Acta Oto-Laryngologica ISSN: 0001-6489 (Print) 1651-2251 (Online) Journal homepage: http://www.tandfonline.com/loi/ioto20 Transplantation of mouse-induced pluripotent stem cells into the cochlea for the treatment of sensorineural hearing loss Jing Chen, Lina Guan, Hengtao Zhu, Shan Xiong, Liang Zeng & Hongqun Jiang To cite this article: Jing Chen, Lina Guan, Hengtao Zhu, Shan Xiong, Liang Zeng & Hongqun Jiang (2017): Transplantation of mouse-induced pluripotent stem cells into the cochlea for the treatment of sensorineural hearing loss, Acta Oto-Laryngologica, DOI: 10.1080/00016489.2017.1342045 To link to this article: http://dx.doi.org/10.1080/00016489.2017.1342045 Published online: 23 Jun 2017. Submit your article to this journal Article views: 2 View related articles View Crossmark data Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=ioto20 Download by: [Cornell University Library] Date: 25 June 2017, At: 00:58 ACTA OTO-LARYNGOLOGICA, 2017 https://doi.org/10.1080/00016489.2017.1342045 RESEARCH ARTICLE Transplantation of mouse-induced pluripotent stem cells into the cochlea for the treatment of sensorineural hearing loss Jing Chen, Lina Guan, Hengtao Zhu, Shan Xiong, Liang Zeng and Hongqun Jiang Department of Otorhinolaryngology Head and Neck Surgery, the First Affiliated Hospital of Nanchang University, Nanchang, China ABSTRACT ARTICLE HISTORY Conclusion: Mouse-induced pluripotent stem cells (iPSCs) could differentiate into hair cell-like cells and spiral ganglion-like cells after transplantation into mouse cochleae, but it cannot improve the auditory brain response (ABR) thresholds in short term. Objective: To evaluate the potential of iPSCs for use as a source of transplants for the treatment of sensorineural hearing loss (SNHL). Methods: Establishing SNHL mice model, then injecting the iPSCs or equal volume DMEM basic medium into the cochleae, respectively. Immunofluorescence staining and reverse transcriptionpolymerase chain reaction (RT-PCR) were used to assess the survival, migration, differentiation of the transplanted iPSCs in cochleae and then recorded the ABR threshold in different time. Hematoxylin–eosin (HE) staining was used to observe the teratoma formation. Results: Four weeks after transplantation, CM-Di1-labeled iPSCs could be found in the modiolus and Rosenthal’s canal (RC), and some of them could expressed auditory hair cell markers or spiral ganglion neuron makers in group A, but not found in group B and C. As to the ABR threshold, no significance differences were found between pre- with postoperative in group A or B. In our study, no teratoma was observed in the cochleae. Received 26 April 2017 Revised 1 June 2017 Accepted 5 June 2017 Introduction Hearing is a primary perception and social communication for individuals. Hearing impairment seriously affect the quality of life, especially in childhood, which also can led to speech and language delay or disorder. A report in 2005 from the WHO showed that approximately 278 million people worldwide were living with disabling hearing impairment. One quarter of hearing impairment began during childhood, and 80% of all deaf and hearing impaired people live in low- and middle-income countries. There are many factors include noise, ototoxic drug, genetic disorder, age and so on, which may cause hearing impairment. We observed that most of the patients with hearing disorder are sensorineural hearing loss. The main pathological changes are degeneration or lack of cochlear hair cells and/or spiral ganglion neurons. The mammalian cochlea hair cells and spiral ganglion neurons cannot regenerate and repair after damaged. Thus, how to repair the damaged hair cells and spiral ganglion neurons and restore its function has become the hot topics of otology research. Scientists from all over the world are researching on etiology of treatment methods to restore the morphology and function of damaged hair cells and spiral ganglion neurons, in which cell transplantation is one choice of the treatment methods. With stem cell KEYWORDS Induced pluripotent stem cells; inner ear transplantation; auditory hair cells; spiral ganglion; cell differentiation; cell therapy technology rapid development, the methods in animal models have made gratifying progress [1–3]. In this study, we established the SNHL model of mice. Then, the iPSCs were transplanted into the cochleae of SNHL mice and identified the iPSCs could differentiated into hair cell-like cells and spiral ganglion-like cells by the methods of immunofluorescence staining and RT-PCR; Comparing the hearing changes pre- and postoperatively and identifying the tumorigenicity of iPSCs in vivo. Accordingly, it provided a preliminary scientific basis for the treatment of sensorineral hearing loss by transplanting the iPSCs into the cochleae. Materials and methods Animals and group setting The normal ICR mice (SCXK201-0001) were bought from Vital River Laboratory Animal Technology Company Limited as the experimental animal. The Animal Research Committee of the Nanchang University Graduate School of Medicine approved all experimental protocols, which were performed in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. CONTACT Hongqun Jiang jianghongqun@sohu.com Department of Otorhinolaryngology Head and Neck Surgery, the First Affiliated Hospital of Nanchang University, No. 17, YongWaiZheng Road, Nanchang 330006, PR China These authors contributed equally to the study. ß 2017 Acta Oto-Laryngologica AB (Ltd) 2 J. CHEN ET AL. We established the SNHL mice model by intraperitoneally injected of the neomycin solution (40 mg/mL in physiological saline; Sigma, St Louis, MO) into the 14-day-old normal ICR mice for 12 days. This kind of administration of to the mice caused loss of almost all the auditory hair cells, resulting in severe sensorineural hearing loss. Two weeks later, the thresholds of ABR were recorded to monitor the mice’s hearing level. The thresholds of ABR were more than 70dBnHL would be selected as SNHL mice. Then, we proceeded the experiment groups. Group A: 20 SNHL mice, which were transplanted of the mouse iPSCs into the cochleae; Group B: 20 SNHL mice which were injected of equal volume DMEM basic medium into the cochleae; Group C: 20 normal mice. The thresholds of ABR of the mice were recorded in different periods after transplantation. window niche (Figure 1), then injected the iPS cells suspension (1  106 cells in 5 lL) by using a Hamilton syringe and infusion pump at the speed of 1 lL per min. The needle was left in place for an additional 2 min and then removed slowly. The hole in the cochlea and acoustic capsule was sealed with muscle and sutured the incision. To prevent bacterial infection of the inner ear, cefazolin was injected intraperitoneally at a dose of 500 mg/kg/day for 3 days. Tissue preparation and immunohistochemistry Transplantation procedure The mice were fed in the cage, under normal condition for 4 weeks after transplantation. The cochleae were dissected and fixed in 4% paraformaldehyde solution for 24 h and then decalcified in 10% EDTA/PBS for 4–5 days at 4  C. After that, the samples were dehydrated in sucrose solution of 15–30% and embedded in OCT. Frozen sections, 6 lm thick, were prepared with freezing microtome (Leica, Germany). The sections were used for immunofluorescence staining. The primary antibodies used were as follows: antiMyosin 7a rabbit polyclonal antibody (1:250; Abcam, England), anti-Math1 rabbit polyclonal antibody (1:100; Abcam, England), anti-Calretinin rabbit monoclonal antibody (1:50; Abcam, England), anti-Nestin rat monoclonal antibody (1:250; Abcam, England), anti-Neurofliment-M rabbit polyclonal antibody (1:400; Abcam, England), antitubulinb-III rabbit polyclonal antibody (1:1000; Abcam, England). The secondary antibodies used were DyLight 488 anti-rabbit or rat antibody (1:100; Earthox, USA). Specimens were observed under a laser confocal microscope (Zeiss LSM 700, Germany). Several sections random selection were used for HE staining to identify whether teratoma formation after iPSCs transplantation. To transplant the CM-Di1-labeled iPSCs into the SNHL mice cochleae, we used general anesthesia with 4% chloral hydrate and local anesthesia with 0.5% lidocaine. The left otic bulla of each animal was opened to expose the round RT-PCR Four weeks postoperation, total RNA was extracted from the left cochleae of each group and then detected the expression Cells and characterization Mouse iPSCs were bought from SiDanSai Biotechnology Co., Ltd which were cultured as described previously [4]. Before transplantation, we identified the pluripotency of iPSCs by using the method of RT-PCR. The polymerase chain reaction was performed with following primer pairs (gene, forward, reverse, cDNA product length): Nanog, CCTCCAGCAGATGCAAGAACT, AGTCCTCCCCGAAGT TATGGA, 398bp; Oct4, GTTTCTGAAGTGCCCGAAGC, CAGAGCAGTAACGGGAACA, 313bp; Sox2, TAGAGCTA GACTCCGGGCGATGA, TTGCCTTAAACAAGACCACGA AA, 297bp; Gapdh, ACCACAGTCCATGCCATCAC, TCC ACCACCCTGTTGCTGTA, 452bp. Mouse iPSCs were labeled with fluorescent dye CM-Di1. Figure 1. (a). The exposed otic bulla and facial nerve; (b) The site of round window niche and stapedial artery. ACTA OTO-LARYNGOLOGICA of hair cell and nerve cell-related genes through the method of RT-PCR. We used the following primer pairs (protein, forward, reverse, and cDNA product length): Myosin7a, GCTGTATTATCAGCGGGGAG, CAGGTGATGCAGTTAC CCATG, 409bp; Math1, GAAGGGTGGGGTTGTAGTGG, CTCCGACAGAGCGTTGATGT, 247bp; Nestin, AGCAGG TGAACAAGACTCCG, AGAGGCCCAAGGGAGTAGAG-3, 668bp; Neurofliment Medium, GCTTACGACCAGGAGAT CCG, ATGGCCTCCTTGTTCTGCTC, 485bp; Tubulinb-III, GCCTTTTCGTCTCTAGCCGC, CTGACCAGGGAATCGA AGGG, 766bp. Results Identification of mice iPSCs Before transplantation, we identified the pluripotency of Mouse iPSCs by RT-PCR. We demonstrated that the iPSCs could express the pluripotent genes Nanog, Oct4, Sox2. By contrast, the mouse embryonic fibrolasts (MEF) could not express those markers (Figure 2). This indicated that iPSCs were in undifferentiated state, and could differentiate into any cell types of three embryonic germ layers. Analysis of ABR test in different periods To observe the functional effect of cochleae after iPSCs transplantation, we recorded the ABR threshold of the mice at special time. The result showed, the ABR threshold of group C were in a stable scope from 15dBnHL to 25dBnHL, the SNHL model mice were from 70dBnHL to 80dBnHL, the group A mice were from 55dBnHL to 80dBnHL at different periods. After 12 weeks, the threshold of ABR began to have the improved tendency in group A. But in group B, the threshold of ABR were more than 70dBnHL at different period. At last, 3 we compared the ABR threshold of group A and group B at 12 and 16 weeks after transplantation, difference was statistically significant (p < .05) (Table 1 and Figure 3). Mouse iPSCs in cochleae differentiate toward auditory hair cells After transplantation of iPSCs into the cochleae of SNHL mice 4 weeks, we observed that partial surviving iPSCs labeled with fluorescent dye CM-Di1 were predominantly located in the RC of the basal portion of the cochlea, which partially express auditory hair cell markers Myosin7A, Math1 and Calretinin (Figure 4(a–c)), indicating that iPSCs could be successfully induced to differentiate into auditory hair cell-like cells. Mouse iPSCs in cochleae differentiate toward spiral ganglion neuron After the transplantation of iPSCs into the cochleae of SNHL mice 4 weeks, we observed that partial surviving iPSCs labeled with fluorescent dye CM-Di1 were predominantly located in the RC of the basal portion of the cochlea. A few transplanted cells were found in the cochlear modiolus, which partially express neuron markers nestin, neurofilament medium and tubulinb-III, which contacted with neurofilament (Figure 5(a–c)), indicating that iPSCs could be successfully induced to differentiate into spiral ganglion-like cells. Expression of auditory hair cell and spiral ganglionrelated genes To detect the expression of auditory hair cell and spiral ganglion-related genes, we extracted total RNA from the left Figure 2. RT-PCR analysis of pluripotent genes Nanog, Oct4, Sox2 expression in Mouse iPSCs, but not in MEF. Table 1. ABR threshold of each group at different time points(dBnHL). Group N Pre 4 weeks post 8 weeks post 12 weeks post 16 weeks post A B C F value p value 10 10 10 75.50 ± 3.69 76.00 ± 3.94 20.50 ± 2.69a 713.630 .000 77.50 ± 2.64 77.50 ± 2.64 20.50 ± 2.69a 1181.455 .000 75.00 ± 3.33 76.50 ± 3.38 19.50 ± 4.38a 759.780 .000 71.50 ± 5.30 75.50 ± 2.84a 20.00 ± 4.71a 492.729 .000 69.00 ± 7.38 76.00 ± 3.94a 20.00 ± 4.08a 322.269 .000 a comparing the ABR threshold of group B or group C with group A at the same period, difference was statistically significant (p < .01). 4 J. CHEN ET AL. cochleae of each group mice at 4 weeks after transplantation and then detect genes expression of hair cells (Myosin7a, Math1) and spiral ganglion (nestin, neurofilament medium, tubulinb-III) by RT-PCR. In our result, there were significant difference between each group (Figure 6), similarly to result of immunofluorescence staining. Figure 3. The change trend of each group ABR threshold at different period during this study (preoperation, 4 weeks postoperation, 8 weeks postoperation, 12 weeks postoperation, 16 weeks postoperation). Teratoma formation after transplantation In our study, we found no teratoma formation after mouse iPSCs transplantation at 4 weeks. Discussion As we know, embryonic stem cells (ESCs) have a very high value in regenerative medicine, tissue engineering and many other fields. Scientists have tried to get ESCs or ESC-like cells from humans and other species in various ways. These ways include: obtaining direct from the blastocyst separation in vitro culture; somatic-cell nuclear transfer; obtaining reprogramming cells after fusion of the somatic cells and pluripotent cells; obtaining by putting the differentiated somatic cell into the oocyte or pluripotent stem cell extracts incubate in order to achieve reprogramming of somatic cells. Although we can use these methods to obtain ECSs or ESCs like cells, we still have a lot of limitations, such as technology, cell source, ethical issues, immune rejection and so on. Unlike the ESCs, the iPSCs can avoid these problems, and the preparation technology is mature [5,6], which provides a theoretical basis for its wide application. In 2006, Takahashi and Yamanaka [4] first announced the successful derivation of iPSCs from adult mouse Figure 4. (a). Transplanted iPSCs labeled with CM-Di1 in RC expressed hair cells marker Myosin 7A. (A) showed the overall organization of cochlea section, transplanted cells were mainly found in RC in the basal portion of the cochlea (w in A). Blue fluorescence shows nuclear labeling with 40 ,6-diamino-2-phenylindole(DAPI). Scale bar ¼ 400 lm (A), 50 lm (B–E). ST, scale tympani; SM, scale media; SV, scale vestibule; MO, modiolus. (b). Transplanted iPSCs labeled with CM-Di1 in RC expressed hair cells marker Math1. (A) showed the overall organization of cochlea section, transplanted cells were mainly found in RC in the basal portion of the cochlea (w in A). Blue fluorescence shows nuclear labeling with 40 ,6-diamino-2-phenyl-indole (DAPI). Scale bar ¼ 400 lm(A), 100 lm (B–E). (c). Transplanted iPSCs labeled with CM-Di1 in RC expressed hair cells marker calretinin. (A) showed the overall organization of cochlea section, transplanted cells were mainly found in RC in the basal portion of the cochlea (w in A). Blue fluorescence shows nuclear labeling with 40 ,6-diamino-2-phenyl-indole(DAPI). Scale bar ¼ 400 lm (A), 100 lm (B–E). ACTA OTO-LARYNGOLOGICA 5 Figure 5. (a) Transplanted iPSCs labeled with CM-Di1 in RC expressed neuron markers nestin. (A) showed the overall organization of cochlea section, transplanted cells were mainly found in RC in the basal portion of the cochlea (w in A). Blue fluorescence shows nuclear labeling with 40 ,6-diamino-2-phenyl-indole(DAPI). Scale bar ¼ 400 lm (A), 100 lm (B–E). (b). Transplanted iPSCs labeled with CM-Di1 in RC expressed neuron markers neurofilament medium. (A) showed the overall organization of cochlea section, transplanted cells were mainly found in RC in the basal portion of the cochlea (w in A). Blue fluorescence shows nuclear labeling with 40 ,6-diamino-2-phenyl-indole (DAPI). Scale bar ¼ 400 lm (A), 100 lm (B–E). (c). Transplanted iPSCs labeled with CM-Di1 in RC expressed neuron markers tubulinb-III. (A) showed the overall organization of cochlea section, transplanted cells were mainly found in cochlear modiolus and RC in the basal portion of the cochlea (w in A). Blue fluorescence shows nuclear labeling with 40 ,6-diamino-2-phenyl-indole(DAPI). Scale bar ¼ 400 lm(A), 100 lm (B–E). Figure 6. Expression of related genes at 4 weeks postoperation in each group. fibroblasts through the ectopic coexpression of only four genes: Oct3/4, Sox2, c-Myc, Klf4. Under the condition of ES cell culture, these researchers found the four genes that were sufficient to reprogram adult fibroblasts into iPSCs, iPSCs are similar with ESCs in morphology and growth characteristics. After subcutaneous injection in nude mice, it can induce the tumor of three germ layers. These indicate that iPSCs maintain the key features of ESCs, including the ability to propagate in culture indefinitely and the capacity to generate cells from each of the three embryonic germ layers; in addition, iPSCs gene expression and surface antigen is also the same as ESCs and can produce teratoma. It is important that iPSCs can produce electrical activity under neural induction [7]. Because iPSCs can be reprogrammed from patients somatic cells, induced directional differentiation into needed cells for patients transplantation in vivo, thus avoiding the immune rejection of their own; without destroying the embryo in the process of preparation, so there is no ethical issues. However, viral vectors and cancer genes (c-Myc) are used to reprogrammed the iPSCs, it has the potential risk of tumorigenesis. Nishimura et al [3] evaluated the tumorigenesis risk of iPSCs and found that after transplanting the iPSCs derived from different somatic cell into mice, the iPSCs derived from adult mouse tail-tip fibroblasts had a higher risk of tumorigenesis than iPS cells from mouse embryonic fibroblasts. Avallone et al [8] demonstrated that no tumors were observed in mice derived from iPSCs generated by using only three reprogramming factors (Oct3/4, Klf4 and Sox2), eliminating c-Myc. In our study, HE staining was performed 4 weeks after transplantation and no tumor formation was found in the frozen section of the mouse cochlea. In summary, the iPSCs's tumor formation is related to the origin of somatic cells and induction procedure, the local microenvironment may also affect the differentiation of transplanted cells [9]. Cell transplantation to repair the damaged auditory hair cells and spiral ganglion neurons is a focus of research now, which through the etiology to improve hearing so as to 6 J. CHEN ET AL. cure SNHL. Previous research had studied various types of cells used in the inner ear transplantation, for example, embryonic stem cells [10], neural stem cells [9,11], dorsal root ganglion [12], mesenchymal stem cells [13], or adult stem cells [14], etc. Hildebrand et al [10] delivered undifferentiated and partially differentiated mouse embryonic stem cells were delivered into the scala media through round window, found transplanted cells survived in the scala media for a postoperative period of at least nine weeks and the transplanted cells were discovered near the spiral ligament and stria vascularis or spiral ligament. Tateya et al [11] demonstrated that fetal neural stem cells were transplanted into the mouse inner ear after drug-induced injury, 30% of which were found to be located in the spiral ganglion after 25 days. Although these cells could survive and differentiate into hair cells and/or spiral neurons, they are difficult to obtain and they have immune rejection and ethical issues, which limit the clinical application. However, iPSCs can be derived from autologous cells, thus avoiding donor restrictions, related immunological rejection and ethical issues. It has been confirmed that iPSCs can differentiate into the mechanosensitive hair cell-like cells in vitro through induced by cytokines and coculture [15]. In vivo experiments, Nishimura et al [16] found 50% of iPSCs induced by SDIA could differentiate into the neural lineage which projected neurites toward cochlear hair cells and the settlement of iPS cell-derived neurons was observed 1 week after transplantation into the cochlea; Besides, Some transplants expressed vesicular glutamate transporter 1, which is a marker for glutamatergic neurons, suggesting that iPSCs has the potential to differentiate into auditory neurons in vivo and in vitro. In our research, aminoglycoside antibiotic neomycin was used to damage the cochlear hair cells, causing delayed death of neurons, thus setting up SNHL model; then, we transplanted iPSCs to Rosenthal's canal through the round window niche.4 weeks after transplantation, we found that the injected iPSCs expressed auditory hair cell markers (Myosin7A, Math1, Calretinin) and spiral ganglion neuron markers (nestin, neurofilament medium, tubulinb-III), which indicated that iPSCs can be successfully induced to differentiate into hair cell-like cells and spiral ganglion neuron-like cells. Myosin 7A now is considered as high specificity marker of the mammalian inner ear hair cells. It belongs to the member of the family of myoglobulin, which plays an important role in the survival and function of hair cells, which is now widely used to identify hair cells. Math1 is essential for the generation of mouse inner ear hair cells, which are expressed from early stage of hair cell formation to maturation; calretinin is an early specific molecular marker of vestibular hair cells. In this study, we can see the transplanted cells expressed Myosin 7A, Math1, Calretinin, possible mechanisms may be the related cytokines in the cochlea lymph or the beneficial substances secreted by auditory cortex induce stem cells to differentiate to hair cells. Nestin is expressed high in neural precursor cells and can trace the differentiation of neural stem cells into neurons, when fully differentiated into neurons, it can be replaced by neurofilament medium, but in the middle of the process, both can exist at the same time [17,18]. Neurofilament medium and tubulinb-III are important structural protein of neurons, which can be used to identify whether neural stem cells have differentiated into neurons [19,20]. Therefore, the expression of the three markers demonstrated that the transplanted iPSCs have differentiated into neural precursor cells not fully differentiated into neuron and maintain the characteristics of stem cells. It can be seen from the cell morphology of immunofluorescence that only a small amount of cell-expressed red fluorescence has nerve fiber structure, most of which were still in round or oval cell morphology. To sum up, These results show that iPSCs transplanted to the cochlea can survive, migrate locally and differentiate into hair cell-like cells and spiral ganglionlike cells, which indicate that iPSCs have potential to repair the damaged cochlear hair cells and spiral ganglion neurons; however, we failed to continue to observe the survival time and final differentiation of the stem cells in the cochlea, which need further study. According to the ABR recording, There are significant differences between group A and group B in 12 weeks and 16 weeks after transplantation, which suggests that ABR threshold of mice in group A is slightly better than in group B, but it still belongs to the category of severe hearing loss and unable to improve auditory threshold in deaf mice effectively. The reason may be that transplanted cells differentiating into new auditory hair cells and spiral ganglion neurons can secrete some cytokines that support the growth of the remaining neurons and strengthen the formation of synaptic connections with host neurons, which is beneficial to self-repair of peripheral auditory system; however, this kind of repair is limited, which may be due to the limitation of the number and the degree of differentiation of the transplanted cells make it difficult to reach the normal level. In other words, this experiment showed that the transplanted iPSCs in the cochlea can make ABR threshold slightly lower in SNHL mice, but when compared with the normal level, there is still a large gap. Furthermore, due to restriction of iPSCs in vivo tracer (fluorescence quenching after a long time), we failed to observe the structural changes and cell differentiation in the cochlea when the ABR threshold was lower, this step needs to be improved. Our results suggest that cell transplantation in the treatment of SNHL is still a long and promising research process, There will be a lot of work to do until it is applied to the clinic. Acknowledgments This study was supported by the National Natural Science Grants of China (No.81160126). We thank Hong Tu for his advise of statistical analysis, and Yanhong Chen for her advise of anatomy of cochlea. Disclosures statement The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. Funding This study was supported by the National Natural Science Grants of China (No.81160126). ACTA OTO-LARYNGOLOGICA References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] Zhao L, Li L, Wu N, et al. Migration and differentiation of mouse embryonic stem cells transplanted into mature cochlea of rats with aminoglycoside-induced hearing loss. Acta OtoLaryngologica. 2013;133:136–143. Corrales CE, Pan LY, Li HW, et al. Engraftment and differentiation of embryonic stem cell-derived neural progenitor cells in the cochlear nerve trunk: growth of processes into the organ of corti. J Neurobiol. 2006;66:1489–1500. Nishimura K, Nakagawa T, Sakamoto T, et al. Fates of murine pluripotent stem cell-derived neural progenitors following transplantation into mouse cochleae. Cell transplant. 2012;21:763–771. Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006;126:663–676. Yoshida Y, Takahashi K, Okita K, et al. Hypoxia enhances the generation of induced pluripotent stem cells. Cell Stem Cell. 2009;5:237–241. Kim K, Doi A, Wen B, et al. Epigenetic memory in induced pluripotent stem cells. Nature. 2010;467:285–290. Jiang P, Rushing SN, Kong CW, et al. Electrophysiological properties of human induced pluripotent stem cells. Am J Physiol Cell Physiol. 2010;298:486–495. Hamanaka S, Yamaguchi T, Kobayashi T, et al. Generation of germline-competent rat induced pluripotent stem cells. PLoS One. 2011;6:e22008. Parker MA, Corliss DA, Gray B, et al. Neural stem cells injected into the sound-damaged cochlea migrate throughout the cochlea and express markers of hair cells, supporting cells, and spiral ganglion cells. Hear Res. 2007;232: 29–43. Hildebrand MS, Dahl HM, Hardman J, et al. Survival of partially differentiated mouse embryonic stem cells in the [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] 7 Scala Media of the Guinea pig cochlea. JARO. 2005; 6:341–354. Tateya I, Nakagawa T, Iguchi F, et al. Fate of neural stem cells grafted into injured inner ears of mice. Neuroreport. 2003;14:1677–1681. Olivius P, Alexandrov L, Miller J, et al. Allografted fetal dorsal root ganglion neuronal survival in the guinea pig cochlea. Brain Res. 2003;979:1–6. Matsuoka AJ, Kondo T, Miyamoto RT, et al. Enhanced survival of bone-marrow-derived pluripotent stem cells in an animal model of auditory neuropathy. Laryngoscope. 2007;117: 1629–1635. Senn P, Heller S. Stem-cell-based approaches for treating inner ear diseases. HNO. 2008;56:21–26. Oshima K, Shin K, Diensthuber M, et al. Mechanosensitive hair cell-like cells from embryonic and induced pluripotent stem cells. Cell. 2010;141:704–716. Nishimura K, Nakagawa T, Ono K, et al. Transplantation of mouse induced pluripotent stem cells into the cochlea. NeuroReport. 2009;20:1250–1254. Chou YH, Khuon S, Herrmann H, et al. Nestin promotes the phosphorylation-dependent disassembly of vimentin intermediate filaments during mitosis. Mol Biol Cell. 2003;14:1468–1478. Messam CA, Hou J, Major EO. Coexpression of nestin in neural and glial cells in the developing human CNS defined by a human-specific anti-nestin antibody. Exp Neurol. 2000;161:585–596. Jeong SW, Chu K, Jung KH, et al. Human neural stem cell transplantation promotes functional recovery in rats with experimental intracerebral hemorrhage. Stroke. 2003;34:2258–2263. Yang M, Stull ND, Berk MA, et al. Neural stem cells spontaneously express dopaminergic traits after transplantation into the intact or 6-hydroxydopamine-lesioned rat. Exp Neurol. 2002;177:50–60.