank number, Plastid DNA GenBank number. A dash (–) indicates missing data. All sequences listed in this Appendix are new. Ammochloa involucrata Murb., Morocco, Vargas, Luceño, Martínez Escribano, Guzmán s.n. (MA 642978), MF155199, KY910435; Ammochloa palaestina Boiss., Tunisia, C. Acedo, I. Aizpuru, I. Alvarez, J. Calvo, S. Castroviejo, A. Ferjani, J. Guemes, A. Herrero, L. Medina, J.F. Munoz Garmendia, C. Navarro, J. Pedroi, A. Prunell, A. Quintanar, E. Rico, V. Rodriguez Garcia, M. Sequeira, S. Villegas 3146 (MA 797964), –, KY910436; Cynosurus echinatus L., Serbia, S. Jovanović, S. Vukojičić, S. Pavić s.n. (BEOU 1612/95), MF155200, KY910437; Cynosurus echinatus L., Serbia, D. Stojanović s.n. (BEOU 28615), MF155201, KY910438; Echinaria capitata (L.) Desf., Italy, S. Torcoletti & G.S. Torcoletti & G. Santoni s.n. (APP 20133), MF155202, KY910439; Echinaria capitata (L.) Desf., Italy, F. Conti, B. Santucci, M. Miglio s.n. (APP 33309), MF155203, KY910440; Festucopsis sancta (Janka) Melderis, Greece, D. Lakušić, B. Lakušić s.n. (BEOU 31560), –, KY910434; Mibora minima (L.) Desv., France, G. Dutartre s.n. (MA 628209), MF155204, KY910443; Mibora minima (L.) Desv., The Netherlands, O. Goubitz s.n. (MA 367308), –, KY910442; Oreochloa disticha (Wulf.) Link, Austria, B. Frajman, P. Schönswetter s.n. (IB 12836), MF155205, KY910444; Oreochloa disticha (Wulfen) Link, Italy, D. Lakušić, N. Kuzmanović s.n. (BEOU 33937), MF155206, KY910445; Oreochloa seslerioides K.Richt., Italy, B. Frajman, P. Schönswetter s.n. (IB 13326), MF155207, KY910446; Parapholis incurva (L.) C.E.Hubb., Croatia, P. Glasnović s.n. (IB 13986), MF155208, KY910441; Sesleria achtarovii Deyl, Bulgaria, S. Vukojičić, N. Kuzmanović, V. Ranđelović s.n. (BEOU 31961), –, KY910452; Sesleria achtarovii Deyl, Bulgaria, S. Vukojičić, N. Kuzmanović, V. Ranđelović s.n. (BEOU 31973), –, KY910453; Sesleria achtarovii Deyl, Greece, D. Lakušić, B. Lakušić s.n. (BEOU 31559), –, KY910454; Sesleria achtarovii Deyl, Greece, D. Lakušić, B. Lakušić s.n. (BEOU 31558), –, KY910455; Sesleria achtarovii Deyl, Bulgaria, M. Niketić , G. Tomović s.n. (BEOU 33317), –, KY910456; Sesleria alba Sm., Bulgaria, D. Lakušić, B. Lakušić s.n. (BEOU 34215), –, KY910457; Sesleria alba Sm., Turkey, D. Lakušić, B. Lakušić s.n. (BEOU 34221), –, KY910458; Sesleria alba Sm., Turkey, M. Niketić , M. Jovanović s.n. (BEOU 34911), –, KY910459; Sesleria alba Sm., Turkey, M. Niketić , M. Jovanović s.n. (BEOU 34912), –, KY910460; Sesleria albanica Ujhelyi, Albania, D. Lakušić, N. Kuzmanović, P. Lazarević, A. Alegro s.n. (BEOU 32488), –, KY910461; Sesleria albanica Ujhelyi, Albania, D. Lakušić, N. Kuzmanović, P. Lazarević, A. Alegro s.n. (BEOU 32505), –, KY910462; Sesleria anatolica Deyl, Georgia, P. Schönswetter, B. Frajman s.n. (IB 13675), –, KY910730; Sesleria angustifolia (Hack. & Beck) Deyl, Serbia, D. Lakušić s.n. (BEOU 27109), –, KY910463; Sesleria angustifolia (Hack. & Beck) Deyl, Serbia, D. Lakušić s.n. (BEOU 30359), –, KY910464; Sesleria angustifolia (Hack. & Beck) Deyl, Serbia, D. Lakušić s.n. (BEOU 30361), –, KY910465; Sesleria angustifolia (Hack. & Beck) Deyl, Serbia, S. Vukojičić s.n. (BEOU 31667), –, KY910466; Sesleria angustifolia (Hack. & Beck) Deyl, Serbia, M. Niketić , G. Tomović s.n. (BEOU 32220), –, KY910467; Sesleria apennina Ujhelyi, Italy, B. Frajman, S. Bogdanović s.n. (IB 13249), –, KY910468; Sesleria apennina Ujhelyi, Italy, B. Frajman, S. Bogdanović s.n. (IB 13250), –, KY910469; Sesleria apennina Ujhely, Italy, A. Alegro s.n. (ZA), –, KY910470; Sesleria apennina Ujhelyi, Italy, R. Di Pietro s.n. (HFLA), –, KY910471; Sesleria argentea (Savi) Savi, Italy, G.M. Schneeweiß s.n. (IB 12765), –, KY910472; Sesleria argentea (Savi) Savi, Italy, B. Frajman, S. Bogdanović s.n. (IB 13246), –, KY910473; Sesleria argentea (Savi) Savi, Italy, B. Frajman, S. Bogdanović s.n. (IB 13251), –, KY910474; Sesleria argentea (Savi) Savi, Spain, B. Frajman, P. Schönswetter s.n. (IB 13361), –, KY910475; Sesleria argentea (Savi) Savi, Spain, B. Frajman, P. Schönswetter s.n. (IB 13362), –, KY910476; Sesleria argentea (Savi) Savi, France, B. Frajman, P. Schönswetter s.n. (IB 13395), –, KY910477; Sesleria argentea (Savi) Savi, Italy, B. Frajman, P. Schönswetter s.n. (IB 13401), –, KY910478; Sesleria argentea (Savi) Savi, Italy, R. Di Pietro s.n. (HFLA), –, KY910479; Sesleria autumnalis (Scop.) F.W.Schultz, Albania, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 13003), –, KY910480; Sesleria autumnalis (Scop.) F.W.Schultz, Montenegro, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 13007), –, KY910481; Sesleria autumnalis (Scop.) F.W.Schultz, Slovenia, B. Frajman s.n. (IB 12752), –, KY910482; Sesleria autumnalis (Scop.) F.W.Schultz, Croatia, A. Alegro, S. Bogdanović s.n. (ZA), –, KY910483; Sesleria autumnalis (Scop.) F.W.Schultz, Croatia, D. Lakušić, B. Surina, A. Alegro s.n. (BEOU 27586), –, KY910484; Sesleria autumnalis (Scop.) F.W.Schultz, Montenegro, D. Lakušić s.n. (BEOU 30340), –, KY910485; Sesleria autumnalis (Scop.) F.W.Schultz, Bosnia & Herzegovina, M. Niketić s.n. (BEOU 31344), –, KY910486; Sesleria autumnalis (Scop.) F.W.Schultz, Croatia, D. Lakušić s.n. (BEOU 20643), –, KY910487; Sesleria autumnalis (Scop.) F.W.Schultz, Albania, D. Lakušić, N. Kuzmanović, P. Lazarević, A. Alegro s.n. (BEOU 32736), –, KY910488; Sesleria autumnalis (Scop.) F.W.Schultz, Greece, D. Lakušić, N. Kuzmanović, P. Lazarević, A. Alegro s.n. (BEOU 32839), –, KY910489; Sesleria autumnalis (Scop.) F.W.Schultz, Italy, R. Di Pietro s.n. (HFLA), –, KY910490; Sesleria autumnalis (Scop.) F.W.Schultz, Italy, R. Di Pietro s.n. (HFLA), –, KY910491; Sesleria autumnalis (Scop.) F.W.Schultz, Italy, R. Di Pietro s.n. (HFLA), –, KY910492; Sesleria bielzii Schur, Romania, N. Kuzmanović, P. Comanescu s.n. (BEOU 32843), –, KY910493; Sesleria bielzii Schur, Romania, N. Kuzmanović, P. Comanescu s.n. (BEOU 32853), –, KY910494; Sesleria caerulea (L.) Ard., Slovenia, B. Frajman s.n. (IB 12828), –, KY910495; Sesleria caerulea (L.) Ard., Austria, G.M. Schneeweiß 17609 (G. Schneeweiss, private herb.), –, KY910496; Sesleria caerulea (L.) Ard., Austria, G.M. Schneeweiß s.n. (IB 13148), –, KY910497; Sesleria caerulea (L.) Ard., Italy, B. Frajman s.n. (IB 13262), –, KY910498; Sesleria caerulea (L.) Ard., Switzerland, M. Magauer s.n. (IB 13272), –, KY910499; Sesleria caerulea (L.) Ard., Italy, C. Pachschwöll, G.M. Schneeweiß s.n. (IB 13454), –, KY910500; Sesleria caerulea (L.) Ard., Austria, C. Pachschwöll, Markus Hofbauer s.n. (IB 13453), –, KY910501; Sesleria caerulea (L.) Ard., France, B. Frajman, P. Schönswetter s.n. (IB 13328), –, KY910502; Sesleria caerulea (L.) Ard., Italy, B. Frajman, P. Schönswetter s.n. (IB 13416), –, KY910503; Sesleria caerulea (L.) Ard., Austria, B. Frajman s.n. (IB 13429), –, KY910504; Sesleria caerulea (L.) Ard., Italy, D. Lakušić, N. Kuzmanović s.n. (BEOU 33939), –, KY910505; Sesleria caerulea (L.) Ard., Slovenia, B. Frajman, P. Schönswetter s.n. (IB 13516), –, KY910506; Sesleria caerulea (L.) Ard., Hungary, N. Kuzmanović, Z. Barina, A. Schmotzer, D. Pifko s.n. (BEOU 32073), –, KY910507; Sesleria caerulea (L.) Ard., Hungary, N. Kuzmanović, Z. Barina, A. Schmotzer, D. Pifko s.n. (BEOU 32071), –, KY910508; Sesleria caerulea (L.) Ard., Slovenia, N. Kuzmanović s.n. (BEOU 33716), –, KY910509; Sesleria caerulea (L.) Ard., Italy, R. Di Pietro s.n. (HFLA), –, KY910510; Sesleria caerulea (L.) Ard., Italy, R. Di Pietro s.n. (HFLA), –, KY910511; Sesleria caerulea (L.) Ard., Ireland, F. Kolár, T. Urfus, P. Vít s.n. (IB 13530), –, KY910512; Sesleria calabrica (Deyl) Di Pietro, Italy, B. Frajman, S. Bogdanović s.n. (IB 13159), –, KY910513; Sesleria calabrica (Deyl) Di Pietro, Italy, B. Frajman, S. Bogdanović s.n. (IB 13167), –, KY910514; Sesleria calabrica (Deyl) Di Pietro, Italy, R. Di Pietro s.n. (HFLA), –, KY910515; Sesleria calabrica (Deyl) Di Pietro, Italy, R. Di Pietro s.n. (HFLA), –, KY910516; Sesleria coerulans Friv., Montenegro, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12927), –, KY910517; Sesleria coerulans Friv., Macedonia, M. Niketić , G. Tomović s.n. (BEOU 30921), –, KY910518; Sesleria coerulans Friv., Bulgaria, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 34902), –, KY910519; Sesleria coerulans Friv., Serbia, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 34903), –, KY910520; Sesleria coerulans Friv., Serbia, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 34904), –, KY910521; Sesleria comosa Velen., Kosovo, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12945), –, MG572116; Sesleria comosa Velen., Kosovo, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12946), –, KY910522; Sesleria comosa Velen., Montenegro, D. Lakušić, B. Lakušić s.n. (BEOU 27382), –, KY910523; Sesleria comosa Velen., Macedonia, D. Lakušić, N. Kuzmanović, B. Surina, R. Di Pietro s.n. (BEOU 33203), –, KY910524; Sesleria comosa Velen., Kosovo, M. Lazarević, P. Lazarević s.n. (BEOU 33121), –, KY910525; Sesleria comosa Velen., Montenegro, M. Niketić , G. Tomović s.n. (BEOU 33840), –, KY910526; Sesleria doerfleri Hayek, Greece, B. Frajman, P. Schönswetter s.n. (IB 13143), MF155209, KY910527; Sesleria doerfleri Hayek, Greece, B. Frajman, P. Schönswetter s.n. (IB 13144), –, KY910528; Sesleria filifolia Hoppe, Serbia, D. Lakušić, N. Kuzmanović s.n. (BEOU 27098), MF155210, –; Sesleria filifolia Hoppe, Serbia, I. Fusijanović s.n. (BEOU 30325), –, KY910529; Sesleria filifolia Hoppe, Serbia, N. Kuzmanović , V. Batanjski, M. Plećaš s.n. (BEOU 30546), –, KY910530; Sesleria filifolia Hoppe, Romania, N. Kuzmanović, M. Plećaš s.n. (BEOU 32107), –, KY910531; Sesleria filifolia Hoppe, Bulgaria, M. Niketić , G. Tomović s.n. (BEOU 33234), –, KY910532; Sesleria filifolia Hoppe, Bulgaria, M. Niketić , G. Tomović s.n. (BEOU 33275), –, KY910533; Sesleria filifolia Hoppe, Serbia, N. Kuzmanović s.n. (BEOU 33936), –, KY910534; Sesleria filifolia Hoppe, Serbia, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 34165), –, KY910535; Sesleria heuflerana Schur, Romania, N. Kuzmanović, P. Comanescu s.n. (BEOU 30332), –, KY910536; Sesleria heuflerana Schur, Romania, N. Kuzmanović, P. Comanescu s.n. (BEOU 30334), –, KY910537; Sesleria heuflerana Schur, Hungary, N. Kuzmanović, Z. Barina, A. Schmotzer, D. Pifko s.n. (BEOU 32074), –, KY910538; Sesleria heuflerana Schur, Hungary, N. Kuzmanović, 1368 Version of Record Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Appendix 1. Continued. Z. Barina, A. Schmotzer, D. Pifko s.n. (BEOU 32069), –, KY910539; Sesleria heuflerana Schur, Hungary, N. Kuzmanović, Z. Barina, A. Schmotzer, D. Pifko s.n. (BEOU 32070), –, KY910540; Sesleria heuflerana Schur, Hungary, N. Kuzmanović, Z. Barina, A. Schmotzer, D. Pifko s.n. (BEOU 32072), –, KY910541; Sesleria insularis Sommier, Italy, R. Di Pietro s.n. (HFLA), –, KY910542; Sesleria insularis Sommier, France, B. Frajman, P. Schönswetter s.n. (IB 13572), –, KY910543; Sesleria insularis Sommier, Italy, B. Frajman, P. Schönswetter s.n. (IB 13575), –, KY910544; Sesleria insularis Sommier, Italy, B. Frajman, P. Schönswetter s.n. (IB 13576), –, KY910545; Sesleria insularis Sommier, France, B. Frajman, P. Schönswetter s.n. (IB 13578), –, KY910546; Sesleria interrupta Vis., Bosnia & Herzegovina, B. Frajman, P. Schönswetter s.n. (IB 12772), –, KY910659; Sesleria interrupta Vis., Bosnia & Herzegovina, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12862), –, KY910660; Sesleria interrupta Vis., Bosnia & Herzegovina, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12873), MF155211, KY910661; Sesleria interrupta Vis., Montenegro, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12905), –, KY910662; Sesleria interrupta Vis., Montenegro, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12926), –, KY910663; Sesleria interrupta Vis., Kosovo, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12965), –, KY910664; Sesleria interrupta Vis., Albania, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12990), –, KY910665; Sesleria interrupta Vis., Montenegro, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 13015), –, KY910666; Sesleria interrupta Vis., Bosnia & Herzegovina, D. Kutnjak, B. Frajman s.n. (IB 13082), –, KY910667; Sesleria interrupta Vis., Croatia, S. Bogdanović, I. Rešetnik s.n. (ZA), –, KY910677; Sesleria interrupta Vis., Croatia, A. Alegro, S. Bogdanović s.n. (ZA), –, KY910678; Sesleria interrupta Vis., Croatia, A. Alegro, S. Bogdanović s.n. (ZA), –, KY910679; Sesleria interrupta Vis., Croatia, S. Bogdanović s.n. (ZA), –, KY910680; Sesleria interrupta Vis., Croatia, S. Bogdanović s.n. (ZA), –, KY910681; Sesleria interrupta Vis., Serbia, D. Lakušić s.n. (BEOU 30358), –, KY910684; Sesleria interrupta Vis., Croatia, D. Lakušić s.n. (BEOU 31265), –, KY910685; Sesleria interrupta Vis., Serbia, D. Lakušić s.n. (BEOU 31337), –, KY910686; Sesleria interrupta Vis., Montenegro, D. Lakušić s.n. (BEOU 31338), –, KY910687; Sesleria interrupta Vis., Serbia, D. Lakušić s.n. (BEOU 31341), –, KY910688; Sesleria interrupta Vis., Bosnia & Herzegovina, M. Niketić s.n. (BEOU 31345), –, KY910689; Sesleria interrupta Vis., Montenegro, M. Niketić , G. Tomović s.n. (BEOU 31404), –, KY910690; Sesleria interrupta Vis., Montenegro, M. Niketić , G. Tomović s.n. (BEOU 31417), –, KY910691; Sesleria interrupta Vis., Serbia, M. Niketić , G. Tomović s.n. (BEOU 31424), –, KY910692; Sesleria interrupta Vis., Macedonia, S. Vukojičić s.n. (BEOU 31011), –, KY910693; Sesleria interrupta Vis., Macedonia, D. Lakušić, N. Kuzmanović, B. Surina, R. Di Pietro s.n. (BEOU 33206), –, KY910694; Sesleria interrupta Vis., Macedonia, D. Lakušić, N. Kuzmanović, B. Surina, R. Di Pietro s.n. (BEOU 33208), –, KY910695; Sesleria interrupta Vis., Albania, D. Lakušić, N. Kuzmanović, B. Surina, R. Di Pietro s.n. (BEOU 33214), –, KY910696; Sesleria interrupta Vis., Macedonia, D. Lakušić, N. Kuzmanović, B. Surina, R. Di Pietro s.n. (BEOU 33223), –, KY910697; Sesleria interrupta Vis., Bosnia and Hercegovina, D. Lakušić, G. Tomović, N. Kuzmanović s.n. (BEOU 34921), –, KY910706; Sesleria italica (Pamp.) Ujhelyi, San Marino, B. Frajman, S. Bogdanović s.n. (IB 13234), –, KY910547; Sesleria italica (Pamp.) Ujhelyi, Italy, B. Frajman, S. Bogdanović s.n. (IB 13235), –, KY910548; Sesleria italica (Pamp.) Ujhelyi, Italy, B. Frajman, S. Bogdanović s.n. (IB 13484), –, KY910549; Sesleria italica (Pamp.) Ujhelyi, Italy, R. Di Pietro s.n. (HFLA), –, KY910550; Sesleria italica (Pamp.) Ujhelyi, Italy, R. Di Pietro s.n. (HFLA), –, KY910551; Sesleria juncifolia Suffren, Slovenia, B. Frajman, P. Schönswetter s.n. (IB 12749), –, KY910668; Sesleria juncifolia Suffren, Croatia, B. Frajman s.n. (IB 13118), –, KY910669; Sesleria juncifolia Suffren, Italy, B. Frajman, S. Bogdanović s.n. (IB 13175), –, KY910670; Sesleria juncifolia Suffren, Italy, B. Frajman, S. Bogdanović s.n. (IB 13180), –, KY910671; Sesleria juncifolia Suffren, Italy, B. Frajman, S. Bogdanović s.n. (IB 13193), –, KY910672; Sesleria juncifolia Suffren, Italy, B. Frajman, S. Bogdanović s.n. (IB 13213), –, KY910673; Sesleria juncifolia Suffren, Italy, C. Dobes s.n. (IB 13303), –, KY910674; Sesleria juncifolia Suffren, Italy, C. Dobes s.n. (IB 13305), –, KY910675; Sesleria juncifolia Suffren, Italy, B. Frajman, S. Bogdanović s.n. (IB 13479), –, KY910676; Sesleria juncifolia Suffren, Croatia, A. Alegro s.n. (ZA), –, KY910682; Sesleria juncifolia Suffren, Croatia, A. Alegro s.n. (ZA), –, KY910683; Sesleria juncifolia Suffren, Italy, R. Di Pietro s.n. (HFLA), –, KY910698; Sesleria juncifolia Suffren, Italy, R. Di Pietro s.n. (HFLA), –, KY910699; Sesleria juncifolia Suffren, Slovenia, A. Radalj, B. Surina 347 (NHMRs 1620), –, KY910700; Sesleria juncifolia Suffren, Slovenia, B. Surina 349 (NHMRs 1623), –, KY910701; Sesleria juncifolia Suffren, Italy, R. Di Pietro s.n. (HFLA), –, KY910702; Sesleria juncifolia Suffren, Italy, R. Di Pietro s.n. (HFLA), –, KY910703; Sesleria juncifolia Suffren, Italy, R. Di Pietro s.n. (HFLA), –, KY910704; Sesleria juncifolia Suffren, Italy, B. Frajman, P. Schönswetter s.n. (IB 13504), –, KY910705; Sesleria kalnikensis Jáv., Slovenia, B. Frajman, P. Schönswetter s.n. (IB 13515), –, KY910552; Sesleria kalnikensis Jáv., Croatia, A. Alegro s.n. (ZA), –, KY910553; Sesleria kalnikensis Jáv., Croatia, A. Alegro s.n. (ZA), –, KY910554; Sesleria kalnikensis Jáv., Croatia, V. Šegota s.n. (ZA), –, KY910555; Sesleria kalnikensis x sadleriana, Croatia, A. Alegro, S. Bogdanović s.n. (ZA), –, KY910556; Sesleria kalnikensis x sadleriana, Slovenia, B. Frajman, P. Schönswetter s.n. (IB 13598), –, KY910557; Sesleria klasterskyi Deyl, Bulgaria, S. Vukojičić, N. Kuzmanović, V. Ranđelović s.n. (BEOU 31965), –, KY910558; Sesleria korabensis (Kümmerle & Jáv.) Deyl, Macedonia, D. Lakušić, N. Kuzmanović, B. Surina, R. Di Pietro s.n. (BEOU 33201), –, KY910559; Sesleria korabensis (Kümmerle & Jáv.) Deyl, Macedonia, D. Lakušić, N. Kuzmanović, B. Surina, R. Di Pietro s.n. (BEOU 33202), –, KY910560; Sesleria korabensis (Kümmerle & Jáv.) Deyl, Kosovo, M. Lazarević, P. Lazarević s.n. (BEOU 33117), –, KY910561; Sesleria korabensis (Kümmerle & Jáv.) Deyl, Kosovo, M. Lazarević, P. Lazarević s.n. (BEOU 33120), –, KY910562; Sesleria korabensis (Kümmerle & Jáv.) Deyl, Kosovo, M. Lazarević, P. Lazarević s.n. (BEOU 33169), –, KY910563; Sesleria latifolia (Adamović) Degen, Greece, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 31939), –, KY910564; Sesleria latifolia (Adamović) Degen, Serbia, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 32061), –, KY910565; Sesleria latifolia (Adamović) Degen, Bulgaria, S. Vukojičić, N. Kuzmanović, V. Ranđelović s.n. (BEOU 31960), –, KY910566; Sesleria latifolia (Adamović) Degen, Greece, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 31852), –, KY910567; Sesleria latifolia (Adamović) Degen, Bosnia & Herzegovina, M. Niketić , G. Tomović s.n. (BEOU 32106), –, KY910568; Sesleria latifolia (Adamović) Degen, Greece, M. Niketić , G. Tomović s.n. (BEOU 32353), –, KY910569; Sesleria latifolia (Adamović) Degen, Bulgaria, M. Niketić , G. Tomović s.n. (BEOU 33263), –, KY910570; Sesleria latifolia (Adamović) Degen, Macedonia, D. Lakušić, N. Kuzmanović, B. Surina, R. Di Pietro s.n. (BEOU 33207), –, KY910571; Sesleria latifolia (Adamović) Degen, Serbia, N. Kuzmanović, K. Jakovljević, U. Buzurović s.n. (BEOU 33673), –, KY910572; Sesleria latifolia (Adamović) Degen, Kosovo, M. Lazarević, P. Lazarević s.n. (BEOU 33184), –, KY910573; Sesleria latifolia (Adamović) Degen, Greece, M. Niketić , M. Jovanović s.n. (BEOU 34913), –, KY910574; Sesleria latifolia (Adamović) Degen, Macedonia, G. Tomović, B. Zlatković s.n. (BEOU 34908), –, KY910575; Sesleria nitida Ten., Italy, B. Frajman, S. Bogdanović s.n. (IB 13157), –, KY910578; Sesleria nitida Ten., Italy, B. Frajman, S. Bogdanović s.n. (IB 13158), –, KY910579; Sesleria nitida Ten., Italy, B. Frajman, S. Bogdanović s.n. (IB 13214), –, KY910580; Sesleria nitida Ten., Italy, C. Dobes s.n. (IB 13302), –, KY910581; Sesleria nitida Ten., Italy, S. Bogdanović s.n. (ZA), –, KY910582; Sesleria nitida Ten., Italy, A. Alegro s.n. (ZA), –, KY910583; Sesleria nitida Ten., Italy, V. Šegota s.n. (ZA), –, KY910584; Sesleria nitida Ten., Italy, R. Di Pietro s.n. (HFLA), –, KY910585; Sesleria nitida Ten., Italy, R. Di Pietro s.n. (HFLA), –, KY910586; Sesleria nitida Ten., Italy, R. Di Pietro s.n. (HFLA), –, KY910587; Sesleria nitida Ten., Italy, R. Di Pietro s.n. (HFLA), –, KY910588; Sesleria nitida Ten., Italy, R. Di Pietro s.n. (HFLA), –, KY910589; Sesleria nitida Ten., Italy, R. Di Pietro s.n. (HFLA), –, KY910590; Sesleria nitida Ten., Italy, R. Di Pietro s.n. (HFLA), –, KY910591; Sesleria ovata (Hoppe) Kern., Austria, G.M. Schneeweiß 17632 (G. Schneeweiss, private herb.), –, KY910447; Sesleria ovata (Hoppe) Kern., Austria, G.M. Schneeweiß 17639 (G. Schneeweiss, private herb.), MF155212, KY910448; Sesleria ovata (Hoppe) Kern., Austria, G. Pflugbeil, A. Tribsch s.n. (IB 13147), –, KY910449; Sesleria ovata (Hoppe) Kern., Austria, B. Frajman, P. Schönswetter s.n. (IB 13280), –, KY910450; Sesleria ovata (Hoppe) Kern., Italy, D. Lakušić, N. Kuzmanović s.n. (BEOU 33938), MF155213, KY910451; Sesleria phleoides Steven ex Roem. & Schult., Armenia, P. Schönswetter, B. Frajman s.n. (IB 13607), –, KY910592; Sesleria phleoides Steven ex Roem. & Schult., Armenia, P. Schönswetter, B. Frajman s.n. (IB 13610), –, KY910593; Sesleria phleoides Steven ex Roem. & Schult., Armenia, P. Schönswetter, B. Frajman s.n. (IB 13619), –, KY910594; Sesleria phleoides Steven ex Roem. & Schult., Armenia, P. Schönswetter, B. Frajman s.n. (IB 13639), –, KY910595; Sesleria pichiana Foggi, Gr. Rossi & Pignotti, Italy, B. Frajman, S. Bogdanović s.n. (IB 13245), –, KY910596; Sesleria pichiana Foggi, Gr. Rossi & Pignotti, Italy, B. Frajman, S. Bogdanović s.n. (IB 13253), –, KY910597; Sesleria pichiana Foggi, Gr. Rossi & Pignotti, Italy, B. Frajman, S. Bogdanović s.n. (IB 13255), –, KY910598; Sesleria pichiana Foggi, Gr. Rossi & Pignotti, Italy, R. Di Pietro s.n. (HFLA), –, KY910599; Sesleria pichiana Foggi, Gr. Rossi & Pignotti, Italy, B. Frajman, P. Schönswetter s.n. (IB 13588), –, KY910600; Sesleria rhodopaea Tashev & D.Dimitrov, Bulgaria, A. Tashev s.n. (BEOU 38197), –, KY910626; Sesleria rigida Rchb., Romania, N. Kuzmanović, P. Comanescu s.n. (BEOU 30329), –, KY910601; Sesleria rigida Rchb., Romania, N. Kuzmanović, P. Comanescu s.n. (BEOU 30333), –, KY910602; Sesleria rigida Rchb., Romania, N. Kuzmanović, P. Comanescu s.n. (BEOU 30337), –, KY910603; Sesleria rigida Rchb., Romania, N. Kuzmanović, Version of Record 1369 Kuzmanović & al. • Phylogeny of Seslerieae (Poaceae) TAXON 66 (6) • December 2017: 1349–1370 Appendix 1. Continued. P. Comanescu s.n. (BEOU 31517), –, KY910604; Sesleria rigida Rchb., Romania, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 31538), –, KY910605; Sesleria robusta Schott, Nyman et Kotschy, Bosnia & Herzegovina, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12854), –, KY910606; Sesleria robusta Schott, Nyman et Kotschy, Bosnia & Herzegovina, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12878), –, KY910607; Sesleria robusta Schott, Nyman et Kotschy, Bosnia & Herzegovina, D. Kutnjak, B. Frajman s.n. (IB 13081), –, KY910608; Sesleria robusta Schott, Nyman et Kotschy, Croatia, A. Alegro, S. Bogdanović s.n. (ZA), –, KY910609; Sesleria robusta Schott, Nyman et Kotschy, Croatia, A. Alegro, S. Bogdanović s.n. (ZA), –, KY910610; Sesleria robusta Schott, Nyman et Kotschy, Croatia, S. Bogdanović s.n. (ZA), –, KY910611; Sesleria robusta Schott, Nyman et Kotschy, Croatia, S. Bogdanović s.n. (ZA), –, KY910612; Sesleria robusta Schott, Nyman et Kotschy, Macedonia, M. Niketić , G. Tomović s.n. (BEOU 30850), –, KY910613; Sesleria robusta Schott, Nyman et Kotschy, Montenegro, D. Lakušić s.n. (BEOU 28809), –, KY910614; Sesleria robusta Schott, Nyman et Kotschy, Montenegro, D. Lakušić s.n. (BEOU 30352), –, KY910615; Sesleria robusta Schott, Nyman et Kotschy, Montenegro, D. Lakušić s.n. (BEOU 30354), –, KY910616; Sesleria robusta Schott, Nyman et Kotschy, Montenegro, M. Niketić , G. Tomović s.n. (BEOU 31403), –, KY910617; Sesleria robusta Schott, Nyman et Kotschy, Montenegro, M. Niketić , G. Tomović s.n. (BEOU 31411), –, KY910618; Sesleria robusta Schott, Nyman et Kotschy, Montenegro, G. Tomović, G. Anačkov s.n. (BEOU 31432), –, KY910619; Sesleria robusta Schott, Nyman et Kotschy, Greece, M. Niketić , G. Tomović s.n. (BEOU 32324), –, KY910620; Sesleria robusta Schott, Nyman et Kotschy, Albania, D. Lakušić, N. Kuzmanović, P. Lazarević, A. Alegro s.n. (BEOU 32735), –, KY910621; Sesleria robusta Schott, Nyman et Kotschy, Albania, D. Lakušić, N. Kuzmanović, P. Lazarević, A. Alegro s.n. (BEOU 32461), –, KY910622; Sesleria robusta Schott, Nyman et Kotschy, Macedonia, D. Lakušić, N. Kuzmanović, B. Surina, R. Di Pietro s.n. (BEOU 33205), –, KY910623; Sesleria robusta Schott, Nyman et Kotschy, Montenegro, M. Niketić , G. Tomović s.n. (BEOU 33836), –, KY910624; Sesleria robusta Schott, Nyman et Kotschy, Greece, D. Lakušić, G. Tomović, N. Kuzmanović s.n. (BEOU 34893), –, KY910625; Sesleria sadlerana Janka, Croatia, A. Alegro, S. Bogdanović s.n. (ZA), –, KY910627; Sesleria sadlerana Janka, Hungary, N. Kuzmanović, D. Pifko s.n. (BEOU 32075), –, KY910628; Sesleria sadlerana Janka, Hungary, N. Kuzmanović, Z. Barina, G. Barina s.n. (BEOU 32063), –, KY910629; Sesleria sadlerana Janka, Hungary, N. Kuzmanović, Z. Barina, G. Barina s.n. (BEOU 32067), –, KY910630; Sesleria sadlerana Janka, Slovakia, F. Kolár, L. Hrouda, M. Hanzl s.n. (IB 13529), –, KY910631; Sesleria sadlerana Janka, Austria, L. Schratt-Ehrendorfer (IB 13538), –, KY910632; Sesleria serbica (Adamović) Ujhelyi, Serbia, N. Kuzmanović s.n. (BEOU 30308), –, KY910633; Sesleria serbica (Adamović) Ujhelyi, Serbia, D. Lakušić s.n. (BEOU 30311), –, KY910634; Sesleria serbica (Adamović) Ujhelyi, Bosnia & Herzegovina, M. Niketić , G. Tomović s.n. (BEOU 32105), –, KY910635; Sesleria serbica (Adamović) Ujhelyi, Serbia, M. Niketić , G. Tomović s.n. (BEOU 32150), –, KY910636; Sesleria serbica (Adamović) Ujhelyi, Serbia, N. Kuzmanović, K. Jakovljević, U. Buzurović s.n. (BEOU 33674), –, KY910637; Sesleria serbica (Adamović) Ujhelyi, Serbia, M. Niketić , G. Tomović s.n. (BEOU 33875), –, KY910638; Sesleria skipetarum Ujhelyi, Albania, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 13004), MF155214, KY910639; Sesleria skipetarum Ujhelyi, Albania, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 13019), –, KY910640; Sesleria skipetarum Ujhelyi, Albania, D. Lakušić, N. Kuzmanović, P. Lazarević, A. Alegro s.n. (BEOU 32416), –, KY910641; Sesleria skipetarum Ujhelyi, Albania, D. Lakušić, N. Kuzmanović, P. Lazarević, A. Alegro s.n. (BEOU 32422), –, KY910642; Sesleria sphaerocephala Ard., Austria, B. Frajman, P. Schönswetter s.n. (IB 12801), –, KY910643; Sesleria sphaerocephala Ard., Slovenia, B. Frajman s.n. (IB 12825), MF155215, KY910644; Sesleria sphaerocephala Ard., Italy, B. Frajman, R. Flatscher, P. Schönswetter s.n. (IB 13022), –, KY910576; Sesleria sphaerocephala Ard., Italy, R. Flatscher, P. Schönswetter s.n. (IB 13029), –, KY910577; Sesleria sphaerocephala Ard., Austria, G. Pflugbeil, A. Tribsch 112039 (A. Tribsch, private herb.), MF155216, KY910645; Sesleria sphaerocephala Ard., Italy, B. Frajman, P. Schönswetter s.n. (IB 13261), MF155217, KY910646; Sesleria sphaerocephala Ard., Italy, C. Pachschwöll, C. Gilli, G.M. Schneeweiß s.n. (IB 13455), MF155218, KY910647; Sesleria tatrae (Degen) Deyl, Poland, F. Kolár, J. Chrtek s.n. (IB 13527), –, KY910648; Sesleria tatrae (Degen) Deyl, Slovakia, F. Kolár s.n. (IB 13528), –, KY910649; Sesleria tatrae (Degen) Deyl, Slovakia, A., M. Ronikier s.n. (KRAM), –, KY910650; Sesleria tatrae (Degen) Deyl, Poland, A., M. Ronikier s.n. (KRAM), –, KY910651; Sesleria taygetea Hayek, Greece, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 31851), –, KY910652; Sesleria tenerrima (Fritsch) Hayek, Greece, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 31745), –, KY910653; Sesleria tenerrima (Fritsch) Hayek, Greece, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 31911), –, KY910654; Sesleria tenerrima (Fritsch) Hayek, Greece, M. Niketić , G. Tomović s.n. (BEOU 32362), –, KY910655; Sesleria tenerrima (Fritsch) Hayek, Macedonia, D. Lakušić, N. Kuzmanović, B. Surina, R. Di Pietro s.n. (BEOU 33204), –, KY910656; Sesleria tenerrima (Fritsch) Hayek, Macedonia, S. Vukojičić s.n. (BEOU 31011), –, KY910657; Sesleria tenerrima (Fritsch) Hayek, Greece, D. Lakušić, G. Tomović, N. Kuzmanović s.n. (BEOU 34892), –, KY910658; Sesleria tuzsonii Ujhelyi, Italy, B. Frajman, S. Bogdanović s.n. (IB 13247), –, KY910707; Sesleria ujhelyii Strgar, Serbia, D. Lakušić s.n. (BEOU 30301), –, KY910708; Sesleria ujhelyii Strgar, Serbia, D. Lakušić, B. Lakušić s.n. (BEOU 30540), –, KY910709; Sesleria ujhelyii Strgar, Serbia, D. Lakušić s.n. (BEOU 31334), –, KY910710; Sesleria ujhelyii Strgar, Serbia, N. Kuzmanović s.n. (BEOU 31437), –, KY910711; Sesleria ujhelyii Strgar, Bosnia & Herzegovina, M. Niketić , G. Tomović s.n. (BEOU 33821), –, KY910712; Sesleria uliginosa Opiz, Croatia, A. Alegro, S. Bogdanović s.n. (ZA), –, KY910713; Sesleria uliginosa Opiz, Montenegro, D. Lakušić s.n. (BEOU 24439), –, KY910714; Sesleria uliginosa Opiz, Romania, N. Kuzmanović, P. Comanescu s.n. (BEOU 30336), –, KY910715; Sesleria uliginosa Opiz, Montenegro, D. Lakušić s.n. (BEOU 30356), –, KY910716; Sesleria uliginosa Opiz, Hungary, N. Kuzmanović, Z. Barina, G. Barina s.n. (BEOU 32068), –, KY910717; Sesleria uliginosa Opiz, Hungary, Z. Barina s.n. (BEOU 32879), –, KY910718; Sesleria uliginosa Opiz, Italy, R. Di Pietro s.n. (HFLA), –, KY910719; Sesleria uliginosa Opiz, Italy, R. Di Pietro s.n. (HFLA), –, KY910720; Sesleria uliginosa Opiz, Italy, R. Di Pietro s.n. (HFLA), –, KY910721; Sesleria uliginosa Opiz, Sweden, M. Thulin s.n. (IB 13727), –, KY910722; Sesleria uliginosa Opiz, Austria, L. Schratt-Ehrendorfer s.n. (IB 13542), –, KY910723; Sesleria uliginosa Opiz., Montenegro, D. Lakušić, N. Kuzmanović, I. Janković, S. Ðurović s.n. (BEOU 35133), –, KY910724; Sesleria vaginalis Boiss. & Orph., Greece, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 31835), –, KY910725; Sesleria vaginalis Boiss. & Orph., Greece, D. Lakušić, N. Kuzmanović, S. Vukojičić s.n. (BEOU 31850), –, KY910726; Sesleria vaginalis Boiss. & Orph., Albania, D. Lakušić, N. Kuzmanović, P. Lazarević, A. Alegro s.n. (BEOU 32797), –, KY910727; Sesleria vaginalis Boiss. & Orph., Greece, D. Lakušić, G. Tomović, N. Kuzmanović s.n. (BEOU 34890), –, KY910728; Sesleria vaginalis Boiss. & Orph., Greece, D. Lakušić, G. Tomović, N. Kuzmanović s.n. (BEOU 34895), –, KY910729; Sesleria wettsteinii Dörfl. & Hayek, Montenegro, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12919), –, KY910731; Sesleria wettsteinii Dörfl. & Hayek, Kosovo, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12958), –, KY910732; Sesleria wettsteinii Dörfl. & Hayek, Albania, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 12988), MF155219, KY910733; Sesleria wettsteinii Dörfl. & Hayek, Montenegro, P. Schönswetter, B. Frajman, D. Kutnjak s.n. (IB 13016), –, KY910734; Sesleria wettsteinii Dörfl. & Hayek, Montenegro, D. Lakušić s.n. (BEOU 31120), –, KY910735; Sesleria wettsteinii Dörfl. & Hayek, Albania, D. Lakušić, N. Kuzmanović, B. Surina, R. Di Pietro s.n. (BEOU 33211), –, KY910736. 1370 Version of Record